>Feature sequence1 1 1545 gene locus_tag LOCUS_00010 gene dnaA 1 1545 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013309.1 protein_id gnl|my_center|LOCUS_00010 2108 3295 gene locus_tag LOCUS_00020 gene dnaN 2108 3295 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 protein_id gnl|my_center|LOCUS_00020 3299 4471 gene locus_tag LOCUS_00030 gene recF 3299 4471 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 protein_id gnl|my_center|LOCUS_00030 4464 5057 gene locus_tag LOCUS_00040 4464 5057 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855338.1 protein_id gnl|my_center|LOCUS_00040 5142 7190 gene locus_tag LOCUS_00050 gene gyrB 5142 7190 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 protein_id gnl|my_center|LOCUS_00050 8407 7187 gene locus_tag LOCUS_00060 8407 7187 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 protein_id gnl|my_center|LOCUS_00060 8634 9158 gene locus_tag LOCUS_00070 8634 9158 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014045.1 protein_id gnl|my_center|LOCUS_00070 9214 10029 gene locus_tag LOCUS_00080 gene tauC 9214 10029 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706737.1 protein_id gnl|my_center|LOCUS_00080 10037 11077 gene locus_tag LOCUS_00090 10037 11077 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726676.1 protein_id gnl|my_center|LOCUS_00090 11074 11847 gene locus_tag LOCUS_00100 11074 11847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173732.1 protein_id gnl|my_center|LOCUS_00100 11885 12739 gene locus_tag LOCUS_00110 11885 12739 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563158.1 protein_id gnl|my_center|LOCUS_00110 14163 12736 gene locus_tag LOCUS_00120 14163 12736 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_00120 14564 14283 gene locus_tag LOCUS_00130 14564 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15067 14798 gene locus_tag LOCUS_00140 15067 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855344.1 protein_id gnl|my_center|LOCUS_00140 15288 15073 gene locus_tag LOCUS_00150 15288 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15365 17926 gene locus_tag LOCUS_00160 gene gyrA 15365 17926 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 protein_id gnl|my_center|LOCUS_00160 17929 18273 gene locus_tag LOCUS_00170 17929 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18353 18429 gene locus_tag LOCUS_t00010 18353 18429 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 18431 18504 gene locus_tag LOCUS_t00020 18431 18504 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19927 18560 gene locus_tag LOCUS_00180 19927 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20443 19982 gene locus_tag LOCUS_00190 20443 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777020.1 protein_id gnl|my_center|LOCUS_00190 20593 21162 gene locus_tag LOCUS_00200 20593 21162 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014502.1 protein_id gnl|my_center|LOCUS_00200 21869 21159 gene locus_tag LOCUS_00210 21869 21159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22136 23131 gene locus_tag LOCUS_00220 22136 23131 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 protein_id gnl|my_center|LOCUS_00220 23180 25435 gene locus_tag LOCUS_00230 gene metE 23180 25435 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 protein_id gnl|my_center|LOCUS_00230 25870 25439 gene locus_tag LOCUS_00240 25870 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26179 26679 gene locus_tag LOCUS_00250 26179 26679 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907463.1 protein_id gnl|my_center|LOCUS_00250 26737 27363 gene locus_tag LOCUS_00260 26737 27363 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855383.1 protein_id gnl|my_center|LOCUS_00260 28949 27621 gene locus_tag LOCUS_00270 28949 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29349 29068 gene locus_tag LOCUS_00280 gene crgA 29349 29068 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 protein_id gnl|my_center|LOCUS_00280 31414 29444 gene locus_tag LOCUS_00290 gene pknB 31414 29444 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 protein_id gnl|my_center|LOCUS_00290 32895 31411 gene locus_tag LOCUS_00300 32895 31411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34328 32895 gene locus_tag LOCUS_00310 34328 32895 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 protein_id gnl|my_center|LOCUS_00310 35680 34325 gene locus_tag LOCUS_00320 35680 34325 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 protein_id gnl|my_center|LOCUS_00320 37088 35682 gene locus_tag LOCUS_00330 37088 35682 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013344.1 protein_id gnl|my_center|LOCUS_00330 37531 37085 gene locus_tag LOCUS_00340 37531 37085 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 protein_id gnl|my_center|LOCUS_00340 38427 37540 gene locus_tag LOCUS_00350 38427 37540 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 protein_id gnl|my_center|LOCUS_00350 38651 38735 gene locus_tag LOCUS_t00030 38651 38735 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39037 39381 gene locus_tag LOCUS_00360 39037 39381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39577 39419 gene locus_tag LOCUS_00370 39577 39419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40294 39854 gene locus_tag LOCUS_00380 40294 39854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40602 40781 gene locus_tag LOCUS_00390 40602 40781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41614 41946 gene locus_tag LOCUS_00400 41614 41946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42574 41969 gene locus_tag LOCUS_00410 42574 41969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_00410 43675 42578 gene locus_tag LOCUS_00420 43675 42578 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152476683.1 protein_id gnl|my_center|LOCUS_00420 43943 43692 gene locus_tag LOCUS_00430 43943 43692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44111 44998 gene locus_tag LOCUS_00440 44111 44998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_00440 45022 45729 gene locus_tag LOCUS_00450 45022 45729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_00450 45752 46612 gene locus_tag LOCUS_00460 45752 46612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46619 47500 gene locus_tag LOCUS_00470 46619 47500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47497 48048 gene locus_tag LOCUS_00480 47497 48048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48045 48809 gene locus_tag LOCUS_00490 48045 48809 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_00490 48806 49465 gene locus_tag LOCUS_00500 48806 49465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_00500 49745 49500 gene locus_tag LOCUS_00510 49745 49500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51455 50919 gene locus_tag LOCUS_00520 51455 50919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51646 51849 gene locus_tag LOCUS_00530 51646 51849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52282 52533 gene locus_tag LOCUS_00540 52282 52533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53059 54408 gene locus_tag LOCUS_00550 53059 54408 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_00550 54488 54820 gene locus_tag LOCUS_00560 54488 54820 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_00560 55435 55725 gene locus_tag LOCUS_00570 55435 55725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 56892 56254 gene locus_tag LOCUS_00580 56892 56254 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804777.1 protein_id gnl|my_center|LOCUS_00580 57446 56889 gene locus_tag LOCUS_00590 57446 56889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57489 57950 gene locus_tag LOCUS_00600 57489 57950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 58279 59889 gene locus_tag LOCUS_00610 58279 59889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59975 60697 gene locus_tag LOCUS_00620 59975 60697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_00620 60702 62105 gene locus_tag LOCUS_00630 60702 62105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62569 62279 gene locus_tag LOCUS_00640 62569 62279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 63516 63184 gene locus_tag LOCUS_00650 63516 63184 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_00650 64446 63595 gene locus_tag LOCUS_00660 64446 63595 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_00660 64967 64443 gene locus_tag LOCUS_00670 64967 64443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 65389 65039 gene locus_tag LOCUS_00680 65389 65039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 65815 65417 gene locus_tag LOCUS_00690 65815 65417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_00690 67003 65828 gene locus_tag LOCUS_00700 67003 65828 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776005.1 protein_id gnl|my_center|LOCUS_00700 67111 67644 gene locus_tag LOCUS_00710 67111 67644 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014903.1 protein_id gnl|my_center|LOCUS_00710 67644 68633 gene locus_tag LOCUS_00720 67644 68633 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776006.1 protein_id gnl|my_center|LOCUS_00720 69339 68638 gene locus_tag LOCUS_00730 69339 68638 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855259.1 protein_id gnl|my_center|LOCUS_00730 69387 69593 gene locus_tag LOCUS_00740 69387 69593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 69697 71118 gene locus_tag LOCUS_00750 69697 71118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 protein_id gnl|my_center|LOCUS_00750 71757 73400 gene locus_tag LOCUS_00760 71757 73400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 73416 74591 gene locus_tag LOCUS_00770 73416 74591 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821341.1 protein_id gnl|my_center|LOCUS_00770 75921 74599 gene locus_tag LOCUS_00780 75921 74599 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_00780 76015 77034 gene locus_tag LOCUS_00790 gene bioB 76015 77034 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861135.1 protein_id gnl|my_center|LOCUS_00790 77037 77240 gene locus_tag LOCUS_00800 77037 77240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 77337 78149 gene locus_tag LOCUS_00810 77337 78149 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706499.1 protein_id gnl|my_center|LOCUS_00810 78156 79151 gene locus_tag LOCUS_00820 78156 79151 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_00820 79148 79810 gene locus_tag LOCUS_00830 79148 79810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084191.1 protein_id gnl|my_center|LOCUS_00830 80326 84045 gene locus_tag LOCUS_00840 80326 84045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84204 85778 gene locus_tag LOCUS_00850 84204 85778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 85922 86833 gene locus_tag LOCUS_00860 85922 86833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 86820 87662 gene locus_tag LOCUS_00870 86820 87662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 88660 87659 gene locus_tag LOCUS_00880 88660 87659 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014988.1 protein_id gnl|my_center|LOCUS_00880 88557 90080 gene locus_tag LOCUS_00890 gene amn 88557 90080 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453446.1 protein_id gnl|my_center|LOCUS_00890 90097 91044 gene locus_tag LOCUS_00900 90097 91044 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 protein_id gnl|my_center|LOCUS_00900 91125 92321 gene locus_tag LOCUS_00910 gene sucC 91125 92321 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_00910 92322 93215 gene locus_tag LOCUS_00920 gene sucD 92322 93215 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_00920 94523 93228 gene locus_tag LOCUS_00930 94523 93228 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 protein_id gnl|my_center|LOCUS_00930 94698 95222 gene locus_tag LOCUS_00940 94698 95222 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013406.1 protein_id gnl|my_center|LOCUS_00940 96257 95178 gene locus_tag LOCUS_00950 96257 95178 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 protein_id gnl|my_center|LOCUS_00950 97076 96315 gene locus_tag LOCUS_00960 97076 96315 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854640.1 protein_id gnl|my_center|LOCUS_00960 97104 98852 gene locus_tag LOCUS_00970 97104 98852 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013418.1 protein_id gnl|my_center|LOCUS_00970 98920 99108 gene locus_tag LOCUS_00980 98920 99108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 100146 99127 gene locus_tag LOCUS_00990 100146 99127 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013419.1 protein_id gnl|my_center|LOCUS_00990 100201 100977 gene locus_tag LOCUS_01000 100201 100977 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283863.1 protein_id gnl|my_center|LOCUS_01000 101001 101609 gene locus_tag LOCUS_01010 101001 101609 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054715.1 protein_id gnl|my_center|LOCUS_01010 102889 101606 gene locus_tag LOCUS_01020 102889 101606 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014015.1 protein_id gnl|my_center|LOCUS_01020 103045 102902 gene locus_tag LOCUS_01030 103045 102902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01030 103430 103843 gene locus_tag LOCUS_01040 103430 103843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 104110 104544 gene locus_tag LOCUS_01050 104110 104544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 104658 105086 gene locus_tag LOCUS_01060 104658 105086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 106998 105205 gene locus_tag LOCUS_01070 gene betA 106998 105205 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_01070 107343 109532 gene locus_tag LOCUS_01080 gene betT 107343 109532 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 protein_id gnl|my_center|LOCUS_01080 109612 111174 gene locus_tag LOCUS_01090 109612 111174 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 protein_id gnl|my_center|LOCUS_01090 112583 111297 gene locus_tag LOCUS_01100 112583 111297 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_01100 113959 112598 gene locus_tag LOCUS_01110 113959 112598 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679578.1 protein_id gnl|my_center|LOCUS_01110 116288 114048 gene locus_tag LOCUS_01120 116288 114048 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013422.1 protein_id gnl|my_center|LOCUS_01120 116753 116433 gene locus_tag LOCUS_01130 116753 116433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117362 119161 gene locus_tag LOCUS_01140 117362 119161 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_01140 119284 119841 gene locus_tag LOCUS_01150 gene thpR 119284 119841 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 protein_id gnl|my_center|LOCUS_01150 119993 119829 gene locus_tag LOCUS_01160 119993 119829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 120017 120664 gene locus_tag LOCUS_01170 120017 120664 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013424.1 protein_id gnl|my_center|LOCUS_01170 120676 121383 gene locus_tag LOCUS_01180 120676 121383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856628.1 protein_id gnl|my_center|LOCUS_01180 121934 121380 gene locus_tag LOCUS_01190 121934 121380 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857169.1 protein_id gnl|my_center|LOCUS_01190 121964 122251 gene locus_tag LOCUS_01200 121964 122251 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 protein_id gnl|my_center|LOCUS_01200 122252 123043 gene locus_tag LOCUS_01210 122252 123043 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857162.1 protein_id gnl|my_center|LOCUS_01210 123756 123040 gene locus_tag LOCUS_01220 123756 123040 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013428.1 protein_id gnl|my_center|LOCUS_01220 125660 123753 gene locus_tag LOCUS_01230 125660 123753 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 protein_id gnl|my_center|LOCUS_01230 129111 125722 gene locus_tag LOCUS_01240 129111 125722 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 protein_id gnl|my_center|LOCUS_01240 131126 129138 gene locus_tag LOCUS_01250 131126 129138 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857673.1 protein_id gnl|my_center|LOCUS_01250 131898 131134 gene locus_tag LOCUS_01260 131898 131134 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013458.1 protein_id gnl|my_center|LOCUS_01260 133361 131946 gene locus_tag LOCUS_01270 133361 131946 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 protein_id gnl|my_center|LOCUS_01270 133742 133506 gene locus_tag LOCUS_01280 133742 133506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857667.1 protein_id gnl|my_center|LOCUS_01280 133780 134214 gene locus_tag LOCUS_01290 133780 134214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 134217 135080 gene locus_tag LOCUS_01300 134217 135080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013461.1 protein_id gnl|my_center|LOCUS_01300 135092 135595 gene locus_tag LOCUS_01310 135092 135595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 136454 135546 gene locus_tag LOCUS_01320 136454 135546 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013464.1 protein_id gnl|my_center|LOCUS_01320 137432 137359 gene locus_tag LOCUS_t00040 137432 137359 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 137525 137434 gene locus_tag LOCUS_t00050 137525 137434 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 137640 138776 gene locus_tag LOCUS_01330 137640 138776 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_01330 138928 138843 gene locus_tag LOCUS_t00060 138928 138843 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 138980 139936 gene locus_tag LOCUS_01340 138980 139936 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857642.1 protein_id gnl|my_center|LOCUS_01340 141229 139943 gene locus_tag LOCUS_01350 141229 139943 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013468.1 protein_id gnl|my_center|LOCUS_01350 141358 142245 gene locus_tag LOCUS_01360 141358 142245 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 protein_id gnl|my_center|LOCUS_01360 142257 143042 gene locus_tag LOCUS_01370 142257 143042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 protein_id gnl|my_center|LOCUS_01370 143195 144178 gene locus_tag LOCUS_01380 143195 144178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144180 145250 gene locus_tag LOCUS_01390 144180 145250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 145415 146758 gene locus_tag LOCUS_01400 gene mgtE 145415 146758 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453796.1 protein_id gnl|my_center|LOCUS_01400 146837 146910 gene locus_tag LOCUS_t00070 146837 146910 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 147995 146961 gene locus_tag LOCUS_01410 147995 146961 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 protein_id gnl|my_center|LOCUS_01410 148035 148517 gene locus_tag LOCUS_01420 148035 148517 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 protein_id gnl|my_center|LOCUS_01420 148556 148993 gene locus_tag LOCUS_01430 gene tadA 148556 148993 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855650.1 protein_id gnl|my_center|LOCUS_01430 149073 149282 gene locus_tag LOCUS_01440 149073 149282 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573729.1 protein_id gnl|my_center|LOCUS_01440 149322 149409 gene locus_tag LOCUS_t00080 149322 149409 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 149513 151987 gene locus_tag LOCUS_01450 149513 151987 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013489.1 protein_id gnl|my_center|LOCUS_01450 151988 153232 gene locus_tag LOCUS_01460 gene tgt 151988 153232 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 protein_id gnl|my_center|LOCUS_01460 153831 153220 gene locus_tag LOCUS_01470 153831 153220 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_01470 153883 154773 gene locus_tag LOCUS_01480 gene gluQRS 153883 154773 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013493.1 protein_id gnl|my_center|LOCUS_01480 155004 155870 gene locus_tag LOCUS_01490 155004 155870 CDS product IS481-like element ISMsm9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731392.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01490 156167 158248 gene locus_tag LOCUS_01500 156167 158248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 158682 160349 gene locus_tag LOCUS_01510 158682 160349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 protein_id gnl|my_center|LOCUS_01510 160489 160400 gene locus_tag LOCUS_t00090 160489 160400 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 160834 161283 gene locus_tag LOCUS_01520 160834 161283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 161422 162693 gene locus_tag LOCUS_01530 161422 162693 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_01530 162694 163239 gene locus_tag LOCUS_01540 162694 163239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 163301 164626 gene locus_tag LOCUS_01550 163301 164626 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_01550 164630 165229 gene locus_tag LOCUS_01560 164630 165229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 165328 167262 gene locus_tag LOCUS_01570 165328 167262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 167333 167698 gene locus_tag LOCUS_01580 167333 167698 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855676.1 protein_id gnl|my_center|LOCUS_01580 167763 168389 gene locus_tag LOCUS_01590 167763 168389 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 protein_id gnl|my_center|LOCUS_01590 169264 168545 gene locus_tag LOCUS_01600 169264 168545 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 protein_id gnl|my_center|LOCUS_01600 170537 169257 gene locus_tag LOCUS_01610 170537 169257 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 protein_id gnl|my_center|LOCUS_01610 171576 170548 gene locus_tag LOCUS_01620 171576 170548 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013503.1 protein_id gnl|my_center|LOCUS_01620 173471 171633 gene locus_tag LOCUS_01630 gene leuA 173471 171633 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 protein_id gnl|my_center|LOCUS_01630 174822 173962 gene locus_tag LOCUS_01640 174822 173962 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 protein_id gnl|my_center|LOCUS_01640 174949 176214 gene locus_tag LOCUS_01650 174949 176214 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 protein_id gnl|my_center|LOCUS_01650 176239 177270 gene locus_tag LOCUS_01660 176239 177270 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 protein_id gnl|my_center|LOCUS_01660 177383 177868 gene locus_tag LOCUS_01670 177383 177868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 179310 177928 gene locus_tag LOCUS_01680 179310 177928 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 protein_id gnl|my_center|LOCUS_01680 179961 179416 gene locus_tag LOCUS_01690 179961 179416 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 protein_id gnl|my_center|LOCUS_01690 180115 181710 gene locus_tag LOCUS_01700 180115 181710 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013509.1 protein_id gnl|my_center|LOCUS_01700 182129 181785 gene locus_tag LOCUS_01710 182129 181785 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863340.1 protein_id gnl|my_center|LOCUS_01710 182395 182129 gene locus_tag LOCUS_01720 182395 182129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 182832 182398 gene locus_tag LOCUS_01730 182832 182398 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013518.1 protein_id gnl|my_center|LOCUS_01730 184364 182832 gene locus_tag LOCUS_01740 184364 182832 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 protein_id gnl|my_center|LOCUS_01740 184789 184361 gene locus_tag LOCUS_01750 184789 184361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 187701 184786 gene locus_tag LOCUS_01760 187701 184786 CDS product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 protein_id gnl|my_center|LOCUS_01760 187875 189239 gene locus_tag LOCUS_01770 187875 189239 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013522.1 protein_id gnl|my_center|LOCUS_01770 189409 189333 gene locus_tag LOCUS_t00100 189409 189333 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 190389 189487 gene locus_tag LOCUS_01780 190389 189487 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 protein_id gnl|my_center|LOCUS_01780 190425 190877 gene locus_tag LOCUS_01790 190425 190877 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 protein_id gnl|my_center|LOCUS_01790 193267 190874 gene locus_tag LOCUS_01800 193267 190874 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 protein_id gnl|my_center|LOCUS_01800 193482 193844 gene locus_tag LOCUS_01810 gene whcA 193482 193844 CDS product WhiB family transcriptional regulator WhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855789.1 protein_id gnl|my_center|LOCUS_01810 193883 194038 gene locus_tag LOCUS_01820 193883 194038 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 protein_id gnl|my_center|LOCUS_01820 194042 194524 gene locus_tag LOCUS_01830 194042 194524 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 protein_id gnl|my_center|LOCUS_01830 194583 195395 gene locus_tag LOCUS_01840 194583 195395 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 protein_id gnl|my_center|LOCUS_01840 196131 195448 gene locus_tag LOCUS_01850 196131 195448 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 protein_id gnl|my_center|LOCUS_01850 196429 197259 gene locus_tag LOCUS_01860 gene nth 196429 197259 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_01860 197261 197848 gene locus_tag LOCUS_01870 197261 197848 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013540.1 protein_id gnl|my_center|LOCUS_01870 197851 198564 gene locus_tag LOCUS_01880 197851 198564 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013541.1 protein_id gnl|my_center|LOCUS_01880 198621 199811 gene locus_tag LOCUS_01890 198621 199811 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 protein_id gnl|my_center|LOCUS_01890 200710 199808 gene locus_tag LOCUS_01900 200710 199808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013543.1 protein_id gnl|my_center|LOCUS_01900 201409 200813 gene locus_tag LOCUS_01910 201409 200813 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 protein_id gnl|my_center|LOCUS_01910 202431 201571 gene locus_tag LOCUS_01920 202431 201571 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 protein_id gnl|my_center|LOCUS_01920 202825 203865 gene locus_tag LOCUS_01930 202825 203865 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013546.1 protein_id gnl|my_center|LOCUS_01930 203862 204971 gene locus_tag LOCUS_01940 203862 204971 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013547.1 protein_id gnl|my_center|LOCUS_01940 204971 205741 gene locus_tag LOCUS_01950 204971 205741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 205738 206310 gene locus_tag LOCUS_01960 205738 206310 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013549.1 protein_id gnl|my_center|LOCUS_01960 206342 206575 gene locus_tag LOCUS_01970 206342 206575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 206575 206868 gene locus_tag LOCUS_01980 206575 206868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863285.1 protein_id gnl|my_center|LOCUS_01980 206868 207191 gene locus_tag LOCUS_01990 206868 207191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 209580 207145 gene locus_tag LOCUS_02000 209580 207145 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013550.1 protein_id gnl|my_center|LOCUS_02000 209748 209951 gene locus_tag LOCUS_02010 209748 209951 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 protein_id gnl|my_center|LOCUS_02010 210636 210010 gene locus_tag LOCUS_02020 210636 210010 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013527.1 protein_id gnl|my_center|LOCUS_02020 210863 213772 gene locus_tag LOCUS_02030 gene topA 210863 213772 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013552.1 protein_id gnl|my_center|LOCUS_02030 213769 214383 gene locus_tag LOCUS_02040 213769 214383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 214465 214812 gene locus_tag LOCUS_02050 214465 214812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02050 214975 215904 gene locus_tag LOCUS_02060 214975 215904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02060 217495 215969 gene locus_tag LOCUS_02070 217495 215969 CDS product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 protein_id gnl|my_center|LOCUS_02070 217568 218752 gene locus_tag LOCUS_02080 217568 218752 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 protein_id gnl|my_center|LOCUS_02080 218827 218902 gene locus_tag LOCUS_t00110 218827 218902 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 220063 221049 gene locus_tag LOCUS_02090 220063 221049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 221036 222301 gene locus_tag LOCUS_02100 221036 222301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 222306 222581 gene locus_tag LOCUS_02110 222306 222581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 222657 222893 gene locus_tag LOCUS_02120 222657 222893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 222890 223222 gene locus_tag LOCUS_02130 222890 223222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 223321 223698 gene locus_tag LOCUS_02140 223321 223698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 223689 224057 gene locus_tag LOCUS_02150 223689 224057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 224095 225111 gene locus_tag LOCUS_02160 224095 225111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 225255 226079 gene locus_tag LOCUS_02170 225255 226079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 226397 226131 gene locus_tag LOCUS_02180 226397 226131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02180 226991 226596 gene locus_tag LOCUS_02190 226991 226596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02190 227296 226988 gene locus_tag LOCUS_02200 227296 226988 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729538.1 protein_id gnl|my_center|LOCUS_02200 228233 227778 gene locus_tag LOCUS_02210 228233 227778 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_02210 229972 228296 gene locus_tag LOCUS_02220 229972 228296 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 protein_id gnl|my_center|LOCUS_02220 230195 231031 gene locus_tag LOCUS_02230 230195 231031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 231065 232156 gene locus_tag LOCUS_02240 231065 232156 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863269.1 protein_id gnl|my_center|LOCUS_02240 232161 232787 gene locus_tag LOCUS_02250 232161 232787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 protein_id gnl|my_center|LOCUS_02250 233740 233000 gene locus_tag LOCUS_02260 gene istB 233740 233000 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_02260 234026 233742 gene locus_tag LOCUS_02270 234026 233742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 235431 234082 gene locus_tag LOCUS_02280 235431 234082 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_02280 235952 235434 gene locus_tag LOCUS_02290 235952 235434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 236680 235895 gene locus_tag LOCUS_02300 236680 235895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02300 236948 237412 gene locus_tag LOCUS_02310 236948 237412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 239312 238167 gene locus_tag LOCUS_02320 239312 238167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 240070 239729 gene locus_tag LOCUS_02330 240070 239729 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013565.1 protein_id gnl|my_center|LOCUS_02330 240765 240067 gene locus_tag LOCUS_02340 240765 240067 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013566.1 protein_id gnl|my_center|LOCUS_02340 241603 240779 gene locus_tag LOCUS_02350 241603 240779 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209330306.1 protein_id gnl|my_center|LOCUS_02350 242478 241615 gene locus_tag LOCUS_02360 gene rfbA 242478 241615 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 protein_id gnl|my_center|LOCUS_02360 243810 242482 gene locus_tag LOCUS_02370 243810 242482 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013573.1 protein_id gnl|my_center|LOCUS_02370 244040 244552 gene locus_tag LOCUS_02380 244040 244552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 244846 245118 gene locus_tag LOCUS_02390 244846 245118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 245666 245121 gene locus_tag LOCUS_02400 245666 245121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 246290 245871 gene locus_tag LOCUS_02410 246290 245871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02410 246920 246327 gene locus_tag LOCUS_02420 246920 246327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 247771 247109 gene locus_tag LOCUS_02430 247771 247109 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015525.1 protein_id gnl|my_center|LOCUS_02430 249845 247824 gene locus_tag LOCUS_02440 249845 247824 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_02440 250345 250473 gene locus_tag LOCUS_02450 250345 250473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 251668 250541 gene locus_tag LOCUS_02460 251668 250541 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 protein_id gnl|my_center|LOCUS_02460 252387 251665 gene locus_tag LOCUS_02470 252387 251665 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015530.1 protein_id gnl|my_center|LOCUS_02470 252791 253366 gene locus_tag LOCUS_02480 252791 253366 CDS product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015531.1 protein_id gnl|my_center|LOCUS_02480 253805 254221 gene locus_tag LOCUS_02490 253805 254221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02490 254279 254920 gene locus_tag LOCUS_02500 254279 254920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02500 255070 255414 gene locus_tag LOCUS_02510 255070 255414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 255516 255821 gene locus_tag LOCUS_02520 255516 255821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 256366 256034 gene locus_tag LOCUS_02530 256366 256034 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_02530 256674 256931 gene locus_tag LOCUS_02540 256674 256931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 256943 257356 gene locus_tag LOCUS_02550 256943 257356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 257356 257808 gene locus_tag LOCUS_02560 257356 257808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 258017 258172 gene locus_tag LOCUS_02570 258017 258172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 259156 258179 gene locus_tag LOCUS_02580 gene rfbB 259156 258179 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855430.1 protein_id gnl|my_center|LOCUS_02580 260353 259175 gene locus_tag LOCUS_02590 260353 259175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013578.1 protein_id gnl|my_center|LOCUS_02590 261594 260350 gene locus_tag LOCUS_02600 261594 260350 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 protein_id gnl|my_center|LOCUS_02600 262764 261619 gene locus_tag LOCUS_02610 262764 261619 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_02610 264657 263209 gene locus_tag LOCUS_02620 264657 263209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 264858 266270 gene locus_tag LOCUS_02630 gene lpdA 264858 266270 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 protein_id gnl|my_center|LOCUS_02630 266801 266340 gene locus_tag LOCUS_02640 266801 266340 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 protein_id gnl|my_center|LOCUS_02640 268247 266844 gene locus_tag LOCUS_02650 gene ramB 268247 266844 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859703.1 protein_id gnl|my_center|LOCUS_02650 268617 269390 gene locus_tag LOCUS_02660 268617 269390 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_02660 269414 271510 gene locus_tag LOCUS_02670 269414 271510 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 protein_id gnl|my_center|LOCUS_02670 271510 272259 gene locus_tag LOCUS_02680 271510 272259 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 protein_id gnl|my_center|LOCUS_02680 272342 272713 gene locus_tag LOCUS_02690 272342 272713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013608.1 protein_id gnl|my_center|LOCUS_02690 272779 274062 gene locus_tag LOCUS_02700 272779 274062 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 protein_id gnl|my_center|LOCUS_02700 274101 274853 gene locus_tag LOCUS_02710 274101 274853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 274896 275213 gene locus_tag LOCUS_02720 274896 275213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 275219 275758 gene locus_tag LOCUS_02730 275219 275758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 276547 275771 gene locus_tag LOCUS_02740 276547 275771 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454126.1 protein_id gnl|my_center|LOCUS_02740 277368 276553 gene locus_tag LOCUS_02750 277368 276553 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013626.1 protein_id gnl|my_center|LOCUS_02750 277875 277378 gene locus_tag LOCUS_02760 277875 277378 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855491.1 protein_id gnl|my_center|LOCUS_02760 278127 277918 gene locus_tag LOCUS_02770 278127 277918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 278032 278904 gene locus_tag LOCUS_02780 278032 278904 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 protein_id gnl|my_center|LOCUS_02780 280613 278901 gene locus_tag LOCUS_02790 280613 278901 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_02790 282362 280659 gene locus_tag LOCUS_02800 282362 280659 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_02800 282490 283014 gene locus_tag LOCUS_02810 282490 283014 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_02810 284796 283078 gene locus_tag LOCUS_02820 284796 283078 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_02820 284997 285971 gene locus_tag LOCUS_02830 284997 285971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 285984 287258 gene locus_tag LOCUS_02840 gene mshA 285984 287258 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 protein_id gnl|my_center|LOCUS_02840 287285 288058 gene locus_tag LOCUS_02850 287285 288058 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 protein_id gnl|my_center|LOCUS_02850 288118 289362 gene locus_tag LOCUS_02860 288118 289362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 protein_id gnl|my_center|LOCUS_02860 289359 290048 gene locus_tag LOCUS_02870 gene regX 289359 290048 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_02870 290944 290045 gene locus_tag LOCUS_02880 290944 290045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013633.1 protein_id gnl|my_center|LOCUS_02880 291086 291946 gene locus_tag LOCUS_02890 291086 291946 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265553.1 protein_id gnl|my_center|LOCUS_02890 291946 292695 gene locus_tag LOCUS_02900 291946 292695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855504.1 protein_id gnl|my_center|LOCUS_02900 292720 293553 gene locus_tag LOCUS_02910 gene proC 292720 293553 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 protein_id gnl|my_center|LOCUS_02910 293756 293947 gene locus_tag LOCUS_02920 293756 293947 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 protein_id gnl|my_center|LOCUS_02920 295370 294318 gene locus_tag LOCUS_02930 295370 294318 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 protein_id gnl|my_center|LOCUS_02930 295456 295695 gene locus_tag LOCUS_02940 295456 295695 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 protein_id gnl|my_center|LOCUS_02940 295745 297070 gene locus_tag LOCUS_02950 295745 297070 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265556.1 protein_id gnl|my_center|LOCUS_02950 297070 297951 gene locus_tag LOCUS_02960 gene hemC 297070 297951 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 protein_id gnl|my_center|LOCUS_02960 298125 299834 gene locus_tag LOCUS_02970 298125 299834 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 protein_id gnl|my_center|LOCUS_02970 299887 300888 gene locus_tag LOCUS_02980 gene hemB 299887 300888 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 protein_id gnl|my_center|LOCUS_02980 300881 301483 gene locus_tag LOCUS_02990 300881 301483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 301491 301985 gene locus_tag LOCUS_03000 301491 301985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 301992 304562 gene locus_tag LOCUS_03010 301992 304562 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013648.1 protein_id gnl|my_center|LOCUS_03010 304623 305657 gene locus_tag LOCUS_03020 gene hemE 304623 305657 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 protein_id gnl|my_center|LOCUS_03020 305659 307035 gene locus_tag LOCUS_03030 305659 307035 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013650.1 protein_id gnl|my_center|LOCUS_03030 307042 307806 gene locus_tag LOCUS_03040 