COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2721150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1494 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 2002..3189 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 3307..4401 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 4398..4895 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5022..7076 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene gyrB CDS complement(7073..7519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7746..8009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8021..8227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 8358..10928 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene gyrA CDS 10932..11273 product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860996.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 tRNA 11373..11447 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 11456..11529 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(11606..12859) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12852..13310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13635..13853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13856..14092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 14089..14283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 14267..14491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 15059..15250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 15321..15614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 15611..16813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 16926..17591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 17605..18105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 18095..18253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 18272..18766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 18872..19174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 20384..20734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 20824..21213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 21907..23145 product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(23185..24330) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(24435..25088) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 24982..25299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(25301..25897) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084603133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 26067..26756 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(26728..27894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(27891..29096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(29103..29984) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(30081..30650) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888173.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 30689..31303 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 31335..32240 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(32245..32886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 33226..34188 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 34233..36545 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene metE CDS complement(36621..37013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(37075..37485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 37503..38048 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 38123..38770 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855383.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(39625..39897) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene crgA CDS complement(39950..41899) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene pknB CDS complement(41896..43287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(43287..44741) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(44742..46115) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(46116..47549) product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(47546..48025) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(48046..48873) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 tRNA 49131..49216 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(49631..50974) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(51059..52000) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211285741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 note possible pseudo, frameshifted CDS complement(51961..52275) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 53212..53829 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 53858..55042 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015171.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 55229..56659 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 56681..57439 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 57452..58156 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 58160..58813 product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 58810..59967 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 59972..60187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(61425..62177) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(62236..63279) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(63285..64895) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855561.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(64914..65942) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 66045..67229 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(67226..67888) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(67918..69246) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 69341..70336 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene bioB CDS 70337..70576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(70708..71649) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 71715..71894 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(71891..73231) product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 73316..74059 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 74131..75483 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 75488..76414 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(76411..77370) product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 77419..77931 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(78780..80018) product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 80394..81821 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene amn CDS 81920..82849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(82846..83631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 83773..84546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(84626..84904) product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 84810..85001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(85028..85744) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(85829..87499) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 87673..88482 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 88479..89987 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 89988..90599 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(90622..90978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(91003..91380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 91621..92892 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(92947..96489) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(96584..96910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(97130..97531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(97679..98599) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(99786..101354) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 101496..102593 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224940.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(102706..103032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(103105..103974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 note possible pseudo, frameshifted CDS complement(104987..106066) product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(106091..107449) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 107590..108255 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 108248..108793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(108790..109296) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(109306..109854) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 109887..110468 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 110465..110971 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013406.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(110968..111777) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene panC CDS complement(111777..112562) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene panB CDS complement(112597..113661) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(113723..115003) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(115015..115773) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 115881..116375 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 116402..118081 product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013418.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 118103..118432 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(118435..118806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 note possible pseudo, internal stop codon, frameshifted CDS complement(118835..119167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 note possible pseudo, frameshifted CDS complement(119169..120233) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 120346..121026 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 121052..121279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(121276..123663) product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 123645..124397 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 124407..125057 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013426.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 125054..125383 product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 125398..125691 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 125692..126498 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 126521..126763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 126756..127796 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(127803..128711) product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013428.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 128786..129403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(129416..131356) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 131400..131999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 131996..132865 product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 132963..137552 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene gltB CDS 137554..139095 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(139115..142519) product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(142542..144641) product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(144644..145408) product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(145428..146843) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 147548..147670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 148056..148205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(148288..148572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 148571..149077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 149080..149577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 149619..150497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 150525..150977 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(150980..151906) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(151912..152856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(153062..153868) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(153878..154774) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 154945..156117 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(156114..157073) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 tRNA 157137..157224 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(157203..158219) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(158216..158677) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(158667..159140) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(159122..160300) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 160318..160587 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(160584..160964) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(160965..161993) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene hisC tRNA 162100..162189 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 162193..162268 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 162341..163696 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene mgtE CDS 163904..165487 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 tRNA 165563..165638 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(165788..167677) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156232373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(167790..169151) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 169287..170789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 170793..171479 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 171489..173012 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene hpaE CDS 173058..174146 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene hpaD CDS 174182..174967 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene hpaH CDS 174952..175746 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene hpaI CDS 175922..177595 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(177660..179069) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 179177..180115 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087121.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(180203..181195) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 181218..181745 product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 181738..182217 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene tadA CDS 182307..182513 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 tRNA 182552..182642 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 182741..185215 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 185212..186468 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene tgt CDS complement(186590..187297) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 187296..188213 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene gluQRS CDS 188302..189615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(189672..190274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 190347..190559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(190592..191182) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 191502..192977 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 193004..194335 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 tRNA complement(194533..194620) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 194919..196190 product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 196138..196725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 196752..198629 product DNA polymerase III subunits gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 198678..199001 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 199044..199700 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(199701..200453) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(200446..201714) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(201756..202781) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(202805..203641) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(203678..205522) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene leuA CDS 206135..206851 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene deoD CDS 206857..208215 product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene tet(38) CDS 208225..209319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 209425..210690 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 210712..211743 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 211920..212918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 213201..214508 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(214639..215970) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(216059..216631) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 216784..218334 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(218392..218721) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(218721..218993) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(218993..219418) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(219418..220950) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(220950..221327) product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(221324..224257) product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 224388..225842 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 tRNA complement(226164..226240) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(226306..227202) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 227229..227714 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(227718..228488) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(228485..229468) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(229498..230457) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 230662..230976 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(230984..231610) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(231678..234056) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 234212..234562 product WhiB family transcriptional regulator WhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene whcA CDS 234599..234754 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 234758..235219 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 235270..236088 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(236148..236930) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 237062..237784 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene nth CDS 237781..238377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 238374..239129 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 239176..240369 product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(240366..241304) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(241383..241886) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 241983..242675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(242685..243518) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 244076..245152 product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 245156..246265 product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 246262..247035 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 247032..247586 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 247602..247769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 247772..248065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 248065..248376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(248351..250717) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 250988..251191 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 251500..252186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(252178..252807) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 252994..255879 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene topA CDS 255881..256495 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 256486..257193 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(257199..258725) product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(258737..258922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 258926..260020 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 tRNA 260088..260163 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(260360..262009) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 262156..263007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 263077..264183 product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 264183..264812 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(264935..265156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 265088..265945 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013564.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(265954..266310) product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(266311..267003) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(267067..267906) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(267925..268791) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene rfbA CDS complement(268788..270128) product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(270129..271139) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene rfbB CDS complement(271162..272409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(272406..273779) product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(273807..275825) product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(275838..276941) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(277074..278171) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 278513..278632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 278752..280161 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene lpdA CDS complement(280214..281644) product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene ramB CDS 282041..282796 product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 282818..284827 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 284827..285576 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 285582..285998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 286536..287858 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 287898..288500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 288510..288809 product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 288814..289434 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene deoC CDS complement(289423..290247) product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(290261..291073) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(291095..291598) product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 291623..292759 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 292765..293031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, frameshifted CDS 292961..293716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 note possible pseudo, frameshifted CDS complement(293713..302664) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 302877..303341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 note possible pseudo, internal stop codon CDS 303338..303769 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(303810..305516) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 305603..306865 product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene mshA CDS 306929..307684 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 307695..308948 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 308945..309643 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(309640..312258) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(312279..313088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 313213..314160 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265553.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 314163..314885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(315064..316755) product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(316768..317022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(316979..317500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 note possible pseudo, frameshifted CDS complement(317493..318089) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 318402..319259 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene proC CDS 319368..319559 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(320136..321266) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 321310..321549 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 321665..323023 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 323020..323907 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene hemC CDS 323921..324289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 324459..326147 product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 326211..327236 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene hemB CDS 327229..327783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 327793..328296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 328307..330940 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013648.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 330985..332058 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene hemE CDS 332058..333443 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 333527..333847 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 333895..335211 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene hemL CDS 335222..335824 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039673525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 335830..336423 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 336423..337235 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013652.