>Feature sequence1 8193 334 gene locus_tag LOCUS_00010 8193 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 8740 9432 gene locus_tag LOCUS_00020 8740 9432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_00020 9436 10614 gene locus_tag LOCUS_00030 9436 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 10607 12541 gene locus_tag LOCUS_00040 10607 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 12612 13157 gene locus_tag LOCUS_00050 12612 13157 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942734.1 protein_id gnl|my_center|LOCUS_00050 13625 13167 gene locus_tag LOCUS_00060 13625 13167 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940846.1 protein_id gnl|my_center|LOCUS_00060 13946 13680 gene locus_tag LOCUS_00070 13946 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14717 13965 gene locus_tag LOCUS_00080 14717 13965 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_00080 15049 14726 gene locus_tag LOCUS_00090 15049 14726 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_00090 15469 17526 gene locus_tag LOCUS_00100 15469 17526 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941379.1 protein_id gnl|my_center|LOCUS_00100 17680 18180 gene locus_tag LOCUS_00110 17680 18180 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941211.1 protein_id gnl|my_center|LOCUS_00110 19148 18207 gene locus_tag LOCUS_00120 19148 18207 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_00120 22309 19319 gene locus_tag LOCUS_00130 22309 19319 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00130 23472 22306 gene locus_tag LOCUS_00140 gene dinB 23472 22306 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_00140 24087 23479 gene locus_tag LOCUS_00150 gene lexA 24087 23479 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267741.1 protein_id gnl|my_center|LOCUS_00150 24505 24714 gene locus_tag LOCUS_00160 24505 24714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 26032 25061 gene locus_tag LOCUS_00170 26032 25061 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_00170 26177 26548 gene locus_tag LOCUS_00180 26177 26548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 26605 27525 gene locus_tag LOCUS_00190 26605 27525 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811178.1 protein_id gnl|my_center|LOCUS_00190 28841 27618 gene locus_tag LOCUS_00200 28841 27618 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_00200 32203 28838 gene locus_tag LOCUS_00210 32203 28838 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_00210 32828 32196 gene locus_tag LOCUS_00220 32828 32196 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00220 34276 32828 gene locus_tag LOCUS_00230 34276 32828 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_00230 34581 34288 gene locus_tag LOCUS_00240 gene hgcB 34581 34288 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_00240 35949 34777 gene locus_tag LOCUS_00250 gene hgcA 35949 34777 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_00250 36464 36162 gene locus_tag LOCUS_00260 36464 36162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 36873 36628 gene locus_tag LOCUS_00270 36873 36628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37338 36991 gene locus_tag LOCUS_00280 37338 36991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00280 37883 37335 gene locus_tag LOCUS_00290 37883 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 39693 38158 gene locus_tag LOCUS_00300 39693 38158 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214443067.1 protein_id gnl|my_center|LOCUS_00300 40507 39803 gene locus_tag LOCUS_00310 40507 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 40709 40882 gene locus_tag LOCUS_00320 40709 40882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41634 40930 gene locus_tag LOCUS_00330 41634 40930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 41986 43041 gene locus_tag LOCUS_00340 41986 43041 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_00340 43663 43049 gene locus_tag LOCUS_00350 43663 43049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 44615 43929 gene locus_tag LOCUS_00360 44615 43929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 44749 45528 gene locus_tag LOCUS_00370 44749 45528 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_00370 47536 45806 gene locus_tag LOCUS_00380 gene polX 47536 45806 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_00380 47729 48634 gene locus_tag LOCUS_00390 47729 48634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48890 49195 gene locus_tag LOCUS_00400 48890 49195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49084 50127 gene locus_tag LOCUS_00410 49084 50127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51396 50089 gene locus_tag LOCUS_00420 51396 50089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_00420 51372 51379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51803 52699 gene locus_tag LOCUS_00430 51803 52699 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_00430 52844 53983 gene locus_tag LOCUS_00440 52844 53983 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_00440 54006 54152 gene locus_tag LOCUS_00450 54006 54152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54642 54169 gene locus_tag LOCUS_00460 54642 54169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56659 54632 gene locus_tag LOCUS_00470 56659 54632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 57911 56799 gene locus_tag LOCUS_00480 57911 56799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58939 57854 gene locus_tag LOCUS_00490 58939 57854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60261 58939 gene locus_tag LOCUS_00500 60261 58939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61747 60296 gene locus_tag LOCUS_00510 61747 60296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61964 62227 gene locus_tag LOCUS_00520 61964 62227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62897 64261 gene locus_tag LOCUS_00530 62897 64261 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_00530 64378 65844 gene locus_tag LOCUS_00540 64378 65844 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867494.1 protein_id gnl|my_center|LOCUS_00540 65841 66518 gene locus_tag LOCUS_00550 65841 66518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67007 66504 gene locus_tag LOCUS_00560 67007 66504 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 protein_id gnl|my_center|LOCUS_00560 67675 67007 gene locus_tag LOCUS_00570 67675 67007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67884 70079 gene locus_tag LOCUS_00580 gene katG 67884 70079 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942744.