307042 307806 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856330.1 protein_id gnl|my_center|LOCUS_03040 307893 309035 gene locus_tag LOCUS_03050 307893 309035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 310266 309052 gene locus_tag LOCUS_03060 gene galK 310266 309052 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776399.1 protein_id gnl|my_center|LOCUS_03060 311348 310263 gene locus_tag LOCUS_03070 gene galT 311348 310263 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_03070 311229 311450 gene locus_tag LOCUS_03080 311229 311450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 311460 312776 gene locus_tag LOCUS_03090 gene hemL 311460 312776 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265562.1 protein_id gnl|my_center|LOCUS_03090 312773 313381 gene locus_tag LOCUS_03100 312773 313381 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039673525.1 protein_id gnl|my_center|LOCUS_03100 313382 313957 gene locus_tag LOCUS_03110 313382 313957 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 protein_id gnl|my_center|LOCUS_03110 313958 314740 gene locus_tag LOCUS_03120 313958 314740 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013652.1 protein_id gnl|my_center|LOCUS_03120 314760 316400 gene locus_tag LOCUS_03130 314760 316400 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 protein_id gnl|my_center|LOCUS_03130 316458 317477 gene locus_tag LOCUS_03140 gene ccsB 316458 317477 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 protein_id gnl|my_center|LOCUS_03140 317478 318476 gene locus_tag LOCUS_03150 gene galE 317478 318476 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_03150 318565 318810 gene locus_tag LOCUS_03160 318565 318810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 319097 318807 gene locus_tag LOCUS_03170 319097 318807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013657.1 protein_id gnl|my_center|LOCUS_03170 319152 319478 gene locus_tag LOCUS_03180 319152 319478 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082868777.1 protein_id gnl|my_center|LOCUS_03180 320427 319510 gene locus_tag LOCUS_03190 320427 319510 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 protein_id gnl|my_center|LOCUS_03190 320500 321348 gene locus_tag LOCUS_03200 320500 321348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855600.1 protein_id gnl|my_center|LOCUS_03200 321341 322648 gene locus_tag LOCUS_03210 321341 322648 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013686.1 protein_id gnl|my_center|LOCUS_03210 323714 322572 gene locus_tag LOCUS_03220 gene menE 323714 322572 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013660.1 protein_id gnl|my_center|LOCUS_03220 323793 325166 gene locus_tag LOCUS_03230 323793 325166 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731369.1 protein_id gnl|my_center|LOCUS_03230 326150 325224 gene locus_tag LOCUS_03240 326150 325224 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 protein_id gnl|my_center|LOCUS_03240 326555 327346 gene locus_tag LOCUS_03250 326555 327346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 328007 328267 gene locus_tag LOCUS_03260 328007 328267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 328270 330207 gene locus_tag LOCUS_03270 gene feoB 328270 330207 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_03270 330208 330468 gene locus_tag LOCUS_03280 330208 330468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 330710 330480 gene locus_tag LOCUS_03290 330710 330480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 330880 331299 gene locus_tag LOCUS_03300 330880 331299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 331302 331772 gene locus_tag LOCUS_03310 331302 331772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 332261 333421 gene locus_tag LOCUS_03320 332261 333421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 333669 335156 gene locus_tag LOCUS_03330 gene istA 333669 335156 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_03330 335158 335898 gene locus_tag LOCUS_03340 gene istB 335158 335898 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_03340 336245 336709 gene locus_tag LOCUS_03350 336245 336709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 336820 337257 gene locus_tag LOCUS_03360 336820 337257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 337261 338025 gene locus_tag LOCUS_03370 gene istB 337261 338025 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_03370 339475 338498 gene locus_tag LOCUS_03380 339475 338498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 343271 339489 gene locus_tag LOCUS_03390 343271 339489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 344174 343278 gene locus_tag LOCUS_03400 344174 343278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 345533 344229 gene locus_tag LOCUS_03410 345533 344229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 345787 346746 gene locus_tag LOCUS_03420 345787 346746 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 protein_id gnl|my_center|LOCUS_03420 346849 348429 gene locus_tag LOCUS_03430 346849 348429 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_03430 348435 349064 gene locus_tag LOCUS_03440 348435 349064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 349065 350678 gene locus_tag LOCUS_03450 gene menD 349065 350678 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013670.1 protein_id gnl|my_center|LOCUS_03450 350675 351082 gene locus_tag LOCUS_03460 350675 351082 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013671.1 protein_id gnl|my_center|LOCUS_03460 351144 352343 gene locus_tag LOCUS_03470 351144 352343 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 protein_id gnl|my_center|LOCUS_03470 352376 353065 gene locus_tag LOCUS_03480 352376 353065 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 protein_id gnl|my_center|LOCUS_03480 354285 353062 gene locus_tag LOCUS_03490 354285 353062 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 protein_id gnl|my_center|LOCUS_03490 354439 355455 gene locus_tag LOCUS_03500 354439 355455 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 protein_id gnl|my_center|LOCUS_03500 355530 355612 gene locus_tag LOCUS_t00120 355530 355612 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 355834 355907 gene locus_tag LOCUS_t00130 355834 355907 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 355938 356010 gene locus_tag LOCUS_t00140 355938 356010 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 356077 356152 gene locus_tag LOCUS_t00150 356077 356152 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 356177 356497 gene locus_tag LOCUS_03510 gene secE 356177 356497 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 protein_id gnl|my_center|LOCUS_03510 356638 357582 gene locus_tag LOCUS_03520 gene nusG 356638 357582 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013678.1 protein_id gnl|my_center|LOCUS_03520 357762 358190 gene locus_tag LOCUS_03530 gene rplK 357762 358190 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 protein_id gnl|my_center|LOCUS_03530 358268 358978 gene locus_tag LOCUS_03540 gene rplA 358268 358978 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 protein_id gnl|my_center|LOCUS_03540 359345 359866 gene locus_tag LOCUS_03550 gene rplJ 359345 359866 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 protein_id gnl|my_center|LOCUS_03550 359934 360323 gene locus_tag LOCUS_03560 gene rplL 359934 360323 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 protein_id gnl|my_center|LOCUS_03560 361142 360387 gene locus_tag LOCUS_03570 361142 360387 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015594.1 protein_id gnl|my_center|LOCUS_03570 361271 362767 gene locus_tag LOCUS_03580 361271 362767 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015326.1 protein_id gnl|my_center|LOCUS_03580 362829 363794 gene locus_tag LOCUS_03590 362829 363794 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512298.1 protein_id gnl|my_center|LOCUS_03590 364161 367640 gene locus_tag LOCUS_03600 364161 367640 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 protein_id gnl|my_center|LOCUS_03600 367749 371747 gene locus_tag LOCUS_03610 367749 371747 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013691.1 protein_id gnl|my_center|LOCUS_03610 371834 372265 gene locus_tag LOCUS_03620 371834 372265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080796943.1 protein_id gnl|my_center|LOCUS_03620 372507 372277 gene locus_tag LOCUS_03630 372507 372277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03630 373318 372653 gene locus_tag LOCUS_03640 373318 372653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 373623 373315 gene locus_tag LOCUS_03650 373623 373315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 374524 374874 gene locus_tag LOCUS_03660 374524 374874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 375239 374871 gene locus_tag LOCUS_03670 375239 374871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 376825 376544 gene locus_tag LOCUS_03680 376825 376544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 377575 378006 gene locus_tag LOCUS_03690 377575 378006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080796943.1 protein_id gnl|my_center|LOCUS_03690 378611 378018 gene locus_tag LOCUS_03700 378611 378018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 378808 379179 gene locus_tag LOCUS_03710 gene rpsL 378808 379179 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 protein_id gnl|my_center|LOCUS_03710 379186 379653 gene locus_tag LOCUS_03720 gene rpsG 379186 379653 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854222.1 protein_id gnl|my_center|LOCUS_03720 379952 382060 gene locus_tag LOCUS_03730 gene fusA 379952 382060 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 protein_id gnl|my_center|LOCUS_03730 382414 383604 gene locus_tag LOCUS_03740 gene tuf 382414 383604 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 protein_id gnl|my_center|LOCUS_03740 383672 384370 gene locus_tag LOCUS_03750 383672 384370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013697.1 protein_id gnl|my_center|LOCUS_03750 384936 384376 gene locus_tag LOCUS_03760 384936 384376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 385520 384933 gene locus_tag LOCUS_03770 385520 384933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 386214 385510 gene locus_tag LOCUS_03780 386214 385510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 386414 386214 gene locus_tag LOCUS_03790 386414 386214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 386745 386458 gene locus_tag LOCUS_03800 386745 386458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 387221 386763 gene locus_tag LOCUS_03810 387221 386763 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_03810 387735 388067 gene locus_tag LOCUS_03820 gene rpsJ 387735 388067 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854291.1 protein_id gnl|my_center|LOCUS_03820 388124 388780 gene locus_tag LOCUS_03830 gene rplC 388124 388780 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 protein_id gnl|my_center|LOCUS_03830 388777 389442 gene locus_tag LOCUS_03840 gene rplD 388777 389442 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 protein_id gnl|my_center|LOCUS_03840 389442 389747 gene locus_tag LOCUS_03850 gene rplW 389442 389747 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 protein_id gnl|my_center|LOCUS_03850 389773 390609 gene locus_tag LOCUS_03860 gene rplB 389773 390609 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 protein_id gnl|my_center|LOCUS_03860 390626 390901 gene locus_tag LOCUS_03870 gene rpsS 390626 390901 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 protein_id gnl|my_center|LOCUS_03870 390905 391264 gene locus_tag LOCUS_03880 gene rplV 390905 391264 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_03880 391264 392007 gene locus_tag LOCUS_03890 gene rpsC 391264 392007 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 protein_id gnl|my_center|LOCUS_03890 392011 392427 gene locus_tag LOCUS_03900 gene rplP 392011 392427 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 protein_id gnl|my_center|LOCUS_03900 392427 392657 gene locus_tag LOCUS_03910 gene rpmC 392427 392657 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 protein_id gnl|my_center|LOCUS_03910 392660 392959 gene locus_tag LOCUS_03920 gene rpsQ 392660 392959 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854306.1 protein_id gnl|my_center|LOCUS_03920 393140 395224 gene locus_tag LOCUS_03930 393140 395224 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_03930 396756 395221 gene locus_tag LOCUS_03940 396756 395221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 397693 396815 gene locus_tag LOCUS_03950 397693 396815 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_03950 397784 398977 gene locus_tag LOCUS_03960 gene scrB 397784 398977 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015273.1 protein_id gnl|my_center|LOCUS_03960 399776 398982 gene locus_tag LOCUS_03970 399776 398982 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254797.1 protein_id gnl|my_center|LOCUS_03970 399865 400113 gene locus_tag LOCUS_03980 399865 400113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03980 400322 401911 gene locus_tag LOCUS_03990 400322 401911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03990 401992 402360 gene locus_tag LOCUS_04000 gene rplN 401992 402360 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 protein_id gnl|my_center|LOCUS_04000 402363 402677 gene locus_tag LOCUS_04010 gene rplX 402363 402677 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 protein_id gnl|my_center|LOCUS_04010 402680 403258 gene locus_tag LOCUS_04020 gene rplE 402680 403258 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 protein_id gnl|my_center|LOCUS_04020 404490 403696 gene locus_tag LOCUS_04030 404490 403696 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081595.1 protein_id gnl|my_center|LOCUS_04030 404620 405567 gene locus_tag LOCUS_04040 404620 405567 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 protein_id gnl|my_center|LOCUS_04040 405574 406596 gene locus_tag LOCUS_04050 405574 406596 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_04050 406597 407628 gene locus_tag LOCUS_04060 406597 407628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 407607 408452 gene locus_tag LOCUS_04070 407607 408452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_04070 410806 408449 gene locus_tag LOCUS_04080 410806 408449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 412146 410803 gene locus_tag LOCUS_04090 412146 410803 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156270133.1 protein_id gnl|my_center|LOCUS_04090 413613 412162 gene locus_tag LOCUS_04100 gene desA 413613 412162 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_04100 414551 413691 gene locus_tag LOCUS_04110 gene fdhD 414551 413691 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_04110 415035 414556 gene locus_tag LOCUS_04120 415035 414556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 415054 415917 gene locus_tag LOCUS_04130 415054 415917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 416030 417646 gene locus_tag LOCUS_04140 416030 417646 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_04140 417788 419092 gene locus_tag LOCUS_04150 417788 419092 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_04150 419412 419810 gene locus_tag LOCUS_04160 gene rpsH 419412 419810 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_04160 419829 420365 gene locus_tag LOCUS_04170 gene rplF 419829 420365 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 protein_id gnl|my_center|LOCUS_04170 420368 420772 gene locus_tag LOCUS_04180 gene rplR 420368 420772 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 protein_id gnl|my_center|LOCUS_04180 420813 421445 gene locus_tag LOCUS_04190 gene rpsE 420813 421445 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 protein_id gnl|my_center|LOCUS_04190 421451 421636 gene locus_tag LOCUS_04200 gene rpmD 421451 421636 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_04200 421644 422210 gene locus_tag LOCUS_04210 gene rplO 421644 422210 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 protein_id gnl|my_center|LOCUS_04210 422449 423777 gene locus_tag LOCUS_04220 gene secY 422449 423777 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 protein_id gnl|my_center|LOCUS_04220 423777 424322 gene locus_tag LOCUS_04230 423777 424322 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 protein_id gnl|my_center|LOCUS_04230 424363 425154 gene locus_tag LOCUS_04240 gene map 424363 425154 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 protein_id gnl|my_center|LOCUS_04240 425042 426010 gene locus_tag LOCUS_04250 425042 426010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 426168 426386 gene locus_tag LOCUS_04260 gene infA 426168 426386 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 protein_id gnl|my_center|LOCUS_04260 426571 426939 gene locus_tag LOCUS_04270 gene rpsM 426571 426939 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 protein_id gnl|my_center|LOCUS_04270 426943 427347 gene locus_tag LOCUS_04280 gene rpsK 426943 427347 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 protein_id gnl|my_center|LOCUS_04280 427373 427978 gene locus_tag LOCUS_04290 gene rpsD 427373 427978 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 protein_id gnl|my_center|LOCUS_04290 428099 429112 gene locus_tag LOCUS_04300 428099 429112 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 protein_id gnl|my_center|LOCUS_04300 429158 429658 gene locus_tag LOCUS_04310 429158 429658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 429741 430637 gene locus_tag LOCUS_04320 gene truA 429741 430637 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 protein_id gnl|my_center|LOCUS_04320 430735 432879 gene locus_tag LOCUS_04330 430735 432879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013733.1 protein_id gnl|my_center|LOCUS_04330 432993 434264 gene locus_tag LOCUS_04340 gene eccB 432993 434264 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013736.1 protein_id gnl|my_center|LOCUS_04340 435396 434230 gene locus_tag LOCUS_04350 gene mycP 435396 434230 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013739.1 protein_id gnl|my_center|LOCUS_04350 436686 435397 gene locus_tag LOCUS_04360 436686 435397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 436870 440490 gene locus_tag LOCUS_04370 gene eccCa 436870 440490 CDS product type VII secretion protein EccCa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382017.1 protein_id gnl|my_center|LOCUS_04370 440487 441461 gene locus_tag LOCUS_04380 440487 441461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 441549 441860 gene locus_tag LOCUS_04390 441549 441860 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013743.1 protein_id gnl|my_center|LOCUS_04390 441914 442198 gene locus_tag LOCUS_04400 441914 442198 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854533.1 protein_id gnl|my_center|LOCUS_04400 442559 443002 gene locus_tag LOCUS_04410 gene rplM 442559 443002 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 protein_id gnl|my_center|LOCUS_04410 443002 443550 gene locus_tag LOCUS_04420 gene rpsI 443002 443550 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 protein_id gnl|my_center|LOCUS_04420 443687 445021 gene locus_tag LOCUS_04430 gene glmM 443687 445021 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 protein_id gnl|my_center|LOCUS_04430 445152 445466 gene locus_tag LOCUS_04440 445152 445466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 445466 447034 gene locus_tag LOCUS_04450 445466 447034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 447034 447309 gene locus_tag LOCUS_04460 447034 447309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 448121 447321 gene locus_tag LOCUS_04470 448121 447321 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 protein_id gnl|my_center|LOCUS_04470 448266 450137 gene locus_tag LOCUS_04480 gene glmS 448266 450137 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 protein_id gnl|my_center|LOCUS_04480 450150 450821 gene locus_tag LOCUS_04490 450150 450821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013979.1 protein_id gnl|my_center|LOCUS_04490 450846 451949 gene locus_tag LOCUS_04500 gene alr 450846 451949 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013748.1 protein_id gnl|my_center|LOCUS_04500 451467 451374 gene locus_tag LOCUS_t00160 451467 451374 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 451959 452450 gene locus_tag LOCUS_04510 gene tsaE 451959 452450 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854549.1 protein_id gnl|my_center|LOCUS_04510 452462 452968 gene locus_tag LOCUS_04520 452462 452968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 452965 453645 gene locus_tag LOCUS_04530 gene tsaB 452965 453645 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013751.1 protein_id gnl|my_center|LOCUS_04530 453642 454139 gene locus_tag LOCUS_04540 gene rimI 453642 454139 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 protein_id gnl|my_center|LOCUS_04540 454136 455182 gene locus_tag LOCUS_04550 gene tsaD 454136 455182 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 protein_id gnl|my_center|LOCUS_04550 455273 455749 gene locus_tag LOCUS_04560 455273 455749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860693.1 protein_id gnl|my_center|LOCUS_04560 455920 456219 gene locus_tag LOCUS_04570 gene groES 455920 456219 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 protein_id gnl|my_center|LOCUS_04570 456241 457851 gene locus_tag LOCUS_04580 gene groL 456241 457851 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 protein_id gnl|my_center|LOCUS_04580 458242 457943 gene locus_tag LOCUS_04590 gene whcB 458242 457943 CDS product WhiB family transcriptional regulator WhcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854562.1 protein_id gnl|my_center|LOCUS_04590 458621 459193 gene locus_tag LOCUS_04600 458621 459193 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013755.1 protein_id gnl|my_center|LOCUS_04600 459190 460029 gene locus_tag LOCUS_04610 459190 460029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013756.1 protein_id gnl|my_center|LOCUS_04610 460408 460037 gene locus_tag LOCUS_04620 460408 460037 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 protein_id gnl|my_center|LOCUS_04620 460559 462094 gene locus_tag LOCUS_04630 gene guaB 460559 462094 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 protein_id gnl|my_center|LOCUS_04630 462114 463268 gene locus_tag LOCUS_04640 462114 463268 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 protein_id gnl|my_center|LOCUS_04640 463279 464835 gene locus_tag LOCUS_04650 gene guaA 463279 464835 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 protein_id gnl|my_center|LOCUS_04650 465999 464875 gene locus_tag LOCUS_04660 gene esrI 465999 464875 CDS product two-component system EsrSR regulator EsrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013762.1 protein_id gnl|my_center|LOCUS_04660 466075 467253 gene locus_tag LOCUS_04670 gene esrS 466075 467253 CDS product two-component system sensor histidine kinase EsrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074469750.1 protein_id gnl|my_center|LOCUS_04670 469168 467237 gene locus_tag LOCUS_04680 469168 467237 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015121.1 protein_id gnl|my_center|LOCUS_04680 469295 471016 gene locus_tag LOCUS_04690 469295 471016 CDS product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015120.1 protein_id gnl|my_center|LOCUS_04690 471013 472008 gene locus_tag LOCUS_04700 471013 472008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015119.1 protein_id gnl|my_center|LOCUS_04700 472005 472865 gene locus_tag LOCUS_04710 472005 472865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863669.1 protein_id gnl|my_center|LOCUS_04710 472862 474484 gene locus_tag LOCUS_04720 472862 474484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015118.1 protein_id gnl|my_center|LOCUS_04720 474477 475709 gene locus_tag LOCUS_04730 474477 475709 CDS product alkylhydroperoxidase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015117.1 protein_id gnl|my_center|LOCUS_04730 475732 476382 gene locus_tag LOCUS_04740 gene esrR 475732 476382 CDS product two-component system response regulator EsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854586.1 protein_id gnl|my_center|LOCUS_04740 476506 477213 gene locus_tag LOCUS_04750 476506 477213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229209.1 protein_id gnl|my_center|LOCUS_04750 477215 478759 gene locus_tag LOCUS_04760 477215 478759 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013767.1 protein_id gnl|my_center|LOCUS_04760 479364 478765 gene locus_tag LOCUS_04770 479364 478765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 protein_id gnl|my_center|LOCUS_04770 479476 480390 gene locus_tag LOCUS_04780 479476 480390 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_04780 481078 480395 gene locus_tag LOCUS_04790 481078 480395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 protein_id gnl|my_center|LOCUS_04790 482103 481075 gene locus_tag LOCUS_04800 482103 481075 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 protein_id gnl|my_center|LOCUS_04800 482995 482105 gene locus_tag LOCUS_04810 482995 482105 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 protein_id gnl|my_center|LOCUS_04810 483913 483023 gene locus_tag LOCUS_04820 483913 483023 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 protein_id gnl|my_center|LOCUS_04820 484058 487186 gene locus_tag LOCUS_04830 484058 487186 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 protein_id gnl|my_center|LOCUS_04830 487845 488294 gene locus_tag LOCUS_04840 487845 488294 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 protein_id gnl|my_center|LOCUS_04840 488294 489595 gene locus_tag LOCUS_04850 488294 489595 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_04850 490043 489606 gene locus_tag LOCUS_04860 490043 489606 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 protein_id gnl|my_center|LOCUS_04860 490102 490950 gene locus_tag LOCUS_04870 490102 490950 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 protein_id gnl|my_center|LOCUS_04870 490943 491278 gene locus_tag LOCUS_04880 490943 491278 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013790.1 protein_id gnl|my_center|LOCUS_04880 493215 491275 gene locus_tag LOCUS_04890 493215 491275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 493521 493306 gene locus_tag LOCUS_04900 493521 493306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 493444 493704 gene locus_tag LOCUS_04910 493444 493704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 494621 493749 gene locus_tag LOCUS_04920 494621 493749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 496420 494621 gene locus_tag LOCUS_04930 496420 494621 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776772.1 protein_id gnl|my_center|LOCUS_04930 497505 496447 gene locus_tag LOCUS_04940 497505 496447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776773.1 protein_id gnl|my_center|LOCUS_04940 498573 497533 gene locus_tag LOCUS_04950 498573 497533 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776774.1 protein_id gnl|my_center|LOCUS_04950 500200 499097 gene locus_tag LOCUS_04960 500200 499097 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 protein_id gnl|my_center|LOCUS_04960 501560 500232 gene locus_tag LOCUS_04970 501560 500232 CDS product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 protein_id gnl|my_center|LOCUS_04970 501823 502431 gene locus_tag LOCUS_04980 501823 502431 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_04980 503174 502488 gene locus_tag LOCUS_04990 503174 502488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 504502 503174 gene locus_tag LOCUS_05000 504502 503174 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060595.1 protein_id gnl|my_center|LOCUS_05000 505332 504502 gene locus_tag LOCUS_05010 505332 504502 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635946.1 protein_id gnl|my_center|LOCUS_05010 506238 505336 gene locus_tag LOCUS_05020 506238 505336 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_05020 507317 506235 gene locus_tag LOCUS_05030 gene ugpC 507317 506235 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114066.1 protein_id gnl|my_center|LOCUS_05030 507899 508924 gene locus_tag LOCUS_05040 507899 508924 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930054.1 protein_id gnl|my_center|LOCUS_05040 511149 508933 gene locus_tag LOCUS_05050 511149 508933 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 protein_id gnl|my_center|LOCUS_05050 511268 512182 gene locus_tag LOCUS_05060 511268 512182 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860808.1 protein_id gnl|my_center|LOCUS_05060 512182 512988 gene locus_tag LOCUS_05070 512182 512988 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854700.1 protein_id gnl|my_center|LOCUS_05070 513065 514075 gene locus_tag LOCUS_05080 gene trpS 513065 514075 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 protein_id gnl|my_center|LOCUS_05080 514142 515236 gene locus_tag LOCUS_05090 514142 515236 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 protein_id gnl|my_center|LOCUS_05090 515361 516062 gene locus_tag LOCUS_05100 515361 516062 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_05100 517314 516076 gene locus_tag LOCUS_05110 517314 516076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 protein_id gnl|my_center|LOCUS_05110 518280 517345 gene locus_tag LOCUS_05120 518280 517345 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013812.1 protein_id gnl|my_center|LOCUS_05120 518732 518280 gene locus_tag LOCUS_05130 518732 518280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 518659 519294 gene locus_tag LOCUS_05140 gene upp 518659 519294 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 protein_id gnl|my_center|LOCUS_05140 519358 519822 gene locus_tag LOCUS_05150 519358 519822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 519866 521071 gene locus_tag LOCUS_05160 519866 521071 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 protein_id gnl|my_center|LOCUS_05160 521151 522557 gene locus_tag LOCUS_05170 521151 522557 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 protein_id gnl|my_center|LOCUS_05170 523931 522567 gene locus_tag LOCUS_05180 523931 522567 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013825.1 protein_id gnl|my_center|LOCUS_05180 524025 525536 gene locus_tag LOCUS_05190 524025 525536 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104208.1 protein_id gnl|my_center|LOCUS_05190 525536 526459 gene locus_tag LOCUS_05200 gene prpB 525536 526459 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265603.1 protein_id gnl|my_center|LOCUS_05200 526473 527621 gene locus_tag LOCUS_05210 526473 527621 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013797.1 protein_id gnl|my_center|LOCUS_05210 529325 527982 gene locus_tag LOCUS_05220 529325 527982 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_05220 529501 532911 gene locus_tag LOCUS_05230 529501 532911 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013816.1 protein_id gnl|my_center|LOCUS_05230 533126 532908 gene locus_tag LOCUS_05240 533126 532908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 535007 533253 gene locus_tag LOCUS_05250 535007 533253 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 protein_id gnl|my_center|LOCUS_05250 536002 535121 gene locus_tag LOCUS_05260 536002 535121 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013827.1 protein_id gnl|my_center|LOCUS_05260 536284 537345 gene locus_tag LOCUS_05270 536284 537345 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 protein_id gnl|my_center|LOCUS_05270 537360 539084 gene locus_tag LOCUS_05280 537360 539084 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775796.1 protein_id gnl|my_center|LOCUS_05280 539491 539093 gene locus_tag LOCUS_05290 539491 539093 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013829.1 protein_id gnl|my_center|LOCUS_05290 540652 540062 gene locus_tag LOCUS_05300 540652 540062 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 protein_id gnl|my_center|LOCUS_05300 540855 540652 gene locus_tag LOCUS_05310 540855 540652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 542382 540868 gene locus_tag LOCUS_05320 542382 540868 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 protein_id gnl|my_center|LOCUS_05320 543559 542507 gene locus_tag LOCUS_05330 543559 542507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 543738 545306 gene locus_tag LOCUS_05340 543738 545306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 545521 545733 gene locus_tag LOCUS_05350 545521 545733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 545730 546893 gene locus_tag LOCUS_05360 545730 546893 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014221.1 protein_id gnl|my_center|LOCUS_05360 546944 547870 gene locus_tag LOCUS_05370 546944 547870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 547959 551087 gene locus_tag LOCUS_05380 547959 551087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 560165 551211 gene locus_tag LOCUS_05390 560165 551211 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013920.1 protein_id gnl|my_center|LOCUS_05390 561830 560205 gene locus_tag LOCUS_05400 561830 560205 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013833.1 protein_id gnl|my_center|LOCUS_05400 561984 562379 gene locus_tag LOCUS_05410 561984 562379 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015166.1 protein_id gnl|my_center|LOCUS_05410 562464 562925 gene locus_tag LOCUS_05420 562464 562925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 562922 563941 gene locus_tag LOCUS_05430 gene nrdF 562922 563941 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776779.1 protein_id gnl|my_center|LOCUS_05430 563997 564740 gene locus_tag LOCUS_05440 563997 564740 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858258.1 protein_id gnl|my_center|LOCUS_05440 564761 565207 gene locus_tag LOCUS_05450 564761 565207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059288845.1 protein_id gnl|my_center|LOCUS_05450 565226 566404 gene locus_tag LOCUS_05460 565226 566404 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 protein_id gnl|my_center|LOCUS_05460 566407 566907 gene locus_tag LOCUS_05470 gene purE 566407 566907 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 protein_id gnl|my_center|LOCUS_05470 566900 567400 gene locus_tag LOCUS_05480 566900 567400 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013839.1 protein_id gnl|my_center|LOCUS_05480 567776 567585 gene locus_tag LOCUS_05490 567776 567585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 568613 567792 gene locus_tag LOCUS_05500 568613 567792 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 protein_id gnl|my_center|LOCUS_05500 569608 568610 gene locus_tag LOCUS_05510 569608 568610 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_05510 570957 569686 gene locus_tag LOCUS_05520 570957 569686 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_05520 571746 571078 gene locus_tag LOCUS_05530 571746 571078 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 protein_id gnl|my_center|LOCUS_05530 573337 571799 gene locus_tag LOCUS_05540 573337 571799 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 protein_id gnl|my_center|LOCUS_05540 573450 574391 gene locus_tag LOCUS_05550 573450 574391 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 protein_id gnl|my_center|LOCUS_05550 574397 575476 gene locus_tag LOCUS_05560 574397 575476 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 protein_id gnl|my_center|LOCUS_05560 575786 576085 gene locus_tag LOCUS_05570 575786 576085 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 protein_id gnl|my_center|LOCUS_05570 576575 576087 gene locus_tag LOCUS_05580 576575 576087 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283667.1 protein_id gnl|my_center|LOCUS_05580 576722 577138 gene locus_tag LOCUS_05590 576722 577138 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 protein_id gnl|my_center|LOCUS_05590 577149 578519 gene locus_tag LOCUS_05600 577149 578519 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 protein_id gnl|my_center|LOCUS_05600 578539 579501 gene locus_tag LOCUS_05610 578539 579501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863573.1 protein_id gnl|my_center|LOCUS_05610 579535 580716 gene locus_tag LOCUS_05620 gene manA 579535 580716 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 protein_id gnl|my_center|LOCUS_05620 581441 580731 gene locus_tag LOCUS_05630 581441 580731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 581698 582048 gene locus_tag LOCUS_05640 581698 582048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858196.1 protein_id gnl|my_center|LOCUS_05640 582226 583686 gene locus_tag LOCUS_05650 gene ahcY 582226 583686 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858195.1 protein_id gnl|my_center|LOCUS_05650 583693 584295 gene locus_tag LOCUS_05660 583693 584295 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 protein_id gnl|my_center|LOCUS_05660 584309 584992 gene locus_tag LOCUS_05670 gene mtrA 584309 584992 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 protein_id gnl|my_center|LOCUS_05670 585081 586613 gene locus_tag LOCUS_05680 gene mtrB 585081 586613 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458538.1 protein_id gnl|my_center|LOCUS_05680 586603 588312 gene locus_tag LOCUS_05690 gene lpqB 586603 588312 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 protein_id gnl|my_center|LOCUS_05690 588325 588930 gene locus_tag LOCUS_05700 588325 588930 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564913.1 protein_id gnl|my_center|LOCUS_05700 589028 589690 gene locus_tag LOCUS_05710 gene raiA 589028 589690 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858182.1 protein_id gnl|my_center|LOCUS_05710 589896 592445 gene locus_tag LOCUS_05720 gene secA 589896 592445 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 protein_id gnl|my_center|LOCUS_05720 592833 592462 gene locus_tag LOCUS_05730 592833 592462 CDS product Rv3235 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858177.1 protein_id gnl|my_center|LOCUS_05730 592981 593394 gene locus_tag LOCUS_05740 592981 593394 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 protein_id gnl|my_center|LOCUS_05740 593395 593892 gene locus_tag LOCUS_05750 593395 593892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 protein_id gnl|my_center|LOCUS_05750 594891 593866 gene locus_tag LOCUS_05760 gene rsgA 594891 593866 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 protein_id gnl|my_center|LOCUS_05760 596096 594897 gene locus_tag LOCUS_05770 gene aroA 596096 594897 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 protein_id gnl|my_center|LOCUS_05770 596193 596852 gene locus_tag LOCUS_05780 596193 596852 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511933.1 protein_id gnl|my_center|LOCUS_05780 597292 596825 gene locus_tag LOCUS_05790 gene ybaK 597292 596825 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728005.1 protein_id gnl|my_center|LOCUS_05790 597382 597990 gene locus_tag LOCUS_05800 597382 597990 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_05800 597990 598265 gene locus_tag LOCUS_05810 597990 598265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 598792 598535 gene locus_tag LOCUS_05820 gene whcE 598792 598535 CDS product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 protein_id gnl|my_center|LOCUS_05820 599269 599793 gene locus_tag LOCUS_05830 599269 599793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 601017 599800 gene locus_tag LOCUS_05840 601017 599800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 protein_id gnl|my_center|LOCUS_05840 602333 601014 gene locus_tag LOCUS_05850 602333 601014 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 protein_id gnl|my_center|LOCUS_05850 602481 602705 gene locus_tag LOCUS_05860 602481 602705 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416863.1 protein_id gnl|my_center|LOCUS_05860 602728 603642 gene locus_tag LOCUS_05870 602728 603642 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858148.1 protein_id gnl|my_center|LOCUS_05870 603665 604372 gene locus_tag LOCUS_05880 603665 604372 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858145.1 protein_id gnl|my_center|LOCUS_05880 604391 607459 gene locus_tag LOCUS_05890 604391 607459 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013879.1 protein_id gnl|my_center|LOCUS_05890 607452 610757 gene locus_tag LOCUS_05900 607452 610757 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 protein_id gnl|my_center|LOCUS_05900 610744 611886 gene locus_tag LOCUS_05910 610744 611886 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 protein_id gnl|my_center|LOCUS_05910 611898 613946 gene locus_tag LOCUS_05920 611898 