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 337281..338927 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 339058..340074 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene ccsB CDS 340114..340521 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 340531..340893 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 341028..341297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(341304..341627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 341714..342037 product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082868777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(342034..342969) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(342969..343865) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 343957..344841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(344838..345956) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene menE CDS complement(345979..346914) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 346952..347950 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 347960..348445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 348457..350082 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene menD CDS 350118..350507 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 350564..351763 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 351790..352491 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(352524..353693) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 353622..353846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 353894..354910 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 tRNA 354994..355078 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 355557..355952 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 tRNA 356096..356169 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 356229..356303 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 356383..356456 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 356592..356930 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene secE CDS 357039..357845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 358052..358486 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene rplK CDS 358564..359274 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rplA CDS 359644..360858 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(360913..362931) product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(362928..364574) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene treC CDS 364970..365485 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rplJ CDS 365561..365947 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rplL CDS 366215..366403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 366513..366812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 366898..367269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 367892..368293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 368451..369650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 369959..373444 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 373508..377518 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(377737..378378) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(378375..379037) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(379012..380799) product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(380955..381983) product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 382261..382632 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rpsL CDS 382636..383103 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene rpsG CDS 383336..385459 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene fusA CDS 385799..386992 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene tuf CDS 387087..387506 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 387511..388206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(388397..388951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(388948..389484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(389474..389950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(389952..390134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(390131..390436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(390439..390912) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 391443..391748 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsJ CDS 391781..392437 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene rplC CDS 392434..393087 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene rplD CDS 393087..393392 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene rplW CDS 393417..394253 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rplB CDS 394270..394548 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rpsS CDS 394551..394913 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene rplV CDS 394913..395668 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene rpsC CDS 395671..396087 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene rplP CDS 396087..396317 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rpmC CDS 396320..396601 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene rpsQ CDS 396779..398305 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 398643..399098 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 399095..399841 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 399845..400744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 400776..401990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 401993..403270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 403267..404562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(404489..405139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 405313..406842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 406992..410471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 410468..411181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(411162..412610) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 412947..414575 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 414559..415278 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 415280..416557 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(416548..418149) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(418133..419824) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 420063..420431 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene rplN CDS 420432..420746 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rplX CDS 420749..421303 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene rplE CDS 421606..422292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(422262..423095) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene fdhD CDS complement(423095..423376) product DUF6457 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 423649..424047 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene rpsH CDS 424063..424599 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene rplF CDS 424602..425006 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rplR CDS 425047..425679 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene rpsE CDS 425683..425868 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene rpmD CDS 425875..426321 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene rplO CDS 427067..428389 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene secY CDS 428386..428931 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 429038..429832 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene map CDS 429937..430623 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 430807..431025 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene infA CDS 431224..431592 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene rpsM CDS 431596..432000 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rpsK CDS 432026..432631 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rpsD CDS 432737..433753 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 433799..434284 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rplQ CDS 434415..434624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 434643..435512 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene truA CDS 435611..437860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 437909..439138 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene eccB CDS 439186..439605 product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(439679..440788) product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene mycP CDS complement(440785..442086) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene eccD CDS 442323..445934 product type VII secretion protein EccCa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene eccCa CDS 445931..446896 product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 447045..447362 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 447389..447676 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 447974..448417 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rplM CDS 448414..448959 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rpsI CDS 449113..450393 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene glmM CDS 450476..450775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 450772..452004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 451998..452201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(452207..453037) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 453176..454984 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene glmS CDS 454991..456034 product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 456048..457157 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene alr CDS 457154..457633 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene tsaE CDS 457719..459323 product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013749.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 459378..459860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 459865..460518 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene tsaB CDS 460515..460979 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rimI CDS 460976..462013 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene tsaD CDS 462081..463346 product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene aztD CDS 463443..463877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 464014..464313 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene groES CDS 464322..465932 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene groL CDS complement(465997..466302) product WhiB family transcriptional regulator WhcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene whcB CDS 466564..467130 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 467130..467885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(467882..468295) product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 468382..469902 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene guaB CDS 469965..471113 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 471124..472683 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene guaA CDS 472810..474018 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(474138..474776) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521496.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(474787..476238) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(476235..477794) product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(477791..478561) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(478648..479742) product two-component system EsrSR regulator EsrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene esrI CDS 479837..481015 product two-component system sensor histidine kinase EsrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074469750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene esrS CDS 481021..481671 product two-component system response regulator EsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene esrR CDS 481673..481918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(481942..482355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 482438..483079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 483082..484563 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(484554..485177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 485294..486178 product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(486138..486896) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(486907..487584) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(487581..488633) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(488710..489594) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 489736..492855 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(492852..493055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 493096..493545 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 493542..494966 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(494848..495324) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 495343..496197 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 496202..496519 product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 496713..497111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 497545..498279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(498291..499397) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(499394..500701) product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(500834..504001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(504007..504624) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 note possible pseudo, internal stop codon, frameshifted CDS complement(504806..505828) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(505825..506826) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013804.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(506831..507913) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 507972..509171 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 509182..510081 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 510081..510884 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 510938..511132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 511160..512197 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene trpS CDS 512278..513357 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 513409..513567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 513564..513863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(513869..515059) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 515225..516067 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 516072..517037 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(517047..518276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(518308..519159) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(519156..519434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 519488..520132 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene upp CDS 520189..520650 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 520693..521901 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 521950..523359 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(523360..524682) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 524854..526368 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 526370..527302 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene prpB CDS 527325..528485 product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 528749..532162 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(532218..532712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 532747..533643 product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 533693..534262 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(534309..536084) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(536263..537120) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 537073..537291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 537360..538415 product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(538422..538832) product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 538927..541035 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(541032..541628) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(541628..541843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(541854..543398) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(543494..545146) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 545264..546079 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 546124..546564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059288845.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 546583..547806 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 547845..548345 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene purE CDS complement(548349..550010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 550390..550743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 550728..551183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(551249..552373) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene hypD CDS complement(552378..552647) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene hypC CDS complement(553105..553332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(553660..556026) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene hypF CDS 556087..556365 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 556385..557143 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene hypB CDS 557297..558496 product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 558506..560254 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 560251..561411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 561408..561881 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(561850..562227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 562226..563356 product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 563361..563636 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(563674..564297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(564413..564808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(564868..565071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013846.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(565076..565912) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(565909..566925) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(567031..568329) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(568440..569444) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(569455..570108) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 570195..570956 product C50 carotenoid glucosyltransferase CrtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene crtX CDS 570956..571921 product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene crtE CDS 571914..572816 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 572813..574393 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 574390..574728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 574725..575015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 575012..575869 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(575876..577456) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 577528..578418 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 578423..579511 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 579751..580074 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(580075..580470) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 580678..581061 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 581073..582440 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 582480..583472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 583474..584631 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene manA CDS complement(584628..585242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 585359..585712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 585716..586324 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 586325..587005 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene mtrA CDS 587063..588571 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene mtrB CDS 588568..590280 product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene lpqB CDS 590286..590888 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 590973..591641 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene raiA CDS 591767..594307 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene secA CDS complement(594314..595786) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(595783..596229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 596334..596744 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 596745..597251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 597335..598378 product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 598390..599694 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(599706..600707) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rsgA CDS complement(600700..601977) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene aroA CDS 601996..602655 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(602641..603138) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728005.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene ybaK CDS 603167..603814 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 603811..604083 product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rsrA CDS complement(604679..604939) product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene whcE CDS 605439..605870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(605867..607084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(607081..608388) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 608379..608654 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 608661..609557 product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 609554..610324 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 610328..613387 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 613380..616601 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 616641..617717 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 617714..618436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 618433..620478 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(620475..621278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 621333..621860 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(621857..623260) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 623342..624409 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(624406..625068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(625114..625653) product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 625742..628732 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 tRNA 628851..628927 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(629361..630113) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 630343..631365 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(631366..632148) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene hisN CDS complement(632145..633008) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 633056..633493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 633500..634603 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene prfB CDS complement(634600..636180) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 636280..636969 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene ftsE CDS 636995..637897 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ftsX CDS 637902..638567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 638571..639251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 639278..639766 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene smpB CDS 639763..640446 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 tmRNA 640524..640900 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(640992..641279) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(641279..641491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(641659..642600) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211285741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 note possible pseudo, frameshifted CDS complement(642561..642875) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(642915..643103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(643196..644122) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 644363..645364 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 645406..646395 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863480.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 646388..647536 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 647533..648288 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 rRNA 648905..650437 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 650944..654023 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 654220..654324 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(654494..654676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 note possible pseudo, internal stop codon CDS complement(655000..656166) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(656163..656813) product DUF3239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(656825..658483) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(658493..660697) product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 660754..660954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(661375..661977) product DUF3235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862355.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 662492..662875 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(662892..663419) product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(663431..664168) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 664104..664274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 664264..664938 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(664946..665650) product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 665785..667248 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 667252..668070 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(668080..668904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(668907..669788) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene sepH CDS complement(669889..671019) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene serC CDS 671530..672822 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(672829..673041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 672925..673284 product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene fkpA CDS complement(673285..674469) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 674534..675412 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 675797..676144 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 676148..677794 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 677889..678680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013918.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(678684..679544) product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 679865..681103 product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 tRNA complement(681523..681596) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 681716..681994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(682009..682269) product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(682266..682802) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(682802..683623) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(683644..684438) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 684437..689014 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 689184..689984 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(689947..690600) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(690638..691162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 691198..691611 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858364.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(691608..693092) product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(693255..694892) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene pgi CDS 694996..695298 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(695323..695640) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 695689..698052 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene pcrA CDS complement(698049..698834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(699101..701770) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013930.