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence2 349 35 gene locus_tag LOCUS_00590 349 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 640 371 gene locus_tag LOCUS_00600 640 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 1026 1232 gene locus_tag LOCUS_00610 1026 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 1248 1583 gene locus_tag LOCUS_00620 1248 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 3699 2644 gene locus_tag LOCUS_00630 3699 2644 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_00630 4425 4027 gene locus_tag LOCUS_00640 4425 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 4797 4588 gene locus_tag LOCUS_00650 4797 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 5167 4757 gene locus_tag LOCUS_00660 5167 4757 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942802.1 protein_id gnl|my_center|LOCUS_00660 5787 5239 gene locus_tag LOCUS_00670 5787 5239 CDS product CHC2 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942812.1 protein_id gnl|my_center|LOCUS_00670 7463 5799 gene locus_tag LOCUS_00680 7463 5799 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_00680 8415 7480 gene locus_tag LOCUS_00690 8415 7480 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_00690 8851 8507 gene locus_tag LOCUS_00700 8851 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 9825 8866 gene locus_tag LOCUS_00710 9825 8866 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_00710 10119 9901 gene locus_tag LOCUS_00720 10119 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10274 10104 gene locus_tag LOCUS_00730 10274 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 11366 10371 gene locus_tag LOCUS_00740 11366 10371 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_00740 12508 11468 gene locus_tag LOCUS_00750 12508 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 13314 12982 gene locus_tag LOCUS_00760 13314 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 13576 13301 gene locus_tag LOCUS_00770 13576 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 14606 13866 gene locus_tag LOCUS_00780 14606 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 17647 14606 gene locus_tag LOCUS_00790 17647 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 18122 18499 gene locus_tag LOCUS_00800 18122 18499 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_00800 18974 18531 gene locus_tag LOCUS_00810 18974 18531 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210981.1 protein_id gnl|my_center|LOCUS_00810 19372 18974 gene locus_tag LOCUS_00820 19372 18974 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266691.1 protein_id gnl|my_center|LOCUS_00820 19817 19524 gene locus_tag LOCUS_00830 19817 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 20086 20379 gene locus_tag LOCUS_00840 20086 20379 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_00840 20451 21254 gene locus_tag LOCUS_00850 20451 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 21644 23092 gene locus_tag LOCUS_00860 gene istA 21644 23092 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_00860 23082 23891 gene locus_tag LOCUS_00870 gene istB 23082 23891 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_00870 23879 24124 gene locus_tag LOCUS_00880 23879 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 26332 25079 gene locus_tag LOCUS_00890 26332 25079 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_00890 27675 26404 gene locus_tag LOCUS_00900 27675 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 28738 27683 gene locus_tag LOCUS_00910 28738 27683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 31736 28728 gene locus_tag LOCUS_00920 31736 28728 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_00920 33322 31856 gene locus_tag LOCUS_00930 33322 31856 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_00930 34638 33319 gene locus_tag LOCUS_00940 34638 33319 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895634.1 protein_id gnl|my_center|LOCUS_00940 35709 34642 gene locus_tag LOCUS_00950 35709 34642 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_00950 37841 35706 gene locus_tag LOCUS_00960 37841 35706 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114406.1 protein_id gnl|my_center|LOCUS_00960 38174 37986 gene locus_tag LOCUS_00970 38174 37986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 39108 38470 gene locus_tag LOCUS_00980 39108 38470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 39402 39205 gene locus_tag LOCUS_00990 39402 39205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 39817 39461 gene locus_tag LOCUS_01000 39817 39461 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_01000 40100 39810 gene locus_tag LOCUS_01010 40100 39810 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_01010 40858 40178 gene locus_tag LOCUS_01020 40858 40178 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_01020 41423 41995 gene locus_tag LOCUS_01030 41423 41995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 42453 42043 gene locus_tag LOCUS_01040 42453 42043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 42836 42537 gene locus_tag LOCUS_01050 42836 42537 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_01050 43473 43210 gene locus_tag LOCUS_01060 43473 43210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 44893 43688 gene locus_tag LOCUS_01070 44893 43688 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_01070 45429 45073 gene locus_tag LOCUS_tm00010 45429 45073 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 46154 45696 gene locus_tag LOCUS_01080 gene smpB 46154 45696 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_01080 46626 46126 gene locus_tag LOCUS_01090 46626 46126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 48345 46942 gene locus_tag LOCUS_01100 gene gltX 48345 46942 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_01100 49306 48506 gene locus_tag LOCUS_01110 gene amrB 49306 48506 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_01110 50213 49320 gene locus_tag LOCUS_01120 50213 49320 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389102.1 protein_id gnl|my_center|LOCUS_01120 50290 50217 gene locus_tag LOCUS_t00010 50290 50217 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51205 50372 gene locus_tag LOCUS_01130 51205 50372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 52267 51221 gene locus_tag LOCUS_01140 gene rtcA 52267 51221 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_01140 