613946 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013882.1 protein_id gnl|my_center|LOCUS_05920 614797 613961 gene locus_tag LOCUS_05930 614797 613961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013883.1 protein_id gnl|my_center|LOCUS_05930 614697 615380 gene locus_tag LOCUS_05940 614697 615380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 616780 615377 gene locus_tag LOCUS_05950 616780 615377 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 protein_id gnl|my_center|LOCUS_05950 616884 617975 gene locus_tag LOCUS_05960 616884 617975 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 protein_id gnl|my_center|LOCUS_05960 618634 617972 gene locus_tag LOCUS_05970 618634 617972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 619200 618676 gene locus_tag LOCUS_05980 619200 618676 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 protein_id gnl|my_center|LOCUS_05980 619345 622284 gene locus_tag LOCUS_05990 619345 622284 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 protein_id gnl|my_center|LOCUS_05990 622384 622458 gene locus_tag LOCUS_t00170 622384 622458 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 623465 622593 gene locus_tag LOCUS_06000 623465 622593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 625143 623794 gene locus_tag LOCUS_06010 625143 623794 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_06010 625397 625789 gene locus_tag LOCUS_06020 625397 625789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 625797 626150 gene locus_tag LOCUS_06030 625797 626150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 626449 626201 gene locus_tag LOCUS_06040 626449 626201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 626843 626664 gene locus_tag LOCUS_06050 626843 626664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 627147 628025 gene locus_tag LOCUS_06060 627147 628025 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_06060 628206 629111 gene locus_tag LOCUS_06070 628206 629111 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_06070 630010 629114 gene locus_tag LOCUS_06080 630010 629114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 630971 630048 gene locus_tag LOCUS_06090 630971 630048 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_06090 632314 631202 gene locus_tag LOCUS_06100 632314 631202 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 protein_id gnl|my_center|LOCUS_06100 632356 634170 gene locus_tag LOCUS_06110 632356 634170 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015032.1 protein_id gnl|my_center|LOCUS_06110 635345 634560 gene locus_tag LOCUS_06120 635345 634560 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 protein_id gnl|my_center|LOCUS_06120 635548 635345 gene locus_tag LOCUS_06130 gene thiS 635548 635345 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_06130 636650 635565 gene locus_tag LOCUS_06140 gene thiO 636650 635565 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 protein_id gnl|my_center|LOCUS_06140 637872 636715 gene locus_tag LOCUS_06150 637872 636715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013383.1 protein_id gnl|my_center|LOCUS_06150 638542 637865 gene locus_tag LOCUS_06160 638542 637865 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014839.1 protein_id gnl|my_center|LOCUS_06160 638822 638532 gene locus_tag LOCUS_06170 638822 638532 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_06170 640642 638843 gene locus_tag LOCUS_06180 gene thiC 640642 638843 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 protein_id gnl|my_center|LOCUS_06180 642058 640757 gene locus_tag LOCUS_06190 642058 640757 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 protein_id gnl|my_center|LOCUS_06190 642185 643279 gene locus_tag LOCUS_06200 642185 643279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 644159 643362 gene locus_tag LOCUS_06210 gene hisN 644159 643362 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 protein_id gnl|my_center|LOCUS_06210 644949 644152 gene locus_tag LOCUS_06220 644949 644152 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 protein_id gnl|my_center|LOCUS_06220 644948 646087 gene locus_tag LOCUS_06230 gene prfB 644948 646087 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 protein_id gnl|my_center|LOCUS_06230 647473 646145 gene locus_tag LOCUS_06240 647473 646145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931161.1 protein_id gnl|my_center|LOCUS_06240 647846 649408 gene locus_tag LOCUS_06250 647846 649408 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_06250 649411 649923 gene locus_tag LOCUS_06260 649411 649923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 649931 651298 gene locus_tag LOCUS_06270 gene accC 649931 651298 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_06270 652409 651315 gene locus_tag LOCUS_06280 652409 651315 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703349.1 protein_id gnl|my_center|LOCUS_06280 652673 654049 gene locus_tag LOCUS_06290 652673 654049 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081816.1 protein_id gnl|my_center|LOCUS_06290 654085 655317 gene locus_tag LOCUS_06300 654085 655317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 655364 656737 gene locus_tag LOCUS_06310 655364 656737 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731470.1 protein_id gnl|my_center|LOCUS_06310 656854 657546 gene locus_tag LOCUS_06320 gene ftsE 656854 657546 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 protein_id gnl|my_center|LOCUS_06320 657546 658448 gene locus_tag LOCUS_06330 gene ftsX 657546 658448 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 protein_id gnl|my_center|LOCUS_06330 658506 658961 gene locus_tag LOCUS_06340 gene smpB 658506 658961 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 protein_id gnl|my_center|LOCUS_06340 658958 659590 gene locus_tag LOCUS_06350 658958 659590 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_06350 659642 660019 gene locus_tag LOCUS_tm00010 659642 660019 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 660125 661114 gene locus_tag LOCUS_06360 660125 661114 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766375.1 protein_id gnl|my_center|LOCUS_06360 661242 662261 gene locus_tag LOCUS_06370 661242 662261 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013905.1 protein_id gnl|my_center|LOCUS_06370 662261 663226 gene locus_tag LOCUS_06380 662261 663226 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777017.1 protein_id gnl|my_center|LOCUS_06380 663216 664229 gene locus_tag LOCUS_06390 663216 664229 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863478.1 protein_id gnl|my_center|LOCUS_06390 664226 664981 gene locus_tag LOCUS_06400 664226 664981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013906.1 protein_id gnl|my_center|LOCUS_06400 665577 667088 gene locus_tag LOCUS_r00010 665577 667088 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 667444 670508 gene locus_tag LOCUS_r00020 667444 670508 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 670650 670754 gene locus_tag LOCUS_r00030 670650 670754 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 671121 670828 gene locus_tag LOCUS_06410 671121 670828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 671357 673183 gene locus_tag LOCUS_06420 671357 673183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 675381 673258 gene locus_tag LOCUS_06430 675381 673258 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014501.1 protein_id gnl|my_center|LOCUS_06430 676212 675556 gene locus_tag LOCUS_06440 676212 675556 CDS product DUF3239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013908.1 protein_id gnl|my_center|LOCUS_06440 677857 676223 gene locus_tag LOCUS_06450 677857 676223 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 protein_id gnl|my_center|LOCUS_06450 679183 677957 gene locus_tag LOCUS_06460 679183 677957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_06460 680073 679180 gene locus_tag LOCUS_06470 680073 679180 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_06470 682169 680148 gene locus_tag LOCUS_06480 682169 680148 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013909.1 protein_id gnl|my_center|LOCUS_06480 682223 682414 gene locus_tag LOCUS_06490 682223 682414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858306.1 protein_id gnl|my_center|LOCUS_06490 683128 682499 gene locus_tag LOCUS_06500 683128 682499 CDS product DUF3235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862355.1 protein_id gnl|my_center|LOCUS_06500 683536 683919 gene locus_tag LOCUS_06510 683536 683919 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 protein_id gnl|my_center|LOCUS_06510 684432 683935 gene locus_tag LOCUS_06520 684432 683935 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858312.1 protein_id gnl|my_center|LOCUS_06520 685228 684443 gene locus_tag LOCUS_06530 685228 684443 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 protein_id gnl|my_center|LOCUS_06530 685227 686000 gene locus_tag LOCUS_06540 685227 686000 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 protein_id gnl|my_center|LOCUS_06540 686739 686044 gene locus_tag LOCUS_06550 686739 686044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 686835 688292 gene locus_tag LOCUS_06560 686835 688292 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 protein_id gnl|my_center|LOCUS_06560 688289 689110 gene locus_tag LOCUS_06570 688289 689110 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 protein_id gnl|my_center|LOCUS_06570 689967 689107 gene locus_tag LOCUS_06580 689967 689107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 protein_id gnl|my_center|LOCUS_06580 690832 689978 gene locus_tag LOCUS_06590 gene sepH 690832 689978 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013912.1 protein_id gnl|my_center|LOCUS_06590 692040 690907 gene locus_tag LOCUS_06600 gene serC 692040 690907 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013913.1 protein_id gnl|my_center|LOCUS_06600 692294 693589 gene locus_tag LOCUS_06610 692294 693589 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 protein_id gnl|my_center|LOCUS_06610 693690 694049 gene locus_tag LOCUS_06620 gene fkpA 693690 694049 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 protein_id gnl|my_center|LOCUS_06620 694113 694946 gene locus_tag LOCUS_06630 694113 694946 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_06630 695151 695492 gene locus_tag LOCUS_06640 695151 695492 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013916.1 protein_id gnl|my_center|LOCUS_06640 695499 697154 gene locus_tag LOCUS_06650 695499 697154 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 protein_id gnl|my_center|LOCUS_06650 698039 697197 gene locus_tag LOCUS_06660 698039 697197 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013919.1 protein_id gnl|my_center|LOCUS_06660 698130 698921 gene locus_tag LOCUS_06670 gene panC 698130 698921 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092170.1 protein_id gnl|my_center|LOCUS_06670 699721 698918 gene locus_tag LOCUS_06680 gene panB 699721 698918 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411489.1 protein_id gnl|my_center|LOCUS_06680 701157 699757 gene locus_tag LOCUS_06690 701157 699757 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_06690 701231 702658 gene locus_tag LOCUS_06700 701231 702658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 702775 703653 gene locus_tag LOCUS_06710 702775 703653 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_06710 703917 704675 gene locus_tag LOCUS_06720 703917 704675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 707267 705819 gene locus_tag LOCUS_06730 707267 705819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028846.1 protein_id gnl|my_center|LOCUS_06730 707924 707851 gene locus_tag LOCUS_t00180 707924 707851 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 708181 707942 gene locus_tag LOCUS_06740 708181 707942 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013923.1 protein_id gnl|my_center|LOCUS_06740 708654 708178 gene locus_tag LOCUS_06750 708654 708178 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013924.1 protein_id gnl|my_center|LOCUS_06750 709448 708651 gene locus_tag LOCUS_06760 709448 708651 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 protein_id gnl|my_center|LOCUS_06760 710232 709459 gene locus_tag LOCUS_06770 710232 709459 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 protein_id gnl|my_center|LOCUS_06770 710253 714836 gene locus_tag LOCUS_06780 710253 714836 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013925.1 protein_id gnl|my_center|LOCUS_06780 714871 715662 gene locus_tag LOCUS_06790 714871 715662 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862398.1 protein_id gnl|my_center|LOCUS_06790 716260 715625 gene locus_tag LOCUS_06800 716260 715625 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013926.1 protein_id gnl|my_center|LOCUS_06800 717796 716309 gene locus_tag LOCUS_06810 717796 716309 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857678.1 protein_id gnl|my_center|LOCUS_06810 719435 717798 gene locus_tag LOCUS_06820 gene pgi 719435 717798 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 protein_id gnl|my_center|LOCUS_06820 719526 719822 gene locus_tag LOCUS_06830 719526 719822 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_06830 720124 719831 gene locus_tag LOCUS_06840 720124 719831 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 protein_id gnl|my_center|LOCUS_06840 720183 722495 gene locus_tag LOCUS_06850 gene pcrA 720183 722495 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013929.1 protein_id gnl|my_center|LOCUS_06850 723181 722492 gene locus_tag LOCUS_06860 723181 722492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 724182 723454 gene locus_tag LOCUS_06870 724182 723454 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 protein_id gnl|my_center|LOCUS_06870 724385 725812 gene locus_tag LOCUS_06880 724385 725812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 725870 726418 gene locus_tag LOCUS_06890 gene purN 725870 726418 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858391.1 protein_id gnl|my_center|LOCUS_06890 726415 727941 gene locus_tag LOCUS_06900 gene purH 726415 727941 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 protein_id gnl|my_center|LOCUS_06900 727946 728752 gene locus_tag LOCUS_06910 727946 728752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 729426 728749 gene locus_tag LOCUS_06920 gene amtR 729426 728749 CDS product TetR/AcrR family transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013937.1 protein_id gnl|my_center|LOCUS_06920 729829 729578 gene locus_tag LOCUS_06930 gene rpsR 729829 729578 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 protein_id gnl|my_center|LOCUS_06930 730151 729846 gene locus_tag LOCUS_06940 gene rpsN 730151 729846 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 protein_id gnl|my_center|LOCUS_06940 730319 730155 gene locus_tag LOCUS_06950 gene rpmG 730319 730155 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_06950 730555 730319 gene locus_tag LOCUS_06960 gene rpmB 730555 730319 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_06960 731738 730722 gene locus_tag LOCUS_06970 731738 730722 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_06970 732000 732272 gene locus_tag LOCUS_06980 732000 732272 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_06980 732306 732479 gene locus_tag LOCUS_06990 gene rpmF 732306 732479 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 protein_id gnl|my_center|LOCUS_06990 732584 733282 gene locus_tag LOCUS_07000 732584 733282 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013940.1 protein_id gnl|my_center|LOCUS_07000 733279 734664 gene locus_tag LOCUS_07010 733279 734664 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082904.1 protein_id gnl|my_center|LOCUS_07010 734741 735931 gene locus_tag LOCUS_07020 734741 735931 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 protein_id gnl|my_center|LOCUS_07020 736032 736601 gene locus_tag LOCUS_07030 736032 736601 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 protein_id gnl|my_center|LOCUS_07030 736598 736759 gene locus_tag LOCUS_07040 736598 736759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 737207 736770 gene locus_tag LOCUS_07050 gene mscL 737207 736770 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 protein_id gnl|my_center|LOCUS_07050 737912 737301 gene locus_tag LOCUS_07060 737912 737301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 738515 737940 gene locus_tag LOCUS_07070 738515 737940 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092258658.1 protein_id gnl|my_center|LOCUS_07070 738582 739538 gene locus_tag LOCUS_07080 738582 739538 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 protein_id gnl|my_center|LOCUS_07080 739595 740854 gene locus_tag LOCUS_07090 739595 740854 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858461.1 protein_id gnl|my_center|LOCUS_07090 740865 741524 gene locus_tag LOCUS_07100 740865 741524 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458539.1 protein_id gnl|my_center|LOCUS_07100 741637 742722 gene locus_tag LOCUS_07110 741637 742722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 protein_id gnl|my_center|LOCUS_07110 742820 742893 gene locus_tag LOCUS_t00190 742820 742893 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 743719 744339 gene locus_tag LOCUS_07120 743719 744339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 746478 744850 gene locus_tag LOCUS_07130 746478 744850 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_07130 747116 746514 gene locus_tag LOCUS_07140 747116 746514 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_07140 747170 747577 gene locus_tag LOCUS_07150 747170 747577 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_07150 747570 748196 gene locus_tag LOCUS_07160 747570 748196 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858471.1 protein_id gnl|my_center|LOCUS_07160 749785 748220 gene locus_tag LOCUS_07170 749785 748220 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 protein_id gnl|my_center|LOCUS_07170 749845 750705 gene locus_tag LOCUS_07180 gene rsmI 749845 750705 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 protein_id gnl|my_center|LOCUS_07180 750797 752527 gene locus_tag LOCUS_07190 gene betP 750797 752527 CDS product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 protein_id gnl|my_center|LOCUS_07190 752541 754421 gene locus_tag LOCUS_07200 gene metG 752541 754421 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013952.1 protein_id gnl|my_center|LOCUS_07200 754400 755593 gene locus_tag LOCUS_07210 754400 755593 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013946.1 protein_id gnl|my_center|LOCUS_07210 755735 756460 gene locus_tag LOCUS_07220 755735 756460 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014381.1 protein_id gnl|my_center|LOCUS_07220 756453 757460 gene locus_tag LOCUS_07230 gene phnD 756453 757460 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014380.1 protein_id gnl|my_center|LOCUS_07230 757477 758283 gene locus_tag LOCUS_07240 gene phnC 757477 758283 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014379.1 protein_id gnl|my_center|LOCUS_07240 758283 759092 gene locus_tag LOCUS_07250 gene phnE 758283 759092 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014378.1 protein_id gnl|my_center|LOCUS_07250 759093 759977 gene locus_tag LOCUS_07260 gene phnE 759093 759977 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014377.1 protein_id gnl|my_center|LOCUS_07260 759940 760749 gene locus_tag LOCUS_07270 759940 760749 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014376.1 protein_id gnl|my_center|LOCUS_07270 761140 760760 gene locus_tag LOCUS_07280 761140 760760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 761258 761974 gene locus_tag LOCUS_07290 761258 761974 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 protein_id gnl|my_center|LOCUS_07290 762109 763269 gene locus_tag LOCUS_07300 762109 763269 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 protein_id gnl|my_center|LOCUS_07300 763302 764153 gene locus_tag LOCUS_07310 gene rsmA 763302 764153 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 protein_id gnl|my_center|LOCUS_07310 764143 765123 gene locus_tag LOCUS_07320 764143 765123 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013967.1 protein_id gnl|my_center|LOCUS_07320 765207 767009 gene locus_tag LOCUS_07330 765207 767009 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 protein_id gnl|my_center|LOCUS_07330 768375 767026 gene locus_tag LOCUS_07340 768375 767026 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776842.1 protein_id gnl|my_center|LOCUS_07340 769890 768412 gene locus_tag LOCUS_07350 769890 768412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 770811 769993 gene locus_tag LOCUS_07360 770811 769993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 770938 772182 gene locus_tag LOCUS_07370 770938 772182 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 protein_id gnl|my_center|LOCUS_07370 772194 772976 gene locus_tag LOCUS_07380 772194 772976 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 protein_id gnl|my_center|LOCUS_07380 774723 772987 gene locus_tag LOCUS_07390 774723 772987 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255177.1 protein_id gnl|my_center|LOCUS_07390 776316 774766 gene locus_tag LOCUS_07400 776316 774766 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 protein_id gnl|my_center|LOCUS_07400 777074 776313 gene locus_tag LOCUS_07410 777074 776313 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_07410 777115 777552 gene locus_tag LOCUS_07420 777115 777552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 777605 778438 gene locus_tag LOCUS_07430 gene ppk2 777605 778438 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 protein_id gnl|my_center|LOCUS_07430 778995 778435 gene locus_tag LOCUS_07440 778995 778435 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 protein_id gnl|my_center|LOCUS_07440 779262 780221 gene locus_tag LOCUS_07450 779262 780221 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 protein_id gnl|my_center|LOCUS_07450 780356 781816 gene locus_tag LOCUS_07460 780356 781816 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 protein_id gnl|my_center|LOCUS_07460 782970 781813 gene locus_tag LOCUS_07470 782970 781813 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_07470 784167 782971 gene locus_tag LOCUS_07480 784167 782971 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393649.1 protein_id gnl|my_center|LOCUS_07480 784369 786021 gene locus_tag LOCUS_07490 784369 786021 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225738.1 protein_id gnl|my_center|LOCUS_07490 786051 786422 gene locus_tag LOCUS_07500 786051 786422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 787967 786999 gene locus_tag LOCUS_07510 787967 786999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 788102 788290 gene locus_tag LOCUS_07520 788102 788290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 789264 788287 gene locus_tag LOCUS_07530 789264 788287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 790148 789756 gene locus_tag LOCUS_07540 790148 789756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 790263 791783 gene locus_tag LOCUS_07550 790263 791783 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288051.1 protein_id gnl|my_center|LOCUS_07550 791816 792178 gene locus_tag LOCUS_07560 791816 792178 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090412.1 protein_id gnl|my_center|LOCUS_07560 792191 793336 gene locus_tag LOCUS_07570 792191 793336 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013999.1 protein_id gnl|my_center|LOCUS_07570 793381 794268 gene locus_tag LOCUS_07580 793381 794268 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014905.1 protein_id gnl|my_center|LOCUS_07580 794335 795207 gene locus_tag LOCUS_07590 794335 795207 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 protein_id gnl|my_center|LOCUS_07590 795401 796489 gene locus_tag LOCUS_07600 795401 796489 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855107.1 protein_id gnl|my_center|LOCUS_07600 798120 796486 gene locus_tag LOCUS_07610 798120 796486 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 protein_id gnl|my_center|LOCUS_07610 798695 798165 gene locus_tag LOCUS_07620 gene pth 798695 798165 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013986.1 protein_id gnl|my_center|LOCUS_07620 798813 799685 gene locus_tag LOCUS_07630 798813 799685 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013987.1 protein_id gnl|my_center|LOCUS_07630 800513 799689 gene locus_tag LOCUS_07640 800513 799689 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 protein_id gnl|my_center|LOCUS_07640 801083 800517 gene locus_tag LOCUS_07650 gene pth 801083 800517 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265655.1 protein_id gnl|my_center|LOCUS_07650 801769 801137 gene locus_tag LOCUS_07660 801769 801137 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 protein_id gnl|my_center|LOCUS_07660 803335 801965 gene locus_tag LOCUS_07670 803335 801965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 protein_id gnl|my_center|LOCUS_07670 803590 805062 gene locus_tag LOCUS_07680 803590 805062 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 protein_id gnl|my_center|LOCUS_07680 806098 805055 gene locus_tag LOCUS_07690 gene hisC 806098 805055 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 protein_id gnl|my_center|LOCUS_07690 807088 806111 gene locus_tag LOCUS_07700 807088 806111 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 protein_id gnl|my_center|LOCUS_07700 808536 807097 gene locus_tag LOCUS_07710 gene glmU 808536 807097 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 protein_id gnl|my_center|LOCUS_07710 809884 808637 gene locus_tag LOCUS_07720 809884 808637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_07720 810085 810013 gene locus_tag LOCUS_t00200 810085 810013 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 810180 810818 gene locus_tag LOCUS_07730 810180 810818 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 protein_id gnl|my_center|LOCUS_07730 810815 814429 gene locus_tag LOCUS_07740 gene mfd 810815 814429 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 protein_id gnl|my_center|LOCUS_07740 814474 814549 gene locus_tag LOCUS_t00210 814474 814549 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 814861 815889 gene locus_tag LOCUS_07750 814861 815889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 816006 816611 gene locus_tag LOCUS_07760 816006 816611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 816940 816773 gene locus_tag LOCUS_07770 816940 816773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 816879 818414 gene locus_tag LOCUS_07780 816879 818414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015026.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 819702 818425 gene locus_tag LOCUS_07790 819702 818425 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_07790 821310 819757 gene locus_tag LOCUS_07800 821310 819757 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 protein_id gnl|my_center|LOCUS_07800 822181 821303 gene locus_tag LOCUS_07810 822181 821303 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 protein_id gnl|my_center|LOCUS_07810 823214 822270 gene locus_tag LOCUS_07820 823214 822270 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_07820 823906 823226 gene locus_tag LOCUS_07830 823906 823226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 824547 823903 gene locus_tag LOCUS_07840 824547 823903 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 protein_id gnl|my_center|LOCUS_07840 825350 824544 gene locus_tag LOCUS_07850 825350 824544 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 protein_id gnl|my_center|LOCUS_07850 825581 826375 gene locus_tag LOCUS_07860 825581 826375 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 protein_id gnl|my_center|LOCUS_07860 826958 826449 gene locus_tag LOCUS_07870 826958 826449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 827541 827017 gene locus_tag LOCUS_07880 gene greA 827541 827017 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014029.1 protein_id gnl|my_center|LOCUS_07880 828159 827674 gene locus_tag LOCUS_07890 828159 827674 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 protein_id gnl|my_center|LOCUS_07890 828197 829168 gene locus_tag LOCUS_07900 gene mca 828197 829168 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 protein_id gnl|my_center|LOCUS_07900 829169 829462 gene locus_tag LOCUS_07910 829169 829462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856779.1 protein_id gnl|my_center|LOCUS_07910 829507 830277 gene locus_tag LOCUS_07920 829507 830277 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 protein_id gnl|my_center|LOCUS_07920 831330 830407 gene locus_tag LOCUS_07930 gene coaA 831330 830407 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 protein_id gnl|my_center|LOCUS_07930 831465 832757 gene locus_tag LOCUS_07940 gene glyA 831465 832757 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_07940 833134 832754 gene locus_tag LOCUS_07950 833134 832754 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 protein_id gnl|my_center|LOCUS_07950 833158 833775 gene locus_tag LOCUS_07960 833158 833775 CDS product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 protein_id gnl|my_center|LOCUS_07960 833845 834426 gene locus_tag LOCUS_07970 833845 834426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 834530 835066 gene locus_tag LOCUS_07980 834530 835066 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 protein_id gnl|my_center|LOCUS_07980 836604 835063 gene locus_tag LOCUS_07990 836604 835063 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 protein_id gnl|my_center|LOCUS_07990 837224 836598 gene locus_tag LOCUS_08000 837224 836598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 837800 837270 gene locus_tag LOCUS_08010 837800 837270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 839243 837843 gene locus_tag LOCUS_08020 839243 837843 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 protein_id gnl|my_center|LOCUS_08020 840349 839324 gene locus_tag LOCUS_08030 gene glpX 840349 839324 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 protein_id gnl|my_center|LOCUS_08030 840517 841089 gene locus_tag LOCUS_08040 840517 841089 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014052.1 protein_id gnl|my_center|LOCUS_08040 841411 841094 gene locus_tag LOCUS_08050 841411 841094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 842703 841447 gene locus_tag LOCUS_08060 gene xseA 842703 841447 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 protein_id gnl|my_center|LOCUS_08060 842838 843791 gene locus_tag LOCUS_08070 842838 843791 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 protein_id gnl|my_center|LOCUS_08070 844433 843804 gene locus_tag LOCUS_08080 844433 843804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 845530 844472 gene locus_tag LOCUS_08090 845530 844472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 846942 845560 gene locus_tag LOCUS_08100 846942 845560 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014057.1 protein_id gnl|my_center|LOCUS_08100 847036 848121 gene locus_tag LOCUS_08110 gene ychF 847036 848121 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 protein_id gnl|my_center|LOCUS_08110 850287 848395 gene locus_tag LOCUS_08120 850287 848395 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 protein_id gnl|my_center|LOCUS_08120 850643 850284 gene locus_tag LOCUS_08130 850643 850284 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_08130 851164 852240 gene locus_tag LOCUS_08140 851164 852240 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905613.1 protein_id gnl|my_center|LOCUS_08140 852770 852243 gene locus_tag LOCUS_08150 852770 852243 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 protein_id gnl|my_center|LOCUS_08150 853023 852862 gene locus_tag LOCUS_08160 853023 852862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 853177 854664 gene locus_tag LOCUS_08170 853177 854664 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015494.1 protein_id gnl|my_center|LOCUS_08170 855153 854668 gene locus_tag LOCUS_08180 855153 854668 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888981.1 protein_id gnl|my_center|LOCUS_08180 855877 855113 gene locus_tag LOCUS_08190 855877 855113 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_08190 855890 856324 gene locus_tag LOCUS_08200 855890 856324 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_08200 857774 856332 gene locus_tag LOCUS_08210 857774 856332 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 protein_id gnl|my_center|LOCUS_08210 859086 857785 gene locus_tag LOCUS_08220 859086 857785 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043078436.1 protein_id gnl|my_center|LOCUS_08220 860117 859152 gene locus_tag LOCUS_08230 860117 859152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 860706 860272 gene locus_tag LOCUS_08240 860706 860272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 861736 860822 gene locus_tag LOCUS_08250 861736 860822 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 protein_id gnl|my_center|LOCUS_08250 862070 863683 gene locus_tag LOCUS_08260 862070 863683 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_08260 863796 864722 gene locus_tag LOCUS_08270 863796 864722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_08270 864715 865689 gene locus_tag LOCUS_08280 864715 865689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_08280 865686 867389 gene locus_tag LOCUS_08290 865686 867389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014807.1 protein_id gnl|my_center|LOCUS_08290 867953 867417 gene locus_tag LOCUS_08300 867953 867417 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 protein_id gnl|my_center|LOCUS_08300 868627 867956 gene locus_tag LOCUS_08310 868627 867956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014120.1 protein_id gnl|my_center|LOCUS_08310 868731 870746 gene locus_tag LOCUS_08320 gene typA 868731 870746 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014121.1 protein_id gnl|my_center|LOCUS_08320 870758 872365 gene locus_tag LOCUS_08330 870758 872365 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569582.1 protein_id gnl|my_center|LOCUS_08330 872396 873274 gene locus_tag LOCUS_08340 gene mshB 872396 873274 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 protein_id gnl|my_center|LOCUS_08340 873286 873648 gene locus_tag LOCUS_08350 873286 873648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858629.1 protein_id gnl|my_center|LOCUS_08350 873661 873984 gene locus_tag LOCUS_08360 873661 873984 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 protein_id gnl|my_center|LOCUS_08360 874012 875130 gene locus_tag LOCUS_08370 gene dapC 874012 875130 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_08370 875172 875762 gene locus_tag LOCUS_08380 875172 875762 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 protein_id gnl|my_center|LOCUS_08380 876753 875788 gene locus_tag LOCUS_08390 gene dapD 876753 875788 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_08390 878172 876772 gene locus_tag LOCUS_08400 gene aroP 878172 876772 CDS product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 protein_id gnl|my_center|LOCUS_08400 879587 878169 gene locus_tag LOCUS_08410 gene aroP 879587 878169 CDS product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 protein_id gnl|my_center|LOCUS_08410 880677 879661 gene locus_tag LOCUS_08420 880677 879661 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014126.1 protein_id gnl|my_center|LOCUS_08420 880709 881809 gene locus_tag LOCUS_08430 gene dapE 880709 881809 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014127.1 protein_id gnl|my_center|LOCUS_08430 881849 882655 gene locus_tag LOCUS_08440 881849 882655 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 protein_id gnl|my_center|LOCUS_08440 882656 883483 gene locus_tag LOCUS_08450 gene folP 882656 883483 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 protein_id gnl|my_center|LOCUS_08450 883480 884214 gene locus_tag LOCUS_08460 883480 884214 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855018.1 protein_id gnl|my_center|LOCUS_08460 884218 884661 gene locus_tag LOCUS_08470 884218 884661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 884639 884773 gene locus_tag LOCUS_08480 884639 884773 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855015.1 protein_id gnl|my_center|LOCUS_08480 884810 885667 gene locus_tag LOCUS_08490 884810 885667 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_08490 887084 885681 gene locus_tag LOCUS_08500 887084 885681 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014131.1 protein_id gnl|my_center|LOCUS_08500 888239 887100 gene locus_tag LOCUS_08510 gene glgA 888239 887100 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 protein_id gnl|my_center|LOCUS_08510 888358 889575 gene locus_tag LOCUS_08520 gene glgC 888358 889575 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 protein_id gnl|my_center|LOCUS_08520 890250 889576 gene locus_tag LOCUS_08530 890250 889576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 890368 891009 gene locus_tag LOCUS_08540 gene sigE 890368 891009 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 protein_id gnl|my_center|LOCUS_08540 891112 891492 gene locus_tag LOCUS_08550 gene rseA 891112 891492 CDS product anti-sigma E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088067.1 protein_id gnl|my_center|LOCUS_08550 891503 891916 gene locus_tag LOCUS_08560 891503 891916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 893001 891913 gene locus_tag LOCUS_08570 893001 891913 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 protein_id gnl|my_center|LOCUS_08570 893188 893718 gene locus_tag LOCUS_08580 893188 893718 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_08580 893753 894475 gene locus_tag LOCUS_08590 893753 894475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 898337 894579 gene locus_tag LOCUS_08600 898337 894579 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 protein_id gnl|my_center|LOCUS_08600 902028 898462 gene locus_tag LOCUS_08610 902028 898462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014139.1 protein_id gnl|my_center|LOCUS_08610 903043 902108 gene locus_tag LOCUS_08620 903043 902108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 903189 904766 gene locus_tag LOCUS_08630 903189 904766 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854963.1 protein_id gnl|my_center|LOCUS_08630 904887 905795 gene locus_tag LOCUS_08640 904887 905795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 protein_id gnl|my_center|LOCUS_08640 906255 905803 gene locus_tag LOCUS_08650 906255 905803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014145.1 protein_id gnl|my_center|LOCUS_08650 906367 907572 gene locus_tag LOCUS_08660 906367 907572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_08660 907590 908579 gene locus_tag LOCUS_08670 907590 908579 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015421.1 protein_id gnl|my_center|LOCUS_08670 908664 909446 gene locus_tag LOCUS_08680 908664 909446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015419.1 protein_id gnl|my_center|LOCUS_08680 909443 910120 gene locus_tag LOCUS_08690 909443 910120 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015418.1 protein_id gnl|my_center|LOCUS_08690 910111 911247 gene locus_tag LOCUS_08700 910111 911247 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853505.1 protein_id gnl|my_center|LOCUS_08700 913306 911252 gene locus_tag LOCUS_08710 913306 911252 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013569.1 protein_id gnl|my_center|LOCUS_08710 914352 913444 gene locus_tag LOCUS_08720 914352 913444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 915408 914380 gene locus_tag LOCUS_08730 915408 914380 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 protein_id gnl|my_center|LOCUS_08730 915581 917572 gene locus_tag LOCUS_08740 915581 917572 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 protein_id gnl|my_center|LOCUS_08740 917624 918448 gene locus_tag LOCUS_08750 917624 918448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 919039 918551 gene locus_tag LOCUS_08760 919039 918551 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073069.1 protein_id gnl|my_center|LOCUS_08760 919685 919050 gene locus_tag LOCUS_08770 919685 919050 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014166.1 protein_id gnl|my_center|LOCUS_08770 921275 919692 gene locus_tag LOCUS_08780 gene putP 921275 919692 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 protein_id gnl|my_center|LOCUS_08780 921379 924342 gene locus_tag LOCUS_08790 921379 924342 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014168.1 protein_id gnl|my_center|LOCUS_08790 924342 925154 gene locus_tag LOCUS_08800 924342 