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(701767..702465) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(702469..703014) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(703432..704163) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 704535..705812 product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 705823..706428 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene purN CDS 706421..707992 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene purH CDS complement(708156..708836) product TetR/AcrR family transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene amtR CDS complement(708906..709742) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(709916..710167) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rpsR CDS complement(710183..710488) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rpsN CDS complement(710492..710656) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rpmG CDS complement(710660..710896) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rpmB CDS complement(711066..711689) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(711686..712774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 712886..713770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 713907..714173 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 714189..714362 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rpmF CDS 714462..715157 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 715154..716641 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013941.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 716695..717888 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 717951..718532 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 718546..718722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(718726..719124) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene mscL CDS complement(719168..719800) product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(719848..720441) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 720508..721461 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 721478..722752 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 722752..723444 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 723551..724591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(724588..725199) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 725289..725702 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 725695..726396 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(726393..727895) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 727971..728813 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rsmI CDS 728989..730749 product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene betP CDS 730760..732598 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene metG CDS 732608..733810 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 733840..735906 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013953.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(735877..736494) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 736457..737359 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 737502..738632 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 738664..739530 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene rsmA CDS 739533..740483 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 740506..742317 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 742428..742805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(742839..744068) product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(744153..744824) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(744805..745413) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(745410..745883) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(745898..746380) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(746466..747137) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005135597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 747281..748753 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 748759..749634 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 749631..751151 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 751178..752560 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 752791..754152 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(754195..755409) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(755406..756917) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182385666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(756910..758238) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene gabT CDS 758353..759837 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013681.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 759848..760171 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 760138..761091 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene ppk2 CDS 761101..761823 product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(761825..762625) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 762643..763662 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(763655..764758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(764787..766982) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene glcB CDS 767442..768737 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene aceA CDS 768833..769333 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rraA CDS complement(769518..769808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 770061..770657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(770637..773447) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(773444..774973) product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 775196..775894 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 776022..777212 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 777226..778599 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 778623..780137 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 780134..781291 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(781247..781624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(781626..783260) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 783293..783847 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(783958..784467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(784478..784696) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(784800..785423) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene pth CDS 785469..786428 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 786469..787926 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 787941..788111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(788114..788941) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(788951..789496) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene pth CDS complement(789570..790214) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(790386..790766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(790772..791332) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(791392..792369) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(792379..793851) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene glmU CDS complement(793917..795134) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 795247..796275 product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 796286..797809 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(797857..798075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 tRNA complement(798288..798360) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 798438..799070 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 799079..802711 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene mfd CDS 802794..802988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 803051..804898 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene feoB CDS 804895..805131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 805231..806379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(806376..807848) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 807905..808528 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(808553..808948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 809116..809880 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 810019..811296 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene eno CDS 811472..811861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 811867..812409 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 812406..813359 product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene ppx2 tRNA 813428..813504 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(813522..814133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(814249..815079) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(815076..815618) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(815753..817348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(817406..818158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 note possible pseudo, frameshifted CDS complement(818396..819760) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 819984..820790 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(821235..821684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(821688..821960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(822000..822518) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014029.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene greA CDS complement(822650..823096) product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 823238..824116 product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene mca CDS 824148..824477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(824759..825049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 824984..825784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 825799..826566 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 826586..827119 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(827116..828051) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene coaA CDS 828175..829473 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene glyA CDS 829477..831441 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene pabB CDS 831468..832154 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(832141..832743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 832805..834001 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(834012..835391) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(835505..835843) product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 835907..836572 product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 836711..838063 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 838113..838640 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(838650..840197) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(840191..840844) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(841073..842473) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(842584..843660) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene glpX CDS 843828..844355 product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(844356..844604) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(844625..845866) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene xseA CDS 845962..846915 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(846916..847638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(847645..848724) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(848759..850237) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(850351..850518) product methionine/alanine import NSS transporter subunit MetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene metS CDS complement(850515..852092) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 852333..853418 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene ychF CDS complement(853555..853701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(853797..854102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(854216..854965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(855005..857851) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 857832..858068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(858381..858566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(858802..859161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(859128..859430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 860026..860361 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 860737..861174 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 861213..861482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 861822..862163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 862547..863428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 863836..864360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 864485..865102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 865301..866461 product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 866499..866939 product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(866946..867200) product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene yoeB CDS complement(867181..867429) product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene yefM CDS complement(867448..868140) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(868150..868722) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(868794..870044) product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(870077..871132) product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(871226..871657) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(871754..872752) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene arsB CDS 873115..873471 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 873587..874120 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(874105..874497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(875052..875747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(876042..876407) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 876543..877187 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 877275..878177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 878202..878915 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 878985..882332 product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_table 11 codon_start 1 transl_except (pos:879549..879551,aa:Sec) note codon on position 189 is selenocysteine opal codon. locus_tag LOCUS_08770 gene fdh CDS 882319..883314 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 883311..884408 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene nrfD CDS complement(884405..885391) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene selD tRNA 885427..885521 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 885611..886864 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804589.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene selA CDS 886865..888652 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene selB CDS complement(888649..889425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(889449..891773) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(891763..892821) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 892991..893797 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene zupT CDS 894039..894383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 note possible pseudo, frameshifted CDS 894383..895255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 note possible pseudo, frameshifted CDS 895343..896656 product ISL3-like element IS31831 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 896694..897035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(897082..898425) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(899792..900646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(901107..901370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 note possible pseudo, internal stop codon CDS complement(901391..902137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(902618..903418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 903648..903875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(904207..904401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 904757..905002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 note possible pseudo, internal stop codon, frameshifted CDS 905275..905541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 note possible pseudo, frameshifted CDS 905441..905959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 note possible pseudo, frameshifted CDS 906001..906309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 906355..906597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 note possible pseudo, internal stop codon CDS complement(906724..907863) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(907865..908812) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 908944..909747 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 909757..910095 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858604.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 910232..910822 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 910822..912150 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 912147..912911 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 912911..913423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 913533..915161 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 915299..916225 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 916218..917225 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 917222..918928 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 919285..920235 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812438.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 920238..921278 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 921275..923182 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 923221..924927 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(924937..925278) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene arsC CDS complement(925282..925461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(925530..926069) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(926075..926779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 927095..929005 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene typA CDS complement(929268..929660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 929957..931144 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 931321..932742 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569582.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 932739..933629 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene mshB CDS 933626..934018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 934015..934389 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 934393..935499 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene dapC CDS 936425..937003 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(937000..937485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(937487..937705) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 937991..939652 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(939649..940623) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene dapD CDS complement(940620..942062) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene aroP CDS complement(942111..943034) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(943094..943312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 943202..944182 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene dapE CDS 944200..944985 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 944982..945815 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene folP CDS 945824..946528 product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 946533..946814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 946859..947026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 947062..947955 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(947906..949375) product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(949390..950550) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene glgA CDS 950681..951907 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene glgC CDS complement(951968..952774) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 952773..953399 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene sigE CDS 953480..953908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 953925..954362 product Sec-independent protein translocase subunit TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene tatB CDS complement(954359..955489) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(955516..956082) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(956075..957382) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 957436..957927 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 957973..958638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(958686..962390) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(962515..966216) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(966218..966952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(967067..967876) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 967896..969461 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 969564..970370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 970381..971466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(971474..971647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 971564..971806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 972041..973264 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 973288..974451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(974500..975576) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(975754..976710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(976746..977864) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(977984..978373) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 978718..979593 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 979590..980609 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 980606..981367 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(981345..982265) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene hutG CDS 982355..983098 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157773333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 983220..984902 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 984923..986242 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 986278..987495 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene hutI CDS 987501..989042 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene hutH CDS 989127..991313 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(991905..992072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 992029..992325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 992736..993140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(993064..993633) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(993737..994213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(994283..994876) product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(994930..996507) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene putP CDS 996775..999870 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014168.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 999872..1000699 product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1000696..1001838 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1001842..1004478 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1004535..1005071) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1005221..1005730 product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene rosR CDS 1005829..1006029 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014173.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1006095..1006385) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene catC CDS complement(1006415..1006960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1007531..1008415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1008929..1010734) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1011024..1011542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1011493..1012836) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1012810..1013163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 tRNA complement(1013865..1013940) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(1014050..1015618) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1015753..1017405 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene argS CDS 1017405..1018739 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene lysA CDS complement(1018736..1019320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1019332..1019604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1019644..1019925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1020312..1020809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1020840..1022333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1022346..1023041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1023120..1024499 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1024516..1025442 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene thrB CDS complement(1025439..1026146) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1026166..1028022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1028026..1028679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1028669..1028842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1028898..1029683) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene narI CDS complement(1029693..1030382) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene narJ CDS complement(1030384..1031985) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene narH CDS complement(1031985..1035710) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1035750..1037084) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1037294..1037773 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1037770..1039038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1039069..1039320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1039387..1040511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1040504..1041727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1041724..1043112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 note possible pseudo, frameshifted CDS complement(1043109..1043684) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1043681..1044151) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene moaC CDS complement(1044173..1045411) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1045421..1046521) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014195.