52864 52349 gene locus_tag LOCUS_01150 52864 52349 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546005.1 protein_id gnl|my_center|LOCUS_01150 55369 52979 gene locus_tag LOCUS_01160 55369 52979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 55884 55366 gene locus_tag LOCUS_01170 55884 55366 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 protein_id gnl|my_center|LOCUS_01170 56054 57757 gene locus_tag LOCUS_01180 gene hcp 56054 57757 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_01180 59270 57852 gene locus_tag LOCUS_01190 59270 57852 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_01190 59807 59517 gene locus_tag LOCUS_01200 59807 59517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 59967 60254 gene locus_tag LOCUS_01210 59967 60254 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_01210 61063 60368 gene locus_tag LOCUS_01220 61063 60368 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_01220 61406 61053 gene locus_tag LOCUS_01230 61406 61053 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_01230 62221 61424 gene locus_tag LOCUS_01240 62221 61424 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_01240 63649 62336 gene locus_tag LOCUS_01250 63649 62336 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942640.1 protein_id gnl|my_center|LOCUS_01250 63982 63749 gene locus_tag LOCUS_01260 gene hfq 63982 63749 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942642.1 protein_id gnl|my_center|LOCUS_01260 64934 64005 gene locus_tag LOCUS_01270 gene miaA 64934 64005 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_01270 66766 64946 gene locus_tag LOCUS_01280 gene mutL 66766 64946 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_01280 67910 67008 gene locus_tag LOCUS_01290 67910 67008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 70125 67966 gene locus_tag LOCUS_01300 70125 67966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 71043 70333 gene locus_tag LOCUS_01310 71043 70333 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_01310 71753 71067 gene locus_tag LOCUS_01320 71753 71067 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_01320 74463 71791 gene locus_tag LOCUS_01330 74463 71791 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_01330 75648 74704 gene locus_tag LOCUS_01340 75648 74704 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_01340 76502 75645 gene locus_tag LOCUS_01350 76502 75645 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_01350 76967 76530 gene locus_tag LOCUS_01360 gene rimI 76967 76530 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_01360 77223 78368 gene locus_tag LOCUS_01370 gene purM 77223 78368 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_01370 78386 79045 gene locus_tag LOCUS_01380 gene purN 78386 79045 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_01380 79055 79519 gene locus_tag LOCUS_01390 79055 79519 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083256.1 protein_id gnl|my_center|LOCUS_01390 79611 79802 gene locus_tag LOCUS_01400 gene rpmB 79611 79802 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_01400 80433 80041 gene locus_tag LOCUS_01410 80433 80041 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_01410 82793 80637 gene locus_tag LOCUS_01420 82793 80637 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_01420 83138 82932 gene locus_tag LOCUS_01430 gene rpoZ 83138 82932 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_01430 83802 83164 gene locus_tag LOCUS_01440 gene gmk 83802 83164 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_01440 84658 83792 gene locus_tag LOCUS_01450 84658 83792 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_01450 85241 84675 gene locus_tag LOCUS_01460 gene rfbC 85241 84675 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_01460 86126 85257 gene locus_tag LOCUS_01470 gene rfbA 86126 85257 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_01470 87046 86123 gene locus_tag LOCUS_01480 gene rfbD 87046 86123 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_01480 88113 87043 gene locus_tag LOCUS_01490 gene rfbB 88113 87043 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943002.1 protein_id gnl|my_center|LOCUS_01490 89473 88157 gene locus_tag LOCUS_01500 89473 88157 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_01500 90663 89596 gene locus_tag LOCUS_01510 90663 89596 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_01510 92098 90644 gene locus_tag LOCUS_01520 92098 90644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 92502 92155 gene locus_tag LOCUS_01530 92502 92155 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_01530 94696 92477 gene locus_tag LOCUS_01540 94696 92477 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942070.1 protein_id gnl|my_center|LOCUS_01540 95823 94693 gene locus_tag LOCUS_01550 95823 94693 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_01550 96896 95919 gene locus_tag LOCUS_01560 96896 95919 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459270.1 protein_id gnl|my_center|LOCUS_01560 97683 96910 gene locus_tag LOCUS_01570 gene cobM 97683 96910 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102926.1 protein_id gnl|my_center|LOCUS_01570 98438 97680 gene locus_tag LOCUS_01580 98438 97680 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_01580 99172 98612 gene locus_tag LOCUS_01590 99172 98612 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_01590 100175 99297 gene locus_tag LOCUS_01600 100175 99297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 102525 100345 gene locus_tag LOCUS_01610 102525 100345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 105833 102681 gene locus_tag LOCUS_01620 105833 102681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 107695 106253 gene locus_tag LOCUS_01630 107695 106253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 108044 107712 gene locus_tag LOCUS_01640 108044 107712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 108758 109006 gene locus_tag LOCUS_01650 108758 109006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 109003 111438 gene locus_tag LOCUS_01660 109003 111438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 111459 111770 gene locus_tag LOCUS_01670 111459 111770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_01670 111794 112612 gene locus_tag LOCUS_01680 111794 112612 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_01680 112909 112727 gene locus_tag LOCUS_01690 112909 112727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 113130 112906 gene locus_tag LOCUS_01700 113130 