925154 CDS product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 protein_id gnl|my_center|LOCUS_08800 925222 926355 gene locus_tag LOCUS_08810 925222 926355 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014169.1 protein_id gnl|my_center|LOCUS_08810 926359 929004 gene locus_tag LOCUS_08820 926359 929004 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 protein_id gnl|my_center|LOCUS_08820 929088 929552 gene locus_tag LOCUS_08830 gene rosR 929088 929552 CDS product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 protein_id gnl|my_center|LOCUS_08830 929690 929914 gene locus_tag LOCUS_08840 929690 929914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 931646 929955 gene locus_tag LOCUS_08850 931646 929955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 932309 931749 gene locus_tag LOCUS_08860 932309 931749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 932896 932561 gene locus_tag LOCUS_08870 932896 932561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 933138 932944 gene locus_tag LOCUS_08880 933138 932944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 933664 933945 gene locus_tag LOCUS_08890 933664 933945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 933969 934817 gene locus_tag LOCUS_08900 933969 934817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08900 934956 935390 gene locus_tag LOCUS_08910 934956 935390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 935929 935663 gene locus_tag LOCUS_08920 935929 935663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 935977 936486 gene locus_tag LOCUS_08930 935977 936486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 936686 936967 gene locus_tag LOCUS_08940 936686 936967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08940 937241 937630 gene locus_tag LOCUS_08950 937241 937630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 937801 938265 gene locus_tag LOCUS_08960 937801 938265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 938438 939652 gene locus_tag LOCUS_08970 938438 939652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 939656 940420 gene locus_tag LOCUS_08980 gene istB 939656 940420 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_08980 941237 940788 gene locus_tag LOCUS_08990 941237 940788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08990 941710 941399 gene locus_tag LOCUS_09000 941710 941399 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_09000 941807 942589 gene locus_tag LOCUS_09010 941807 942589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 943155 943514 gene locus_tag LOCUS_09020 943155 943514 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_09020 943511 944113 gene locus_tag LOCUS_09030 943511 944113 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_09030 944287 944433 gene locus_tag LOCUS_09040 944287 944433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 944399 945109 gene locus_tag LOCUS_09050 944399 945109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 945220 945429 gene locus_tag LOCUS_09060 945220 945429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09060 945778 945704 gene locus_tag LOCUS_t00220 945778 945704 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 947494 945857 gene locus_tag LOCUS_09070 947494 945857 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014178.1 protein_id gnl|my_center|LOCUS_09070 948252 947617 gene locus_tag LOCUS_09080 948252 947617 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804907.1 protein_id gnl|my_center|LOCUS_09080 949771 948254 gene locus_tag LOCUS_09090 949771 948254 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_09090 950553 949768 gene locus_tag LOCUS_09100 950553 949768 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_09100 950699 952351 gene locus_tag LOCUS_09110 gene argS 950699 952351 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 protein_id gnl|my_center|LOCUS_09110 952355 953764 gene locus_tag LOCUS_09120 gene lysA 952355 953764 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 protein_id gnl|my_center|LOCUS_09120 953840 955192 gene locus_tag LOCUS_09130 953840 955192 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 protein_id gnl|my_center|LOCUS_09130 955195 956124 gene locus_tag LOCUS_09140 gene thrB 955195 956124 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 protein_id gnl|my_center|LOCUS_09140 957956 956196 gene locus_tag LOCUS_09150 957956 956196 CDS product long-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854869.1 protein_id gnl|my_center|LOCUS_09150 958349 960190 gene locus_tag LOCUS_09160 958349 960190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09160 960190 961284 gene locus_tag LOCUS_09170 gene prfA 960190 961284 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 protein_id gnl|my_center|LOCUS_09170 961271 962122 gene locus_tag LOCUS_09180 gene prmC 961271 962122 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 protein_id gnl|my_center|LOCUS_09180 962153 962812 gene locus_tag LOCUS_09190 962153 962812 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 protein_id gnl|my_center|LOCUS_09190 962813 963976 gene locus_tag LOCUS_09200 962813 963976 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 protein_id gnl|my_center|LOCUS_09200 964638 963973 gene locus_tag LOCUS_09210 964638 963973 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776232.1 protein_id gnl|my_center|LOCUS_09210 964723 965217 gene locus_tag LOCUS_09220 964723 965217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 protein_id gnl|my_center|LOCUS_09220 965419 966300 gene locus_tag LOCUS_09230 gene atpB 965419 966300 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 protein_id gnl|my_center|LOCUS_09230 966407 966652 gene locus_tag LOCUS_09240 966407 966652 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_09240 966700 967269 gene locus_tag LOCUS_09250 966700 967269 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 protein_id gnl|my_center|LOCUS_09250 967275 968108 gene locus_tag LOCUS_09260 967275 968108 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 protein_id gnl|my_center|LOCUS_09260 968150 969790 gene locus_tag LOCUS_09270 gene atpA 968150 969790 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 protein_id gnl|my_center|LOCUS_09270 969838 970812 gene locus_tag LOCUS_09280 969838 970812 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 protein_id gnl|my_center|LOCUS_09280 970816 972285 gene locus_tag LOCUS_09290 gene atpD 970816 972285 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 protein_id gnl|my_center|LOCUS_09290 972296 972667 gene locus_tag LOCUS_09300 972296 972667 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 protein_id gnl|my_center|LOCUS_09300 972895 973359 gene locus_tag LOCUS_09310 972895 973359 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854831.1 protein_id gnl|my_center|LOCUS_09310 973470 974081 gene locus_tag LOCUS_09320 gene nucS 973470 974081 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 protein_id gnl|my_center|LOCUS_09320 974085 974372 gene locus_tag LOCUS_09330 974085 974372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014206.1 protein_id gnl|my_center|LOCUS_09330 974383 974691 gene locus_tag LOCUS_09340 974383 974691 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 protein_id gnl|my_center|LOCUS_09340 974696 975544 gene locus_tag LOCUS_09350 974696 975544 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014209.1 protein_id gnl|my_center|LOCUS_09350 977750 975552 gene locus_tag LOCUS_09360 gene glgB 977750 975552 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 protein_id gnl|my_center|LOCUS_09360 979840 977810 gene locus_tag LOCUS_09370 979840 977810 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014215.1 protein_id gnl|my_center|LOCUS_09370 979967 980854 gene locus_tag LOCUS_09380 979967 980854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 protein_id gnl|my_center|LOCUS_09380 980910 981737 gene locus_tag LOCUS_09390 980910 981737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854804.1 protein_id gnl|my_center|LOCUS_09390 981727 982878 gene locus_tag LOCUS_09400 981727 982878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 protein_id gnl|my_center|LOCUS_09400 983746 984882 gene locus_tag LOCUS_09410 983746 984882 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 protein_id gnl|my_center|LOCUS_09410 984938 985987 gene locus_tag LOCUS_09420 984938 985987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 986831 986004 gene locus_tag LOCUS_09430 986831 986004 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_09430 986848 987909 gene locus_tag LOCUS_09440 gene mnmA 986848 987909 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861382.1 protein_id gnl|my_center|LOCUS_09440 987931 988800 gene locus_tag LOCUS_09450 987931 988800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014226.1 protein_id gnl|my_center|LOCUS_09450 989480 988809 gene locus_tag LOCUS_09460 989480 988809 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 protein_id gnl|my_center|LOCUS_09460 989455 991554 gene locus_tag LOCUS_09470 gene ligA 989455 991554 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014227.1 protein_id gnl|my_center|LOCUS_09470 991789 991523 gene locus_tag LOCUS_09480 991789 991523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 992805 991786 gene locus_tag LOCUS_09490 992805 991786 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015101.1 protein_id gnl|my_center|LOCUS_09490 993302 992805 gene locus_tag LOCUS_09500 993302 992805 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015100.1 protein_id gnl|my_center|LOCUS_09500 994023 993355 gene locus_tag LOCUS_09510 994023 993355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 protein_id gnl|my_center|LOCUS_09510 994144 994467 gene locus_tag LOCUS_09520 gene gatC 994144 994467 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 protein_id gnl|my_center|LOCUS_09520 994471 995958 gene locus_tag LOCUS_09530 gene gatA 994471 995958 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 protein_id gnl|my_center|LOCUS_09530 995988 997028 gene locus_tag LOCUS_09540 995988 997028 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 protein_id gnl|my_center|LOCUS_09540 997160 997720 gene locus_tag LOCUS_09550 997160 997720 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854745.1 protein_id gnl|my_center|LOCUS_09550 997792 999297 gene locus_tag LOCUS_09560 gene gatB 997792 999297 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 protein_id gnl|my_center|LOCUS_09560 1000793 999369 gene locus_tag LOCUS_09570 1000793 999369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 protein_id gnl|my_center|LOCUS_09570 1000969 1001769 gene locus_tag LOCUS_09580 1000969 1001769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1003629 1001791 gene locus_tag LOCUS_09590 gene ilvD 1003629 1001791 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 protein_id gnl|my_center|LOCUS_09590 1004184 1003633 gene locus_tag LOCUS_09600 1004184 1003633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1005779 1004190 gene locus_tag LOCUS_09610 1005779 1004190 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096455574.1 protein_id gnl|my_center|LOCUS_09610 1006020 1007876 gene locus_tag LOCUS_09620 1006020 1007876 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 protein_id gnl|my_center|LOCUS_09620 1007880 1008398 gene locus_tag LOCUS_09630 gene ilvN 1007880 1008398 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286979.1 protein_id gnl|my_center|LOCUS_09630 1008492 1009508 gene locus_tag LOCUS_09640 gene ilvC 1008492 1009508 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854117.1 protein_id gnl|my_center|LOCUS_09640 1009633 1010556 gene locus_tag LOCUS_09650 1009633 1010556 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 protein_id gnl|my_center|LOCUS_09650 1010578 1012416 gene locus_tag LOCUS_09660 1010578 1012416 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014255.1 protein_id gnl|my_center|LOCUS_09660 1012385 1013251 gene locus_tag LOCUS_09670 1012385 1013251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09670 1013360 1014943 gene locus_tag LOCUS_09680 gene serA 1013360 1014943 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854094.1 protein_id gnl|my_center|LOCUS_09680 1015208 1016224 gene locus_tag LOCUS_09690 1015208 1016224 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 protein_id gnl|my_center|LOCUS_09690 1016301 1017779 gene locus_tag LOCUS_09700 1016301 1017779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1017820 1019682 gene locus_tag LOCUS_09710 1017820 1019682 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 protein_id gnl|my_center|LOCUS_09710 1019683 1020246 gene locus_tag LOCUS_09720 1019683 1020246 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 protein_id gnl|my_center|LOCUS_09720 1020307 1021065 gene locus_tag LOCUS_09730 1020307 1021065 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 protein_id gnl|my_center|LOCUS_09730 1022222 1021113 gene locus_tag LOCUS_09740 1022222 1021113 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 protein_id gnl|my_center|LOCUS_09740 1023634 1022300 gene locus_tag LOCUS_09750 1023634 1022300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1024479 1023631 gene locus_tag LOCUS_09760 1024479 1023631 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_09760 1025225 1024479 gene locus_tag LOCUS_09770 1025225 1024479 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_09770 1026127 1025222 gene locus_tag LOCUS_09780 1026127 1025222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1027594 1026167 gene locus_tag LOCUS_09790 1027594 1026167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1029030 1027606 gene locus_tag LOCUS_09800 1029030 1027606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1030854 1029169 gene locus_tag LOCUS_09810 1030854 1029169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1031892 1030999 gene locus_tag LOCUS_09820 1031892 1030999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1032030 1033613 gene locus_tag LOCUS_09830 gene gltX 1032030 1033613 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447895.1 protein_id gnl|my_center|LOCUS_09830 1033749 1033821 gene locus_tag LOCUS_t00230 1033749 1033821 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1033845 1033918 gene locus_tag LOCUS_t00240 1033845 1033918 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1034522 1034040 gene locus_tag LOCUS_09840 1034522 1034040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1034852 1036201 gene locus_tag LOCUS_09850 1034852 1036201 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_09850 1036423 1036614 gene locus_tag LOCUS_09860 1036423 1036614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1037427 1036687 gene locus_tag LOCUS_09870 gene istB 1037427 1036687 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_09870 1037713 1037429 gene locus_tag LOCUS_09880 1037713 1037429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1039129 1037780 gene locus_tag LOCUS_09890 1039129 1037780 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_09890 1039756 1039160 gene locus_tag LOCUS_09900 1039756 1039160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 1040366 1039701 gene locus_tag LOCUS_09910 1040366 1039701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09910 1040624 1041832 gene locus_tag LOCUS_09920 1040624 1041832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1041838 1042605 gene locus_tag LOCUS_09930 gene istB 1041838 1042605 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024318137.1 protein_id gnl|my_center|LOCUS_09930 1043141 1042929 gene locus_tag LOCUS_09940 1043141 1042929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1043147 1043641 gene locus_tag LOCUS_09950 1043147 1043641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1044582 1044121 gene locus_tag LOCUS_09960 1044582 1044121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1045368 1045051 gene locus_tag LOCUS_09970 1045368 1045051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1045790 1046593 gene locus_tag LOCUS_09980 1045790 1046593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1046883 1046590 gene locus_tag LOCUS_09990 1046883 1046590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1047023 1047439 gene locus_tag LOCUS_10000 1047023 1047439 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 protein_id gnl|my_center|LOCUS_10000 1047723 1047487 gene locus_tag LOCUS_10010 1047723 1047487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1047641 1048225 gene locus_tag LOCUS_10020 1047641 1048225 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804024.1 protein_id gnl|my_center|LOCUS_10020 1048230 1049483 gene locus_tag LOCUS_10030 gene nadA 1048230 1049483 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804025.1 protein_id gnl|my_center|LOCUS_10030 1049480 1050904 gene locus_tag LOCUS_10040 gene nadB 1049480 1050904 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804026.1 protein_id gnl|my_center|LOCUS_10040 1050915 1051766 gene locus_tag LOCUS_10050 gene nadC 1050915 1051766 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804027.1 protein_id gnl|my_center|LOCUS_10050 1051763 1052881 gene locus_tag LOCUS_10060 1051763 1052881 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_10060 1052899 1054101 gene locus_tag LOCUS_10070 gene chrA 1052899 1054101 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_10070 1054189 1055418 gene locus_tag LOCUS_10080 1054189 1055418 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_10080 1055498 1055571 gene locus_tag LOCUS_t00250 1055498 1055571 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1056313 1055630 gene locus_tag LOCUS_10090 1056313 1055630 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_10090 1057324 1056326 gene locus_tag LOCUS_10100 1057324 1056326 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_10100 1057406 1058221 gene locus_tag LOCUS_10110 1057406 1058221 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973698.1 protein_id gnl|my_center|LOCUS_10110 1060395 1058218 gene locus_tag LOCUS_10120 1060395 1058218 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_10120 1062950 1060395 gene locus_tag LOCUS_10130 1062950 1060395 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 protein_id gnl|my_center|LOCUS_10130 1063105 1064016 gene locus_tag LOCUS_10140 1063105 1064016 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014907.1 protein_id gnl|my_center|LOCUS_10140 1064021 1066774 gene locus_tag LOCUS_10150 1064021 1066774 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982744.1 protein_id gnl|my_center|LOCUS_10150 1067460 1066771 gene locus_tag LOCUS_10160 1067460 1066771 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014280.1 protein_id gnl|my_center|LOCUS_10160 1067581 1069002 gene locus_tag LOCUS_10170 gene leuC 1067581 1069002 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014281.1 protein_id gnl|my_center|LOCUS_10170 1069037 1069624 gene locus_tag LOCUS_10180 gene leuD 1069037 1069624 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014282.1 protein_id gnl|my_center|LOCUS_10180 1070705 1069632 gene locus_tag LOCUS_10190 1070705 1069632 CDS product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 protein_id gnl|my_center|LOCUS_10190 1070831 1071829 gene locus_tag LOCUS_10200 1070831 1071829 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 protein_id gnl|my_center|LOCUS_10200 1071850 1072905 gene locus_tag LOCUS_10210 1071850 1072905 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 protein_id gnl|my_center|LOCUS_10210 1073851 1072877 gene locus_tag LOCUS_10220 1073851 1072877 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014286.1 protein_id gnl|my_center|LOCUS_10220 1073808 1074848 gene locus_tag LOCUS_10230 1073808 1074848 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 protein_id gnl|my_center|LOCUS_10230 1074848 1075492 gene locus_tag LOCUS_10240 1074848 1075492 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804387.1 protein_id gnl|my_center|LOCUS_10240 1075514 1077022 gene locus_tag LOCUS_10250 1075514 1077022 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 protein_id gnl|my_center|LOCUS_10250 1077027 1079159 gene locus_tag LOCUS_10260 1077027 1079159 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 protein_id gnl|my_center|LOCUS_10260 1079169 1079756 gene locus_tag LOCUS_10270 gene rsmD 1079169 1079756 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858829.1 protein_id gnl|my_center|LOCUS_10270 1079761 1080237 gene locus_tag LOCUS_10280 gene coaD 1079761 1080237 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 protein_id gnl|my_center|LOCUS_10280 1080234 1080983 gene locus_tag LOCUS_10290 1080234 1080983 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857192.1 protein_id gnl|my_center|LOCUS_10290 1081741 1080980 gene locus_tag LOCUS_10300 1081741 1080980 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 protein_id gnl|my_center|LOCUS_10300 1082691 1081744 gene locus_tag LOCUS_10310 1082691 1081744 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 protein_id gnl|my_center|LOCUS_10310 1083615 1082698 gene locus_tag LOCUS_10320 1083615 1082698 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014291.1 protein_id gnl|my_center|LOCUS_10320 1084246 1083698 gene locus_tag LOCUS_10330 1084246 1083698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1084824 1084297 gene locus_tag LOCUS_10340 1084824 1084297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1086274 1084730 gene locus_tag LOCUS_10350 1086274 1084730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1086557 1086633 gene locus_tag LOCUS_t00260 1086557 1086633 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1087206 1086802 gene locus_tag LOCUS_10360 1087206 1086802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10360 1087767 1087297 gene locus_tag LOCUS_10370 1087767 1087297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10370 1088393 1088058 gene locus_tag LOCUS_10380 1088393 1088058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1088952 1089245 gene locus_tag LOCUS_10390 1088952 1089245 CDS product lactococcin 972 family bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726502.1 protein_id gnl|my_center|LOCUS_10390 1089249 1091237 gene locus_tag LOCUS_10400 1089249 1091237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1091234 1091848 gene locus_tag LOCUS_10410 1091234 1091848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027323.1 protein_id gnl|my_center|LOCUS_10410 1091848 1092552 gene locus_tag LOCUS_10420 1091848 1092552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1092656 1095226 gene locus_tag LOCUS_10430 gene polA 1092656 1095226 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014298.1 protein_id gnl|my_center|LOCUS_10430 1095594 1097048 gene locus_tag LOCUS_10440 gene rpsA 1095594 1097048 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 protein_id gnl|my_center|LOCUS_10440 1097119 1097730 gene locus_tag LOCUS_10450 gene coaE 1097119 1097730 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_10450 1097783 1098136 gene locus_tag LOCUS_10460 1097783 1098136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1098163 1100262 gene locus_tag LOCUS_10470 gene uvrB 1098163 1100262 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 protein_id gnl|my_center|LOCUS_10470 1100282 1100740 gene locus_tag LOCUS_10480 1100282 1100740 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284441.1 protein_id gnl|my_center|LOCUS_10480 1100852 1101295 gene locus_tag LOCUS_10490 1100852 1101295 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 protein_id gnl|my_center|LOCUS_10490 1103506 1101305 gene locus_tag LOCUS_10500 1103506 1101305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 protein_id gnl|my_center|LOCUS_10500 1104572 1103610 gene locus_tag LOCUS_10510 1104572 1103610 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014318.1 protein_id gnl|my_center|LOCUS_10510 1105270 1104668 gene locus_tag LOCUS_10520 1105270 1104668 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858732.1 protein_id gnl|my_center|LOCUS_10520 1105389 1108241 gene locus_tag LOCUS_10530 gene uvrA 1105389 1108241 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 protein_id gnl|my_center|LOCUS_10530 1109928 1108207 gene locus_tag LOCUS_10540 1109928 1108207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1110207 1111487 gene locus_tag LOCUS_10550 1110207 1111487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1111524 1112096 gene locus_tag LOCUS_10560 1111524 1112096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1112096 1112677 gene locus_tag LOCUS_10570 1112096 1112677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1113357 1112692 gene locus_tag LOCUS_10580 gene absA2 1113357 1112692 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028838.1 protein_id gnl|my_center|LOCUS_10580 1113551 1113354 gene locus_tag LOCUS_10590 1113551 1113354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1114793 1113594 gene locus_tag LOCUS_10600 1114793 1113594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1115197 1115643 gene locus_tag LOCUS_10610 gene infC 1115197 1115643 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 protein_id gnl|my_center|LOCUS_10610 1115674 1115868 gene locus_tag LOCUS_10620 gene rpmI 1115674 1115868 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 protein_id gnl|my_center|LOCUS_10620 1115927 1116310 gene locus_tag LOCUS_10630 gene rplT 1115927 1116310 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858719.1 protein_id gnl|my_center|LOCUS_10630 1116381 1117196 gene locus_tag LOCUS_10640 1116381 1117196 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 protein_id gnl|my_center|LOCUS_10640 1117845 1117453 gene locus_tag LOCUS_10650 1117845 1117453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10650 1118219 1117857 gene locus_tag LOCUS_10660 1118219 1117857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10660 1118470 1119516 gene locus_tag LOCUS_10670 gene pheS 1118470 1119516 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 protein_id gnl|my_center|LOCUS_10670 1119532 1122039 gene locus_tag LOCUS_10680 gene pheT 1119532 1122039 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014330.1 protein_id gnl|my_center|LOCUS_10680 1122077 1123120 gene locus_tag LOCUS_10690 gene argC 1122077 1123120 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 protein_id gnl|my_center|LOCUS_10690 1123132 1124304 gene locus_tag LOCUS_10700 gene argJ 1123132 1124304 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 protein_id gnl|my_center|LOCUS_10700 1124315 1125262 gene locus_tag LOCUS_10710 gene argB 1124315 1125262 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 protein_id gnl|my_center|LOCUS_10710 1125259 1126440 gene locus_tag LOCUS_10720 1125259 1126440 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 protein_id gnl|my_center|LOCUS_10720 1126456 1127406 gene locus_tag LOCUS_10730 gene argF 1126456 1127406 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 protein_id gnl|my_center|LOCUS_10730 1127403 1127888 gene locus_tag LOCUS_10740 1127403 1127888 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 protein_id gnl|my_center|LOCUS_10740 1127920 1129122 gene locus_tag LOCUS_10750 1127920 1129122 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 protein_id gnl|my_center|LOCUS_10750 1129123 1130556 gene locus_tag LOCUS_10760 gene argH 1129123 1130556 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 protein_id gnl|my_center|LOCUS_10760 1130570 1131781 gene locus_tag LOCUS_10770 1130570 1131781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014338.1 protein_id gnl|my_center|LOCUS_10770 1131778 1133358 gene locus_tag LOCUS_10780 1131778 1133358 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014339.1 protein_id gnl|my_center|LOCUS_10780 1133345 1134010 gene locus_tag LOCUS_10790 1133345 1134010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1134007 1134180 gene locus_tag LOCUS_10800 1134007 1134180 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 protein_id gnl|my_center|LOCUS_10800 1134199 1135464 gene locus_tag LOCUS_10810 gene tyrS 1134199 1135464 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 protein_id gnl|my_center|LOCUS_10810 1136054 1137565 gene locus_tag LOCUS_r00040 1136054 1137565 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1137921 1140984 gene locus_tag LOCUS_r00050 1137921 1140984 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1141122 1141226 gene locus_tag LOCUS_r00060 1141122 1141226 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1141337 1142197 gene locus_tag LOCUS_10820 1141337 1142197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1142201 1143184 gene locus_tag LOCUS_10830 1142201 1143184 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 protein_id gnl|my_center|LOCUS_10830 1143192 1143359 gene locus_tag LOCUS_10840 1143192 1143359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1143389 1144216 gene locus_tag LOCUS_10850 1143389 1144216 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 protein_id gnl|my_center|LOCUS_10850 1144216 1145136 gene locus_tag LOCUS_10860 1144216 1145136 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 protein_id gnl|my_center|LOCUS_10860 1145136 1146863 gene locus_tag LOCUS_10870 gene recN 1145136 1146863 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 protein_id gnl|my_center|LOCUS_10870 1146904 1148133 gene locus_tag LOCUS_10880 gene steA 1146904 1148133 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 protein_id gnl|my_center|LOCUS_10880 1148162 1149025 gene locus_tag LOCUS_10890 1148162 1149025 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014348.1 protein_id gnl|my_center|LOCUS_10890 1149036 1149683 gene locus_tag LOCUS_10900 1149036 1149683 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014349.1 protein_id gnl|my_center|LOCUS_10900 1149683 1150606 gene locus_tag LOCUS_10910 gene xerD 1149683 1150606 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 protein_id gnl|my_center|LOCUS_10910 1150682 1151554 gene locus_tag LOCUS_10920 1150682 1151554 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 protein_id gnl|my_center|LOCUS_10920 1151551 1152354 gene locus_tag LOCUS_10930 1151551 1152354 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 protein_id gnl|my_center|LOCUS_10930 1152366 1152926 gene locus_tag LOCUS_10940 gene scpB 1152366 1152926 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 protein_id gnl|my_center|LOCUS_10940 1153008 1153892 gene locus_tag LOCUS_10950 1153008 1153892 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 protein_id gnl|my_center|LOCUS_10950 1153892 1154608 gene locus_tag LOCUS_10960 gene cmk 1153892 1154608 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 protein_id gnl|my_center|LOCUS_10960 1154605 1156083 gene locus_tag LOCUS_10970 gene der 1154605 1156083 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328343.1 protein_id gnl|my_center|LOCUS_10970 1156841 1156080 gene locus_tag LOCUS_10980 1156841 1156080 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014360.1 protein_id gnl|my_center|LOCUS_10980 1156894 1157841 gene locus_tag LOCUS_10990 1156894 1157841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1158102 1158605 gene locus_tag LOCUS_11000 1158102 1158605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1158853 1160202 gene locus_tag LOCUS_11010 1158853 1160202 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_11010 1160239 1160526 gene locus_tag LOCUS_11020 1160239 1160526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1160715 1160641 gene locus_tag LOCUS_t00270 1160715 1160641 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1161983 1160820 gene locus_tag LOCUS_11030 1161983 1160820 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856255.1 protein_id gnl|my_center|LOCUS_11030 1162119 1164410 gene locus_tag LOCUS_11040 gene secA2 1162119 1164410 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014367.1 protein_id gnl|my_center|LOCUS_11040 1164546 1164974 gene locus_tag LOCUS_11050 1164546 1164974 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 protein_id gnl|my_center|LOCUS_11050 1165149 1164964 gene locus_tag LOCUS_11060 1165149 1164964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1165070 1165819 gene locus_tag LOCUS_11070 1165070 1165819 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 protein_id gnl|my_center|LOCUS_11070 1165830 1166378 gene locus_tag LOCUS_11080 1165830 1166378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1166495 1167067 gene locus_tag LOCUS_11090 1166495 1167067 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 protein_id gnl|my_center|LOCUS_11090 1168482 1167082 gene locus_tag LOCUS_11100 1168482 1167082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014368.1 protein_id gnl|my_center|LOCUS_11100 1169386 1168508 gene locus_tag LOCUS_11110 1169386 1168508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 protein_id gnl|my_center|LOCUS_11110 1170451 1169387 gene locus_tag LOCUS_11120 1170451 1169387 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014370.1 protein_id gnl|my_center|LOCUS_11120 1171830 1170448 gene locus_tag LOCUS_11130 1171830 1170448 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014371.1 protein_id gnl|my_center|LOCUS_11130 1173123 1171861 gene locus_tag LOCUS_11140 1173123 1171861 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 protein_id gnl|my_center|LOCUS_11140 1174621 1173155 gene locus_tag LOCUS_11150 gene gndA 1174621 1173155 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 protein_id gnl|my_center|LOCUS_11150 1174660 1175097 gene locus_tag LOCUS_11160 1174660 1175097 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877767.1 protein_id gnl|my_center|LOCUS_11160 1176174 1175101 gene locus_tag LOCUS_11170 gene corA 1176174 1175101 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730286.1 protein_id gnl|my_center|LOCUS_11170 1177698 1176298 gene locus_tag LOCUS_11180 1177698 1176298 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 protein_id gnl|my_center|LOCUS_11180 1177900 1179135 gene locus_tag LOCUS_11190 1177900 1179135 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 protein_id gnl|my_center|LOCUS_11190 1179879 1179187 gene locus_tag LOCUS_11200 1179879 1179187 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 protein_id gnl|my_center|LOCUS_11200 1180214 1179876 gene locus_tag LOCUS_11210 1180214 1179876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 protein_id gnl|my_center|LOCUS_11210 1180337 1180711 gene locus_tag LOCUS_11220 1180337 1180711 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 protein_id gnl|my_center|LOCUS_11220 1181727 1180750 gene locus_tag LOCUS_11230 1181727 1180750 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856192.1 protein_id gnl|my_center|LOCUS_11230 1183255 1181735 gene locus_tag LOCUS_11240 gene lnt 1183255 1181735 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 protein_id gnl|my_center|LOCUS_11240 1183819 1183256 gene locus_tag LOCUS_11250 1183819 1183256 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014393.1 protein_id gnl|my_center|LOCUS_11250 1185019 1183829 gene locus_tag LOCUS_11260 1185019 1183829 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382062.1 protein_id gnl|my_center|LOCUS_11260 1185768 1185040 gene locus_tag LOCUS_11270 1185768 1185040 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014397.1 protein_id gnl|my_center|LOCUS_11270 1186866 1185775 gene locus_tag LOCUS_11280 1186866 1185775 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 protein_id gnl|my_center|LOCUS_11280 1189645 1186883 gene locus_tag LOCUS_11290 1189645 1186883 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014399.1 protein_id gnl|my_center|LOCUS_11290 1190586 1189651 gene locus_tag LOCUS_11300 gene tatC 1190586 1189651 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 protein_id gnl|my_center|LOCUS_11300 1190898 1190629 gene locus_tag LOCUS_11310 1190898 1190629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1191878 1190949 gene locus_tag LOCUS_11320 1191878 1190949 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014402.1 protein_id gnl|my_center|LOCUS_11320 1192785 1191871 gene locus_tag LOCUS_11330 1192785 1191871 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 protein_id gnl|my_center|LOCUS_11330 1194164 1192782 gene locus_tag LOCUS_11340 gene pafA 1194164 1192782 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 protein_id gnl|my_center|LOCUS_11340 1194350 1194168 gene locus_tag LOCUS_11350 1194350 1194168 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 protein_id gnl|my_center|LOCUS_11350 1195838 1194360 gene locus_tag LOCUS_11360 gene dop 1195838 1194360 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014405.1 protein_id gnl|my_center|LOCUS_11360 1196173 1196934 gene locus_tag LOCUS_11370 1196173 1196934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1196939 1198249 gene locus_tag LOCUS_11380 1196939 1198249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1198263 1198919 gene locus_tag LOCUS_11390 1198263 1198919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1199455 1198916 gene locus_tag LOCUS_11400 gene pdxT 1199455 1198916 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_11400 1200390 1199491 gene locus_tag LOCUS_11410 gene pdxS 1200390 1199491 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803695.1 protein_id gnl|my_center|LOCUS_11410 1200454 1201779 gene locus_tag LOCUS_11420 gene pdxR 1200454 1201779 CDS product pyridoxine biosynthesis transcriptional regulator PdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013887.1 protein_id gnl|my_center|LOCUS_11420 1203306 1201789 gene locus_tag LOCUS_11430 gene arc 1203306 1201789 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265753.1 protein_id gnl|my_center|LOCUS_11430 1204149 1203316 gene locus_tag LOCUS_11440 1204149 1203316 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 protein_id gnl|my_center|LOCUS_11440 1205377 1204184 gene locus_tag LOCUS_11450 1205377 1204184 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 protein_id gnl|my_center|LOCUS_11450 1205403 1206212 gene locus_tag LOCUS_11460 1205403 1206212 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 protein_id gnl|my_center|LOCUS_11460 1207864 1206209 gene locus_tag LOCUS_11470 1207864 1206209 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776500.1 protein_id gnl|my_center|LOCUS_11470 1209281 1207893 gene locus_tag LOCUS_11480 gene aspA 1209281 1207893 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 protein_id gnl|my_center|LOCUS_11480 1210220 1209372 gene locus_tag LOCUS_11490 gene hisG 1210220 1209372 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856149.1 protein_id gnl|my_center|LOCUS_11490 1210495 1210232 gene locus_tag LOCUS_11500 1210495 1210232 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895567.1 protein_id gnl|my_center|LOCUS_11500 1211188 1210502 gene locus_tag LOCUS_11510 1211188 1210502 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 protein_id gnl|my_center|LOCUS_11510 1211561 1211181 gene locus_tag LOCUS_11520 1211561 1211181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 protein_id gnl|my_center|LOCUS_11520 1212799 1211558 gene locus_tag LOCUS_11530 gene mshC 1212799 1211558 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 protein_id gnl|my_center|LOCUS_11530 1213653 1212820 gene locus_tag LOCUS_11540 1213653 1212820 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 protein_id gnl|my_center|LOCUS_11540 1213697 1214704 gene locus_tag LOCUS_11550 1213697 1214704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396105.1 protein_id gnl|my_center|LOCUS_11550 1214729 1215814 gene locus_tag LOCUS_11560 1214729 1215814 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 protein_id gnl|my_center|LOCUS_11560 1216136 1215789 gene locus_tag LOCUS_11570 1216136 1215789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856120.1 protein_id gnl|my_center|LOCUS_11570 1216686 1216147 gene locus_tag LOCUS_11580 1216686 1216147 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 protein_id gnl|my_center|LOCUS_11580 1216864 1216950 gene locus_tag LOCUS_t00280 1216864 1216950 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1217076 1217753 gene locus_tag LOCUS_11590 1217076 1217753 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 protein_id gnl|my_center|LOCUS_11590 1217774 1218325 gene locus_tag LOCUS_11600 1217774 1218325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 protein_id gnl|my_center|LOCUS_11600 1219460 1218303 gene locus_tag LOCUS_11610 1219460 1218303 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014431.