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene moaA CDS complement(1046580..1048316) product long-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1048661..1050592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1050592..1051665 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene prfA CDS 1051670..1052506 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene prmC CDS 1052548..1053207 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1053208..1054386 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1054414..1054839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1055299..1056096 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene atpB CDS 1056192..1056443 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1056483..1057055 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1057061..1057879 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1057939..1059582 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene atpA CDS 1059639..1060616 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1060620..1062065 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene atpD CDS 1062078..1062449 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1062595..1063059 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1063162..1063773 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene nucS CDS 1063773..1064039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1064058..1064369 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1064370..1065248 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1065352..1066920 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1066931..1067359 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1067362..1068204 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1068272..1068733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1068756..1070960) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene glgB CDS complement(1071037..1073058) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1073150..1073980 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1073983..1074771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1074773..1075915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1075958..1076740 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1076771..1077700 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1077697..1078809 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1078806..1081307) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1081297..1082505) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1082681..1083232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1083206..1084012) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1084105..1085178 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene mnmA CDS 1085175..1086131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1086194..1087135 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1087122..1087790) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1087796..1088026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1088027..1088983) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1088983..1089408) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1089462..1091501 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene ligA CDS 1091539..1093449 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene ggt CDS complement(1093446..1094117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1094302..1094601 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene gatC CDS 1094604..1096091 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene gatA CDS 1096123..1096851 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1096848..1097201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1097194..1098552 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1098570..1099610 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1099607..1100533) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene prpF CDS 1100551..1100946 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1100957..1102462 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene gatB CDS complement(1102468..1103706) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1103854..1104936 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene mgrA CDS complement(1104938..1105621) product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene lysE CDS 1105692..1106576 product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1106545..1107528) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1107585..1108295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1108306..1109118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1109102..1110364) product alpha-(1-2)-mannopyranosyltransferase MptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene mptD CDS complement(1110375..1112219) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ilvD CDS complement(1112216..1112728) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1112730..1114145) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096455574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1114424..1116298 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1116304..1116819 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene ilvN CDS 1116932..1117945 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene ilvC CDS complement(1118219..1118977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 note possible pseudo, frameshifted CDS complement(1119121..1119432) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1119472..1120266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1120386..1121102) product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1121095..1121862) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene ntrB CDS complement(1121859..1122830) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1122961..1124748 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014255.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1124862..1126448 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene serA CDS complement(1126445..1127383) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1127394..1128719) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1128855..1129565) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1129783..1130331 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1130331..1131383 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1131387..1131875 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1131876..1132130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1132014..1132964 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1133020..1134495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1134546..1136402 product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1136402..1137058 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1137090..1137890 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1137877..1138440 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1138437..1139549) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1139799..1141283 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene gltX CDS complement(1141280..1141498) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1141498..1141959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 tRNA 1142152..1142225 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1142261..1142334 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 1143049..1143122 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1143347..1143982) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1144633..1145343) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1145404..1146822 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene leuC CDS 1146833..1147423 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene leuD CDS complement(1147428..1148432) product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1148602..1149600 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1149757..1150833 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1150830..1151771) product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1151761..1152768 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1152770..1153414 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1153426..1154859 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1154859..1156967 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1157020..1157358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1157374..1157778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1158000..1158470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1158523..1158732 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1158729..1159298 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rsmD CDS 1159321..1159806 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene coaD CDS 1159816..1160568 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1160565..1161329) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1161332..1162240) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1162237..1163154) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1163154..1164071) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1164277..1165167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1165164..1165376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 tRNA complement(1165773..1165847) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 1166000..1168624 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene polA CDS complement(1168599..1169258) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1169255..1169671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1169668..1170423) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1170642..1172111 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene rpsA CDS 1172468..1174489 product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1174507..1175112 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene coaE CDS 1175120..1175602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1175639..1177744 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene uvrB CDS 1177755..1178210 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1178272..1178715 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1178905..1183734) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1183721..1187422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1187518..1189686) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1189733..1190644) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1190698..1191408) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1191445..1194294 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene uvrA CDS complement(1194291..1195898) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1195846..1196001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1196358..1197008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1197273..1197842 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene infC CDS 1197878..1198072 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rpmI CDS 1198124..1198507 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene rplT CDS 1198796..1199179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1199190..1200005 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1200012..1200887 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927239.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1200963..1202009 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene pheS CDS 1202046..1204559 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014330.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene pheT CDS complement(1204892..1205350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1205634..1205990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083985459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1206554..1207615 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene argC CDS 1207644..1208804 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene argJ CDS 1208817..1209752 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene argB CDS 1209755..1210936 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1210938..1211900 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene argF CDS 1211867..1212373 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1212444..1213643 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1213644..1215077 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene argH CDS 1215159..1215350 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1215366..1216631 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene tyrS rRNA 1217234..1218766 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 1219273..1222352 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 1222551..1222656 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(1222794..1222949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1223064..1223675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1223687..1224685 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1224676..1224882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1224893..1225717 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1225714..1226646 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1226674..1228395 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene recN CDS 1228444..1229625 product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene steA CDS 1229643..1230578 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1230679..1232310 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1232343..1233008 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1233005..1233907 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene xerD CDS 1233994..1234908 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1234914..1235768 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1235765..1237225) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1237317..1238615 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1238612..1239295 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene bioD CDS complement(1239292..1239855) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1239955..1240725 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1240734..1241273 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene scpB CDS 1241336..1242277 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1242274..1242969 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene cmk CDS 1242966..1244516 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene der CDS complement(1244536..1245321) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1245450..1246823 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1246820..1248577 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1248586..1249443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1249454..1250467 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1250581..1251585 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1251582..1252493 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1252495..1253286 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1253456..1254442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1254453..1255691) product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1255948..1256211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 tRNA complement(1256584..1256658) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(1256737..1257126) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1257123..1258238) product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1258360..1260648 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene secA2 CDS 1260754..1261182 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1261278..1261940 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1261937..1262551 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1262680..1263243 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1263344..1264720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1264753..1265613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1265600..1266652) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014370.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1266649..1268031) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1268055..1269332) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1269389..1270852) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene gndA CDS 1270946..1271413 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1271651..1272700) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene corA CDS 1272795..1273382 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1273400..1274575) product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1274599..1276059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1276056..1276874) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014383.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene thiM CDS complement(1277000..1277878) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene pflA CDS complement(1277888..1278139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1278151..1280244) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene pflB CDS complement(1280451..1281863) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1282026..1283306 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1283303..1286233) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1286389..1287381 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1287449..1288210) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1288662..1288901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1288920..1289390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1289919..1290980 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene xerC CDS 1291035..1291259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1291747..1292058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 note possible pseudo, frameshifted CDS 1292102..1292677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 note possible pseudo, frameshifted CDS 1293587..1293856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1293897..1296032) product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene brxL CDS complement(1296042..1298537) product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene pglZ CDS complement(1298534..1302034) product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene pglX CDS complement(1302054..1305560) product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene brxC CDS complement(1305563..1306177) product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014819602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1306174..1306800) product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1306870..1307061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 1307593..1307781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1308663..1309712) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1309723..1311741) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1311738..1312517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1313027..1313209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1313206..1313916) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1313923..1314270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1314368..1314745 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1314798..1315595) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1315628..1317091) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene lnt CDS complement(1317088..1317603) product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014393.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1317614..1318921) product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1318942..1319388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1319385..1320107) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1320113..1320877) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene ygiD CDS complement(1320885..1321970) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1321999..1322607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1322604..1325396) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1325419..1326339) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene tatC CDS complement(1326418..1326702) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014401.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene tatA CDS complement(1326741..1327715) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1327717..1328670) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1328667..1330091) product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene pafA CDS complement(1330095..1330286) product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1330308..1331849) product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene dop CDS complement(1331870..1333369) product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene arc CDS complement(1333390..1334226) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1334251..1335504) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1335541..1336362 product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1336383..1336619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1336918..1338252) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1338491..1340149) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1340211..1341521) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1341662..1343164) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene aspA CDS complement(1343306..1344151) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene hisG CDS complement(1344164..1344427) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1344446..1345117) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1345123..1345512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1345528..1346778) product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene mshC CDS complement(1346789..1347655) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1347701..1348600 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1348624..1349652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1349653..1350762 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1350768..1351166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856120.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1351179..1351718) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1351739..1353532) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1353529..1354866) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 tRNA 1355256..1355342 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(1355574..1355819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1356149..1356988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1356995..1357420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1357621..1358238 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1358287..1358838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1358835..1359854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1359789..1360106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1360026..1360478) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862316.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1360479..1361135) product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1361037..1362095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1362062..1363171) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1363174..1364892) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1365383..1365883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1366175..1368958 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene can CDS 1369089..1369655 product TetR/AcrR family transcriptional regulator AcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene acnR CDS 1369774..1370415 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1370388..1371065) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856099.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1371085..1371642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1371570..1371788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1371827..1372096 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1372103..1373467 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1373540..1374280 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1374308..1374448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1374593..1375861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1375935..1377593) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1377696..1378094) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1378098..1378547) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1378548..1379795) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1379792..1380550) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene sufC CDS complement(1380581..1381762) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene sufD CDS complement(1381767..1383212) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene sufB CDS complement(1383209..1383901) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1384110..1385780 product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene mptB CDS 1385817..1386725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1386727..1387509 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1387579..1388547 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1388568..1389533 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1389530..1390462) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1390784..1392883 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene tkt CDS 1392913..1393992 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene tal CDS 1394013..1395551 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene zwf CDS 1395584..1396522 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1396527..1397231 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene pgl CDS 1397569..1398168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1398245..1398481) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene secG CDS complement(1398535..1401300) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene ppc CDS complement(1401355..1402134) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene tpiA CDS complement(1402167..1403384) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene pgk CDS complement(1403529..1404533) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene gap CDS complement(1404882..1405868) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene whiA CDS complement(1405940..1406908) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene yvcK CDS complement(1406924..1407817) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene rapZ CDS complement(1407834..1409837) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene uvrC CDS complement(1409850..1410383) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1410437..1410910) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene ribH CDS complement(1410907..1412187) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1412199..1412819) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1412823..1413791) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014471.