112906 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_01700 113875 113234 gene locus_tag LOCUS_01710 113875 113234 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_01710 114338 114889 gene locus_tag LOCUS_01720 gene hoxE 114338 114889 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 protein_id gnl|my_center|LOCUS_01720 114886 116598 gene locus_tag LOCUS_01730 114886 116598 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943356.1 protein_id gnl|my_center|LOCUS_01730 116598 117314 gene locus_tag LOCUS_01740 gene hoxU 116598 117314 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943355.1 protein_id gnl|my_center|LOCUS_01740 117335 117880 gene locus_tag LOCUS_01750 117335 117880 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943354.1 protein_id gnl|my_center|LOCUS_01750 117902 119332 gene locus_tag LOCUS_01760 117902 119332 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943353.1 protein_id gnl|my_center|LOCUS_01760 119332 119802 gene locus_tag LOCUS_01770 119332 119802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 120203 119730 gene locus_tag LOCUS_01780 120203 119730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 121255 120200 gene locus_tag LOCUS_01790 121255 120200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 122377 121349 gene locus_tag LOCUS_01800 122377 121349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 124706 122343 gene locus_tag LOCUS_01810 124706 122343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 126143 124920 gene locus_tag LOCUS_01820 126143 124920 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_01820 126574 126726 gene locus_tag LOCUS_01830 126574 126726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 127786 127025 gene locus_tag LOCUS_01840 127786 127025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 128728 127853 gene locus_tag LOCUS_01850 128728 127853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 129053 129235 gene locus_tag LOCUS_01860 129053 129235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 129935 129312 gene locus_tag LOCUS_01870 gene ycaC 129935 129312 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 protein_id gnl|my_center|LOCUS_01870 130249 131679 gene locus_tag LOCUS_01880 130249 131679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 132054 131695 gene locus_tag LOCUS_01890 132054 131695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 133314 132091 gene locus_tag LOCUS_01900 133314 132091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 133750 133331 gene locus_tag LOCUS_01910 133750 133331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 134055 135005 gene locus_tag LOCUS_01920 134055 135005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 135236 135108 gene locus_tag LOCUS_01930 135236 135108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 135539 135339 gene locus_tag LOCUS_01940 135539 135339 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_01940 136933 136610 gene locus_tag LOCUS_01950 136933 136610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 136817 138064 gene locus_tag LOCUS_01960 136817 138064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 138780 139748 gene locus_tag LOCUS_01970 138780 139748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 139793 140071 gene locus_tag LOCUS_01980 139793 140071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 140068 140871 gene locus_tag LOCUS_01990 140068 140871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 140885 141052 gene locus_tag LOCUS_02000 140885 141052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 143316 142132 gene locus_tag LOCUS_02010 143316 142132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 144179 143406 gene locus_tag LOCUS_02020 144179 143406 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_02020 144493 144203 gene locus_tag LOCUS_02030 144493 144203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 145072 144680 gene locus_tag LOCUS_02040 145072 144680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 145582 145166 gene locus_tag LOCUS_02050 145582 145166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943077.1 protein_id gnl|my_center|LOCUS_02050 145939 147060 gene locus_tag LOCUS_02060 145939 147060 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_02060 148073 149608 gene locus_tag LOCUS_02070 148073 149608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 149605 150396 gene locus_tag LOCUS_02080 gene istB 149605 150396 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_02080 152698 151391 gene locus_tag LOCUS_02090 152698 151391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 153280 152861 gene locus_tag LOCUS_02100 153280 152861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 153935 154963 gene locus_tag LOCUS_02110 153935 154963 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251612.1 protein_id gnl|my_center|LOCUS_02110 155827 154976 gene locus_tag LOCUS_02120 155827 154976 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_02120 157951 156098 gene locus_tag LOCUS_02130 gene recD 157951 156098 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_02130 161550 157948 gene locus_tag LOCUS_02140 gene recB 161550 157948 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_02140 164792 161547 gene locus_tag LOCUS_02150 gene recC 164792 161547 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932746.1 protein_id gnl|my_center|LOCUS_02150 165416 164937 gene locus_tag LOCUS_02160 165416 164937 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941052.1 protein_id gnl|my_center|LOCUS_02160 165594 165430 gene locus_tag LOCUS_02170 165594 165430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941841.1 protein_id gnl|my_center|LOCUS_02170 166396 165677 gene locus_tag LOCUS_02180 166396 165677 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_02180 166896 167651 gene locus_tag LOCUS_02190 166896 167651 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_02190 169030 167690 gene locus_tag LOCUS_02200 169030 167690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 169759 170013 gene locus_tag LOCUS_02210 169759 170013 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_02210 170029 171834 gene locus_tag LOCUS_02220 170029 171834 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_02220 171982 172368 gene locus_tag LOCUS_02230 171982 172368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 172769 172377 gene locus_tag LOCUS_02240 172769 172377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941888.1 protein_id gnl|my_center|LOCUS_02240 