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11610 1219888 1219460 gene locus_tag LOCUS_11620 1219888 1219460 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862316.1 protein_id gnl|my_center|LOCUS_11620 1220735 1219899 gene locus_tag LOCUS_11630 1220735 1219899 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 protein_id gnl|my_center|LOCUS_11630 1220769 1221524 gene locus_tag LOCUS_11640 1220769 1221524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014433.1 protein_id gnl|my_center|LOCUS_11640 1222570 1221521 gene locus_tag LOCUS_11650 1222570 1221521 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014434.1 protein_id gnl|my_center|LOCUS_11650 1224196 1222592 gene locus_tag LOCUS_11660 1224196 1222592 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014435.1 protein_id gnl|my_center|LOCUS_11660 1225063 1224578 gene locus_tag LOCUS_11670 1225063 1224578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1225274 1228054 gene locus_tag LOCUS_11680 gene can 1225274 1228054 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 protein_id gnl|my_center|LOCUS_11680 1228126 1228692 gene locus_tag LOCUS_11690 gene acnR 1228126 1228692 CDS product TetR/AcrR family transcriptional regulator AcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856101.1 protein_id gnl|my_center|LOCUS_11690 1228716 1229441 gene locus_tag LOCUS_11700 1228716 1229441 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 protein_id gnl|my_center|LOCUS_11700 1229438 1229725 gene locus_tag LOCUS_11710 1229438 1229725 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691603.1 protein_id gnl|my_center|LOCUS_11710 1229735 1231105 gene locus_tag LOCUS_11720 1229735 1231105 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 protein_id gnl|my_center|LOCUS_11720 1232195 1231071 gene locus_tag LOCUS_11730 1232195 1231071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1233702 1232209 gene locus_tag LOCUS_11740 1233702 1232209 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014443.1 protein_id gnl|my_center|LOCUS_11740 1233769 1233918 gene locus_tag LOCUS_11750 1233769 1233918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1233952 1234779 gene locus_tag LOCUS_11760 1233952 1234779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1235158 1235871 gene locus_tag LOCUS_11770 1235158 1235871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1235871 1236071 gene locus_tag LOCUS_11780 1235871 1236071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1236498 1236118 gene locus_tag LOCUS_11790 1236498 1236118 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856083.1 protein_id gnl|my_center|LOCUS_11790 1236969 1236520 gene locus_tag LOCUS_11800 1236969 1236520 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 protein_id gnl|my_center|LOCUS_11800 1238232 1236973 gene locus_tag LOCUS_11810 1238232 1236973 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 protein_id gnl|my_center|LOCUS_11810 1238987 1238232 gene locus_tag LOCUS_11820 gene sufC 1238987 1238232 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 protein_id gnl|my_center|LOCUS_11820 1240206 1239031 gene locus_tag LOCUS_11830 gene sufD 1240206 1239031 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014448.1 protein_id gnl|my_center|LOCUS_11830 1241656 1240211 gene locus_tag LOCUS_11840 gene sufB 1241656 1240211 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 protein_id gnl|my_center|LOCUS_11840 1242347 1241649 gene locus_tag LOCUS_11850 1242347 1241649 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 protein_id gnl|my_center|LOCUS_11850 1242615 1244156 gene locus_tag LOCUS_11860 gene mptB 1242615 1244156 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265766.1 protein_id gnl|my_center|LOCUS_11860 1244168 1245118 gene locus_tag LOCUS_11870 1244168 1245118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 protein_id gnl|my_center|LOCUS_11870 1245124 1245885 gene locus_tag LOCUS_11880 1245124 1245885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014451.1 protein_id gnl|my_center|LOCUS_11880 1245952 1246920 gene locus_tag LOCUS_11890 1245952 1246920 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014452.1 protein_id gnl|my_center|LOCUS_11890 1247889 1246975 gene locus_tag LOCUS_11900 1247889 1246975 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 protein_id gnl|my_center|LOCUS_11900 1248178 1250286 gene locus_tag LOCUS_11910 gene tkt 1248178 1250286 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856055.1 protein_id gnl|my_center|LOCUS_11910 1250302 1251387 gene locus_tag LOCUS_11920 gene tal 1250302 1251387 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 protein_id gnl|my_center|LOCUS_11920 1251418 1252965 gene locus_tag LOCUS_11930 gene zwf 1251418 1252965 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 protein_id gnl|my_center|LOCUS_11930 1252978 1253910 gene locus_tag LOCUS_11940 1252978 1253910 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 protein_id gnl|my_center|LOCUS_11940 1253921 1254652 gene locus_tag LOCUS_11950 gene pgl 1253921 1254652 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 protein_id gnl|my_center|LOCUS_11950 1255243 1255791 gene locus_tag LOCUS_11960 1255243 1255791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1255837 1256235 gene locus_tag LOCUS_11970 1255837 1256235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11970 1256882 1258231 gene locus_tag LOCUS_11980 1256882 1258231 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_11980 1258286 1258750 gene locus_tag LOCUS_11990 1258286 1258750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1258863 1259084 gene locus_tag LOCUS_12000 1258863 1259084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1259092 1261173 gene locus_tag LOCUS_12010 gene pabB 1259092 1261173 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_12010 1261170 1262183 gene locus_tag LOCUS_12020 1261170 1262183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1262164 1263399 gene locus_tag LOCUS_12030 1262164 1263399 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704137.1 protein_id gnl|my_center|LOCUS_12030 1263418 1265730 gene locus_tag LOCUS_12040 1263418 1265730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1265730 1268762 gene locus_tag LOCUS_12050 1265730 1268762 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441479.1 protein_id gnl|my_center|LOCUS_12050 1268762 1269325 gene locus_tag LOCUS_12060 1268762 1269325 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_12060 1269322 1270770 gene locus_tag LOCUS_12070 1269322 1270770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 protein_id gnl|my_center|LOCUS_12070 1270852 1272039 gene locus_tag LOCUS_12080 gene metK 1270852 1272039 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805085.1 protein_id gnl|my_center|LOCUS_12080 1273042 1272743 gene locus_tag LOCUS_12090 gene secG 1273042 1272743 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 protein_id gnl|my_center|LOCUS_12090 1273833 1273051 gene locus_tag LOCUS_12100 gene tpiA 1273833 1273051 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 protein_id gnl|my_center|LOCUS_12100 1275068 1273851 gene locus_tag LOCUS_12110 gene pgk 1275068 1273851 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 protein_id gnl|my_center|LOCUS_12110 1276142 1275129 gene locus_tag LOCUS_12120 gene gap 1276142 1275129 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 protein_id gnl|my_center|LOCUS_12120 1277261 1276251 gene locus_tag LOCUS_12130 gene whiA 1277261 1276251 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862248.1 protein_id gnl|my_center|LOCUS_12130 1278239 1277277 gene locus_tag LOCUS_12140 gene yvcK 1278239 1277277 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014467.1 protein_id gnl|my_center|LOCUS_12140 1279136 1278267 gene locus_tag LOCUS_12150 gene rapZ 1279136 1278267 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 protein_id gnl|my_center|LOCUS_12150 1281228 1279171 gene locus_tag LOCUS_12160 gene uvrC 1281228 1279171 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014468.1 protein_id gnl|my_center|LOCUS_12160 1281757 1281236 gene locus_tag LOCUS_12170 1281757 1281236 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014469.1 protein_id gnl|my_center|LOCUS_12170 1282325 1281840 gene locus_tag LOCUS_12180 gene ribH 1282325 1281840 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 protein_id gnl|my_center|LOCUS_12180 1283593 1282337 gene locus_tag LOCUS_12190 1283593 1282337 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 protein_id gnl|my_center|LOCUS_12190 1284210 1283605 gene locus_tag LOCUS_12200 1284210 1283605 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_12200 1285182 1284211 gene locus_tag LOCUS_12210 gene ribD 1285182 1284211 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014471.1 protein_id gnl|my_center|LOCUS_12210 1285847 1285185 gene locus_tag LOCUS_12220 gene rpe 1285847 1285185 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 protein_id gnl|my_center|LOCUS_12220 1287268 1285853 gene locus_tag LOCUS_12230 1287268 1285853 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014473.1 protein_id gnl|my_center|LOCUS_12230 1288203 1287265 gene locus_tag LOCUS_12240 gene fmt 1288203 1287265 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 protein_id gnl|my_center|LOCUS_12240 1288704 1288204 gene locus_tag LOCUS_12250 gene def 1288704 1288204 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 protein_id gnl|my_center|LOCUS_12250 1290706 1288733 gene locus_tag LOCUS_12260 1290706 1288733 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014474.1 protein_id gnl|my_center|LOCUS_12260 1291993 1290773 gene locus_tag LOCUS_12270 gene metK 1291993 1290773 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 protein_id gnl|my_center|LOCUS_12270 1293279 1292056 gene locus_tag LOCUS_12280 gene coaBC 1293279 1292056 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 protein_id gnl|my_center|LOCUS_12280 1293668 1293384 gene locus_tag LOCUS_12290 gene rpoZ 1293668 1293384 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 protein_id gnl|my_center|LOCUS_12290 1294274 1293681 gene locus_tag LOCUS_12300 gene gmk 1294274 1293681 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 protein_id gnl|my_center|LOCUS_12300 1294599 1294279 gene locus_tag LOCUS_12310 gene mihF 1294599 1294279 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_12310 1295641 1294823 gene locus_tag LOCUS_12320 gene pyrF 1295641 1294823 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 protein_id gnl|my_center|LOCUS_12320 1298979 1295641 gene locus_tag LOCUS_12330 gene carB 1298979 1295641 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862217.1 protein_id gnl|my_center|LOCUS_12330 1300161 1299004 gene locus_tag LOCUS_12340 gene carA 1300161 1299004 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014478.1 protein_id gnl|my_center|LOCUS_12340 1301472 1300201 gene locus_tag LOCUS_12350 1301472 1300201 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 protein_id gnl|my_center|LOCUS_12350 1302393 1301473 gene locus_tag LOCUS_12360 1302393 1301473 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 protein_id gnl|my_center|LOCUS_12360 1302958 1302395 gene locus_tag LOCUS_12370 gene pyrR 1302958 1302395 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 protein_id gnl|my_center|LOCUS_12370 1303065 1303535 gene locus_tag LOCUS_12380 1303065 1303535 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014481.1 protein_id gnl|my_center|LOCUS_12380 1303525 1303968 gene locus_tag LOCUS_12390 1303525 1303968 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014482.1 protein_id gnl|my_center|LOCUS_12390 1304743 1303985 gene locus_tag LOCUS_12400 1304743 1303985 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013333.1 protein_id gnl|my_center|LOCUS_12400 1305781 1304747 gene locus_tag LOCUS_12410 1305781 1304747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896031.1 protein_id gnl|my_center|LOCUS_12410 1306770 1305778 gene locus_tag LOCUS_12420 1306770 1305778 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013332.1 protein_id gnl|my_center|LOCUS_12420 1307734 1306886 gene locus_tag LOCUS_12430 1307734 1306886 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112196.1 protein_id gnl|my_center|LOCUS_12430 1308266 1307799 gene locus_tag LOCUS_12440 1308266 1307799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1308829 1308266 gene locus_tag LOCUS_12450 gene efp 1308829 1308266 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 protein_id gnl|my_center|LOCUS_12450 1309972 1308881 gene locus_tag LOCUS_12460 1309972 1308881 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014485.1 protein_id gnl|my_center|LOCUS_12460 1310405 1309959 gene locus_tag LOCUS_12470 gene aroQ 1310405 1309959 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057656.1 protein_id gnl|my_center|LOCUS_12470 1311469 1310411 gene locus_tag LOCUS_12480 gene aroB 1311469 1310411 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 protein_id gnl|my_center|LOCUS_12480 1312054 1311494 gene locus_tag LOCUS_12490 1312054 1311494 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 protein_id gnl|my_center|LOCUS_12490 1313264 1312047 gene locus_tag LOCUS_12500 gene aroC 1313264 1312047 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 protein_id gnl|my_center|LOCUS_12500 1313700 1313278 gene locus_tag LOCUS_12510 1313700 1313278 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014489.1 protein_id gnl|my_center|LOCUS_12510 1314522 1313725 gene locus_tag LOCUS_12520 1314522 1313725 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014493.1 protein_id gnl|my_center|LOCUS_12520 1315709 1314558 gene locus_tag LOCUS_12530 gene mltG 1315709 1314558 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014494.1 protein_id gnl|my_center|LOCUS_12530 1316203 1315715 gene locus_tag LOCUS_12540 gene ruvX 1316203 1315715 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014495.1 protein_id gnl|my_center|LOCUS_12540 1319010 1316341 gene locus_tag LOCUS_12550 gene alaS 1319010 1316341 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 protein_id gnl|my_center|LOCUS_12550 1320433 1319078 gene locus_tag LOCUS_12560 1320433 1319078 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 protein_id gnl|my_center|LOCUS_12560 1321672 1320437 gene locus_tag LOCUS_12570 1321672 1320437 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 protein_id gnl|my_center|LOCUS_12570 1323487 1321691 gene locus_tag LOCUS_12580 gene aspS 1323487 1321691 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 protein_id gnl|my_center|LOCUS_12580 1323604 1324728 gene locus_tag LOCUS_12590 1323604 1324728 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014504.1 protein_id gnl|my_center|LOCUS_12590 1324728 1325285 gene locus_tag LOCUS_12600 1324728 1325285 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 1325296 1326690 gene locus_tag LOCUS_12610 1325296 1326690 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014507.1 protein_id gnl|my_center|LOCUS_12610 1327976 1326687 gene locus_tag LOCUS_12620 gene hisS 1327976 1326687 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 protein_id gnl|my_center|LOCUS_12620 1328633 1327983 gene locus_tag LOCUS_12630 1328633 1327983 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 protein_id gnl|my_center|LOCUS_12630 1328746 1329678 gene locus_tag LOCUS_12640 1328746 1329678 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 protein_id gnl|my_center|LOCUS_12640 1329794 1330132 gene locus_tag LOCUS_12650 1329794 1330132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1332479 1330203 gene locus_tag LOCUS_12660 1332479 1330203 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 protein_id gnl|my_center|LOCUS_12660 1333079 1332516 gene locus_tag LOCUS_12670 1333079 1332516 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 protein_id gnl|my_center|LOCUS_12670 1334712 1333105 gene locus_tag LOCUS_12680 1334712 1333105 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014515.1 protein_id gnl|my_center|LOCUS_12680 1335900 1334773 gene locus_tag LOCUS_12690 gene secF 1335900 1334773 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014516.1 protein_id gnl|my_center|LOCUS_12690 1337726 1335903 gene locus_tag LOCUS_12700 gene secD 1337726 1335903 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 protein_id gnl|my_center|LOCUS_12700 1338128 1337874 gene locus_tag LOCUS_12710 1338128 1337874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1339217 1338150 gene locus_tag LOCUS_12720 gene ruvB 1339217 1338150 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 protein_id gnl|my_center|LOCUS_12720 1339833 1339228 gene locus_tag LOCUS_12730 gene ruvA 1339833 1339228 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_12730 1340354 1339830 gene locus_tag LOCUS_12740 1340354 1339830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1341205 1340450 gene locus_tag LOCUS_12750 1341205 1340450 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 protein_id gnl|my_center|LOCUS_12750 1342180 1341314 gene locus_tag LOCUS_12760 1342180 1341314 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014521.1 protein_id gnl|my_center|LOCUS_12760 1342715 1342263 gene locus_tag LOCUS_12770 1342715 1342263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855892.1 protein_id gnl|my_center|LOCUS_12770 1343803 1342712 gene locus_tag LOCUS_12780 1343803 1342712 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 protein_id gnl|my_center|LOCUS_12780 1344724 1343810 gene locus_tag LOCUS_12790 1344724 1343810 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 protein_id gnl|my_center|LOCUS_12790 1345376 1344741 gene locus_tag LOCUS_12800 1345376 1344741 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 protein_id gnl|my_center|LOCUS_12800 1345959 1345369 gene locus_tag LOCUS_12810 1345959 1345369 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 protein_id gnl|my_center|LOCUS_12810 1348009 1345940 gene locus_tag LOCUS_12820 gene thrS 1348009 1345940 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855874.1 protein_id gnl|my_center|LOCUS_12820 1349376 1348120 gene locus_tag LOCUS_12830 1349376 1348120 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 protein_id gnl|my_center|LOCUS_12830 1350036 1349410 gene locus_tag LOCUS_12840 1350036 1349410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1350707 1350120 gene locus_tag LOCUS_12850 1350707 1350120 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855865.1 protein_id gnl|my_center|LOCUS_12850 1350977 1350905 gene locus_tag LOCUS_t00290 1350977 1350905 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1351226 1351300 gene locus_tag LOCUS_t00300 1351226 1351300 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1351323 1351395 gene locus_tag LOCUS_t00310 1351323 1351395 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1351445 1351520 gene locus_tag LOCUS_t00320 1351445 1351520 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1351577 1351650 gene locus_tag LOCUS_t00330 1351577 1351650 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1351667 1351739 gene locus_tag LOCUS_t00340 1351667 1351739 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1351789 1351862 gene locus_tag LOCUS_t00350 1351789 1351862 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1351916 1352578 gene locus_tag LOCUS_12860 1351916 1352578 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014736.1 protein_id gnl|my_center|LOCUS_12860 1352608 1353837 gene locus_tag LOCUS_12870 gene aftC 1352608 1353837 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 protein_id gnl|my_center|LOCUS_12870 1353830 1354252 gene locus_tag LOCUS_12880 gene msrB 1353830 1354252 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 protein_id gnl|my_center|LOCUS_12880 1355101 1354397 gene locus_tag LOCUS_12890 1355101 1354397 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014738.1 protein_id gnl|my_center|LOCUS_12890 1355221 1355877 gene locus_tag LOCUS_12900 1355221 1355877 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 protein_id gnl|my_center|LOCUS_12900 1355884 1357065 gene locus_tag LOCUS_12910 1355884 1357065 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 protein_id gnl|my_center|LOCUS_12910 1358996 1357062 gene locus_tag LOCUS_12920 gene dxs 1358996 1357062 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014741.1 protein_id gnl|my_center|LOCUS_12920 1360403 1359132 gene locus_tag LOCUS_12930 1360403 1359132 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 protein_id gnl|my_center|LOCUS_12930 1361281 1360403 gene locus_tag LOCUS_12940 1361281 1360403 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 protein_id gnl|my_center|LOCUS_12940 1361867 1361388 gene locus_tag LOCUS_12950 gene dut 1361867 1361388 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_12950 1361921 1362439 gene locus_tag LOCUS_12960 1361921 1362439 CDS product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 protein_id gnl|my_center|LOCUS_12960 1362739 1362446 gene locus_tag LOCUS_12970 1362739 1362446 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 protein_id gnl|my_center|LOCUS_12970 1363725 1362925 gene locus_tag LOCUS_12980 1363725 1362925 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014746.1 protein_id gnl|my_center|LOCUS_12980 1363827 1364624 gene locus_tag LOCUS_12990 gene ppgK 1363827 1364624 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014747.1 protein_id gnl|my_center|LOCUS_12990 1364875 1366377 gene locus_tag LOCUS_13000 1364875 1366377 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857350.1 protein_id gnl|my_center|LOCUS_13000 1368158 1366398 gene locus_tag LOCUS_13010 1368158 1366398 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 protein_id gnl|my_center|LOCUS_13010 1368415 1368155 gene locus_tag LOCUS_13020 1368415 1368155 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389816.1 protein_id gnl|my_center|LOCUS_13020 1368478 1368990 gene locus_tag LOCUS_13030 1368478 1368990 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014750.1 protein_id gnl|my_center|LOCUS_13030 1368983 1370512 gene locus_tag LOCUS_13040 1368983 1370512 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 protein_id gnl|my_center|LOCUS_13040 1370536 1370970 gene locus_tag LOCUS_13050 gene dtd 1370536 1370970 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859832.1 protein_id gnl|my_center|LOCUS_13050 1371057 1372052 gene locus_tag LOCUS_13060 1371057 1372052 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 protein_id gnl|my_center|LOCUS_13060 1372251 1372943 gene locus_tag LOCUS_13070 1372251 1372943 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 protein_id gnl|my_center|LOCUS_13070 1372968 1373951 gene locus_tag LOCUS_13080 gene galE 1372968 1373951 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 protein_id gnl|my_center|LOCUS_13080 1375064 1373961 gene locus_tag LOCUS_13090 1375064 1373961 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066566054.1 protein_id gnl|my_center|LOCUS_13090 1375339 1376397 gene locus_tag LOCUS_13100 1375339 1376397 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 protein_id gnl|my_center|LOCUS_13100 1376424 1378976 gene locus_tag LOCUS_13110 1376424 1378976 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 protein_id gnl|my_center|LOCUS_13110 1379070 1380299 gene locus_tag LOCUS_13120 1379070 1380299 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015567.1 protein_id gnl|my_center|LOCUS_13120 1380422 1381378 gene locus_tag LOCUS_13130 1380422 1381378 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 protein_id gnl|my_center|LOCUS_13130 1381394 1385296 gene locus_tag LOCUS_13140 gene hrpA 1381394 1385296 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014759.1 protein_id gnl|my_center|LOCUS_13140 1385718 1385299 gene locus_tag LOCUS_13150 gene nrdR 1385718 1385299 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857385.1 protein_id gnl|my_center|LOCUS_13150 1386223 1385861 gene locus_tag LOCUS_13160 1386223 1385861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1386551 1387237 gene locus_tag LOCUS_13170 gene lexA 1386551 1387237 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 protein_id gnl|my_center|LOCUS_13170 1387317 1387583 gene locus_tag LOCUS_13180 1387317 1387583 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 protein_id gnl|my_center|LOCUS_13180 1387657 1388445 gene locus_tag LOCUS_13190 1387657 1388445 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 protein_id gnl|my_center|LOCUS_13190 1389739 1388393 gene locus_tag LOCUS_13200 1389739 1388393 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 protein_id gnl|my_center|LOCUS_13200 1390704 1389736 gene locus_tag LOCUS_13210 1390704 1389736 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_13210 1391550 1390723 gene locus_tag LOCUS_13220 1391550 1390723 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 protein_id gnl|my_center|LOCUS_13220 1393647 1391554 gene locus_tag LOCUS_13230 1393647 1391554 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993832.1 protein_id gnl|my_center|LOCUS_13230 1394600 1393653 gene locus_tag LOCUS_13240 1394600 1393653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 protein_id gnl|my_center|LOCUS_13240 1396194 1394638 gene locus_tag LOCUS_13250 1396194 1394638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116517.1 protein_id gnl|my_center|LOCUS_13250 1396377 1397090 gene locus_tag LOCUS_13260 1396377 1397090 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015280.1 protein_id gnl|my_center|LOCUS_13260 1397809 1397087 gene locus_tag LOCUS_13270 1397809 1397087 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015278.1 protein_id gnl|my_center|LOCUS_13270 1398785 1397823 gene locus_tag LOCUS_13280 1398785 1397823 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015277.1 protein_id gnl|my_center|LOCUS_13280 1398956 1400098 gene locus_tag LOCUS_13290 1398956 1400098 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853898.1 protein_id gnl|my_center|LOCUS_13290 1400129 1400893 gene locus_tag LOCUS_13300 gene nagB 1400129 1400893 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 protein_id gnl|my_center|LOCUS_13300 1402428 1400890 gene locus_tag LOCUS_13310 gene hflX 1402428 1400890 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 protein_id gnl|my_center|LOCUS_13310 1402598 1403347 gene locus_tag LOCUS_13320 1402598 1403347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 protein_id gnl|my_center|LOCUS_13320 1403384 1403899 gene locus_tag LOCUS_13330 1403384 1403899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014771.1 protein_id gnl|my_center|LOCUS_13330 1404738 1403911 gene locus_tag LOCUS_13340 gene dapF 1404738 1403911 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 protein_id gnl|my_center|LOCUS_13340 1405637 1404735 gene locus_tag LOCUS_13350 gene miaA 1405637 1404735 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 protein_id gnl|my_center|LOCUS_13350 1406230 1405634 gene locus_tag LOCUS_13360 1406230 1405634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014774.1 protein_id gnl|my_center|LOCUS_13360 1406403 1407755 gene locus_tag LOCUS_13370 1406403 1407755 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014775.1 protein_id gnl|my_center|LOCUS_13370 1407757 1408803 gene locus_tag LOCUS_13380 1407757 1408803 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014776.1 protein_id gnl|my_center|LOCUS_13380 1408796 1409758 gene locus_tag LOCUS_13390 1408796 1409758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1410513 1409755 gene locus_tag LOCUS_13400 1410513 1409755 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105024.1 protein_id gnl|my_center|LOCUS_13400 1411869 1410607 gene locus_tag LOCUS_13410 1411869 1410607 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775828.1 protein_id gnl|my_center|LOCUS_13410 1412590 1411955 gene locus_tag LOCUS_13420 1412590 1411955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1414547 1412994 gene locus_tag LOCUS_13430 gene miaB 1414547 1412994 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 protein_id gnl|my_center|LOCUS_13430 1414682 1415431 gene locus_tag LOCUS_13440 gene gluA 1414682 1415431 CDS product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857431.1 protein_id gnl|my_center|LOCUS_13440 1415448 1416314 gene locus_tag LOCUS_13450 gene gluB 1415448 1416314 CDS product glutamate ABC transporter substrate-binding protein GluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014779.1 protein_id gnl|my_center|LOCUS_13450 1416397 1417083 gene locus_tag LOCUS_13460 gene gluC 1416397 1417083 CDS product glutamate ABC transporter permease GluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014780.1 protein_id gnl|my_center|LOCUS_13460 1417083 1418036 gene locus_tag LOCUS_13470 1417083 1418036 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014781.1 protein_id gnl|my_center|LOCUS_13470 1418655 1418050 gene locus_tag LOCUS_13480 gene recX 1418655 1418050 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 protein_id gnl|my_center|LOCUS_13480 1419806 1418661 gene locus_tag LOCUS_13490 gene recA 1419806 1418661 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 protein_id gnl|my_center|LOCUS_13490 1420209 1419994 gene locus_tag LOCUS_13500 1420209 1419994 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857447.1 protein_id gnl|my_center|LOCUS_13500 1420286 1420867 gene locus_tag LOCUS_13510 gene bioY 1420286 1420867 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 protein_id gnl|my_center|LOCUS_13510 1420869 1421561 gene locus_tag LOCUS_13520 1420869 1421561 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 protein_id gnl|my_center|LOCUS_13520 1421558 1422172 gene locus_tag LOCUS_13530 1421558 1422172 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857456.1 protein_id gnl|my_center|LOCUS_13530 1423054 1422230 gene locus_tag LOCUS_13540 1423054 1422230 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 protein_id gnl|my_center|LOCUS_13540 1423503 1423117 gene locus_tag LOCUS_13550 1423503 1423117 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861658.1 protein_id gnl|my_center|LOCUS_13550 1424057 1423500 gene locus_tag LOCUS_13560 1424057 1423500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1424601 1424050 gene locus_tag LOCUS_13570 gene pgsA 1424601 1424050 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 protein_id gnl|my_center|LOCUS_13570 1425818 1424649 gene locus_tag LOCUS_13580 1425818 1424649 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 protein_id gnl|my_center|LOCUS_13580 1428893 1426080 gene locus_tag LOCUS_13590 1428893 1426080 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857472.1 protein_id gnl|my_center|LOCUS_13590 1428892 1429092 gene locus_tag LOCUS_13600 1428892 1429092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1429733 1429089 gene locus_tag LOCUS_13610 1429733 1429089 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 protein_id gnl|my_center|LOCUS_13610 1431786 1429759 gene locus_tag LOCUS_13620 1431786 1429759 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014791.1 protein_id gnl|my_center|LOCUS_13620 1432697 1431789 gene locus_tag LOCUS_13630 gene dapA 1432697 1431789 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014792.1 protein_id gnl|my_center|LOCUS_13630 1433522 1432770 gene locus_tag LOCUS_13640 gene thyX 1433522 1432770 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014793.1 protein_id gnl|my_center|LOCUS_13640 1434272 1433526 gene locus_tag LOCUS_13650 gene dapB 1434272 1433526 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 protein_id gnl|my_center|LOCUS_13650 1434407 1435066 gene locus_tag LOCUS_13660 1434407 1435066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1437436 1435094 gene locus_tag LOCUS_13670 1437436 1435094 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 protein_id gnl|my_center|LOCUS_13670 1437836 1437567 gene locus_tag LOCUS_13680 gene rpsO 1437836 1437567 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 protein_id gnl|my_center|LOCUS_13680 1438935 1437979 gene locus_tag LOCUS_13690 1438935 1437979 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 protein_id gnl|my_center|LOCUS_13690 1439929 1438952 gene locus_tag LOCUS_13700 1439929 1438952 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121910865.1 protein_id gnl|my_center|LOCUS_13700 1439960 1440865 gene locus_tag LOCUS_13710 gene truB 1439960 1440865 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 protein_id gnl|my_center|LOCUS_13710 1441559 1440879 gene locus_tag LOCUS_13720 1441559 1440879 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857486.1 protein_id gnl|my_center|LOCUS_13720 1442359 1441559 gene locus_tag LOCUS_13730 1442359 1441559 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857487.1 protein_id gnl|my_center|LOCUS_13730 1443681 1442386 gene locus_tag LOCUS_13740 1443681 1442386 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 protein_id gnl|my_center|LOCUS_13740 1444661 1443681 gene locus_tag LOCUS_13750 1444661 1443681 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014801.1 protein_id gnl|my_center|LOCUS_13750 1445097 1444663 gene locus_tag LOCUS_13760 gene rbfA 1445097 1444663 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 protein_id gnl|my_center|LOCUS_13760 1448076 1445227 gene locus_tag LOCUS_13770 1448076 1445227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1448508 1448185 gene locus_tag LOCUS_13780 1448508 1448185 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014803.1 protein_id gnl|my_center|LOCUS_13780 1449684 1448683 gene locus_tag LOCUS_13790 gene nusA 1449684 1448683 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 protein_id gnl|my_center|LOCUS_13790 1450233 1449685 gene locus_tag LOCUS_13800 gene rimP 1450233 1449685 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 protein_id gnl|my_center|LOCUS_13800 1450232 1451056 gene locus_tag LOCUS_13810 1450232 1451056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1452824 1451064 gene locus_tag LOCUS_13820 1452824 1451064 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 protein_id gnl|my_center|LOCUS_13820 1452855 1453565 gene locus_tag LOCUS_13830 gene yaaA 1452855 1453565 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 protein_id gnl|my_center|LOCUS_13830 1454484 1453522 gene locus_tag LOCUS_13840 1454484 1453522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1454715 1455815 gene locus_tag LOCUS_13850 1454715 1455815 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 protein_id gnl|my_center|LOCUS_13850 1456755 1455808 gene locus_tag LOCUS_13860 1456755 1455808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1457479 1456742 gene locus_tag LOCUS_13870 gene cobA 1457479 1456742 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014811.1 protein_id gnl|my_center|LOCUS_13870 1457504 1458706 gene locus_tag LOCUS_13880 1457504 1458706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1460218 1458722 gene locus_tag LOCUS_13890 gene mqo 1460218 1458722 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 protein_id gnl|my_center|LOCUS_13890 1460455 1461462 gene locus_tag LOCUS_13900 1460455 1461462 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 protein_id gnl|my_center|LOCUS_13900 1461521 1462936 gene locus_tag LOCUS_13910 gene mtr 1461521 1462936 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 protein_id gnl|my_center|LOCUS_13910 1463845 1462943 gene locus_tag LOCUS_13920 gene map 1463845 1462943 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 protein_id gnl|my_center|LOCUS_13920 1465690 1463879 gene locus_tag LOCUS_13930 1465690 1463879 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 protein_id gnl|my_center|LOCUS_13930 1466931 1465768 gene locus_tag LOCUS_13940 gene ispG 1466931 1465768 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 protein_id gnl|my_center|LOCUS_13940 1468163 1466952 gene locus_tag LOCUS_13950 1468163 1466952 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_13950 1469334 1468180 gene locus_tag LOCUS_13960 gene dxr 1469334 1468180 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014825.1 protein_id gnl|my_center|LOCUS_13960 1469263 1469442 gene locus_tag LOCUS_13970 1469263 1469442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1469520 1469954 gene locus_tag LOCUS_13980 1469520 1469954 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857542.1 protein_id gnl|my_center|LOCUS_13980 1471076 1469973 gene locus_tag LOCUS_13990 gene rlmN 1471076 1469973 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 protein_id gnl|my_center|LOCUS_13990 1472034 1471132 gene locus_tag LOCUS_14000 1472034 1471132 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 protein_id gnl|my_center|LOCUS_14000 1472615 1472058 gene locus_tag LOCUS_14010 gene frr 1472615 1472058 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 protein_id gnl|my_center|LOCUS_14010 1473431 1472706 gene locus_tag LOCUS_14020 gene pyrH 1473431 1472706 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 protein_id gnl|my_center|LOCUS_14020 1474398 1473580 gene locus_tag LOCUS_14030 gene tsf 1474398 1473580 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 protein_id gnl|my_center|LOCUS_14030 1475523 1474663 gene locus_tag LOCUS_14040 gene rpsB 1475523 1474663 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 protein_id gnl|my_center|LOCUS_14040 1475812 1476333 gene locus_tag LOCUS_14050 1475812 1476333 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014832.1 protein_id gnl|my_center|LOCUS_14050 1477254 1476352 gene locus_tag LOCUS_14060 1477254 1476352 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 protein_id gnl|my_center|LOCUS_14060 1478455 1477280 gene locus_tag LOCUS_14070 gene dprA 1478455 1477280 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 protein_id gnl|my_center|LOCUS_14070 1479966 1478452 gene locus_tag LOCUS_14080 1479966 1478452 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 protein_id gnl|my_center|LOCUS_14080 1480327 1479953 gene locus_tag LOCUS_14090 1480327 1479953 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014835.1 protein_id gnl|my_center|LOCUS_14090 1480718 1480410 gene locus_tag LOCUS_14100 1480718 1480410 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 protein_id gnl|my_center|LOCUS_14100 1481338 1480715 gene locus_tag LOCUS_14110 1481338 1480715 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982719.1 protein_id gnl|my_center|LOCUS_14110 1482133 1481339 gene locus_tag LOCUS_14120 gene lepB 1482133 1481339 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 protein_id gnl|my_center|LOCUS_14120 1482577 1482230 gene locus_tag LOCUS_14130 gene rplS 1482577 1482230 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 protein_id gnl|my_center|LOCUS_14130 1484981 1482690 gene locus_tag LOCUS_14140 1484981 1482690 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 protein_id gnl|my_center|LOCUS_14140 1486071 1484992 gene locus_tag LOCUS_14150 gene trmD 1486071 1484992 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050816932.1 protein_id gnl|my_center|LOCUS_14150 1486564 1486064 gene locus_tag LOCUS_14160 gene rimM 1486564 1486064 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 protein_id gnl|my_center|LOCUS_14160 1487203 1486697 gene locus_tag LOCUS_14170 1487203 1486697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1487591 1489723 gene locus_tag LOCUS_14180 1487591 1489723 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 protein_id gnl|my_center|LOCUS_14180 1491361 1489730 gene locus_tag LOCUS_14190 gene ffh 1491361 1489730 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 protein_id gnl|my_center|LOCUS_14190 1491793 1491455 gene locus_tag LOCUS_14200 gene glnK 1491793 1491455 CDS product P-II family nitrogen regulator GlnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014853.1 protein_id gnl|my_center|LOCUS_14200 1493211 1491820 gene locus_tag LOCUS_14210 1493211 1491820 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014854.1 protein_id gnl|my_center|LOCUS_14210 1493458 1494894 gene locus_tag LOCUS_14220 1493458 1494894 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 protein_id gnl|my_center|LOCUS_14220 1496492 1494915 gene locus_tag LOCUS_14230 1496492 1494915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1499996 1496529 gene locus_tag LOCUS_14240 gene smc 1499996 1496529 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 protein_id gnl|my_center|LOCUS_14240 1501934 1500051 gene locus_tag LOCUS_14250 1501934 1500051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015651613.1 protein_id gnl|my_center|LOCUS_14250 1502241 1501972 gene locus_tag LOCUS_14260 1502241 1501972 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 protein_id gnl|my_center|LOCUS_14260 1502364 1504046 gene locus_tag LOCUS_14270 1502364 1504046 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_14270 1504047 1504301 gene locus_tag LOCUS_14280 1504047 1504301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1504292 1505191 gene locus_tag LOCUS_14290 1504292 1505191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1507516 1506020 gene locus_tag LOCUS_14300 1507516 1506020 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 protein_id gnl|my_center|LOCUS_14300 1508437 1507595 gene locus_tag LOCUS_14310 gene mutM 1508437 1507595 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 protein_id