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ribD CDS complement(1413791..1414447) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene rpe CDS 1414503..1415252 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1415249..1416697) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1416694..1417653) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene fmt CDS complement(1417670..1418179) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene def CDS complement(1418271..1420286) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1420298..1421515) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene metK CDS complement(1421559..1422800) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene coaBC CDS complement(1422883..1423182) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene rpoZ CDS complement(1423207..1423785) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene gmk CDS complement(1423789..1424112) product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene mihF CDS complement(1424331..1425149) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene pyrF CDS complement(1425151..1428492) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene carB CDS complement(1428520..1429731) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene carA CDS complement(1429740..1431098) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1431112..1432056) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1432053..1432628) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene pyrR CDS 1432699..1434129 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1434173..1434667 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1434657..1435130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1435127..1435978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1436038..1437306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1437535..1438155) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene nusB CDS complement(1438170..1438733) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene efp CDS complement(1438784..1439875) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014485.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1439947..1440375) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene aroQ CDS complement(1440372..1441457) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene aroB CDS complement(1441475..1441984) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1441984..1443135) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene aroC CDS complement(1443246..1443650) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1443661..1444476) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1444473..1445666) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene mltG CDS complement(1445663..1446160) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ruvX CDS complement(1446291..1448957) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene alaS CDS complement(1449032..1450282) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1450190..1450381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1450378..1451607) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1451626..1453413) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene aspS CDS 1453558..1454442 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1454439..1457045) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074025476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1457070..1457795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1457848..1458975 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014504.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1458975..1459610 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1459637..1460992 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1460989..1462275) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene hisS CDS complement(1462297..1462800) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1462702..1462950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1462954..1463487) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene tpx CDS 1463546..1464391 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1464614..1464919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1465097..1466356 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1466375..1466920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1466945..1469233) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1469230..1469790) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1469780..1471405) product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1471464..1472585) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene secF CDS complement(1472586..1474391) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene secD CDS complement(1474546..1474869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1474904..1475968) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene ruvB CDS complement(1475985..1476593) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ruvA CDS complement(1476590..1477132) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene ruvC CDS complement(1477207..1477959) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1478077..1478937) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1479032..1479499 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1479511..1480374) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene pdxS CDS 1480440..1481708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1481679..1482125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855892.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1482122..1483216) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1483213..1484091) product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1484091..1484741) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1484734..1485336) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1485296..1487353) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene thrS CDS complement(1487495..1488733) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1488755..1489339) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1489348..1489884) product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1490084..1490764) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1490757..1492061) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1492233..1493762) product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1494015..1494392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1494734..1495177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1496167..1497180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 note possible pseudo, frameshifted CDS 1497355..1498503 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 1498694..1498876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1498929..1499444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1499419..1502469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1502859..1503470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1503615..1504217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1504214..1505266 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1505380..1506552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1506549..1507739) product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1509013..1509894 product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1510487..1511320) product IS5-like element ISCgl6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1511547..1512290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1512470..1514233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1514784..1515221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1515218..1515841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1515904..1518276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224208497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1518276..1518500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 tRNA complement(1518890..1518964) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 1519164..1519237 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 1519273..1519345 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 1519364..1519437 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 1519480..1519551 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 1519564..1519636 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 1519655..1519730 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1519781..1520494 product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1520505..1521845 product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene aftC CDS 1521817..1522221 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene msrB CDS complement(1522500..1523399) product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1523400..1524050 product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1524055..1525263 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1525252..1527147) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene dxs CDS complement(1527255..1528475) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1528510..1529211) product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1529304..1529759) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene dut CDS 1529890..1530381 product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1530472..1530765) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1530855..1531682) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1531737..1532501 product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene ppgK CDS 1532738..1534135 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1534199..1535455) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1535493..1536029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1536177..1537886) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1537883..1538134) product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1538179..1538649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1538646..1540172 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1540169..1540591 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene dtd CDS 1540679..1541671 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1541876..1542556 product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1542596..1543579 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene galE CDS complement(1543601..1544044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1543979..1544263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1544309..1544668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1545113..1546108 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1546129..1548708 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1548863..1549384 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1549445..1549969) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1549973..1550569) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1550732..1551691 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1551682..1552566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1552640..1556545 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene hrpA CDS complement(1556559..1557032) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene nrdR CDS 1557799..1558527 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene lexA CDS 1558743..1559609 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1559692..1561374) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene ptsP CDS 1561709..1562686 product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1562696..1564756 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1564811..1565074 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1565313..1566851) product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1567420..1568220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1568217..1570241 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1570238..1571197) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1571222..1572508) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1572547..1574088) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene hflX CDS 1574187..1574918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1574934..1575464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1575465..1576259) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene dapF CDS complement(1576256..1577152) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene miaA CDS complement(1577154..1577810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1577883..1579241 product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1579241..1580323 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1580320..1580997) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1581024..1582553) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene miaB CDS 1582805..1583533 product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene gluA CDS 1583572..1584447 product glutamate ABC transporter substrate-binding protein GluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene gluB CDS 1584481..1585167 product glutamate ABC transporter permease GluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene gluC CDS 1585167..1586105 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014781.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1586179..1586766) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene recX CDS complement(1586776..1587903) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene recA CDS complement(1588141..1588356) product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1588502..1589050 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene bioY CDS 1589050..1589748 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1589745..1590356 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1590525..1591355) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1591476..1591796) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1591805..1592278) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1592284..1592871) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene pgsA CDS 1592926..1593243 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857466.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1593240..1594352) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1594558..1597110) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1597419..1598072) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1598094..1600202) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1600205..1601101) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene dapA CDS complement(1601172..1601930) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene thyX CDS complement(1601935..1602681) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene dapB CDS 1602801..1603409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1603528..1605774) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1605852..1606040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1606271..1606540) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene rpsO CDS complement(1606656..1607060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1607042..1607752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1607752..1608693) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1608706..1609593) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121910865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1609501..1609704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1609701..1610594 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene truB CDS complement(1610587..1611507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1611858..1612523) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1612516..1613334) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1613361..1614650) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1614647..1615597) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1615597..1616028) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene rbfA CDS complement(1616062..1616874) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1616876..1619719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1619827..1620150) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1620264..1621256) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene nusA CDS complement(1621253..1621795) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene rimP CDS 1621794..1622576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1622609..1624531 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1624528..1626285) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1626465..1627046 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene yaaA CDS 1627097..1628209 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1628369..1632892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1633295..1634137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1634139..1634864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1634861..1635751) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1635757..1636398) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1636509..1637510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 note possible pseudo, internal stop codon CDS complement(1637588..1638805) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1639015..1639881 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1639889..1640629) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene cobA CDS complement(1640794..1640937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1640953..1641129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1641094..1642134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1642131..1643006) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014813.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1643062..1644564) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene mqo CDS 1644785..1645783 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1645816..1647180 product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene mtr CDS complement(1647181..1648044) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene map CDS complement(1648050..1649864) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1649868..1651031) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene ispG CDS complement(1651090..1652286) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1652295..1653458) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene dxr CDS 1653624..1654049 product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1654468..1656000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1655982..1656740) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1656760..1657857) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene rlmN CDS 1657964..1658362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1658370..1659230) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1659299..1659862) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene frr CDS complement(1659912..1660643) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene pyrH CDS 1660817..1661068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1661056..1661307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1661279..1662106) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene tsf CDS complement(1662223..1663095) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene rpsB CDS 1663397..1663885 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1663815..1665134) product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1665200..1666075) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1666086..1667264) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene dprA CDS complement(1667261..1668760) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1668747..1669112) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014835.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1669510..1670052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1670109..1670414) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1670417..1671037) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982719.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1671037..1671750) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene lepB CDS complement(1671802..1672284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1672447..1672674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1672562..1673641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1673638..1674240 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1674939..1675280) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene rplS CDS 1675592..1677340 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene thiC CDS 1677333..1677968 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1677965..1679026 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene thiO CDS 1679023..1679226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1679232..1680011 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 1680012..1681070 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1681045..1683300) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1683311..1684150) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1684168..1685205) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene fepG CDS complement(1685202..1686164) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1686241..1687266 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1687373..1688128) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1688227..1688604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1688606..1689484) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050816932.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene trmD CDS complement(1689481..1690047) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rimM CDS 1690082..1690501 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861911.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1690498..1692084) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1692081..1692728) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene deoC CDS complement(1692739..1694025) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1694175..1694582 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 1694589..1695803 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1695860..1696507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1696481..1696777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1697217..1697747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1698032..1699654) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene ffh CDS complement(1699699..1701849) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1701839..1702177) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1702181..1703611) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1703759..1705441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1705474..1708908) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene smc CDS complement(1708955..1709236) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1709221..1710789) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1711143..1711703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1712121..1713650 product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1713930..1714760) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene mutM CDS complement(1714760..1715518) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene rnc CDS complement(1715515..1716027) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1716051..1716764) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1716892..1717344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1717341..1718684) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene gdhA CDS 1718797..1719909 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1719879..1720277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1720308..1721636 product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 1722135..1723400 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014868.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1723505..1725889 product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene malP CDS complement(1726159..1727592) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene pyk CDS complement(1727669..1728661) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene lgt CDS complement(1728677..1729498) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene trpC CDS complement(1729574..1730221) product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1730218..1730568) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014876.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene hisI CDS complement(1730565..1731341) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene hisF CDS complement(1731372..1732160) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1732168..1732908) product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856418.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene priA CDS complement(1732927..1733562) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene hisH CDS complement(1733573..1733899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1733926..1735167) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1735168..1735341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1735342..1735944) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene hisB CDS complement(1735951..1737045) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1737046..1738377) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene hisD CDS 1738538..1739626 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1739623..1740132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1740145..1740588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1740605..1740781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1740860..1741423 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1741455..1743836 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene glgX CDS complement(1743840..1744220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 1744300..1745664 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 1745762..1746373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1746419..1748908 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene treY CDS 1748901..1749926 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1749972..1750100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1750326..1750706) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1750719..1750946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1750977..1751615) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1751614..1753401 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856468.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene treZ CDS 1753374..1754135 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1754132..1754866 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1754863..1756167) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene ilvA CDS 1756306..1756638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1756700..1760266) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene dnaE CDS 1760337..1761206 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene rarD CDS complement(1761203..1761778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1761775..1762701) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1762698..1763243) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856491.