173366 172944 gene locus_tag LOCUS_02250 173366 172944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 173990 173376 gene locus_tag LOCUS_02260 173990 173376 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_02260 174337 174065 gene locus_tag LOCUS_02270 gene ybeD 174337 174065 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418162.1 protein_id gnl|my_center|LOCUS_02270 174785 174330 gene locus_tag LOCUS_02280 gene dut 174785 174330 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_02280 177043 174944 gene locus_tag LOCUS_02290 gene pnp 177043 174944 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_02290 177506 177240 gene locus_tag LOCUS_02300 gene rpsO 177506 177240 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_02300 178530 177613 gene locus_tag LOCUS_02310 gene truB 178530 177613 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_02310 179505 178534 gene locus_tag LOCUS_02320 179505 178534 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_02320 179842 179465 gene locus_tag LOCUS_02330 179842 179465 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_02330 180322 180035 gene locus_tag LOCUS_02340 180322 180035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 183141 180334 gene locus_tag LOCUS_02350 183141 180334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 183734 183141 gene locus_tag LOCUS_02360 183734 183141 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942232.1 protein_id gnl|my_center|LOCUS_02360 184933 183734 gene locus_tag LOCUS_02370 gene nusA 184933 183734 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_02370 185510 185016 gene locus_tag LOCUS_02380 gene rimP 185510 185016 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_02380 186961 185675 gene locus_tag LOCUS_02390 gene rlmD 186961 185675 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_02390 187362 186961 gene locus_tag LOCUS_02400 187362 186961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 188138 187359 gene locus_tag LOCUS_02410 188138 187359 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_02410 188983 188216 gene locus_tag LOCUS_02420 188983 188216 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_02420 189386 188964 gene locus_tag LOCUS_02430 189386 188964 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919563.1 protein_id gnl|my_center|LOCUS_02430 189943 189401 gene locus_tag LOCUS_02440 189943 189401 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942504.1 protein_id gnl|my_center|LOCUS_02440 190725 189940 gene locus_tag LOCUS_02450 190725 189940 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_02450 191792 190722 gene locus_tag LOCUS_02460 191792 190722 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_02460 192039 191815 gene locus_tag LOCUS_02470 192039 191815 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942507.1 protein_id gnl|my_center|LOCUS_02470 193338 192124 gene locus_tag LOCUS_02480 193338 192124 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_02480 194272 193385 gene locus_tag LOCUS_02490 gene xerD 194272 193385 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_02490 197046 194344 gene locus_tag LOCUS_02500 gene glnD 197046 194344 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_02500 198397 197141 gene locus_tag LOCUS_02510 198397 197141 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_02510 201101 198489 gene locus_tag LOCUS_02520 gene mutS 201101 198489 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_02520 201350 201850 gene locus_tag LOCUS_02530 201350 201850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942083.1 protein_id gnl|my_center|LOCUS_02530 201857 202801 gene locus_tag LOCUS_02540 201857 202801 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 protein_id gnl|my_center|LOCUS_02540 205526 202869 gene locus_tag LOCUS_02550 205526 202869 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_02550 206803 205649 gene locus_tag LOCUS_02560 206803 205649 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_02560 208159 207227 gene locus_tag LOCUS_02570 208159 207227 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_02570 208408 208839 gene locus_tag LOCUS_02580 208408 208839 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942508.1 protein_id gnl|my_center|LOCUS_02580 209356 208970 gene locus_tag LOCUS_02590 209356 208970 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044869.1 protein_id gnl|my_center|LOCUS_02590 209538 210311 gene locus_tag LOCUS_02600 209538 210311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 211489 210308 gene locus_tag LOCUS_02610 211489 210308 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_02610 212172 211510 gene locus_tag LOCUS_02620 gene deoC 212172 211510 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887848.1 protein_id gnl|my_center|LOCUS_02620 213394 212195 gene locus_tag LOCUS_02630 gene argJ 213394 212195 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_02630 215118 213439 gene locus_tag LOCUS_02640 215118 213439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 217846 215156 gene locus_tag LOCUS_02650 gene secA 217846 215156 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_02650 219012 218146 gene locus_tag LOCUS_02660 219012 218146 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_02660 219565 219116 gene locus_tag LOCUS_02670 219565 219116 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930707.1 protein_id gnl|my_center|LOCUS_02670 221263 219593 gene locus_tag LOCUS_02680 gene recN 221263 219593 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_02680 222173 221319 gene locus_tag LOCUS_02690 222173 221319 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_02690 222293 223600 gene locus_tag LOCUS_02700 222293 223600 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_02700 224650 223637 gene locus_tag LOCUS_02710 gene amrS 224650 223637 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_02710 225880 224783 gene locus_tag LOCUS_02720 gene rodA 225880 224783 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_02720 227744 225882 gene locus_tag LOCUS_02730 gene mrdA 227744 225882 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02730 228273 227761 gene locus_tag LOCUS_02740 228273 227761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 229088 228270 gene locus_tag LOCUS_02750 gene mreC 229088 228270 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_02750 230234 229185 gene locus_tag LOCUS_02760 230234 229185 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_02760 230427 232367 gene locus_tag LOCUS_02770 230427 