gnl|my_center|LOCUS_14310 1509214 1508441 gene locus_tag LOCUS_14320 gene rnc 1509214 1508441 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 protein_id gnl|my_center|LOCUS_14320 1509744 1509211 gene locus_tag LOCUS_14330 1509744 1509211 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861940.1 protein_id gnl|my_center|LOCUS_14330 1510553 1509777 gene locus_tag LOCUS_14340 1510553 1509777 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 protein_id gnl|my_center|LOCUS_14340 1511950 1510604 gene locus_tag LOCUS_14350 gene gdhA 1511950 1510604 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 protein_id gnl|my_center|LOCUS_14350 1512182 1513315 gene locus_tag LOCUS_14360 1512182 1513315 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014866.1 protein_id gnl|my_center|LOCUS_14360 1513707 1513285 gene locus_tag LOCUS_14370 1513707 1513285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856390.1 protein_id gnl|my_center|LOCUS_14370 1513781 1515118 gene locus_tag LOCUS_14380 1513781 1515118 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_14380 1515129 1516403 gene locus_tag LOCUS_14390 1515129 1516403 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014868.1 protein_id gnl|my_center|LOCUS_14390 1516484 1518880 gene locus_tag LOCUS_14400 gene malP 1516484 1518880 CDS product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 protein_id gnl|my_center|LOCUS_14400 1518924 1520822 gene locus_tag LOCUS_14410 gene pabB 1518924 1520822 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_14410 1520819 1521529 gene locus_tag LOCUS_14420 1520819 1521529 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014036.1 protein_id gnl|my_center|LOCUS_14420 1522898 1521513 gene locus_tag LOCUS_14430 gene pyk 1522898 1521513 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 protein_id gnl|my_center|LOCUS_14430 1523867 1522968 gene locus_tag LOCUS_14440 gene lgt 1523867 1522968 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 protein_id gnl|my_center|LOCUS_14440 1524770 1523943 gene locus_tag LOCUS_14450 gene trpC 1524770 1523943 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 protein_id gnl|my_center|LOCUS_14450 1525556 1524879 gene locus_tag LOCUS_14460 1525556 1524879 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 protein_id gnl|my_center|LOCUS_14460 1525989 1525549 gene locus_tag LOCUS_14470 gene hisI 1525989 1525549 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014876.1 protein_id gnl|my_center|LOCUS_14470 1526768 1525986 gene locus_tag LOCUS_14480 gene hisF 1526768 1525986 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 protein_id gnl|my_center|LOCUS_14480 1527615 1526824 gene locus_tag LOCUS_14490 1527615 1526824 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 protein_id gnl|my_center|LOCUS_14490 1528411 1527671 gene locus_tag LOCUS_14500 gene priA 1528411 1527671 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856418.1 protein_id gnl|my_center|LOCUS_14500 1529081 1528422 gene locus_tag LOCUS_14510 gene hisH 1529081 1528422 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014877.1 protein_id gnl|my_center|LOCUS_14510 1530397 1529093 gene locus_tag LOCUS_14520 1530397 1529093 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 protein_id gnl|my_center|LOCUS_14520 1531061 1530459 gene locus_tag LOCUS_14530 gene hisB 1531061 1530459 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861983.1 protein_id gnl|my_center|LOCUS_14530 1532205 1531054 gene locus_tag LOCUS_14540 1532205 1531054 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014880.1 protein_id gnl|my_center|LOCUS_14540 1533540 1532206 gene locus_tag LOCUS_14550 gene hisD 1533540 1532206 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014881.1 protein_id gnl|my_center|LOCUS_14550 1533902 1533534 gene locus_tag LOCUS_14560 1533902 1533534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1533914 1534969 gene locus_tag LOCUS_14570 1533914 1534969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1535559 1534993 gene locus_tag LOCUS_14580 1535559 1534993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1536266 1535550 gene locus_tag LOCUS_14590 1536266 1535550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1536434 1537021 gene locus_tag LOCUS_14600 gene bioQ 1536434 1537021 CDS product TetR family transcriptional regulator BioQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728885.1 protein_id gnl|my_center|LOCUS_14600 1537014 1539233 gene locus_tag LOCUS_14610 gene glgX 1537014 1539233 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 protein_id gnl|my_center|LOCUS_14610 1539290 1540696 gene locus_tag LOCUS_14620 1539290 1540696 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856453.1 protein_id gnl|my_center|LOCUS_14620 1540749 1541372 gene locus_tag LOCUS_14630 1540749 1541372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1541425 1543881 gene locus_tag LOCUS_14640 gene treY 1541425 1543881 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014893.1 protein_id gnl|my_center|LOCUS_14640 1543892 1544905 gene locus_tag LOCUS_14650 1543892 1544905 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 protein_id gnl|my_center|LOCUS_14650 1545282 1544902 gene locus_tag LOCUS_14660 1545282 1544902 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 protein_id gnl|my_center|LOCUS_14660 1545522 1545289 gene locus_tag LOCUS_14670 1545522 1545289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862025.1 protein_id gnl|my_center|LOCUS_14670 1546197 1545541 gene locus_tag LOCUS_14680 1546197 1545541 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 protein_id gnl|my_center|LOCUS_14680 1546239 1548005 gene locus_tag LOCUS_14690 gene treZ 1546239 1548005 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856468.1 protein_id gnl|my_center|LOCUS_14690 1549318 1548002 gene locus_tag LOCUS_14700 gene ilvA 1549318 1548002 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862033.1 protein_id gnl|my_center|LOCUS_14700 1550047 1549325 gene locus_tag LOCUS_14710 1550047 1549325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013346.1 protein_id gnl|my_center|LOCUS_14710 1553618 1550058 gene locus_tag LOCUS_14720 gene dnaE 1553618 1550058 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 protein_id gnl|my_center|LOCUS_14720 1554938 1553664 gene locus_tag LOCUS_14730 1554938 1553664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015552.1 protein_id gnl|my_center|LOCUS_14730 1555726 1554935 gene locus_tag LOCUS_14740 1555726 1554935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_14740 1557228 1555735 gene locus_tag LOCUS_14750 1557228 1555735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1557858 1557337 gene locus_tag LOCUS_14760 1557858 1557337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014908.1 protein_id gnl|my_center|LOCUS_14760 1558781 1557855 gene locus_tag LOCUS_14770 1558781 1557855 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 protein_id gnl|my_center|LOCUS_14770 1559283 1558771 gene locus_tag LOCUS_14780 gene lspA 1559283 1558771 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856491.1 protein_id gnl|my_center|LOCUS_14780 1559376 1560320 gene locus_tag LOCUS_14790 1559376 1560320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 protein_id gnl|my_center|LOCUS_14790 1560330 1562015 gene locus_tag LOCUS_14800 1560330 1562015 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014910.1 protein_id gnl|my_center|LOCUS_14800 1562614 1562012 gene locus_tag LOCUS_14810 1562614 1562012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1562732 1563670 gene locus_tag LOCUS_14820 1562732 1563670 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 protein_id gnl|my_center|LOCUS_14820 1565056 1563653 gene locus_tag LOCUS_14830 1565056 1563653 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 protein_id gnl|my_center|LOCUS_14830 1568278 1565090 gene locus_tag LOCUS_14840 gene ileS 1568278 1565090 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014916.1 protein_id gnl|my_center|LOCUS_14840 1569574 1568594 gene locus_tag LOCUS_14850 1569574 1568594 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 protein_id gnl|my_center|LOCUS_14850 1570094 1569789 gene locus_tag LOCUS_14860 1570094 1569789 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 protein_id gnl|my_center|LOCUS_14860 1570088 1570267 gene locus_tag LOCUS_14870 1570088 1570267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1570749 1570264 gene locus_tag LOCUS_14880 1570749 1570264 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856516.1 protein_id gnl|my_center|LOCUS_14880 1571538 1570822 gene locus_tag LOCUS_14890 1571538 1570822 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856518.1 protein_id gnl|my_center|LOCUS_14890 1572303 1571545 gene locus_tag LOCUS_14900 gene pgeF 1572303 1571545 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 protein_id gnl|my_center|LOCUS_14900 1573557 1572340 gene locus_tag LOCUS_14910 gene ftsZ 1573557 1572340 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 protein_id gnl|my_center|LOCUS_14910 1574487 1573732 gene locus_tag LOCUS_14920 gene ftsQ 1574487 1573732 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860375.1 protein_id gnl|my_center|LOCUS_14920 1575967 1574492 gene locus_tag LOCUS_14930 gene murC 1575967 1574492 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 protein_id gnl|my_center|LOCUS_14930 1577173 1576046 gene locus_tag LOCUS_14940 gene murG 1577173 1576046 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856529.1 protein_id gnl|my_center|LOCUS_14940 1578754 1577201 gene locus_tag LOCUS_14950 1578754 1577201 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014922.1 protein_id gnl|my_center|LOCUS_14950 1580278 1578857 gene locus_tag LOCUS_14960 gene murD 1580278 1578857 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 protein_id gnl|my_center|LOCUS_14960 1581384 1580278 gene locus_tag LOCUS_14970 gene mraY 1581384 1580278 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 protein_id gnl|my_center|LOCUS_14970 1582994 1581447 gene locus_tag LOCUS_14980 1582994 1581447 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 protein_id gnl|my_center|LOCUS_14980 1584586 1582991 gene locus_tag LOCUS_14990 1584586 1582991 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 protein_id gnl|my_center|LOCUS_14990 1586639 1584609 gene locus_tag LOCUS_15000 1586639 1584609 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 protein_id gnl|my_center|LOCUS_15000 1587586 1586771 gene locus_tag LOCUS_15010 1587586 1586771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014927.1 protein_id gnl|my_center|LOCUS_15010 1588632 1587583 gene locus_tag LOCUS_15020 gene rsmH 1588632 1587583 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 protein_id gnl|my_center|LOCUS_15020 1589262 1588828 gene locus_tag LOCUS_15030 gene mraZ 1589262 1588828 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 protein_id gnl|my_center|LOCUS_15030 1590116 1589733 gene locus_tag LOCUS_15040 1590116 1589733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1590621 1590208 gene locus_tag LOCUS_15050 1590621 1590208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1590787 1591398 gene locus_tag LOCUS_15060 1590787 1591398 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856553.1 protein_id gnl|my_center|LOCUS_15060 1591448 1592557 gene locus_tag LOCUS_15070 gene idsA 1591448 1592557 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_15070 1592550 1594091 gene locus_tag LOCUS_15080 1592550 1594091 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 protein_id gnl|my_center|LOCUS_15080 1594332 1593994 gene locus_tag LOCUS_15090 1594332 1593994 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 protein_id gnl|my_center|LOCUS_15090 1594407 1595681 gene locus_tag LOCUS_15100 1594407 1595681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1597082 1595694 gene locus_tag LOCUS_15110 1597082 1595694 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 protein_id gnl|my_center|LOCUS_15110 1597673 1597152 gene locus_tag LOCUS_15120 1597673 1597152 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 protein_id gnl|my_center|LOCUS_15120 1597914 1597675 gene locus_tag LOCUS_15130 1597914 1597675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1598678 1597941 gene locus_tag LOCUS_15140 1598678 1597941 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 protein_id gnl|my_center|LOCUS_15140 1599658 1598675 gene locus_tag LOCUS_15150 1599658 1598675 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 protein_id gnl|my_center|LOCUS_15150 1600833 1599682 gene locus_tag LOCUS_15160 gene pimB 1600833 1599682 CDS product GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014943.1 protein_id gnl|my_center|LOCUS_15160 1601864 1600833 gene locus_tag LOCUS_15170 1601864 1600833 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014944.1 protein_id gnl|my_center|LOCUS_15170 1602708 1602073 gene locus_tag LOCUS_15180 1602708 1602073 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 protein_id gnl|my_center|LOCUS_15180 1604855 1603239 gene locus_tag LOCUS_15190 gene qcrB 1604855 1603239 CDS product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 protein_id gnl|my_center|LOCUS_15190 1606078 1604855 gene locus_tag LOCUS_15200 1606078 1604855 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 protein_id gnl|my_center|LOCUS_15200 1606923 1606075 gene locus_tag LOCUS_15210 1606923 1606075 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 protein_id gnl|my_center|LOCUS_15210 1607570 1607004 gene locus_tag LOCUS_15220 1607570 1607004 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 protein_id gnl|my_center|LOCUS_15220 1608535 1608104 gene locus_tag LOCUS_15230 1608535 1608104 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 protein_id gnl|my_center|LOCUS_15230 1609648 1608554 gene locus_tag LOCUS_15240 1609648 1608554 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 protein_id gnl|my_center|LOCUS_15240 1610037 1611959 gene locus_tag LOCUS_15250 gene asnB 1610037 1611959 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 protein_id gnl|my_center|LOCUS_15250 1612386 1612042 gene locus_tag LOCUS_15260 1612386 1612042 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 protein_id gnl|my_center|LOCUS_15260 1612674 1613279 gene locus_tag LOCUS_15270 1612674 1613279 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856624.1 protein_id gnl|my_center|LOCUS_15270 1613334 1614317 gene locus_tag LOCUS_15280 gene cobT 1613334 1614317 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014954.1 protein_id gnl|my_center|LOCUS_15280 1615439 1614333 gene locus_tag LOCUS_15290 1615439 1614333 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014956.1 protein_id gnl|my_center|LOCUS_15290 1615570 1617042 gene locus_tag LOCUS_15300 1615570 1617042 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 protein_id gnl|my_center|LOCUS_15300 1617464 1617057 gene locus_tag LOCUS_15310 1617464 1617057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856631.1 protein_id gnl|my_center|LOCUS_15310 1617610 1619766 gene locus_tag LOCUS_15320 gene sucB 1617610 1619766 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 protein_id gnl|my_center|LOCUS_15320 1619893 1622772 gene locus_tag LOCUS_15330 gene gcvP 1619893 1622772 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_15330 1622783 1623850 gene locus_tag LOCUS_15340 gene gcvT 1622783 1623850 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_15340 1623854 1624240 gene locus_tag LOCUS_15350 gene gcvH 1623854 1624240 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908706.1 protein_id gnl|my_center|LOCUS_15350 1624253 1625041 gene locus_tag LOCUS_15360 gene lipB 1624253 1625041 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 protein_id gnl|my_center|LOCUS_15360 1625148 1626155 gene locus_tag LOCUS_15370 gene lipA 1625148 1626155 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 protein_id gnl|my_center|LOCUS_15370 1628337 1626232 gene locus_tag LOCUS_15380 1628337 1626232 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729863.1 protein_id gnl|my_center|LOCUS_15380 1629671 1628376 gene locus_tag LOCUS_15390 1629671 1628376 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726890.1 protein_id gnl|my_center|LOCUS_15390 1629900 1631234 gene locus_tag LOCUS_15400 1629900 1631234 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079898.1 protein_id gnl|my_center|LOCUS_15400 1631239 1632192 gene locus_tag LOCUS_15410 1631239 1632192 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510610.1 protein_id gnl|my_center|LOCUS_15410 1632260 1633918 gene locus_tag LOCUS_15420 1632260 1633918 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_15420 1633934 1634158 gene locus_tag LOCUS_15430 1633934 1634158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1634151 1635317 gene locus_tag LOCUS_15440 1634151 1635317 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239947.1 protein_id gnl|my_center|LOCUS_15440 1635292 1639059 gene locus_tag LOCUS_15450 1635292 1639059 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053385512.1 protein_id gnl|my_center|LOCUS_15450 1639697 1639056 gene locus_tag LOCUS_15460 1639697 1639056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1640802 1639726 gene locus_tag LOCUS_15470 gene dhbC 1640802 1639726 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_15470 1641535 1640795 gene locus_tag LOCUS_15480 1641535 1640795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1642385 1641585 gene locus_tag LOCUS_15490 1642385 1641585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_15490 1643428 1642382 gene locus_tag LOCUS_15500 1643428 1642382 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112992.1 protein_id gnl|my_center|LOCUS_15500 1644333 1643425 gene locus_tag LOCUS_15510 1644333 1643425 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_15510 1645482 1644424 gene locus_tag LOCUS_15520 1645482 1644424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1647118 1645508 gene locus_tag LOCUS_15530 1647118 1645508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1648162 1647149 gene locus_tag LOCUS_15540 1648162 1647149 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581989.1 protein_id gnl|my_center|LOCUS_15540 1650798 1648348 gene locus_tag LOCUS_15550 1650798 1648348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1651031 1651813 gene locus_tag LOCUS_15560 1651031 1651813 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 protein_id gnl|my_center|LOCUS_15560 1652287 1651820 gene locus_tag LOCUS_15570 1652287 1651820 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 protein_id gnl|my_center|LOCUS_15570 1652401 1653837 gene locus_tag LOCUS_15580 gene glnA 1652401 1653837 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 protein_id gnl|my_center|LOCUS_15580 1654123 1654914 gene locus_tag LOCUS_15590 1654123 1654914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1654904 1655431 gene locus_tag LOCUS_15600 1654904 1655431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1656038 1655454 gene locus_tag LOCUS_15610 1656038 1655454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1656563 1656039 gene locus_tag LOCUS_15620 1656563 1656039 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 protein_id gnl|my_center|LOCUS_15620 1656654 1657427 gene locus_tag LOCUS_15630 1656654 1657427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1658370 1657441 gene locus_tag LOCUS_15640 1658370 1657441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1658506 1658354 gene locus_tag LOCUS_15650 1658506 1658354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1659965 1658514 gene locus_tag LOCUS_15660 gene thrC 1659965 1658514 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 protein_id gnl|my_center|LOCUS_15660 1660025 1661326 gene locus_tag LOCUS_15670 1660025 1661326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856952.1 protein_id gnl|my_center|LOCUS_15670 1661594 1661340 gene locus_tag LOCUS_15680 1661594 1661340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1664704 1661663 gene locus_tag LOCUS_15690 1664704 1661663 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 protein_id gnl|my_center|LOCUS_15690 1666041 1664707 gene locus_tag LOCUS_15700 1666041 1664707 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 protein_id gnl|my_center|LOCUS_15700 1666167 1667759 gene locus_tag LOCUS_15710 1666167 1667759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1667969 1667763 gene locus_tag LOCUS_15720 1667969 1667763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1668093 1669304 gene locus_tag LOCUS_15730 1668093 1669304 CDS product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856970.1 protein_id gnl|my_center|LOCUS_15730 1670803 1669310 gene locus_tag LOCUS_15740 1670803 1669310 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856972.1 protein_id gnl|my_center|LOCUS_15740 1672304 1671207 gene locus_tag LOCUS_15750 1672304 1671207 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859605.1 protein_id gnl|my_center|LOCUS_15750 1672970 1672311 gene locus_tag LOCUS_15760 1672970 1672311 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014976.1 protein_id gnl|my_center|LOCUS_15760 1674163 1673021 gene locus_tag LOCUS_15770 1674163 1673021 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 protein_id gnl|my_center|LOCUS_15770 1674241 1674720 gene locus_tag LOCUS_15780 1674241 1674720 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 protein_id gnl|my_center|LOCUS_15780 1674730 1675611 gene locus_tag LOCUS_15790 1674730 1675611 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 protein_id gnl|my_center|LOCUS_15790 1675633 1676073 gene locus_tag LOCUS_15800 1675633 1676073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1676105 1676030 gene locus_tag LOCUS_t00360 1676105 1676030 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1676587 1676153 gene locus_tag LOCUS_15810 1676587 1676153 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859595.1 protein_id gnl|my_center|LOCUS_15810 1676688 1679465 gene locus_tag LOCUS_15820 gene aceE 1676688 1679465 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 protein_id gnl|my_center|LOCUS_15820 1680682 1679834 gene locus_tag LOCUS_15830 1680682 1679834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1681630 1680710 gene locus_tag LOCUS_15840 1681630 1680710 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856999.1 protein_id gnl|my_center|LOCUS_15840 1681629 1681904 gene locus_tag LOCUS_15850 1681629 1681904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1683849 1681915 gene locus_tag LOCUS_15860 gene ggt 1683849 1681915 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014002.1 protein_id gnl|my_center|LOCUS_15860 1684176 1683904 gene locus_tag LOCUS_15870 1684176 1683904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1685572 1684199 gene locus_tag LOCUS_15880 1685572 1684199 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731470.1 protein_id gnl|my_center|LOCUS_15880 1685885 1685565 gene locus_tag LOCUS_15890 1685885 1685565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1687061 1686138 gene locus_tag LOCUS_15900 1687061 1686138 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014098.1 protein_id gnl|my_center|LOCUS_15900 1688013 1687072 gene locus_tag LOCUS_15910 1688013 1687072 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 protein_id gnl|my_center|LOCUS_15910 1689445 1688018 gene locus_tag LOCUS_15920 1689445 1688018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 protein_id gnl|my_center|LOCUS_15920 1690291 1689473 gene locus_tag LOCUS_15930 1690291 1689473 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 protein_id gnl|my_center|LOCUS_15930 1691132 1690302 gene locus_tag LOCUS_15940 1691132 1690302 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013417.1 protein_id gnl|my_center|LOCUS_15940 1691250 1692863 gene locus_tag LOCUS_15950 1691250 1692863 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404324.1 protein_id gnl|my_center|LOCUS_15950 1693185 1693376 gene locus_tag LOCUS_15960 1693185 1693376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1693624 1694409 gene locus_tag LOCUS_15970 1693624 1694409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15970 1694352 1695122 gene locus_tag LOCUS_15980 1694352 1695122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 1695420 1695836 gene locus_tag LOCUS_15990 1695420 1695836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1695875 1696696 gene locus_tag LOCUS_16000 1695875 1696696 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301552.1 protein_id gnl|my_center|LOCUS_16000 1696976 1696728 gene locus_tag LOCUS_16010 1696976 1696728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1697566 1697742 gene locus_tag LOCUS_16020 1697566 1697742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1697748 1698515 gene locus_tag LOCUS_16030 gene istB 1697748 1698515 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024318137.1 protein_id gnl|my_center|LOCUS_16030 1698699 1700519 gene locus_tag LOCUS_16040 1698699 1700519 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065612062.1 protein_id gnl|my_center|LOCUS_16040 1701031 1700720 gene locus_tag LOCUS_16050 1701031 1700720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1700991 1701653 gene locus_tag LOCUS_16060 1700991 1701653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16060 1702811 1702053 gene locus_tag LOCUS_16070 1702811 1702053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1703375 1702815 gene locus_tag LOCUS_16080 1703375 1702815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1704770 1703421 gene locus_tag LOCUS_16090 1704770 1703421 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_16090 1706118 1705582 gene locus_tag LOCUS_16100 1706118 1705582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1706405 1706332 gene locus_tag LOCUS_t00370 1706405 1706332 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1706578 1706652 gene locus_tag LOCUS_t00380 1706578 1706652 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1706705 1706962 gene locus_tag LOCUS_16110 1706705 1706962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014998.1 protein_id gnl|my_center|LOCUS_16110 1707891 1706959 gene locus_tag LOCUS_16120 gene ppx2 1707891 1706959 CDS product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 protein_id gnl|my_center|LOCUS_16120 1708433 1707888 gene locus_tag LOCUS_16130 1708433 1707888 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 protein_id gnl|my_center|LOCUS_16130 1708905 1708474 gene locus_tag LOCUS_16140 1708905 1708474 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014020.1 protein_id gnl|my_center|LOCUS_16140 1710440 1709163 gene locus_tag LOCUS_16150 gene eno 1710440 1709163 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 protein_id gnl|my_center|LOCUS_16150 1711376 1710525 gene locus_tag LOCUS_16160 1711376 1710525 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 protein_id gnl|my_center|LOCUS_16160 1711570 1713054 gene locus_tag LOCUS_16170 1711570 1713054 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030671.1 protein_id gnl|my_center|LOCUS_16170 1713106 1714920 gene locus_tag LOCUS_16180 1713106 1714920 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730664.1 protein_id gnl|my_center|LOCUS_16180 1715877 1714981 gene locus_tag LOCUS_16190 1715877 1714981 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_16190 1716676 1715927 gene locus_tag LOCUS_16200 1716676 1715927 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_16200 1717768 1716857 gene locus_tag LOCUS_16210 1717768 1716857 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727988.1 protein_id gnl|my_center|LOCUS_16210 1717905 1719068 gene locus_tag LOCUS_16220 1717905 1719068 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_16220 1719102 1720328 gene locus_tag LOCUS_16230 1719102 1720328 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259394.1 protein_id gnl|my_center|LOCUS_16230 1720341 1721543 gene locus_tag LOCUS_16240 1720341 1721543 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 protein_id gnl|my_center|LOCUS_16240 1721551 1722048 gene locus_tag LOCUS_16250 1721551 1722048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1722641 1722045 gene locus_tag LOCUS_16260 1722641 1722045 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014016.1 protein_id gnl|my_center|LOCUS_16260 1722687 1723328 gene locus_tag LOCUS_16270 1722687 1723328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1725385 1723496 gene locus_tag LOCUS_16280 gene dnaG 1725385 1723496 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 protein_id gnl|my_center|LOCUS_16280 1725433 1725828 gene locus_tag LOCUS_16290 1725433 1725828 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726744.1 protein_id gnl|my_center|LOCUS_16290 1727123 1725825 gene locus_tag LOCUS_16300 1727123 1725825 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015002.1 protein_id gnl|my_center|LOCUS_16300 1727180 1729180 gene locus_tag LOCUS_16310 1727180 1729180 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 protein_id gnl|my_center|LOCUS_16310 1729583 1729185 gene locus_tag LOCUS_16320 1729583 1729185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1730092 1729583 gene locus_tag LOCUS_16330 1730092 1729583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1731476 1730097 gene locus_tag LOCUS_16340 1731476 1730097 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 protein_id gnl|my_center|LOCUS_16340 1731721 1731990 gene locus_tag LOCUS_16350 1731721 1731990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1731990 1732178 gene locus_tag LOCUS_16360 1731990 1732178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1732190 1732621 gene locus_tag LOCUS_16370 1732190 1732621 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 protein_id gnl|my_center|LOCUS_16370 1733362 1732631 gene locus_tag LOCUS_16380 1733362 1732631 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 protein_id gnl|my_center|LOCUS_16380 1734089 1733370 gene locus_tag LOCUS_16390 gene recO 1734089 1733370 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 protein_id gnl|my_center|LOCUS_16390 1735036 1734098 gene locus_tag LOCUS_16400 gene era 1735036 1734098 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 protein_id gnl|my_center|LOCUS_16400 1736954 1735047 gene locus_tag LOCUS_16410 1736954 1735047 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_16410 1737890 1736955 gene locus_tag LOCUS_16420 1737890 1736955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1739256 1737922 gene locus_tag LOCUS_16430 1739256 1737922 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222506.1 protein_id gnl|my_center|LOCUS_16430 1740941 1739319 gene locus_tag LOCUS_16440 1740941 1739319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729550.1 protein_id gnl|my_center|LOCUS_16440 1742598 1740934 gene locus_tag LOCUS_16450 1742598 1740934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268118.1 protein_id gnl|my_center|LOCUS_16450 1743445 1742615 gene locus_tag LOCUS_16460 1743445 1742615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 protein_id gnl|my_center|LOCUS_16460 1744485 1743448 gene locus_tag LOCUS_16470 1744485 1743448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385705.1 protein_id gnl|my_center|LOCUS_16470 1745500 1744649 gene locus_tag LOCUS_16480 gene pdxY 1745500 1744649 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_16480 1746904 1745585 gene locus_tag LOCUS_16490 1746904 1745585 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 protein_id gnl|my_center|LOCUS_16490 1747471 1746905 gene locus_tag LOCUS_16500 gene ybeY 1747471 1746905 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 protein_id gnl|my_center|LOCUS_16500 1748478 1747468 gene locus_tag LOCUS_16510 1748478 1747468 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 protein_id gnl|my_center|LOCUS_16510 1749194 1748490 gene locus_tag LOCUS_16520 1749194 1748490 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 protein_id gnl|my_center|LOCUS_16520 1750333 1749191 gene locus_tag LOCUS_16530 gene dnaJ 1750333 1749191 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015015.1 protein_id gnl|my_center|LOCUS_16530 1751376 1750363 gene locus_tag LOCUS_16540 gene hrcA 1751376 1750363 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 protein_id gnl|my_center|LOCUS_16540 1752532 1751420 gene locus_tag LOCUS_16550 gene hemW 1752532 1751420 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 protein_id gnl|my_center|LOCUS_16550 1753222 1752554 gene locus_tag LOCUS_16560 1753222 1752554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 protein_id gnl|my_center|LOCUS_16560 1753346 1753188 gene locus_tag LOCUS_16570 1753346 1753188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1755200 1753362 gene locus_tag LOCUS_16580 1755200 1753362 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 protein_id gnl|my_center|LOCUS_16580 1755271 1757376 gene locus_tag LOCUS_16590 gene malQ 1755271 1757376 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015019.1 protein_id gnl|my_center|LOCUS_16590 1757513 1757373 gene locus_tag LOCUS_16600 1757513 1757373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1757891 1757703 gene locus_tag LOCUS_16610 1757891 1757703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1759852 1757894 gene locus_tag LOCUS_16620 1759852 1757894 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 protein_id gnl|my_center|LOCUS_16620 1759895 1761160 gene locus_tag LOCUS_16630 1759895 1761160 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015022.1 protein_id gnl|my_center|LOCUS_16630 1761735 1761181 gene locus_tag LOCUS_16640 1761735 1761181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015028.1 protein_id gnl|my_center|LOCUS_16640 1761821 1763683 gene locus_tag LOCUS_16650 1761821 1763683 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 protein_id gnl|my_center|LOCUS_16650 1763935 1763672 gene locus_tag LOCUS_16660 1763935 1763672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1763979 1765694 gene locus_tag LOCUS_16670 gene treS 1763979 1765694 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396061.1 protein_id gnl|my_center|LOCUS_16670 1765687 1766778 gene locus_tag LOCUS_16680 1765687 1766778 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015024.1 protein_id gnl|my_center|LOCUS_16680 1766855 1768252 gene locus_tag LOCUS_16690 gene brnQ 1766855 1768252 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 protein_id gnl|my_center|LOCUS_16690 1768273 1769259 gene locus_tag LOCUS_16700 1768273 1769259 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 protein_id gnl|my_center|LOCUS_16700 1769309 1770784 gene locus_tag LOCUS_16710 1769309 1770784 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 protein_id gnl|my_center|LOCUS_16710 1770781 1771704 gene locus_tag LOCUS_16720 1770781 1771704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015038.1 protein_id gnl|my_center|LOCUS_16720 1771701 1772483 gene locus_tag LOCUS_16730 1771701 1772483 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 protein_id gnl|my_center|LOCUS_16730 1772470 1773825 gene locus_tag LOCUS_16740 1772470 1773825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015040.1 protein_id gnl|my_center|LOCUS_16740 1775111 1773837 gene locus_tag LOCUS_16750 1775111 1773837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1775294 1775157 gene locus_tag LOCUS_16760 1775294 1775157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1776510 1775338 gene locus_tag LOCUS_16770 1776510 1775338 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 protein_id gnl|my_center|LOCUS_16770 1778372 1776516 gene locus_tag LOCUS_16780 gene lepA 1778372 1776516 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 protein_id gnl|my_center|LOCUS_16780 1778512 1779009 gene locus_tag LOCUS_16790 1778512 1779009 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859345.1 protein_id gnl|my_center|LOCUS_16790 1779201 1779473 gene locus_tag LOCUS_16800 gene rpsT 1779201 1779473 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 protein_id gnl|my_center|LOCUS_16800 1780197 1779550 gene locus_tag LOCUS_16810 1780197 1779550 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 protein_id gnl|my_center|LOCUS_16810 1780604 1780194 gene locus_tag LOCUS_16820 1780604 1780194 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567697.1 protein_id gnl|my_center|LOCUS_16820 1781568 1780627 gene locus_tag LOCUS_16830 gene holA 1781568 1780627 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 protein_id gnl|my_center|LOCUS_16830 1783190 1781565 gene locus_tag LOCUS_16840 1783190 1781565 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015058.1 protein_id gnl|my_center|LOCUS_16840 1783840 1783193 gene locus_tag LOCUS_16850 1783840 1783193 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015059.1 protein_id gnl|my_center|LOCUS_16850 1784799 1783990 gene locus_tag LOCUS_16860 1784799 1783990 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015060.1 protein_id gnl|my_center|LOCUS_16860 1785446 1784799 gene locus_tag LOCUS_16870 1785446 1784799 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859329.1 protein_id gnl|my_center|LOCUS_16870 1786003 1785515 gene locus_tag LOCUS_16880 gene rsfS 1786003 1785515 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859327.1 protein_id gnl|my_center|LOCUS_16880 1786695 1786078 gene locus_tag LOCUS_16890 gene nadD 1786695 1786078 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 protein_id gnl|my_center|LOCUS_16890 1788113 1786821 gene locus_tag LOCUS_16900 1788113 1786821 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 protein_id gnl|my_center|LOCUS_16900 1789285 1788368 gene locus_tag LOCUS_16910 1789285 1788368 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 protein_id gnl|my_center|LOCUS_16910 1789366 1789914 gene locus_tag LOCUS_16920 gene fcoT 1789366 1789914 CDS product fatty acyl CoA thioesterase FcoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899810.1 protein_id gnl|my_center|LOCUS_16920 1790128 1790598 gene locus_tag LOCUS_16930 1790128 1790598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1791761 1790628 gene locus_tag LOCUS_16940 gene proB 1791761 1790628 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 protein_id gnl|my_center|LOCUS_16940 1793294 1791789 gene locus_tag LOCUS_16950 gene obgE 1793294 1791789 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 protein_id gnl|my_center|LOCUS_16950 1793756 1793433 gene locus_tag LOCUS_16960 gene rpmA 1793756 1793433 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 protein_id gnl|my_center|LOCUS_16960 1794081 1793776 gene locus_tag LOCUS_16970 gene rplU 1794081 1793776 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 protein_id gnl|my_center|LOCUS_16970 1796900 1794309 gene locus_tag LOCUS_16980 1796900 1794309 CDS product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015068.1 protein_id gnl|my_center|LOCUS_16980 1797696 1797106 gene locus_tag LOCUS_16990 1797696 1797106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1799421 1797781 gene locus_tag LOCUS_17000 1799421 1797781 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_17000 1800007 1799597 gene locus_tag LOCUS_17010 gene ndk 1800007 1799597 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 protein_id gnl|my_center|LOCUS_17010 1800148 1801653 gene locus_tag LOCUS_17020 1800148 1801653 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_17020 1801749 1802954 gene locus_tag LOCUS_17030 1801749 1802954 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776991.1 protein_id gnl|my_center|LOCUS_17030 1802985 1804169 gene locus_tag LOCUS_17040 1802985 1804169 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776991.1 protein_id gnl|my_center|LOCUS_17040 1805140 1804364 gene locus_tag LOCUS_17050 1805140 1804364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1805856 1805146 gene locus_tag LOCUS_17060 1805856 1805146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1809236 1807056 gene locus_tag LOCUS_17070 1809236 1807056 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_17070 1810394 1809243 gene locus_tag LOCUS_17080 1810394 1809243 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338901.1 protein_id gnl|my_center|LOCUS_17080 1811077 1810640 gene locus_tag LOCUS_17090 1811077 1810640 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 protein_id gnl|my_center|LOCUS_17090 1812534 1811074 gene locus_tag LOCUS_17100 1812534 1811074 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567661.1 protein_id gnl|my_center|LOCUS_17100 1815237 1812535 gene locus_tag LOCUS_17110 1815237 1812535 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 protein_id gnl|my_center|LOCUS_17110 1816335 1815334 gene locus_tag LOCUS_17120 1816335 1815334 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015079.1 protein_id gnl|my_center|LOCUS_17120 1816629 1817354 gene locus_tag LOCUS_17130 1816629 1817354 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 protein_id