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene lspA CDS 1763292..1764347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1764465..1766141 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1766138..1766710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1766842..1767762 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1767759..1769147) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1769149..1770027) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014913.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1770038..1773265) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene ileS CDS complement(1773635..1774627) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1774819..1775106) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1775282..1775761) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1775843..1776556) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1776553..1777290) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene pgeF CDS complement(1777314..1778504) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene ftsZ CDS complement(1778651..1779310) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene ftsQ CDS complement(1779307..1780761) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene murC CDS complement(1780803..1781912) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene murG CDS complement(1781916..1783382) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1783379..1784779) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene murD CDS complement(1784776..1785885) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene mraY CDS complement(1785888..1787441) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1787438..1788961) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1788989..1790836) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1791067..1791879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1791876..1792913) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene rsmH CDS complement(1793088..1793522) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene mraZ CDS complement(1794052..1794447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1794573..1795004) product SAV_6107 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1795135..1795776 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856553.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1795858..1796958 product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene idsA CDS 1796960..1798549 product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1798452..1798817) product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 1798716..1801082 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene pknB CDS complement(1801079..1802467) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1802499..1803023) product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 1803089..1804528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 1804540..1805700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1805701..1805883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1805947..1807131) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014940.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1807218..1807958) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1807987..1808952) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1809044..1810171) product GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene pimB CDS complement(1810176..1811111) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1811392..1812012) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1812710..1814338) product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene qcrB CDS complement(1814338..1815555) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1815552..1816439) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1816510..1817055) product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1817684..1818115) product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1818131..1819225) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 1819663..1821585 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene asnB CDS 1821610..1822272 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1822727..1823071) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1823265..1823963 product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1824014..1825015 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene cobT CDS complement(1825012..1826121) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014956.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 1826205..1827713 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1827889..1828647 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1828644..1829036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1829161..1831188 product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene sucB CDS 1831538..1834417 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene gcvP CDS 1834432..1835532 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene gcvT CDS 1835589..1835978 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene gcvH CDS 1836061..1836840 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene lipB CDS 1836929..1837945 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene lipA CDS 1837956..1838747 product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 1838852..1840471 product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1840478..1840954) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 1841107..1842543 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene glnA CDS 1842867..1843379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1843389..1843901 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 1844144..1844830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1844836..1845396) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(1845486..1846244) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene aztA CDS complement(1846241..1847098) product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene aztB CDS complement(1847136..1848095) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 1848224..1848580 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1848577..1849299) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1849312..1849644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1849525..1849767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1849908..1850441) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1850457..1851314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1851311..1851469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1851482..1852930) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene thrC CDS 1853023..1854390 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1854411..1855118) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1855180..1855464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1855560..1858661) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1858680..1860017) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1860191..1861327 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 1861392..1863248 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1863310..1863522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1863657..1864895 product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1864892..1866289) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1866796..1867944) product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859605.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1867948..1868670) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1868682..1869815) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 1869853..1870539 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856980.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1870502..1871023 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1871039..1871959 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1872165..1872749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1872746..1873057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1873112..1873912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(1874155..1874625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 tRNA complement(1874862..1874937) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1875012..1875443) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859595.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1875805..1878552 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene aceE CDS 1878636..1879244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1879231..1880043) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1880040..1881074) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 1881120..1881374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 1881384..1882193 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1882190..1883149) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1883142..1883549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1883725..1884516) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1884746..1885201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 tRNA complement(1885252..1885326) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 1885496..1885569 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(1885618..1886430) product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1886903..1887145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1887142..1889055) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene dnaG CDS 1889108..1889533 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1889557..1891308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1891481..1892761) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1892807..1893112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1893092..1893355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1893533..1895575 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1895607..1896080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1896090..1896596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1896599..1897978) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 1898256..1898723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1898797..1899225 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1899222..1900328) product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1900346..1901095) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1901112..1901849) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene recO CDS complement(1901876..1902697) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene era CDS complement(1902830..1903681) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene pdxY CDS complement(1903713..1905050) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1905051..1905674) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene ybeY CDS complement(1905674..1906639) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1906650..1907360) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(1907357..1908481) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene dnaJ CDS complement(1908532..1909542) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene hrcA CDS complement(1909711..1910826) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene hemW CDS complement(1910826..1911503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 1911587..1912126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 1912123..1912587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 1912584..1913240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1913226..1914539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1914547..1916376) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 1916633..1918777 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene malQ CDS complement(1918774..1918914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1918926..1919117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1919127..1921253) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 1921176..1922438 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015022.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1922446..1922997) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene idi CDS complement(1923013..1924680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1924658..1925269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1925387..1925908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 1926086..1927936 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 1927957..1929114 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 1929155..1931053 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene treS CDS 1931053..1932237 product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 1932335..1933672 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene brnQ CDS 1933737..1934765 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1934772..1935263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1935620..1936387 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 1936452..1937930 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 1937927..1938865 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 1938862..1939677 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1939674..1941107 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1941186..1941701) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene thpR CDS 1941951..1942994 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 1942991..1944547 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1944544..1945512 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 1945540..1946472 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014235.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1946469..1947371 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1947376..1947750 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rbsD CDS complement(1947913..1949202) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 1949245..1950018 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567731.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1950015..1951397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1951501..1952067) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1952077..1952769) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 1952848..1953483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1953488..1954828) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 1954975..1955907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1955955..1956653 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 1956786..1957838 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(1957819..1958760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 1958918..1959481 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 1959498..1961105 product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(1961130..1962977) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene lepA CDS 1963186..1963779 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 1963957..1964223 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene rpsT CDS complement(1964494..1965147) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(1965144..1965533) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(1965545..1966507) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene holA CDS complement(1966525..1968165) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(1968162..1968815) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(1968891..1969712) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1969713..1970432) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859329.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(1970437..1970910) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene rsfS CDS complement(1971011..1971583) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene nadD CDS complement(1971736..1973019) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(1973039..1973959) product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(1973973..1975073) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene proB CDS complement(1975215..1976723) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene obgE CDS complement(1976850..1977116) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene rpmA CDS complement(1977159..1977464) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene rplU CDS complement(1977661..1980606) product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 1980901..1981518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(1981969..1982379) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene ndk CDS complement(1982434..1982781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 1982847..1983869 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 1983869..1984189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 1984186..1984653 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(1984650..1985063) product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(1985060..1986595) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567661.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(1986592..1989270) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 1989362..1990399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(1990445..1991950) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(1992035..1993012) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 1993338..1994105 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1994116..1995408) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene clpX CDS complement(1995476..1996144) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(1996147..1996887) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 1996959..1997726 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 1997742..1998971 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 1998983..1999738 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015088.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene pcaD CDS 1999738..2000946 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2000982..2003180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 2003180..2004232 product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene mcrC CDS complement(2004247..2005251) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2005251..2005910) product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2005930..2007573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2007566..2008387) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene phnC CDS complement(2008392..2009330) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2009447..2010565) product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2010782..2011516 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2011513..2012415) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(2012743..2012991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2012988..2014109) product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2014183..2015055) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene catA CDS 2015679..2017172 product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene benA CDS 2017203..2017700 product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene benB CDS 2017711..2019264 product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene benC CDS 2019261..2020067 product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2020089..2022755 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2023165..2023791) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2023812..2024411) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2024575..2025936) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene tig tRNA complement(2026002..2026076) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(2026214..2026288) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 2026403..2027191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2027322..2028488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2028485..2029951 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2029963..2031177 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2031174..2031647) product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2031658..2032698) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2032695..2034185) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2034263..2035339) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(2035488..2036105) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2036209..2038785 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene pepN CDS 2038897..2039262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2039349..2040731 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2040728..2041393 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013524.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(2041518..2042261) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(2042364..2043515) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2043656..2044615 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2044612..2045025 product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2044982..2046049) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene ald CDS complement(2046369..2046647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2046556..2047302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(2047299..2047916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2047913..2048371) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2048481..2050151) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene ettA CDS complement(2050197..2050805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2050945..2053035) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 tRNA 2053147..2053221 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 2053896..2054702 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(2054699..2056054) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2056228..2056605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2056724..2057527 product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene cmrA CDS 2057529..2058173 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene orn tRNA 2058223..2058298 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 2058410..2058766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029703736.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2059096..2059551 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2059612..2060517) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2060548..2061087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2061115..2062269) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 tRNA 2062566..2062641 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(2063167..2063829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2063875..2064189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2064189..2065439) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2065467..2066054 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2066051..2066644) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2066656..2067054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2067053..2067523 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene bcp CDS 2067530..2068201 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2068256..2068690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 2068687..2068977 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2068974..2069393) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2069380..2069982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2069996..2070877) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2070874..2071719) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(2071797..2073122) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 2073411..2074556 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene ugpC CDS complement(2074563..2074865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 2075327..2075482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2076006..2085056) product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2085383..2085880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 note possible pseudo, frameshifted CDS complement(2085802..2086341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 note possible pseudo, frameshifted CDS 2086551..2088446 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2088474..2089868 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 2089877..2090053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 2090295..2090567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 note possible pseudo, frameshifted CDS 2090581..2091252 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 2091249..2092145 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2092212..2093198 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2093544..2094227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2094224..2094574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 2094969..2095343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2095352..2098993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2099153..2099464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2100248..2101747 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2101887..2103377 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2103452..2104132) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2104582..2105334 product C50 carotenoid glucosyltransferase CrtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene crtX CDS 2105331..2106296 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2106289..2107200 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2107239..2108843 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2108836..2109180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2109177..2109473 product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2109470..2110333 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2110548..2111207) product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235933501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2111354..2112715) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(2112960..2113556) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2113556..2113915) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013963.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2114266..2114889 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690625.