232367 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_02770 232375 233271 gene locus_tag LOCUS_02780 232375 233271 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_02780 233378 234031 gene locus_tag LOCUS_02790 233378 234031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 234126 234485 gene locus_tag LOCUS_02800 234126 234485 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_02800 234826 236100 gene locus_tag LOCUS_02810 234826 236100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943282.1 protein_id gnl|my_center|LOCUS_02810 236152 236622 gene locus_tag LOCUS_02820 236152 236622 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943281.1 protein_id gnl|my_center|LOCUS_02820 236662 237864 gene locus_tag LOCUS_02830 236662 237864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 238839 237913 gene locus_tag LOCUS_02840 238839 237913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 239731 238775 gene locus_tag LOCUS_02850 239731 238775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 240675 239806 gene locus_tag LOCUS_02860 240675 239806 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707870.1 protein_id gnl|my_center|LOCUS_02860 241583 240675 gene locus_tag LOCUS_02870 241583 240675 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_02870 242902 241745 gene locus_tag LOCUS_02880 242902 241745 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_02880 243125 244444 gene locus_tag LOCUS_02890 gene mgtE 243125 244444 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_02890 246876 244483 gene locus_tag LOCUS_02900 gene ppsA 246876 244483 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838605.1 protein_id gnl|my_center|LOCUS_02900 247058 249481 gene locus_tag LOCUS_02910 247058 249481 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139545.1 protein_id gnl|my_center|LOCUS_02910 249887 249492 gene locus_tag LOCUS_02920 249887 249492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 252440 249900 gene locus_tag LOCUS_02930 252440 249900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 253381 252437 gene locus_tag LOCUS_02940 gene coxB 253381 252437 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 protein_id gnl|my_center|LOCUS_02940 254383 253472 gene locus_tag LOCUS_02950 254383 253472 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_02950 254871 254419 gene locus_tag LOCUS_02960 254871 254419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 255922 255413 gene locus_tag LOCUS_02970 255922 255413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 256364 257854 gene locus_tag LOCUS_02980 256364 257854 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_02980 257868 258722 gene locus_tag LOCUS_02990 257868 258722 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_02990 259274 259624 gene locus_tag LOCUS_03000 259274 259624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 259725 260189 gene locus_tag LOCUS_03010 259725 260189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 260075 260290 gene locus_tag LOCUS_03020 260075 260290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 260897 260745 gene locus_tag LOCUS_03030 260897 260745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 261372 261284 gene locus_tag LOCUS_t00020 261372 261284 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 261454 261897 gene locus_tag LOCUS_03040 261454 261897 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_03040 263998 261944 gene locus_tag LOCUS_03050 263998 261944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 265016 264156 gene locus_tag LOCUS_03060 265016 264156 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_03060 266533 265013 gene locus_tag LOCUS_03070 266533 265013 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_03070 267507 266650 gene locus_tag LOCUS_03080 267507 266650 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_03080 268902 267565 gene locus_tag LOCUS_03090 gene accC 268902 267565 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_03090 269456 268971 gene locus_tag LOCUS_03100 gene accB 269456 268971 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_03100 270600 269527 gene locus_tag LOCUS_03110 270600 269527 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_03110 271067 270621 gene locus_tag LOCUS_03120 gene aroQ 271067 270621 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142437.1 protein_id gnl|my_center|LOCUS_03120 271433 271074 gene locus_tag LOCUS_03130 271433 271074 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_03130 272229 271423 gene locus_tag LOCUS_03140 272229 271423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 273326 272226 gene locus_tag LOCUS_03150 gene aroB 273326 272226 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_03150 273865 273323 gene locus_tag LOCUS_03160 273865 273323 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_03160 276759 273982 gene locus_tag LOCUS_03170 276759 273982 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942671.1 protein_id gnl|my_center|LOCUS_03170 277291 276764 gene locus_tag LOCUS_03180 277291 276764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 277884 277294 gene locus_tag LOCUS_03190 277884 277294 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_03190 278499 277936 gene locus_tag LOCUS_03200 278499 277936 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_03200 279554 278496 gene locus_tag LOCUS_03210 gene pilM 279554 278496 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_03210 280603 279815 gene locus_tag LOCUS_03220 280603 279815 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_03220 281061 280630 gene locus_tag LOCUS_03230 281061 280630 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_03230 281446 281033 gene locus_tag LOCUS_03240 281446 281033 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_03240 282543 281665 gene locus_tag LOCUS_03250 282543 281665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_03250 283352 282543 gene locus_tag LOCUS_03260 283352 282543 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_03260 284275 283349 gene locus_tag LOCUS_03270 284275 283349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_03270 285617 284244 gene locus_tag LOCUS_03280 285617 284244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 286517 286194 gene locus_tag LOCUS_03290 286517 286194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 286758 286543 gene locus_tag LOCUS_03300 286758 286543 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049786599.1 protein_id gnl|my_center|LOCUS_03300 287401 287171 