gnl|my_center|LOCUS_17130 1818641 1817364 gene locus_tag LOCUS_17140 gene clpX 1818641 1817364 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015085.1 protein_id gnl|my_center|LOCUS_17140 1818823 1819611 gene locus_tag LOCUS_17150 gene pcaD 1818823 1819611 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015088.1 protein_id gnl|my_center|LOCUS_17150 1819713 1820063 gene locus_tag LOCUS_17160 1819713 1820063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1821306 1820020 gene locus_tag LOCUS_17170 1821306 1820020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1822535 1821312 gene locus_tag LOCUS_17180 1822535 1821312 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015432.1 protein_id gnl|my_center|LOCUS_17180 1823225 1822605 gene locus_tag LOCUS_17190 1823225 1822605 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 protein_id gnl|my_center|LOCUS_17190 1823837 1823253 gene locus_tag LOCUS_17200 1823837 1823253 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_17200 1825419 1824019 gene locus_tag LOCUS_17210 gene tig 1825419 1824019 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 protein_id gnl|my_center|LOCUS_17210 1825570 1825496 gene locus_tag LOCUS_t00390 1825570 1825496 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1825834 1825760 gene locus_tag LOCUS_t00400 1825834 1825760 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1825978 1826751 gene locus_tag LOCUS_17220 1825978 1826751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015105.1 protein_id gnl|my_center|LOCUS_17220 1826967 1827947 gene locus_tag LOCUS_17230 1826967 1827947 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_17230 1827950 1828750 gene locus_tag LOCUS_17240 1827950 1828750 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 protein_id gnl|my_center|LOCUS_17240 1828816 1829589 gene locus_tag LOCUS_17250 1828816 1829589 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_17250 1829603 1830553 gene locus_tag LOCUS_17260 1829603 1830553 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_17260 1830576 1831937 gene locus_tag LOCUS_17270 1830576 1831937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17270 1831947 1832777 gene locus_tag LOCUS_17280 1831947 1832777 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567680.1 protein_id gnl|my_center|LOCUS_17280 1834531 1832762 gene locus_tag LOCUS_17290 1834531 1832762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1835631 1834528 gene locus_tag LOCUS_17300 1835631 1834528 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_17300 1836605 1835628 gene locus_tag LOCUS_17310 1836605 1835628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1836670 1837503 gene locus_tag LOCUS_17320 1836670 1837503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1837500 1838378 gene locus_tag LOCUS_17330 1837500 1838378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1838354 1839463 gene locus_tag LOCUS_17340 1838354 1839463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1839937 1839464 gene locus_tag LOCUS_17350 1839937 1839464 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 protein_id gnl|my_center|LOCUS_17350 1840586 1839972 gene locus_tag LOCUS_17360 1840586 1839972 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 protein_id gnl|my_center|LOCUS_17360 1840640 1843030 gene locus_tag LOCUS_17370 gene pepN 1840640 1843030 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015108.1 protein_id gnl|my_center|LOCUS_17370 1843129 1843410 gene locus_tag LOCUS_17380 1843129 1843410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1843487 1844695 gene locus_tag LOCUS_17390 1843487 1844695 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804927.1 protein_id gnl|my_center|LOCUS_17390 1844692 1845999 gene locus_tag LOCUS_17400 1844692 1845999 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_17400 1846628 1845996 gene locus_tag LOCUS_17410 1846628 1845996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567537.1 protein_id gnl|my_center|LOCUS_17410 1847056 1846625 gene locus_tag LOCUS_17420 1847056 1846625 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 protein_id gnl|my_center|LOCUS_17420 1848749 1847079 gene locus_tag LOCUS_17430 gene ettA 1848749 1847079 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015133.1 protein_id gnl|my_center|LOCUS_17430 1849388 1848816 gene locus_tag LOCUS_17440 1849388 1848816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1851563 1849554 gene locus_tag LOCUS_17450 1851563 1849554 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015135.1 protein_id gnl|my_center|LOCUS_17450 1851677 1851751 gene locus_tag LOCUS_t00410 1851677 1851751 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1851864 1851992 gene locus_tag LOCUS_17460 1851864 1851992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1851995 1852129 gene locus_tag LOCUS_17470 1851995 1852129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1852271 1853632 gene locus_tag LOCUS_17480 1852271 1853632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_17480 1853641 1854054 gene locus_tag LOCUS_17490 1853641 1854054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1854057 1854365 gene locus_tag LOCUS_17500 1854057 1854365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1854751 1855812 gene locus_tag LOCUS_17510 1854751 1855812 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_17510 1855829 1856644 gene locus_tag LOCUS_17520 gene cmrA 1855829 1856644 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015148.1 protein_id gnl|my_center|LOCUS_17520 1856645 1857274 gene locus_tag LOCUS_17530 gene orn 1856645 1857274 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 protein_id gnl|my_center|LOCUS_17530 1857324 1857398 gene locus_tag LOCUS_t00420 1857324 1857398 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1858321 1857653 gene locus_tag LOCUS_17540 1858321 1857653 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854638.1 protein_id gnl|my_center|LOCUS_17540 1859150 1858332 gene locus_tag LOCUS_17550 1859150 1858332 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111893.1 protein_id gnl|my_center|LOCUS_17550 1859986 1859147 gene locus_tag LOCUS_17560 1859986 1859147 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111894.1 protein_id gnl|my_center|LOCUS_17560 1860606 1859983 gene locus_tag LOCUS_17570 1860606 1859983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1861742 1860609 gene locus_tag LOCUS_17580 1861742 1860609 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115334.1 protein_id gnl|my_center|LOCUS_17580 1863118 1861892 gene locus_tag LOCUS_17590 1863118 1861892 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 protein_id gnl|my_center|LOCUS_17590 1863294 1863368 gene locus_tag LOCUS_t00430 1863294 1863368 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1863448 1864011 gene locus_tag LOCUS_17600 1863448 1864011 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 protein_id gnl|my_center|LOCUS_17600 1864337 1864062 gene locus_tag LOCUS_17610 1864337 1864062 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015163.1 protein_id gnl|my_center|LOCUS_17610 1864406 1864882 gene locus_tag LOCUS_17620 gene bcp 1864406 1864882 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 protein_id gnl|my_center|LOCUS_17620 1864987 1864905 gene locus_tag LOCUS_t00440 1864987 1864905 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1865099 1865557 gene locus_tag LOCUS_17630 1865099 1865557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857998.1 protein_id gnl|my_center|LOCUS_17630 1865554 1865916 gene locus_tag LOCUS_17640 1865554 1865916 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 protein_id gnl|my_center|LOCUS_17640 1866550 1865954 gene locus_tag LOCUS_17650 gene rdgB 1866550 1865954 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015172.1 protein_id gnl|my_center|LOCUS_17650 1867278 1866544 gene locus_tag LOCUS_17660 gene rph 1867278 1866544 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 protein_id gnl|my_center|LOCUS_17660 1868073 1867294 gene locus_tag LOCUS_17670 gene cdpA 1868073 1867294 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857989.1 protein_id gnl|my_center|LOCUS_17670 1868887 1868126 gene locus_tag LOCUS_17680 gene murI 1868887 1868126 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_17680 1869685 1869005 gene locus_tag LOCUS_17690 1869685 1869005 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 protein_id gnl|my_center|LOCUS_17690 1870610 1869696 gene locus_tag LOCUS_17700 1870610 1869696 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 protein_id gnl|my_center|LOCUS_17700 1871226 1870687 gene locus_tag LOCUS_17710 1871226 1870687 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 protein_id gnl|my_center|LOCUS_17710 1871558 1871259 gene locus_tag LOCUS_17720 gene clpS 1871558 1871259 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 protein_id gnl|my_center|LOCUS_17720 1871712 1873049 gene locus_tag LOCUS_17730 1871712 1873049 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 protein_id gnl|my_center|LOCUS_17730 1873069 1875030 gene locus_tag LOCUS_17740 1873069 1875030 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015186.1 protein_id gnl|my_center|LOCUS_17740 1875736 1874990 gene locus_tag LOCUS_17750 1875736 1874990 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 protein_id gnl|my_center|LOCUS_17750 1876989 1875736 gene locus_tag LOCUS_17760 gene serB 1876989 1875736 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082353449.1 protein_id gnl|my_center|LOCUS_17760 1877163 1877579 gene locus_tag LOCUS_17770 1877163 1877579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1877618 1878439 gene locus_tag LOCUS_17780 1877618 1878439 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301552.1 protein_id gnl|my_center|LOCUS_17780 1880307 1878517 gene locus_tag LOCUS_17790 gene ctaD 1880307 1878517 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015188.1 protein_id gnl|my_center|LOCUS_17790 1881591 1880581 gene locus_tag LOCUS_17800 gene nrdF 1881591 1880581 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 protein_id gnl|my_center|LOCUS_17800 1881752 1882504 gene locus_tag LOCUS_17810 1881752 1882504 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567723.1 protein_id gnl|my_center|LOCUS_17810 1884677 1882512 gene locus_tag LOCUS_17820 gene nrdE 1884677 1882512 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 protein_id gnl|my_center|LOCUS_17820 1885227 1884691 gene locus_tag LOCUS_17830 gene nrdI 1885227 1884691 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 protein_id gnl|my_center|LOCUS_17830 1885523 1885293 gene locus_tag LOCUS_17840 gene nrdH 1885523 1885293 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857948.1 protein_id gnl|my_center|LOCUS_17840 1885928 1885806 gene locus_tag LOCUS_17850 gene ykgO 1885928 1885806 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 protein_id gnl|my_center|LOCUS_17850 1886078 1886926 gene locus_tag LOCUS_17860 gene nadE 1886078 1886926 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015194.1 protein_id gnl|my_center|LOCUS_17860 1887681 1886923 gene locus_tag LOCUS_17870 1887681 1886923 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015195.1 protein_id gnl|my_center|LOCUS_17870 1888191 1887709 gene locus_tag LOCUS_17880 1888191 1887709 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_17880 1888889 1888188 gene locus_tag LOCUS_17890 gene bioD 1888889 1888188 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_17890 1890025 1888886 gene locus_tag LOCUS_17900 1890025 1888886 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111242.1 protein_id gnl|my_center|LOCUS_17900 1891340 1890048 gene locus_tag LOCUS_17910 1891340 1890048 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_17910 1892063 1892899 gene locus_tag LOCUS_17920 1892063 1892899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1893037 1893342 gene locus_tag LOCUS_17930 1893037 1893342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1893899 1893826 gene locus_tag LOCUS_t00450 1893899 1893826 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1894001 1893928 gene locus_tag LOCUS_t00460 1894001 1893928 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1894822 1894076 gene locus_tag LOCUS_17940 1894822 1894076 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 protein_id gnl|my_center|LOCUS_17940 1895362 1894868 gene locus_tag LOCUS_17950 1895362 1894868 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_17950 1897061 1895418 gene locus_tag LOCUS_17960 gene pgm 1897061 1895418 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 protein_id gnl|my_center|LOCUS_17960 1897174 1897479 gene locus_tag LOCUS_17970 1897174 1897479 CDS product fluoride efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015200.1 protein_id gnl|my_center|LOCUS_17970 1897479 1897835 gene locus_tag LOCUS_17980 1897479 1897835 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860253.1 protein_id gnl|my_center|LOCUS_17980 1899418 1897850 gene locus_tag LOCUS_17990 1899418 1897850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013368.1 protein_id gnl|my_center|LOCUS_17990 1902086 1899555 gene locus_tag LOCUS_18000 1902086 1899555 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_18000 1902835 1902089 gene locus_tag LOCUS_18010 1902835 1902089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_18010 1905521 1902978 gene locus_tag LOCUS_18020 1905521 1902978 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_18020 1906297 1905533 gene locus_tag LOCUS_18030 1906297 1905533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_18030 1906524 1906420 gene locus_tag LOCUS_r00070 1906524 1906420 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1909730 1906665 gene locus_tag LOCUS_r00080 1909730 1906665 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1911597 1910086 gene locus_tag LOCUS_r00090 1911597 1910086 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1913393 1912143 gene locus_tag LOCUS_18040 gene murA 1913393 1912143 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 protein_id gnl|my_center|LOCUS_18040 1914259 1913420 gene locus_tag LOCUS_18050 1914259 1913420 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 protein_id gnl|my_center|LOCUS_18050 1914511 1915482 gene locus_tag LOCUS_18060 gene cysK 1914511 1915482 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 protein_id gnl|my_center|LOCUS_18060 1915487 1916113 gene locus_tag LOCUS_18070 gene cysE 1915487 1916113 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 protein_id gnl|my_center|LOCUS_18070 1917115 1916132 gene locus_tag LOCUS_18080 1917115 1916132 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894804.1 protein_id gnl|my_center|LOCUS_18080 1918894 1917545 gene locus_tag LOCUS_18090 1918894 1917545 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_18090 1919152 1920444 gene locus_tag LOCUS_18100 1919152 1920444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1920767 1920477 gene locus_tag LOCUS_18110 1920767 1920477 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 protein_id gnl|my_center|LOCUS_18110 1920941 1920868 gene locus_tag LOCUS_t00470 1920941 1920868 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1921040 1920966 gene locus_tag LOCUS_t00480 1921040 1920966 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1921304 1921230 gene locus_tag LOCUS_t00490 1921304 1921230 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1921417 1921344 gene locus_tag LOCUS_t00500 1921417 1921344 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1921575 1921892 gene locus_tag LOCUS_18120 1921575 1921892 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_18120 1921892 1922476 gene locus_tag LOCUS_18130 1921892 1922476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863725.1 protein_id gnl|my_center|LOCUS_18130 1922584 1922511 gene locus_tag LOCUS_t00510 1922584 1922511 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1922688 1923722 gene locus_tag LOCUS_18140 1922688 1923722 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858297.1 protein_id gnl|my_center|LOCUS_18140 1923719 1924486 gene locus_tag LOCUS_18150 1923719 1924486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1924499 1925428 gene locus_tag LOCUS_18160 1924499 1925428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1926959 1925457 gene locus_tag LOCUS_18170 1926959 1925457 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015219.1 protein_id gnl|my_center|LOCUS_18170 1927097 1928266 gene locus_tag LOCUS_18180 gene dusB 1927097 1928266 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858945.1 protein_id gnl|my_center|LOCUS_18180 1928269 1929045 gene locus_tag LOCUS_18190 gene phoU 1928269 1929045 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 protein_id gnl|my_center|LOCUS_18190 1929832 1929059 gene locus_tag LOCUS_18200 gene pstB 1929832 1929059 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015221.1 protein_id gnl|my_center|LOCUS_18200 1930816 1929863 gene locus_tag LOCUS_18210 gene pstA 1930816 1929863 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 protein_id gnl|my_center|LOCUS_18210 1931912 1930833 gene locus_tag LOCUS_18220 gene pstC 1931912 1930833 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858938.1 protein_id gnl|my_center|LOCUS_18220 1933221 1932085 gene locus_tag LOCUS_18230 gene pstS 1933221 1932085 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015224.1 protein_id gnl|my_center|LOCUS_18230 1934293 1933433 gene locus_tag LOCUS_18240 gene mshD 1934293 1933433 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015225.1 protein_id gnl|my_center|LOCUS_18240 1934362 1935102 gene locus_tag LOCUS_18250 1934362 1935102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1935113 1935772 gene locus_tag LOCUS_18260 1935113 1935772 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 protein_id gnl|my_center|LOCUS_18260 1936677 1935769 gene locus_tag LOCUS_18270 1936677 1935769 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 protein_id gnl|my_center|LOCUS_18270 1936697 1937809 gene locus_tag LOCUS_18280 1936697 1937809 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015229.1 protein_id gnl|my_center|LOCUS_18280 1938319 1938504 gene locus_tag LOCUS_18290 1938319 1938504 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 protein_id gnl|my_center|LOCUS_18290 1939629 1938553 gene locus_tag LOCUS_18300 gene purM 1939629 1938553 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 protein_id gnl|my_center|LOCUS_18300 1941174 1939633 gene locus_tag LOCUS_18310 gene purF 1941174 1939633 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 protein_id gnl|my_center|LOCUS_18310 1941573 1941184 gene locus_tag LOCUS_18320 1941573 1941184 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087146.1 protein_id gnl|my_center|LOCUS_18320 1941651 1942616 gene locus_tag LOCUS_18330 1941651 1942616 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015231.1 protein_id gnl|my_center|LOCUS_18330 1944920 1942635 gene locus_tag LOCUS_18340 gene purL 1944920 1942635 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015233.1 protein_id gnl|my_center|LOCUS_18340 1945596 1944925 gene locus_tag LOCUS_18350 gene purQ 1945596 1944925 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863118.1 protein_id gnl|my_center|LOCUS_18350 1945835 1945593 gene locus_tag LOCUS_18360 gene purS 1945835 1945593 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854010.1 protein_id gnl|my_center|LOCUS_18360 1946092 1948629 gene locus_tag LOCUS_18370 1946092 1948629 CDS product SpnA family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015235.1 protein_id gnl|my_center|LOCUS_18370 1949130 1948633 gene locus_tag LOCUS_18380 1949130 1948633 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_18380 1949831 1949145 gene locus_tag LOCUS_18390 1949831 1949145 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854006.1 protein_id gnl|my_center|LOCUS_18390 1950188 1950691 gene locus_tag LOCUS_18400 1950188 1950691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1950709 1950978 gene locus_tag LOCUS_18410 1950709 1950978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1953201 1951054 gene locus_tag LOCUS_18420 1953201 1951054 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015237.1 protein_id gnl|my_center|LOCUS_18420 1954169 1953273 gene locus_tag LOCUS_18430 1954169 1953273 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 protein_id gnl|my_center|LOCUS_18430 1954238 1954918 gene locus_tag LOCUS_18440 1954238 1954918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1956345 1954915 gene locus_tag LOCUS_18450 gene purB 1956345 1954915 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 protein_id gnl|my_center|LOCUS_18450 1956774 1956517 gene locus_tag LOCUS_18460 1956774 1956517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1957373 1957152 gene locus_tag LOCUS_18470 1957373 1957152 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858801.1 protein_id gnl|my_center|LOCUS_18470 1958164 1957376 gene locus_tag LOCUS_18480 1958164 1957376 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014295.1 protein_id gnl|my_center|LOCUS_18480 1959097 1958798 gene locus_tag LOCUS_18490 1959097 1958798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18490 1959157 1959444 gene locus_tag LOCUS_18500 1959157 1959444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1959572 1959387 gene locus_tag LOCUS_18510 1959572 1959387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18510 1959930 1960526 gene locus_tag LOCUS_18520 1959930 1960526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1960563 1960868 gene locus_tag LOCUS_18530 1960563 1960868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18530 1961042 1961347 gene locus_tag LOCUS_18540 1961042 1961347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18540 1961281 1961778 gene locus_tag LOCUS_18550 1961281 1961778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18550 1961841 1962743 gene locus_tag LOCUS_18560 1961841 1962743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1962745 1963539 gene locus_tag LOCUS_18570 gene istB 1962745 1963539 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_18570 1963831 1963559 gene locus_tag LOCUS_18580 1963831 1963559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1964136 1963855 gene locus_tag LOCUS_18590 1964136 1963855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1964469 1965446 gene locus_tag LOCUS_18600 1964469 1965446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1965551 1966477 gene locus_tag LOCUS_18610 1965551 1966477 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 protein_id gnl|my_center|LOCUS_18610 1966482 1967522 gene locus_tag LOCUS_18620 gene fepG 1966482 1967522 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_18620 1967519 1968352 gene locus_tag LOCUS_18630 1967519 1968352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_18630 1969215 1968349 gene locus_tag LOCUS_18640 1969215 1968349 CDS product IS481-like element ISMsm9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731392.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18640 1971177 1969924 gene locus_tag LOCUS_18650 gene purD 1971177 1969924 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863105.1 protein_id gnl|my_center|LOCUS_18650 1971176 1971631 gene locus_tag LOCUS_18660 1971176 1971631 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_18660 1972577 1972191 gene locus_tag LOCUS_18670 1972577 1972191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1972875 1972639 gene locus_tag LOCUS_18680 1972875 1972639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1974592 1973189 gene locus_tag LOCUS_18690 1974592 1973189 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015245.1 protein_id gnl|my_center|LOCUS_18690 1975299 1974592 gene locus_tag LOCUS_18700 1975299 1974592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 protein_id gnl|my_center|LOCUS_18700 1975584 1976738 gene locus_tag LOCUS_18710 1975584 1976738 CDS product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 protein_id gnl|my_center|LOCUS_18710 1976922 1976848 gene locus_tag LOCUS_t00520 1976922 1976848 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1977039 1978547 gene locus_tag LOCUS_18720 1977039 1978547 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 protein_id gnl|my_center|LOCUS_18720 1978596 1978961 gene locus_tag LOCUS_18730 1978596 1978961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1978967 1980259 gene locus_tag LOCUS_18740 1978967 1980259 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_18740 1980256 1980720 gene locus_tag LOCUS_18750 1980256 1980720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1980717 1981457 gene locus_tag LOCUS_18760 gene otsB 1980717 1981457 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863055.1 protein_id gnl|my_center|LOCUS_18760 1982505 1981423 gene locus_tag LOCUS_18770 1982505 1981423 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015259.1 protein_id gnl|my_center|LOCUS_18770 1982593 1983510 gene locus_tag LOCUS_18780 1982593 1983510 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015260.1 protein_id gnl|my_center|LOCUS_18780 1983507 1984196 gene locus_tag LOCUS_18790 1983507 1984196 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015261.1 protein_id gnl|my_center|LOCUS_18790 1984193 1985044 gene locus_tag LOCUS_18800 1984193 1985044 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015262.1 protein_id gnl|my_center|LOCUS_18800 1985582 1986058 gene locus_tag LOCUS_18810 1985582 1986058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 1986427 1987233 gene locus_tag LOCUS_18820 1986427 1987233 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015255.1 protein_id gnl|my_center|LOCUS_18820 1987244 1988116 gene locus_tag LOCUS_18830 1987244 1988116 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113234.1 protein_id gnl|my_center|LOCUS_18830 1989020 1988082 gene locus_tag LOCUS_18840 gene rlmB 1989020 1988082 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 protein_id gnl|my_center|LOCUS_18840 1990456 1989026 gene locus_tag LOCUS_18850 gene cysS 1990456 1989026 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 protein_id gnl|my_center|LOCUS_18850 1990929 1990456 gene locus_tag LOCUS_18860 gene ispF 1990929 1990456 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015288.1 protein_id gnl|my_center|LOCUS_18860 1991540 1990935 gene locus_tag LOCUS_18870 gene ispD 1991540 1990935 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015289.1 protein_id gnl|my_center|LOCUS_18870 1992231 1991641 gene locus_tag LOCUS_18880 1992231 1991641 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 protein_id gnl|my_center|LOCUS_18880 1992434 1992985 gene locus_tag LOCUS_18890 1992434 1992985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015291.1 protein_id gnl|my_center|LOCUS_18890 1993035 1994402 gene locus_tag LOCUS_18900 gene radA 1993035 1994402 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015292.1 protein_id gnl|my_center|LOCUS_18900 1994428 1995495 gene locus_tag LOCUS_18910 gene disA 1994428 1995495 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015293.1 protein_id gnl|my_center|LOCUS_18910 1996302 1995601 gene locus_tag LOCUS_18920 1996302 1995601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 protein_id gnl|my_center|LOCUS_18920 1996928 1996320 gene locus_tag LOCUS_18930 1996928 1996320 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 protein_id gnl|my_center|LOCUS_18930 1996927 1997814 gene locus_tag LOCUS_18940 1996927 1997814 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 protein_id gnl|my_center|LOCUS_18940 1998016 1998789 gene locus_tag LOCUS_18950 gene zupT 1998016 1998789 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856259.1 protein_id gnl|my_center|LOCUS_18950 2000267 1998867 gene locus_tag LOCUS_18960 2000267 1998867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2000850 2002166 gene locus_tag LOCUS_18970 2000850 2002166 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_18970 2004981 2002231 gene locus_tag LOCUS_18980 2004981 2002231 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 protein_id gnl|my_center|LOCUS_18980 2006381 2005122 gene locus_tag LOCUS_18990 gene aftC 2006381 2005122 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 protein_id gnl|my_center|LOCUS_18990 2007141 2006392 gene locus_tag LOCUS_19000 2007141 2006392 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969934.1 protein_id gnl|my_center|LOCUS_19000 2007369 2008217 gene locus_tag LOCUS_19010 2007369 2008217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665818.1 protein_id gnl|my_center|LOCUS_19010 2008225 2009760 gene locus_tag LOCUS_19020 2008225 2009760 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064265.1 protein_id gnl|my_center|LOCUS_19020 2011333 2009780 gene locus_tag LOCUS_19030 gene lysS 2011333 2009780 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 protein_id gnl|my_center|LOCUS_19030 2012763 2011612 gene locus_tag LOCUS_19040 2012763 2011612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2013834 2012887 gene locus_tag LOCUS_19050 2013834 2012887 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_19050 2014210 2013827 gene locus_tag LOCUS_19060 2014210 2013827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2015543 2014221 gene locus_tag LOCUS_19070 2015543 2014221 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_19070 2016981 2016187 gene locus_tag LOCUS_19080 2016981 2016187 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015311.1 protein_id gnl|my_center|LOCUS_19080 2017646 2016981 gene locus_tag LOCUS_19090 2017646 2016981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2018555 2017647 gene locus_tag LOCUS_19100 2018555 2017647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853812.1 protein_id gnl|my_center|LOCUS_19100 2019033 2018566 gene locus_tag LOCUS_19110 2019033 2018566 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853810.1 protein_id gnl|my_center|LOCUS_19110 2019488 2019030 gene locus_tag LOCUS_19120 gene folK 2019488 2019030 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 protein_id gnl|my_center|LOCUS_19120 2019862 2019485 gene locus_tag LOCUS_19130 gene folB 2019862 2019485 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_19130 2020723 2019863 gene locus_tag LOCUS_19140 gene folP 2020723 2019863 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 protein_id gnl|my_center|LOCUS_19140 2021301 2020726 gene locus_tag LOCUS_19150 gene folE 2021301 2020726 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 protein_id gnl|my_center|LOCUS_19150 2023684 2021294 gene locus_tag LOCUS_19160 gene ftsH 2023684 2021294 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015317.1 protein_id gnl|my_center|LOCUS_19160 2024377 2023733 gene locus_tag LOCUS_19170 gene hpt 2024377 2023733 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 protein_id gnl|my_center|LOCUS_19170 2025400 2024516 gene locus_tag LOCUS_19180 gene tilS 2025400 2024516 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015318.1 protein_id gnl|my_center|LOCUS_19180 2026615 2025401 gene locus_tag LOCUS_19190 gene dacB 2026615 2025401 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015319.1 protein_id gnl|my_center|LOCUS_19190 2026723 2027265 gene locus_tag LOCUS_19200 2026723 2027265 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 protein_id gnl|my_center|LOCUS_19200 2028496 2027336 gene locus_tag LOCUS_19210 2028496 2027336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2029449 2028679 gene locus_tag LOCUS_19220 2029449 2028679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2030182 2029481 gene locus_tag LOCUS_19230 2030182 2029481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2030284 2030577 gene locus_tag LOCUS_19240 2030284 2030577 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 protein_id gnl|my_center|LOCUS_19240 2030635 2031075 gene locus_tag LOCUS_19250 2030635 2031075 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 protein_id gnl|my_center|LOCUS_19250 2031137 2034919 gene locus_tag LOCUS_19260 2031137 2034919 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 protein_id gnl|my_center|LOCUS_19260 2034988 2036322 gene locus_tag LOCUS_19270 2034988 2036322 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_19270 2036315 2037013 gene locus_tag LOCUS_19280 2036315 2037013 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_19280 2037240 2037076 gene locus_tag LOCUS_19290 2037240 2037076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2037482 2039116 gene locus_tag LOCUS_19300 gene istA 2037482 2039116 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_19300 2039122 2039889 gene locus_tag LOCUS_19310 gene istB 2039122 2039889 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_19310 2041077 2039962 gene locus_tag LOCUS_19320 2041077 2039962 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_19320 2041539 2041751 gene locus_tag LOCUS_19330 2041539 2041751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2042301 2041858 gene locus_tag LOCUS_19340 2042301 2041858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2042786 2042298 gene locus_tag LOCUS_19350 2042786 2042298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2043854 2043048 gene locus_tag LOCUS_19360 2043854 2043048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2045242 2043905 gene locus_tag LOCUS_19370 2045242 2043905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2046761 2045256 gene locus_tag LOCUS_19380 2046761 2045256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2046643 2046915 gene locus_tag LOCUS_19390 2046643 2046915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2052822 2046925 gene locus_tag LOCUS_19400 2052822 2046925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2053697 2052975 gene locus_tag LOCUS_19410 2053697 2052975 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_19410 2054645 2053698 gene locus_tag LOCUS_19420 gene ppk2 2054645 2053698 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 protein_id gnl|my_center|LOCUS_19420 2054949 2054740 gene locus_tag LOCUS_19430 2054949 2054740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2055180 2054983 gene locus_tag LOCUS_19440 2055180 2054983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2055664 2056704 gene locus_tag LOCUS_19450 2055664 2056704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2058406 2056769 gene locus_tag LOCUS_19460 gene groL 2058406 2056769 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 protein_id gnl|my_center|LOCUS_19460 2058681 2060024 gene locus_tag LOCUS_19470 2058681 2060024 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 protein_id gnl|my_center|LOCUS_19470 2060685 2061203 gene locus_tag LOCUS_19480 2060685 2061203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862907.1 protein_id gnl|my_center|LOCUS_19480 2061353 2064424 gene locus_tag LOCUS_19490 2061353 2064424 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 protein_id gnl|my_center|LOCUS_19490 2064425 2064919 gene locus_tag LOCUS_19500 2064425 2064919 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 protein_id gnl|my_center|LOCUS_19500 2064909 2066693 gene locus_tag LOCUS_19510 2064909 2066693 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 protein_id gnl|my_center|LOCUS_19510 2066696 2067205 gene locus_tag LOCUS_19520 2066696 2067205 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015339.1 protein_id gnl|my_center|LOCUS_19520 2067210 2067488 gene locus_tag LOCUS_19530 2067210 2067488 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862899.1 protein_id gnl|my_center|LOCUS_19530 2067485 2067862 gene locus_tag LOCUS_19540 gene mnhG 2067485 2067862 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853711.1 protein_id gnl|my_center|LOCUS_19540 2069029 2067893 gene locus_tag LOCUS_19550 2069029 2067893 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 protein_id gnl|my_center|LOCUS_19550 2069860 2069096 gene locus_tag LOCUS_19560 2069860 2069096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2070095 2069880 gene locus_tag LOCUS_19570 2070095 2069880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2070112 2070684 gene locus_tag LOCUS_19580 2070112 2070684 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 protein_id gnl|my_center|LOCUS_19580 2070685 2071647 gene locus_tag LOCUS_19590 2070685 2071647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015341.1 protein_id gnl|my_center|LOCUS_19590 2071658 2072449 gene locus_tag LOCUS_19600 2071658 2072449 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 protein_id gnl|my_center|LOCUS_19600 2072446 2073921 gene locus_tag LOCUS_19610 2072446 2073921 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 protein_id gnl|my_center|LOCUS_19610 2074660 2073929 gene locus_tag LOCUS_19620 2074660 2073929 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853677.1 protein_id gnl|my_center|LOCUS_19620 2075582 2074653 gene locus_tag LOCUS_19630 2075582 2074653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 protein_id gnl|my_center|LOCUS_19630 2076060 2075575 gene locus_tag LOCUS_19640 2076060 2075575 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853671.1 protein_id gnl|my_center|LOCUS_19640 2076093 2077550 gene locus_tag LOCUS_19650 2076093 2077550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 protein_id gnl|my_center|LOCUS_19650 2077550 2078536 gene locus_tag LOCUS_19660 2077550 2078536 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 protein_id gnl|my_center|LOCUS_19660 2078529 2080940 gene locus_tag LOCUS_19670 2078529 2080940 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 protein_id gnl|my_center|LOCUS_19670 2081686 2080889 gene locus_tag LOCUS_19680 2081686 2080889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2083731 2082532 gene locus_tag LOCUS_19690 2083731 2082532 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 protein_id gnl|my_center|LOCUS_19690 2085084 2083732 gene locus_tag LOCUS_19700 gene pta 2085084 2083732 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853660.1 protein_id gnl|my_center|LOCUS_19700 2089881 2085271 gene locus_tag LOCUS_19710 2089881 2085271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2091312 2090206 gene locus_tag LOCUS_19720 gene purT 2091312 2090206 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853648.1 protein_id gnl|my_center|LOCUS_19720 2092656 2091367 gene locus_tag LOCUS_19730 2092656 2091367 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 protein_id gnl|my_center|LOCUS_19730 2092707 2093630 gene locus_tag LOCUS_19740 2092707 2093630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 protein_id gnl|my_center|LOCUS_19740 2093926 2094765 gene locus_tag LOCUS_19750 2093926 2094765 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229813.1 protein_id gnl|my_center|LOCUS_19750 2095985 2094819 gene locus_tag LOCUS_19760 2095985 2094819 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_19760 2097107 2096073 gene locus_tag LOCUS_19770 gene fbaA 2097107 2096073 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 protein_id gnl|my_center|LOCUS_19770 2098462 2097257 gene locus_tag LOCUS_19780 2098462 2097257 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 protein_id gnl|my_center|LOCUS_19780 2099180 2098524 gene locus_tag LOCUS_19790 2099180 2098524 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 protein_id gnl|my_center|LOCUS_19790 2099715 2099167 gene locus_tag LOCUS_19800 gene pyrE 2099715 2099167 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_19800 2100727 2099756 gene locus_tag LOCUS_19810 2100727 2099756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2101720 2100758 gene locus_tag LOCUS_19820 2101720 2100758 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 protein_id gnl|my_center|LOCUS_19820 2102042 2101629 gene locus_tag LOCUS_19830 2102042 2101629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2103157 2102126 gene locus_tag LOCUS_19840 gene adhP 2103157 2102126 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_19840 2105858 2103309 gene locus_tag LOCUS_19850 gene clpB 2105858 2103309 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 protein_id gnl|my_center|LOCUS_19850 2107568 2106180 gene locus_tag LOCUS_19860 2107568 2106180 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_19860 2107688 2108704 gene locus_tag LOCUS_19870 2107688 2108704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2109488 2108709 gene locus_tag LOCUS_19880 2109488 2108709 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 protein_id gnl|my_center|LOCUS_19880 2109595 2109858 gene locus_tag LOCUS_19890 2109595 2109858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2109855 2111021 gene locus_tag LOCUS_19900 2109855 2111021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2111061 2112836 gene locus_tag LOCUS_19910 2111061 2112836 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 protein_id gnl|my_center|LOCUS_19910 2114146 2112833 gene locus_tag LOCUS_19920 2114146 2112833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060595.1 