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2115875..2116294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2116628..2117515 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2117606..2118013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2118142..2118618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2119014..2120066 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2120255..2120620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2120675..2121541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2121570..2122640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2122637..2123308 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2123380..2124297 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2124294..2125052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2125055..2125801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2126120..2126830 product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2127088..2127756) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 2127737..2128597 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2128599..2129252) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2129252..2130424) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 2130477..2131691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2131693..2131863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 2131915..2132271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2132285..2132995 product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2133423..2133908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 2134030..2137392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2137693..2138352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 2138254..2139498 product ISL3-like element IS31831 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015071.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2139530..2140144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2140229..2140444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2140462..2140896) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2141201..2141821) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2141952..2142170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2142186..2142557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2142554..2143273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2143270..2144082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2144261..2144455) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2144459..2144860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2144748..2145005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2145280..2145453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 note possible pseudo, internal stop codon CDS complement(2145539..2145943) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 2146120..2147679 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 2147781..2148971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2149065..2149454) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 2149817..2150146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 note possible pseudo, frameshifted CDS 2150143..2150520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 note possible pseudo, frameshifted CDS 2150529..2151239 product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2151214..2153412) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2153679..2155355 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465068.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2155349..2156266 product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2156263..2157444 product TniQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(2157551..2158147) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2158304..2159014 product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2159224..2159754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2160010..2160339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 note possible pseudo, frameshifted CDS complement(2160323..2161459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 note possible pseudo, frameshifted CDS complement(2161559..2162014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2162023..2162208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2162299..2162886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 2163034..2165097 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 2165803..2165985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2166505..2167323 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363838.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2167338..2168387 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2168384..2168665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2168590..2169318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 tRNA complement(2169597..2169681) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 2169761..2170192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2170189..2170548 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2170660..2170908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(2171060..2171986) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013616.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene purU CDS complement(2171988..2172599) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rdgB CDS complement(2172599..2173330) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene rph CDS complement(2173349..2174116) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene cdpA CDS complement(2174172..2175005) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene murI CDS complement(2175013..2175471) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015181.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2175574..2176173) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2176259..2177233) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2177235..2177777) product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(2177794..2178087) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene clpS CDS 2178280..2178816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2178853..2180199 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2180206..2182167 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(2182155..2182934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804423.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(2183021..2183752) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2183749..2185032) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082353449.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene serB CDS complement(2185163..2186914) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene ctaD CDS complement(2187230..2189248) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2189252..2189464) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2189599..2190603) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene nrdF CDS 2190954..2191664 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2191734..2193902) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene nrdE CDS complement(2193933..2194373) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene nrdI CDS complement(2194516..2194749) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857948.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene nrdH CDS complement(2195430..2195552) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene ykgO CDS 2195758..2196594 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene nadE CDS complement(2196591..2197013) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2197176..2197787 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2197774..2198796 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2198724..2199419) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2199416..2200465) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2200617..2201783 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2201780..2202400 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2202397..2203536) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2204011..2204661) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2204755..2205840 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2205840..2207609 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097482.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2207560..2207811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2207859..2208419) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2209248..2210111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2210183..2211307) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(2211756..2212556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2212799..2213269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2213515..2214684 product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 tRNA complement(2214865..2214938) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(2214976..2215049) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(2215203..2215931) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2215962..2216462) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2216538..2218199) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene pgm CDS 2218351..2219805 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2219816..2220118 product fluoride efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2220115..2220441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2220433..2223003) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2223016..2223900) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2224247..2225167 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 rRNA complement(2225286..2225390) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(2225589..2228668) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA complement(2229175..2230707) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(2231307..2232560) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene murA CDS complement(2232590..2233432) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 2233751..2234683 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene cysK CDS 2234769..2235335 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene cysE CDS complement(2235341..2235631) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 tRNA complement(2235761..2235834) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(2235864..2235938) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(2236556..2236630) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(2236653..2236726) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 2236820..2237155 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2237156..2237479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2237515..2238192 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 2238469..2238846 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929919.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 2238901..2239575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2239838..2242399) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(2242405..2243403) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2243625..2244068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 tRNA complement(2244214..2244287) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(2244421..2245923) product succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2246189..2247337 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858945.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene dusB CDS 2247397..2248134 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene phoU CDS complement(2248202..2248975) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene pstB CDS complement(2249024..2249950) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene pstA CDS complement(2249966..2251024) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene pstC CDS complement(2251221..2252339) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene pstS CDS complement(2252564..2253460) product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene mshD CDS 2253495..2254253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2254250..2255287) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015227.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2255328..2255987 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2255984..2256883) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2256905..2257306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2257241..2257999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 2258210..2258440 product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2258525..2259604) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene purM CDS complement(2259627..2261153) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene purF CDS complement(2261150..2261533) product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 2261532..2262560 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015231.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2262599..2263924) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 2264197..2264676 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2264673..2265347) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015232.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 2265522..2265713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 2265706..2266005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 2266009..2266185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2266252..2268528) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene purL CDS complement(2268544..2269215) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene purQ CDS complement(2269212..2269457) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene purS CDS complement(2269540..2270043) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2270056..2270727) product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2270772..2272880) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015237.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2272911..2273804) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2273849..2275279) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene purB CDS complement(2275305..2276468) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285864.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(2276465..2277742) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene purD CDS 2277812..2278237 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2278306..2278839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2278827..2279111 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857637.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2279122..2279946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2279943..2280869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2280866..2281540) product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene raaS CDS complement(2281664..2282428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 2283044..2284378 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene trpB CDS complement(2284375..2285814) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2285811..2286527) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2286610..2287365) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015246.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(2287407..2288417) product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(2288422..2290209) product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 2290312..2291640 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2291630..2292145 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2292163..2293473 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(2293436..2294398) product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015254.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 2294616..2294804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 tRNA complement(2294947..2295020) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 2295091..2296560 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2296609..2296938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 2296950..2298362 product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2298359..2298811 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 2298870..2299619 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene otsB CDS complement(2299579..2300631) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 2300704..2301561 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(2301577..2302518) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene rlmB CDS complement(2302527..2303927) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene cysS CDS complement(2303938..2304732) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene nagB CDS complement(2304755..2305909) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 2306051..2306980 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2306987..2307892 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2307896..2308591 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(2308588..2309307) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2309602..2311224 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2311358..2312323 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 2312323..2314299 product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2314299..2315081 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2315196..2315996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2316239..2316709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2317146..2317631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 note possible pseudo, internal stop codon, frameshifted CDS complement(2317643..2319232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 note possible pseudo, internal stop codon, frameshifted CDS complement(2319229..2320101) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2320405..2320893) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene ispF CDS complement(2320890..2321618) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene ispD CDS complement(2321626..2322210) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2322480..2323037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015291.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2323159..2323419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 2323310..2324518 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene radA CDS 2324530..2325597 product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene disA CDS 2325618..2326976 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene scrB CDS 2327316..2329328 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2329315..2329998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(2330059..2330649) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2330727..2331590 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2331596..2331766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2331786..2334512) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 2334771..2335796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2335793..2337223) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2337319..2338584) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2338944..2339543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2339550..2341232) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene lysS CDS 2341331..2342305 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015422.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2342316..2342510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2342507..2343682) product globin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015425.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2343879..2345957 product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2346215..2347930 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 2347935..2348195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 2348186..2349157 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2349154..2349966) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2349963..2350691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2350708..2351697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2351690..2352157) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(2352154..2352645) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene folK CDS complement(2352645..2353034) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene folB CDS complement(2353027..2353881) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene folP CDS complement(2353892..2354461) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene folE CDS complement(2354462..2356864) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene ftsH CDS complement(2356969..2357562) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene hpt CDS complement(2357573..2358475) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015318.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene tilS CDS complement(2358477..2359748) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015319.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene dacB CDS 2359869..2360342 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(2360363..2360821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 2360969..2361259 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 2361329..2361829 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2361836..2365723 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2365730..2366629) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene ppk2 CDS complement(2366776..2366967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(2367053..2367223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2367761..2369407) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene groL CDS 2369612..2370967 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2371170..2371673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2371713..2372684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2373061..2376009 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 2376010..2376501 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 2376494..2378242 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2378239..2378748 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2378754..2379029 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 2379033..2379413 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853711.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene mnhG CDS complement(2379580..2380143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2380133..2381281) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(2381294..2381884) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2381881..2382150) product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853699.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2382149..2382733 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 2382733..2383731 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015341.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2383742..2384563 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2384564..2386057 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(2386029..2387258) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862889.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2387333..2388598 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(2388708..2389469) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(2389473..2390402) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(2390425..2390862) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2390976..2392559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 2392559..2393602 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2393602..2396037 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2396092..2397291) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2397293..2398666) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853660.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene pta CDS complement(2398659..2398880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 2399163..2400530 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2400629..2401102 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015352.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2401088..2402149) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene purT CDS complement(2402155..2403444) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2403562..2404371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2404437..2405180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2405325..2405654 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889857.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 2405782..2406540 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(2406826..2408007) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2408217..2409251) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene fbaA CDS 2409407..2410378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803908.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(2411537..2412319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(2412553..2414397) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2414605..2414985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2415504..2417135 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 2417139..2418395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 2418388..2419647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2419651..2420934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2421119..2422648 product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(2422827..2423162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(2423166..2423717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2424475..2425623 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 2425626..2426237 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2426227..2426598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 2426479..2426835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 2426921..2427874 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2427839..2428417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2428533..2429726) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(2429791..2430444) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2430425..2430979) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene pyrE CDS complement(2430990..2431976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2432043..2432873) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 2432946..2434316 product multidrug efflux MFS transporter Cmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene cmr CDS complement(2434388..2436946) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene clpB CDS complement(2437100..2438446) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2438563..2439591) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene adhP CDS 2439748..2440923 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 2440932..2441993 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015375.