gene locus_tag LOCUS_03310 287401 287171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 288563 287631 gene locus_tag LOCUS_03320 288563 287631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 289017 288547 gene locus_tag LOCUS_03330 289017 288547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 290759 289131 gene locus_tag LOCUS_03340 290759 289131 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_03340 291989 290772 gene locus_tag LOCUS_03350 291989 290772 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03350 293122 292007 gene locus_tag LOCUS_03360 293122 292007 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_03360 294906 293206 gene locus_tag LOCUS_03370 gene pilB 294906 293206 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_03370 295856 294987 gene locus_tag LOCUS_03380 gene aroE 295856 294987 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_03380 296873 295902 gene locus_tag LOCUS_03390 296873 295902 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_03390 299047 296870 gene locus_tag LOCUS_03400 gene rnr 299047 296870 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_03400 300162 299125 gene locus_tag LOCUS_03410 300162 299125 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391888.1 protein_id gnl|my_center|LOCUS_03410 301673 300312 gene locus_tag LOCUS_03420 301673 300312 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_03420 302008 302415 gene locus_tag LOCUS_03430 302008 302415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 303877 302507 gene locus_tag LOCUS_03440 gene ltrA 303877 302507 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_03440 307958 304398 gene locus_tag LOCUS_03450 307958 304398 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_03450 308509 307958 gene locus_tag LOCUS_03460 308509 307958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 309356 308526 gene locus_tag LOCUS_03470 309356 308526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 309787 309368 gene locus_tag LOCUS_03480 309787 309368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 310247 310540 gene locus_tag LOCUS_03490 310247 310540 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_03490 310537 310887 gene locus_tag LOCUS_03500 310537 310887 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_03500 311434 310919 gene locus_tag LOCUS_03510 311434 310919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 312360 311434 gene locus_tag LOCUS_03520 312360 311434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 315873 312391 gene locus_tag LOCUS_03530 315873 312391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 316246 315866 gene locus_tag LOCUS_03540 316246 315866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 316753 316259 gene locus_tag LOCUS_03550 316753 316259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 317806 316838 gene locus_tag LOCUS_03560 317806 316838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 318213 317803 gene locus_tag LOCUS_03570 318213 317803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 319714 318365 gene locus_tag LOCUS_03580 319714 318365 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_03580 321212 319707 gene locus_tag LOCUS_03590 321212 319707 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_03590 321462 321677 gene locus_tag LOCUS_03600 321462 321677 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_03600 321721 322902 gene locus_tag LOCUS_03610 321721 322902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_03610 323002 323250 gene locus_tag LOCUS_03620 323002 323250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 323887 325137 gene locus_tag LOCUS_03630 gene istA 323887 325137 CDS product IS21-like element ISSme2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970474.1 protein_id gnl|my_center|LOCUS_03630 325134 325931 gene locus_tag LOCUS_03640 gene istB 325134 325931 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_03640 325932 326468 gene locus_tag LOCUS_03650 325932 326468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 326526 328049 gene locus_tag LOCUS_03660 326526 328049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 328129 329154 gene locus_tag LOCUS_03670 328129 329154 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_03670 329151 330035 gene locus_tag LOCUS_03680 329151 330035 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_03680 330634 330122 gene locus_tag LOCUS_03690 330634 330122 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_03690 332134 330692 gene locus_tag LOCUS_03700 332134 330692 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881379.1 protein_id gnl|my_center|LOCUS_03700 334823 332289 gene locus_tag LOCUS_03710 gene acnB 334823 332289 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942304.1 protein_id gnl|my_center|LOCUS_03710 335870 335322 gene locus_tag LOCUS_03720 335870 335322 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_03720 336718 335897 gene locus_tag LOCUS_03730 336718 335897 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_03730 337852 336719 gene locus_tag LOCUS_03740 337852 336719 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_03740 338076 337876 gene locus_tag LOCUS_03750 338076 337876 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942113.1 protein_id gnl|my_center|LOCUS_03750 339245 338289 gene locus_tag LOCUS_03760 gene mdh 339245 338289 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_03760 341576 339342 gene locus_tag LOCUS_03770 341576 339342 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_03770 342576 341935 gene locus_tag LOCUS_03780 342576 341935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 344570 342783 gene locus_tag LOCUS_03790 gene aspS 344570 342783 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_03790 345921 344671 gene locus_tag LOCUS_03800 gene hisS 345921 344671 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_03800 347457 346111 gene locus_tag LOCUS_03810 347457 346111 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942302.1 protein_id gnl|my_center|LOCUS_03810 350117 347751 gene locus_tag LOCUS_03820 350117 347751 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_03820 351262 350120 gene locus_tag LOCUS_03830 351262 350120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 355017 351565 gene locus_tag LOCUS_03840 355017 351565 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_03840 356110 355337 gene locus_tag LOCUS_03850 356110 355337 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_03850 357444 356173 gene locus_tag LOCUS_03860 357444 