protein_id gnl|my_center|LOCUS_19920 2115230 2114265 gene locus_tag LOCUS_19930 2115230 2114265 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113289.1 protein_id gnl|my_center|LOCUS_19930 2115355 2116362 gene locus_tag LOCUS_19940 2115355 2116362 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777050.1 protein_id gnl|my_center|LOCUS_19940 2116757 2116359 gene locus_tag LOCUS_19950 2116757 2116359 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 protein_id gnl|my_center|LOCUS_19950 2117955 2116768 gene locus_tag LOCUS_19960 gene dnaJ 2117955 2116768 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 protein_id gnl|my_center|LOCUS_19960 2118743 2118087 gene locus_tag LOCUS_19970 gene grpE 2118743 2118087 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 protein_id gnl|my_center|LOCUS_19970 2120597 2118756 gene locus_tag LOCUS_19980 gene dnaK 2120597 2118756 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 protein_id gnl|my_center|LOCUS_19980 2121625 2120840 gene locus_tag LOCUS_19990 2121625 2120840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2123248 2121728 gene locus_tag LOCUS_20000 2123248 2121728 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015386.1 protein_id gnl|my_center|LOCUS_20000 2123379 2124896 gene locus_tag LOCUS_20010 2123379 2124896 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 protein_id gnl|my_center|LOCUS_20010 2124940 2125464 gene locus_tag LOCUS_20020 2124940 2125464 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887842.1 protein_id gnl|my_center|LOCUS_20020 2125990 2125430 gene locus_tag LOCUS_20030 2125990 2125430 CDS product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 protein_id gnl|my_center|LOCUS_20030 2126967 2126017 gene locus_tag LOCUS_20040 2126967 2126017 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015401.1 protein_id gnl|my_center|LOCUS_20040 2127678 2126971 gene locus_tag LOCUS_20050 2127678 2126971 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015402.1 protein_id gnl|my_center|LOCUS_20050 2128957 2127689 gene locus_tag LOCUS_20060 2128957 2127689 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862775.1 protein_id gnl|my_center|LOCUS_20060 2129871 2128957 gene locus_tag LOCUS_20070 2129871 2128957 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015403.1 protein_id gnl|my_center|LOCUS_20070 2130680 2129904 gene locus_tag LOCUS_20080 2130680 2129904 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853541.1 protein_id gnl|my_center|LOCUS_20080 2130969 2130673 gene locus_tag LOCUS_20090 2130969 2130673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2132636 2130966 gene locus_tag LOCUS_20100 2132636 2130966 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015405.1 protein_id gnl|my_center|LOCUS_20100 2132932 2134281 gene locus_tag LOCUS_20110 2132932 2134281 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015406.1 protein_id gnl|my_center|LOCUS_20110 2135307 2137022 gene locus_tag LOCUS_20120 2135307 2137022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 protein_id gnl|my_center|LOCUS_20120 2137019 2138962 gene locus_tag LOCUS_20130 2137019 2138962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776694.1 protein_id gnl|my_center|LOCUS_20130 2139273 2139037 gene locus_tag LOCUS_20140 2139273 2139037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2139160 2140875 gene locus_tag LOCUS_20150 2139160 2140875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2143507 2141279 gene locus_tag LOCUS_20160 2143507 2141279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2143973 2144587 gene locus_tag LOCUS_20170 2143973 2144587 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 protein_id gnl|my_center|LOCUS_20170 2144636 2145937 gene locus_tag LOCUS_20180 2144636 2145937 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 protein_id gnl|my_center|LOCUS_20180 2146086 2146985 gene locus_tag LOCUS_20190 2146086 2146985 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015309.1 protein_id gnl|my_center|LOCUS_20190 2148395 2147067 gene locus_tag LOCUS_20200 2148395 2147067 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 protein_id gnl|my_center|LOCUS_20200 2148991 2148428 gene locus_tag LOCUS_20210 gene dcd 2148991 2148428 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853460.1 protein_id gnl|my_center|LOCUS_20210 2149057 2149130 gene locus_tag LOCUS_t00530 2149057 2149130 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2149339 2149755 gene locus_tag LOCUS_20220 2149339 2149755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2150300 2149752 gene locus_tag LOCUS_20230 2150300 2149752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2151937 2150585 gene locus_tag LOCUS_20240 2151937 2150585 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777033.1 protein_id gnl|my_center|LOCUS_20240 2153686 2152061 gene locus_tag LOCUS_20250 2153686 2152061 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 protein_id gnl|my_center|LOCUS_20250 2154994 2153804 gene locus_tag LOCUS_20260 2154994 2153804 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853452.1 protein_id gnl|my_center|LOCUS_20260 2155066 2155263 gene locus_tag LOCUS_20270 2155066 2155263 CDS product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853449.1 protein_id gnl|my_center|LOCUS_20270 2155279 2158209 gene locus_tag LOCUS_20280 2155279 2158209 CDS product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853429.1 protein_id gnl|my_center|LOCUS_20280 2158373 2160370 gene locus_tag LOCUS_20290 2158373 2160370 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_20290 2160375 2161484 gene locus_tag LOCUS_20300 2160375 2161484 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 protein_id gnl|my_center|LOCUS_20300 2161493 2163184 gene locus_tag LOCUS_20310 2161493 2163184 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_20310 2165543 2163384 gene locus_tag LOCUS_20320 2165543 2163384 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_20320 2166791 2165547 gene locus_tag LOCUS_20330 2166791 2165547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2167552 2166800 gene locus_tag LOCUS_20340 2167552 2166800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2167795 2168166 gene locus_tag LOCUS_20350 2167795 2168166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2168163 2168654 gene locus_tag LOCUS_20360 2168163 2168654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2169036 2168683 gene locus_tag LOCUS_20370 2169036 2168683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20370 2170493 2169531 gene locus_tag LOCUS_20380 gene tmaT 2170493 2169531 CDS product trehalose corynomycolate mycolyl acetyltransferase TmaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015440.1 protein_id gnl|my_center|LOCUS_20380 2170569 2171264 gene locus_tag LOCUS_20390 2170569 2171264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2171251 2172606 gene locus_tag LOCUS_20400 2171251 2172606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015442.1 protein_id gnl|my_center|LOCUS_20400 2172964 2173146 gene locus_tag LOCUS_20410 2172964 2173146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2173171 2173395 gene locus_tag LOCUS_20420 2173171 2173395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2174456 2173392 gene locus_tag LOCUS_20430 2174456 2173392 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 protein_id gnl|my_center|LOCUS_20430 2174462 2175220 gene locus_tag LOCUS_20440 2174462 2175220 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 protein_id gnl|my_center|LOCUS_20440 2175577 2175443 gene locus_tag LOCUS_20450 2175577 2175443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2176199 2175636 gene locus_tag LOCUS_20460 2176199 2175636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20460 2176843 2176538 gene locus_tag LOCUS_20470 2176843 2176538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20470 2177236 2177595 gene locus_tag LOCUS_20480 2177236 2177595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2177886 2177530 gene locus_tag LOCUS_20490 2177886 2177530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20490 2178212 2177883 gene locus_tag LOCUS_20500 2178212 2177883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20500 2178388 2178909 gene locus_tag LOCUS_20510 2178388 2178909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20510 2179292 2179603 gene locus_tag LOCUS_20520 2179292 2179603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2179738 2181042 gene locus_tag LOCUS_20530 2179738 2181042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2181125 2182027 gene locus_tag LOCUS_20540 2181125 2182027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2182034 2185762 gene locus_tag LOCUS_20550 2182034 2185762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2185780 2186763 gene locus_tag LOCUS_20560 2185780 2186763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2187227 2186796 gene locus_tag LOCUS_20570 2187227 2186796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2187327 2187896 gene locus_tag LOCUS_20580 2187327 2187896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2188726 2187962 gene locus_tag LOCUS_20590 gene istB 2188726 2187962 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_20590 2189236 2188730 gene locus_tag LOCUS_20600 2189236 2188730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2190126 2189386 gene locus_tag LOCUS_20610 gene istB 2190126 2189386 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_20610 2191006 2190128 gene locus_tag LOCUS_20620 2191006 2190128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20620 2191616 2190951 gene locus_tag LOCUS_20630 2191616 2190951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20630 2193110 2191860 gene locus_tag LOCUS_20640 2193110 2191860 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_20640 2193371 2193189 gene locus_tag LOCUS_20650 2193371 2193189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2193425 2193586 gene locus_tag LOCUS_20660 2193425 2193586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20660 2195436 2193583 gene locus_tag LOCUS_20670 2195436 2193583 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 protein_id gnl|my_center|LOCUS_20670 2195835 2196605 gene locus_tag LOCUS_20680 gene trmB 2195835 2196605 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 protein_id gnl|my_center|LOCUS_20680 2196610 2197293 gene locus_tag LOCUS_20690 2196610 2197293 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 protein_id gnl|my_center|LOCUS_20690 2197303 2199606 gene locus_tag LOCUS_20700 2197303 2199606 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015449.1 protein_id gnl|my_center|LOCUS_20700 2199607 2200614 gene locus_tag LOCUS_20710 2199607 2200614 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 protein_id gnl|my_center|LOCUS_20710 2200625 2200972 gene locus_tag LOCUS_20720 2200625 2200972 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 protein_id gnl|my_center|LOCUS_20720 2202213 2200969 gene locus_tag LOCUS_20730 2202213 2200969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2204613 2203072 gene locus_tag LOCUS_20740 2204613 2203072 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 protein_id gnl|my_center|LOCUS_20740 2209327 2204597 gene locus_tag LOCUS_20750 gene pks13 2209327 2204597 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015451.1 protein_id gnl|my_center|LOCUS_20750 2211168 2209360 gene locus_tag LOCUS_20760 2211168 2209360 CDS product FadD32-like long-chain-fatty-acid--AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015452.1 protein_id gnl|my_center|LOCUS_20760 2212149 2211208 gene locus_tag LOCUS_20770 2212149 2211208 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 protein_id gnl|my_center|LOCUS_20770 2212643 2212158 gene locus_tag LOCUS_20780 2212643 2212158 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 protein_id gnl|my_center|LOCUS_20780 2214568 2212643 gene locus_tag LOCUS_20790 2214568 2212643 CDS product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 protein_id gnl|my_center|LOCUS_20790 2215528 2214695 gene locus_tag LOCUS_20800 2215528 2214695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 protein_id gnl|my_center|LOCUS_20800 2216549 2215536 gene locus_tag LOCUS_20810 2216549 2215536 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 protein_id gnl|my_center|LOCUS_20810 2218439 2216616 gene locus_tag LOCUS_20820 gene aftB 2218439 2216616 CDS product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 protein_id gnl|my_center|LOCUS_20820 2219334 2218450 gene locus_tag LOCUS_20830 2219334 2218450 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 protein_id gnl|my_center|LOCUS_20830 2219933 2219430 gene locus_tag LOCUS_20840 2219933 2219430 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 protein_id gnl|my_center|LOCUS_20840 2221884 2219920 gene locus_tag LOCUS_20850 2221884 2219920 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 protein_id gnl|my_center|LOCUS_20850 2222603 2221992 gene locus_tag LOCUS_20860 2222603 2221992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2222647 2223336 gene locus_tag LOCUS_20870 2222647 2223336 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804226.1 protein_id gnl|my_center|LOCUS_20870 2223437 2223754 gene locus_tag LOCUS_20880 2223437 2223754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2223914 2224171 gene locus_tag LOCUS_20890 2223914 2224171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2224196 2224420 gene locus_tag LOCUS_20900 2224196 2224420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2224431 2226017 gene locus_tag LOCUS_20910 2224431 2226017 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_20910 2226110 2227213 gene locus_tag LOCUS_20920 2226110 2227213 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_20920 2227218 2230394 gene locus_tag LOCUS_20930 2227218 2230394 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_20930 2230403 2231047 gene locus_tag LOCUS_20940 2230403 2231047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2231029 2231412 gene locus_tag LOCUS_20950 2231029 2231412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2232657 2231437 gene locus_tag LOCUS_20960 2232657 2231437 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_20960 2234398 2232812 gene locus_tag LOCUS_20970 2234398 2232812 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014364.1 protein_id gnl|my_center|LOCUS_20970 2234571 2235197 gene locus_tag LOCUS_20980 2234571 2235197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2235711 2235208 gene locus_tag LOCUS_20990 2235711 2235208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2237043 2235868 gene locus_tag LOCUS_21000 gene glf 2237043 2235868 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 protein_id gnl|my_center|LOCUS_21000 2237246 2238982 gene locus_tag LOCUS_21010 2237246 2238982 CDS product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015467.1 protein_id gnl|my_center|LOCUS_21010 2240476 2239004 gene locus_tag LOCUS_21020 gene glpK 2240476 2239004 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 protein_id gnl|my_center|LOCUS_21020 2241345 2240521 gene locus_tag LOCUS_21030 2241345 2240521 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 protein_id gnl|my_center|LOCUS_21030 2242189 2241353 gene locus_tag LOCUS_21040 2242189 2241353 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015469.1 protein_id gnl|my_center|LOCUS_21040 2243442 2242189 gene locus_tag LOCUS_21050 gene serS 2243442 2242189 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857828.1 protein_id gnl|my_center|LOCUS_21050 2243511 2244227 gene locus_tag LOCUS_21060 2243511 2244227 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 protein_id gnl|my_center|LOCUS_21060 2244242 2245285 gene locus_tag LOCUS_21070 2244242 2245285 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 protein_id gnl|my_center|LOCUS_21070 2245282 2245632 gene locus_tag LOCUS_21080 2245282 2245632 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_21080 2246244 2245642 gene locus_tag LOCUS_21090 2246244 2245642 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015472.1 protein_id gnl|my_center|LOCUS_21090 2247144 2246245 gene locus_tag LOCUS_21100 gene pheA 2247144 2246245 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862609.1 protein_id gnl|my_center|LOCUS_21100 2247161 2247868 gene locus_tag LOCUS_21110 2247161 2247868 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857812.1 protein_id gnl|my_center|LOCUS_21110 2247890 2249068 gene locus_tag LOCUS_21120 2247890 2249068 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702410.1 protein_id gnl|my_center|LOCUS_21120 2250620 2249052 gene locus_tag LOCUS_21130 2250620 2249052 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776828.1 protein_id gnl|my_center|LOCUS_21130 2251680 2250727 gene locus_tag LOCUS_21140 gene hutG 2251680 2250727 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777037.1 protein_id gnl|my_center|LOCUS_21140 2253082 2251685 gene locus_tag LOCUS_21150 2253082 2251685 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014160.1 protein_id gnl|my_center|LOCUS_21150 2253157 2253900 gene locus_tag LOCUS_21160 2253157 2253900 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157773333.1 protein_id gnl|my_center|LOCUS_21160 2255215 2254904 gene locus_tag LOCUS_21170 2255215 2254904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2255596 2255886 gene locus_tag LOCUS_21180 2255596 2255886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 2256360 2256034 gene locus_tag LOCUS_21190 2256360 2256034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2256650 2256366 gene locus_tag LOCUS_21200 2256650 2256366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2256934 2258487 gene locus_tag LOCUS_21210 gene hutH 2256934 2258487 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_21210 2258663 2260357 gene locus_tag LOCUS_21220 2258663 2260357 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777035.1 protein_id gnl|my_center|LOCUS_21220 2260401 2261585 gene locus_tag LOCUS_21230 gene hutI 2260401 2261585 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_21230 2261851 2261582 gene locus_tag LOCUS_21240 2261851 2261582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2262370 2261861 gene locus_tag LOCUS_21250 2262370 2261861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2262646 2262912 gene locus_tag LOCUS_21260 2262646 2262912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2263038 2262862 gene locus_tag LOCUS_21270 2263038 2262862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2263955 2263041 gene locus_tag LOCUS_21280 2263955 2263041 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 protein_id gnl|my_center|LOCUS_21280 2264779 2263967 gene locus_tag LOCUS_21290 2264779 2263967 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 protein_id gnl|my_center|LOCUS_21290 2264866 2266812 gene locus_tag LOCUS_21300 2264866 2266812 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015484.1 protein_id gnl|my_center|LOCUS_21300 2268065 2267067 gene locus_tag LOCUS_21310 2268065 2267067 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383226.1 protein_id gnl|my_center|LOCUS_21310 2269555 2268065 gene locus_tag LOCUS_21320 2269555 2268065 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_21320 2270718 2269561 gene locus_tag LOCUS_21330 2270718 2269561 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401058.1 protein_id gnl|my_center|LOCUS_21330 2272124 2270718 gene locus_tag LOCUS_21340 2272124 2270718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730982.1 protein_id gnl|my_center|LOCUS_21340 2274020 2272251 gene locus_tag LOCUS_21350 2274020 2272251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2274804 2274076 gene locus_tag LOCUS_21360 gene fabG 2274804 2274076 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_21360 2275567 2274806 gene locus_tag LOCUS_21370 2275567 2274806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21370 2276284 2275643 gene locus_tag LOCUS_21380 gene msrA 2276284 2275643 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 protein_id gnl|my_center|LOCUS_21380 2276406 2277008 gene locus_tag LOCUS_21390 2276406 2277008 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862560.1 protein_id gnl|my_center|LOCUS_21390 2277077 2278300 gene locus_tag LOCUS_21400 2277077 2278300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 protein_id gnl|my_center|LOCUS_21400 2279793 2278297 gene locus_tag LOCUS_21410 2279793 2278297 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 protein_id gnl|my_center|LOCUS_21410 2279885 2280520 gene locus_tag LOCUS_21420 2279885 2280520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2281165 2280527 gene locus_tag LOCUS_21430 2281165 2280527 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 protein_id gnl|my_center|LOCUS_21430 2282400 2281162 gene locus_tag LOCUS_21440 2282400 2281162 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015505.1 protein_id gnl|my_center|LOCUS_21440 2282399 2282989 gene locus_tag LOCUS_21450 2282399 2282989 CDS product DUF2020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015506.1 protein_id gnl|my_center|LOCUS_21450 2282989 2283951 gene locus_tag LOCUS_21460 2282989 2283951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2284100 2283948 gene locus_tag LOCUS_21470 2284100 2283948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858985.1 protein_id gnl|my_center|LOCUS_21470 2284826 2284101 gene locus_tag LOCUS_21480 2284826 2284101 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015507.1 protein_id gnl|my_center|LOCUS_21480 2284939 2286060 gene locus_tag LOCUS_21490 2284939 2286060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2286695 2286048 gene locus_tag LOCUS_21500 gene mcbR 2286695 2286048 CDS product TetR/AcrR family transcriptional regulator MbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 protein_id gnl|my_center|LOCUS_21500 2287101 2286832 gene locus_tag LOCUS_21510 2287101 2286832 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 protein_id gnl|my_center|LOCUS_21510 2288090 2287197 gene locus_tag LOCUS_21520 2288090 2287197 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_21520 2288335 2288189 gene locus_tag LOCUS_21530 2288335 2288189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2288356 2289300 gene locus_tag LOCUS_21540 2288356 2289300 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 protein_id gnl|my_center|LOCUS_21540 2289478 2289374 gene locus_tag LOCUS_r00100 2289478 2289374 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2292683 2289620 gene locus_tag LOCUS_r00110 2292683 2289620 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2294550 2293039 gene locus_tag LOCUS_r00120 2294550 2293039 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2295475 2295101 gene locus_tag LOCUS_21550 2295475 2295101 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015515.1 protein_id gnl|my_center|LOCUS_21550 2295689 2296828 gene locus_tag LOCUS_21560 2295689 2296828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2297716 2296838 gene locus_tag LOCUS_21570 gene rsmP 2297716 2296838 CDS product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 protein_id gnl|my_center|LOCUS_21570 2298193 2297822 gene locus_tag LOCUS_21580 gene trxA 2298193 2297822 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_21580 2298306 2298518 gene locus_tag LOCUS_21590 2298306 2298518 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015540.1 protein_id gnl|my_center|LOCUS_21590 2298591 2298791 gene locus_tag LOCUS_21600 2298591 2298791 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113056.1 protein_id gnl|my_center|LOCUS_21600 2298819 2301041 gene locus_tag LOCUS_21610 2298819 2301041 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013619.1 protein_id gnl|my_center|LOCUS_21610 2301053 2302372 gene locus_tag LOCUS_21620 2301053 2302372 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 protein_id gnl|my_center|LOCUS_21620 2302885 2303217 gene locus_tag LOCUS_21630 2302885 2303217 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235677901.1 protein_id gnl|my_center|LOCUS_21630 2303832 2304122 gene locus_tag LOCUS_21640 2303832 2304122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 2305904 2304453 gene locus_tag LOCUS_21650 gene dnaB 2305904 2304453 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 protein_id gnl|my_center|LOCUS_21650 2306682 2306230 gene locus_tag LOCUS_21660 gene rplI 2306682 2306230 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 protein_id gnl|my_center|LOCUS_21660 2307285 2306731 gene locus_tag LOCUS_21670 2307285 2306731 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_21670 2307626 2307357 gene locus_tag LOCUS_21680 gene rpsF 2307626 2307357 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 protein_id gnl|my_center|LOCUS_21680 2308009 2307815 gene locus_tag LOCUS_21690 2308009 2307815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2309451 2308006 gene locus_tag LOCUS_21700 2309451 2308006 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015546.1 protein_id gnl|my_center|LOCUS_21700 2311691 2309454 gene locus_tag LOCUS_21710 2311691 2309454 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 protein_id gnl|my_center|LOCUS_21710 2312329 2311775 gene locus_tag LOCUS_21720 2312329 2311775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2312220 2312711 gene locus_tag LOCUS_21730 gene carR 2312220 2312711 CDS product MarR family transcriptional regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855083.1 protein_id gnl|my_center|LOCUS_21730 2312762 2313745 gene locus_tag LOCUS_21740 2312762 2313745 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 protein_id gnl|my_center|LOCUS_21740 2313771 2314241 gene locus_tag LOCUS_21750 2313771 2314241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861203.1 protein_id gnl|my_center|LOCUS_21750 2315119 2314238 gene locus_tag LOCUS_21760 2315119 2314238 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_21760 2316022 2315129 gene locus_tag LOCUS_21770 2316022 2315129 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_21770 2317622 2316129 gene locus_tag LOCUS_21780 2317622 2316129 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775811.1 protein_id gnl|my_center|LOCUS_21780 2319899 2317692 gene locus_tag LOCUS_21790 gene glcB 2319899 2317692 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015044.1 protein_id gnl|my_center|LOCUS_21790 2320353 2321648 gene locus_tag LOCUS_21800 gene aceA 2320353 2321648 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859378.1 protein_id gnl|my_center|LOCUS_21800 2321736 2322233 gene locus_tag LOCUS_21810 gene rraA 2321736 2322233 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 protein_id gnl|my_center|LOCUS_21810 2322252 2323043 gene locus_tag LOCUS_21820 2322252 2323043 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855116.1 protein_id gnl|my_center|LOCUS_21820 2323053 2324543 gene locus_tag LOCUS_21830 2323053 2324543 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013753.1 protein_id gnl|my_center|LOCUS_21830 2325237 2324494 gene locus_tag LOCUS_21840 2325237 2324494 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930266.1 protein_id gnl|my_center|LOCUS_21840 2325298 2326518 gene locus_tag LOCUS_21850 2325298 2326518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015561.1 protein_id gnl|my_center|LOCUS_21850 2326621 2327784 gene locus_tag LOCUS_21860 2326621 2327784 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014210.1 protein_id gnl|my_center|LOCUS_21860 2328440 2327781 gene locus_tag LOCUS_21870 2328440 2327781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_21870 2329448 2328441 gene locus_tag LOCUS_21880 2329448 2328441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803689.1 protein_id gnl|my_center|LOCUS_21880 2329862 2331211 gene locus_tag LOCUS_21890 2329862 2331211 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_21890 2331530 2332639 gene locus_tag LOCUS_21900 2331530 2332639 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_21900 2332640 2333239 gene locus_tag LOCUS_21910 2332640 2333239 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 protein_id gnl|my_center|LOCUS_21910 2333250 2334149 gene locus_tag LOCUS_21920 2333250 2334149 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014310.1 protein_id gnl|my_center|LOCUS_21920 2335309 2334146 gene locus_tag LOCUS_21930 2335309 2334146 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862889.1 protein_id gnl|my_center|LOCUS_21930 2335390 2336697 gene locus_tag LOCUS_21940 2335390 2336697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2336953 2336681 gene locus_tag LOCUS_21950 2336953 2336681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2337336 2336968 gene locus_tag LOCUS_21960 2337336 2336968 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857248.1 protein_id gnl|my_center|LOCUS_21960 2337857 2337348 gene locus_tag LOCUS_21970 2337857 2337348 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015564.1 protein_id gnl|my_center|LOCUS_21970 2337856 2338851 gene locus_tag LOCUS_21980 2337856 2338851 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015197.1 protein_id gnl|my_center|LOCUS_21980 2339804 2338848 gene locus_tag LOCUS_21990 2339804 2338848 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014758.1 protein_id gnl|my_center|LOCUS_21990 2342686 2339858 gene locus_tag LOCUS_22000 gene leuS 2342686 2339858 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 protein_id gnl|my_center|LOCUS_22000 2344370 2342679 gene locus_tag LOCUS_22010 2344370 2342679 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049825762.1 protein_id gnl|my_center|LOCUS_22010 2344468 2345589 gene locus_tag LOCUS_22020 2344468 2345589 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217828.1 protein_id gnl|my_center|LOCUS_22020 2345867 2345586 gene locus_tag LOCUS_22030 2345867 2345586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2346205 2345939 gene locus_tag LOCUS_22040 2346205 2345939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2346511 2346209 gene locus_tag LOCUS_22050 2346511 2346209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2346696 2346571 gene locus_tag LOCUS_22060 2346696 2346571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2347336 2348511 gene locus_tag LOCUS_22070 2347336 2348511 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_22070 2348906 2348532 gene locus_tag LOCUS_22080 2348906 2348532 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403190.1 protein_id gnl|my_center|LOCUS_22080 2349079 2350488 gene locus_tag LOCUS_22090 gene dcuC 2349079 2350488 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 protein_id gnl|my_center|LOCUS_22090 2350566 2352374 gene locus_tag LOCUS_22100 2350566 2352374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2353482 2352382 gene locus_tag LOCUS_22110 2353482 2352382 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_22110 2353598 2353479 gene locus_tag LOCUS_22120 2353598 2353479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2353746 2354600 gene locus_tag LOCUS_22130 2353746 2354600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2355081 2356553 gene locus_tag LOCUS_22140 2355081 2356553 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015396.1 protein_id gnl|my_center|LOCUS_22140 2356554 2357141 gene locus_tag LOCUS_22150 2356554 2357141 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015395.1 protein_id gnl|my_center|LOCUS_22150 2357138 2360488 gene locus_tag LOCUS_22160 2357138 2360488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_22160 2360475 2361575 gene locus_tag LOCUS_22170 2360475 2361575 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015393.1 protein_id gnl|my_center|LOCUS_22170 2366364 2361871 gene locus_tag LOCUS_22180 2366364 2361871 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966317.1 protein_id gnl|my_center|LOCUS_22180 2367715 2366648 gene locus_tag LOCUS_22190 2367715 2366648 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_22190 2368198 2367971 gene locus_tag LOCUS_22200 2368198 2367971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2369223 2368303 gene locus_tag LOCUS_22210 2369223 2368303 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 protein_id gnl|my_center|LOCUS_22210 2374164 2369239 gene locus_tag LOCUS_22220 2374164 2369239 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015608.1 protein_id gnl|my_center|LOCUS_22220 2374751 2374897 gene locus_tag LOCUS_22230 2374751 2374897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2375113 2375256 gene locus_tag LOCUS_22240 2375113 2375256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 2375309 2376241 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctggggatctgttcacaaaccccctggtagacttc 2377516 2376608 gene locus_tag LOCUS_22250 gene cas1 2377516 2376608 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352326.1 protein_id gnl|my_center|LOCUS_22250 2380831 2377517 gene locus_tag LOCUS_22260 2380831 2377517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2381274 2381047 gene locus_tag LOCUS_22270 2381274 2381047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2381434 2381760 gene locus_tag LOCUS_22280 2381434 2381760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2381772 2382812 gene locus_tag LOCUS_22290 2381772 2382812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2383812 2382829 gene locus_tag LOCUS_22300 2383812 2382829 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014413.1 protein_id gnl|my_center|LOCUS_22300 2384131 2383805 gene locus_tag LOCUS_22310 2384131 2383805 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013515.1 protein_id gnl|my_center|LOCUS_22310 2384169 2385215 gene locus_tag LOCUS_22320 gene arsB 2384169 2385215 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265757.1 protein_id gnl|my_center|LOCUS_22320 2385235 2385639 gene locus_tag LOCUS_22330 2385235 2385639 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014415.1 protein_id gnl|my_center|LOCUS_22330 2386772 2385666 gene locus_tag LOCUS_22340 2386772 2385666 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015116.1 protein_id gnl|my_center|LOCUS_22340 2387998 2386787 gene locus_tag LOCUS_22350 2387998 2386787 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_22350 2389490 2388027 gene locus_tag LOCUS_22360 2389490 2388027 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479724.1 protein_id gnl|my_center|LOCUS_22360 2391506 2389530 gene locus_tag LOCUS_22370 2391506 2389530 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_22370 2392693 2391518 gene locus_tag LOCUS_22380 2392693 2391518 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_22380 2393987 2392773 gene locus_tag LOCUS_22390 2393987 2392773 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_22390 2395510 2394080 gene locus_tag LOCUS_22400 2395510 2394080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2396243 2395530 gene locus_tag LOCUS_22410 2396243 2395530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2396305 2397393 gene locus_tag LOCUS_22420 gene ugpC 2396305 2397393 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015140.1 protein_id gnl|my_center|LOCUS_22420 2398692 2397457 gene locus_tag LOCUS_22430 2398692 2397457 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 protein_id gnl|my_center|LOCUS_22430 2398807 2399229 gene locus_tag LOCUS_22440 2398807 2399229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2399488 2401032 gene locus_tag LOCUS_22450 2399488 2401032 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 protein_id gnl|my_center|LOCUS_22450 2401029 2401652 gene locus_tag LOCUS_22460 2401029 2401652 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855176.1 protein_id gnl|my_center|LOCUS_22460 2401652 2402680 gene locus_tag LOCUS_22470 gene trpD 2401652 2402680 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855178.1 protein_id gnl|my_center|LOCUS_22470 2402673 2404073 gene locus_tag LOCUS_22480 gene trpCF 2402673 2404073 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015582.1 protein_id gnl|my_center|LOCUS_22480 2404086 2405336 gene locus_tag LOCUS_22490 gene trpB 2404086 2405336 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 protein_id gnl|my_center|LOCUS_22490 2405339 2406154 gene locus_tag LOCUS_22500 gene trpA 2405339 2406154 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567954.1 protein_id gnl|my_center|LOCUS_22500 2406168 2406548 gene locus_tag LOCUS_22510 2406168 2406548 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855195.1 protein_id gnl|my_center|LOCUS_22510 2406579 2407541 gene locus_tag LOCUS_22520 2406579 2407541 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 protein_id gnl|my_center|LOCUS_22520 2407570 2407878 gene locus_tag LOCUS_22530 2407570 2407878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015617.1 protein_id gnl|my_center|LOCUS_22530 2408220 2407882 gene locus_tag LOCUS_22540 2408220 2407882 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 protein_id gnl|my_center|LOCUS_22540 2408934 2408221 gene locus_tag LOCUS_22550 2408934 2408221 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_22550 2409553 2408945 gene locus_tag LOCUS_22560 2409553 2408945 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 protein_id gnl|my_center|LOCUS_22560 2411048 2409546 gene locus_tag LOCUS_22570 2411048 2409546 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 protein_id gnl|my_center|LOCUS_22570 2411422 2411925 gene locus_tag LOCUS_22580 2411422 2411925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2411940 2414459 gene locus_tag LOCUS_22590 2411940 2414459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 protein_id gnl|my_center|LOCUS_22590 2414473 2417871 gene locus_tag LOCUS_22600 2414473 2417871 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 protein_id gnl|my_center|LOCUS_22600 2417882 2418577 gene locus_tag LOCUS_22610 2417882 2418577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2418704 2419732 gene locus_tag LOCUS_22620 gene trxB 2418704 2419732 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 protein_id gnl|my_center|LOCUS_22620 2419820 2420143 gene locus_tag LOCUS_22630 gene trxA 2419820 2420143 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 protein_id gnl|my_center|LOCUS_22630 2420177 2421412 gene locus_tag LOCUS_22640 2420177 2421412 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 protein_id gnl|my_center|LOCUS_22640 2421695 2421420 gene locus_tag LOCUS_22650 2421695 2421420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2423096 2422056 gene locus_tag LOCUS_22660 2423096 2422056 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855307.1 protein_id gnl|my_center|LOCUS_22660 2424064 2423099 gene locus_tag LOCUS_22670 2424064 2423099 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 protein_id gnl|my_center|LOCUS_22670 2424766 2424125 gene locus_tag LOCUS_22680 gene rsmG 2424766 2424125 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 protein_id gnl|my_center|LOCUS_22680 2427274 2426462 gene locus_tag LOCUS_22690 2427274 2426462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2428387 2427299 gene locus_tag LOCUS_22700 2428387 2427299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014542.1 protein_id gnl|my_center|LOCUS_22700 2429009 2428734 gene locus_tag LOCUS_22710 2429009 2428734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2429196 2429342 gene locus_tag LOCUS_22720 2429196 2429342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2429474 2430334 gene locus_tag LOCUS_22730 2429474 2430334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 2431028 2430414 gene locus_tag LOCUS_22740 2431028 2430414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2430988 2431299 gene locus_tag LOCUS_22750 2430988 2431299 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_22750 2432735 2431386 gene locus_tag LOCUS_22760 2432735 2431386 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 protein_id gnl|my_center|LOCUS_22760 2432910 2433443 gene locus_tag LOCUS_22770 2432910 2433443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 2433542 2435176 gene locus_tag LOCUS_22780 gene istA 2433542 2435176 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_22780 2435182 2435949 gene locus_tag LOCUS_22790 gene istB 2435182 2435949 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_22790 2436048 2436305 gene locus_tag LOCUS_22800 2436048 2436305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2437841 2436864 gene locus_tag LOCUS_22810 gene yidC 2437841 2436864 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 protein_id gnl|my_center|LOCUS_22810 2438153 2437857 gene locus_tag LOCUS_22820 2438153 2437857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2438518 2438153 gene locus_tag LOCUS_22830 gene rnpA 2438518 2438153 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 protein_id gnl|my_center|LOCUS_22830 2438705 2438568 gene locus_tag LOCUS_22840 gene rpmH 2438705 2438568 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_22840