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2442360..2443889) product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2444153..2444488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(2444639..2445427) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2445463..2446893) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(2447098..2447328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 2447460..2447750 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 2447975..2448349 product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2448539..2449900 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2449897..2450361) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 2450721..2451305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(2451292..2452137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 note possible pseudo, frameshifted CDS complement(2452192..2452533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 note possible pseudo, frameshifted CDS 2452695..2453078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 2453109..2454104 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 2454124..2454519 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(2454516..2455427) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(2455424..2456071) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(2456068..2456706) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143979554.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2456703..2457509) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 2457625..2458815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2458801..2459589) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 2459696..2459953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 2459953..2461116 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(2461173..2462693) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015386.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2462954..2463397) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(2463421..2464605) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene dnaJ CDS complement(2464735..2465382) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene grpE CDS complement(2465382..2467235) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene dnaK CDS 2467693..2471109 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 2471151..2472494 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(2472504..2473079) product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2473099..2474460) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2474481..2476094) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2476232..2477158) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2477167..2477886) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(2477883..2479160) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(2479160..2480077) product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015403.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(2480074..2480838) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853541.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2481092..2482798) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 2483123..2484502 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015406.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 2484607..2485083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2485147..2485557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2485623..2487356 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 2487353..2489308 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2489321..2489746) product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 repeat_region 2490444..2503226 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcatccccgctggcgcggggagcac CDS complement(2503632..2504129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2505226..2505888) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene cas5e CDS complement(2505927..2507060) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene cas7e CDS complement(2507711..2509381) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene casA CDS complement(2509428..2512277) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 2512530..2515070 product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112277.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 2515117..2515797 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2515835..2517100 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2517112..2518335 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(2518332..2519654) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(2519713..2520276) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene dcd tRNA 2520369..2520440 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 2520993..2524286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 2524279..2527011 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2527001..2527933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2529058..2529399) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2529491..2531155) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2531250..2532377) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2532474..2532959 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2532863..2533177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 2533188..2536328 product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(2536244..2537416) product trehalose corynomycolate mycolyl acetyltransferase TmaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015440.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene tmaT CDS 2537629..2538657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2538759..2540129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(2540068..2541189) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2541352..2542020 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 2542222..2543607 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 2543659..2544585 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(2544586..2545779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(2545908..2547731) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(2547850..2548233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2548249..2549466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 2549583..2550365 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene trmB CDS 2550394..2551071 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 2551099..2553435 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2553435..2554478 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 2554489..2554914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 note possible pseudo, internal stop codon CDS complement(2555002..2555298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2555206..2555595 product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 2555785..2557146 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457649.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2557450..2559000) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2559026..2563834) product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015451.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene pks13 CDS complement(2563986..2565836) product FadD32-like long-chain-fatty-acid--AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2565984..2566895) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2566900..2567388) product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2567388..2569328) product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2569692..2570708) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2570897..2572858) product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene aftB CDS complement(2572889..2573869) product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2573866..2574369) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2574366..2576330) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 2576411..2577859 product DUF5129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015462.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(2577962..2578594) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2578769..2579176) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853529.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(2579173..2579625) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(2579645..2580277) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(2580362..2581561) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene glf CDS 2581730..2583829 product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015467.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(2583826..2585313) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene glpK CDS complement(2585345..2586172) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(2586174..2587115) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015469.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(2587118..2588377) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene serS CDS 2588647..2589312 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 2589388..2590395 product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 2590392..2590739 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(2590760..2591422) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(2591424..2592407) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862609.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene pheA CDS 2592406..2593638 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568791.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 2593635..2594372 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857812.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 2594801..2595634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2595639..2596553) product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(2596575..2597300) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(2597306..2599156) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 2599939..2603871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 2603868..2605739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(2606007..2606963) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 2607052..2608956 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015484.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2608946..2610496) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 2610671..2611354 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(2611360..2612031) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene msrA CDS 2612160..2612759 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862560.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(2612928..2613815) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015499.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 2613878..2615080 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(2615058..2616527) product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 2616681..2617316 product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015503.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 2617527..2617865 product iron-regulated nucleoid-associated protein Lsr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419513.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene lsr2 CDS complement(2617869..2618507) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(2618504..2619796) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 2619956..2621176 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene yidC CDS complement(2621103..2621735) product TetR/AcrR family transcriptional regulator MbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene mcbR CDS complement(2621921..2622175) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 2622440..2622910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 2623153..2623953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2624076..2624972) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(2625068..2625214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2625213..2626208 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 rRNA complement(2626378..2626482) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2626681..2629760) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA complement(2630267..2631799) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(2632402..2633436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(2633433..2634329) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(2634326..2634700) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015515.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2634880..2636136 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015516.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(2636161..2636985) product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene rsmP CDS complement(2637147..2637530) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene trxA CDS 2637685..2637891 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 2637996..2640257 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013619.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2640285..2641622 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2641619..2641762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2642047..2643210 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(2643207..2644706) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene dnaB CDS complement(2645297..2645749) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene rplI CDS complement(2645835..2646446) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015545.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(2646523..2646810) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene rpsF CDS complement(2646948..2647145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(2647133..2648533) product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015546.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(2648538..2650688) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2650788..2651153) product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015548.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 2651303..2652394 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 2652429..2652899 product MarR family transcriptional regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855083.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene carR CDS 2652920..2653882 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 2653904..2654437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(2654415..2655320) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(2655331..2656824) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015555.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 2656816..2657685 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855116.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(2657682..2659010) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228261.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(2659094..2660407) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083202.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene paaF CDS complement(2660650..2661258) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2661399..2661830 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene paaI CDS 2661936..2662907 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene paaA CDS 2662935..2663225 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene paaB CDS 2663222..2664058 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene paaC CDS 2664055..2664591 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene paaJ CDS 2664591..2665757 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene paaK CDS 2665770..2666540 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 2666576..2667778 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 2667783..2668544 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 2668546..2669382 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729557.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(2669379..2669771) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2669859..2671895 product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene paaZ CDS complement(2671877..2672566) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 2672602..2674197 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013753.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(2674331..2675296) product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013610.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2675304..2675621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(2675686..2676201) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015564.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2676395..2677753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 2677805..2678794 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(2678791..2681604) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene leuS CDS complement(2681616..2683607) product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 2683649..2684029 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 2684041..2685375 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 2685448..2685732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(2685707..2686951) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 2687061..2687519 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 2687791..2689353 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 2689350..2689997 product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855176.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 2689998..2691026 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855178.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene trpD CDS 2691019..2692458 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015582.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene trpCF CDS 2692455..2693702 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene trpB CDS 2693705..2694547 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene trpA CDS complement(2694548..2695045) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014359.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2695159..2695416 product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 2695413..2696360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 2696557..2697438 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567959.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 2697435..2699009 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015585.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 2699041..2699610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 2699844..2700092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 2700686..2701666 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 2701726..2702037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015617.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(2702034..2702378) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2702375..2703076) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(2703079..2703690) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(2703692..2705164) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 2705239..2706024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 2706021..2708582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 2708754..2711831 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2711849..2712487 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2712572..2713519 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene trxB CDS 2713531..2713854 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene trxA CDS 2713898..2715079 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(2715076..2715738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015626.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2715755..2716840) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(2716840..2717757) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(2717840..2718496) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene rsmG CDS complement(2718585..2719544) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene yidC CDS complement(2719550..2719831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2719824..2720192) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene rnpA CDS complement(2720208..2720351) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene rpmH sequence2 source 1..44506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(689..1723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 1995..2231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2264..5836) product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene mobF CDS 6128..6310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 6350..7000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(7181..7417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 8523..8936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 8939..10051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 10438..11643 product ISL3-like element IS31831 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(11618..12430) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727958.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene istB CDS complement(12427..13752) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 13900..14088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(14041..14451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(14518..15228) product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(15373..15537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 15478..15840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(15891..16058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 16975..17562 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 17559..17789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 17867..18043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 18236..19219 product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 19815..22889 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(22952..23866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(23998..24846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 25101..25973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 26320..27528 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150490919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(27690..28118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(28320..29030) product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(29039..29215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(29339..31396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(31400..31855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 32059..33903 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 34164..35444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(35823..36086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(36092..37192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(37371..37973) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(37963..38187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 38499..38936 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(39082..40641) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 tRNA 40545..40622 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 40813..41217 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 41531..41938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(41881..42591) product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 42702..43052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 43260..44171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 sequence3 source 1..43539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..529 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094791896.1:type IV secretory system conjugative DNA transfer family protein locus_tag LOCUS_26340 CDS 526..876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 1271..1645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(1654..5292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 5350..5766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(6333..6509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(6512..6838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(6860..7390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 7607..7864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 8054..9685 product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 9702..10457 product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211463095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(10898..11560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(11560..12651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 13022..14125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 14122..14385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 14781..15011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 15095..15526 product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858809.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(15600..21008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 note possible pseudo, internal stop codon, frameshifted CDS complement(21104..21667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(21857..22096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(22093..22671) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 repeat_region 23249..23429 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcatgtacaaatccgcgc CDS complement(23483..24400) product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(24526..24945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(25077..26036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(26071..26571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 26714..27094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 27081..28268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 28278..28934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 28950..30623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 30620..31297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 31301..31585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 31582..31851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 31888..32517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 32514..33407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 33404..35059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 35071..36564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 36572..37474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 37471..39171 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 39171..39449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 39461..41050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 41056..41604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 41643..42320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750