356173 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_03860 357657 357732 gene locus_tag LOCUS_t00030 357657 357732 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 357804 358085 gene locus_tag LOCUS_03870 357804 358085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 358232 358942 gene locus_tag LOCUS_03880 358232 358942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 359189 361015 gene locus_tag LOCUS_03890 gene btuB 359189 361015 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_03890 361012 361905 gene locus_tag LOCUS_03900 361012 361905 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_03900 361902 362858 gene locus_tag LOCUS_03910 361902 362858 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986441.1 protein_id gnl|my_center|LOCUS_03910 362848 363615 gene locus_tag LOCUS_03920 362848 363615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331761.1 protein_id gnl|my_center|LOCUS_03920 364416 363652 gene locus_tag LOCUS_03930 364416 363652 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_03930 365812 364469 gene locus_tag LOCUS_03940 365812 364469 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_03940 366383 365826 gene locus_tag LOCUS_03950 366383 365826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_03950 367809 366577 gene locus_tag LOCUS_03960 367809 366577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_03960 368894 367806 gene locus_tag LOCUS_03970 gene aroC 368894 367806 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_03970 369234 370610 gene locus_tag LOCUS_03980 369234 370610 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530114.1 protein_id gnl|my_center|LOCUS_03980 370607 371440 gene locus_tag LOCUS_03990 370607 371440 CDS product branched chain amino acid--2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393599.1 protein_id gnl|my_center|LOCUS_03990 371488 371574 gene locus_tag LOCUS_t00040 371488 371574 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 371727 372059 gene locus_tag LOCUS_04000 371727 372059 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_04000 372184 372462 gene locus_tag LOCUS_04010 372184 372462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 372459 372761 gene locus_tag LOCUS_04020 372459 372761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 373360 374355 gene locus_tag LOCUS_04030 373360 374355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 374755 374967 gene locus_tag LOCUS_04040 374755 374967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 375188 375445 gene locus_tag LOCUS_04050 375188 375445 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074236.1 protein_id gnl|my_center|LOCUS_04050 375433 375744 gene locus_tag LOCUS_04060 375433 375744 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_04060 376053 375808 gene locus_tag LOCUS_04070 376053 375808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 376405 376190 gene locus_tag LOCUS_04080 376405 376190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 377243 376776 gene locus_tag LOCUS_04090 377243 376776 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_04090 377668 377243 gene locus_tag LOCUS_04100 377668 377243 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481265.1 protein_id gnl|my_center|LOCUS_04100 380777 377817 gene locus_tag LOCUS_04110 380777 377817 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941340.1 protein_id gnl|my_center|LOCUS_04110 381074 381706 gene locus_tag LOCUS_04120 381074 381706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 383184 381883 gene locus_tag LOCUS_04130 383184 381883 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_04130 383349 383873 gene locus_tag LOCUS_04140 383349 383873 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706911.1 protein_id gnl|my_center|LOCUS_04140 384078 384680 gene locus_tag LOCUS_04150 384078 384680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 384899 385537 gene locus_tag LOCUS_04160 384899 385537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 385722 386543 gene locus_tag LOCUS_04170 385722 386543 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933406.1 protein_id gnl|my_center|LOCUS_04170 387148 387459 gene locus_tag LOCUS_04180 387148 387459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04180 387481 388062 gene locus_tag LOCUS_04190 387481 388062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04190 388696 388265 gene locus_tag LOCUS_04200 388696 388265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 388888 389649 gene locus_tag LOCUS_04210 388888 389649 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942981.1 protein_id gnl|my_center|LOCUS_04210 389846 390481 gene locus_tag LOCUS_04220 389846 390481 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210249913.1 protein_id gnl|my_center|LOCUS_04220 390478 391008 gene locus_tag LOCUS_04230 390478 391008 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_04230 391037 391744 gene locus_tag LOCUS_04240 391037 391744 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_04240 391853 392185 gene locus_tag LOCUS_04250 391853 392185 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_04250 392198 393175 gene locus_tag LOCUS_04260 392198 393175 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941966.1 protein_id gnl|my_center|LOCUS_04260 393233 395374 gene locus_tag LOCUS_04270 393233 395374 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_04270 395392 396222 gene locus_tag LOCUS_04280 395392 396222 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_04280 397107 396232 gene locus_tag LOCUS_04290 397107 396232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 397257 397412 gene locus_tag LOCUS_04300 397257 397412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 397870 397667 gene locus_tag LOCUS_04310 397870 397667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 398047 398355 gene locus_tag LOCUS_04320 398047 398355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 398481 399803 gene locus_tag LOCUS_04330 398481 399803 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_04330 403404 399892 gene locus_tag LOCUS_04340 403404 399892 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_04340 404660 403401 gene locus_tag LOCUS_04350 404660 403401 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_04350 405895 405116 gene locus_tag LOCUS_04360 405895 405116 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_04360 406932 405928 gene locus_tag LOCUS_04370 406932 405928 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_04370 407556 407044 gene locus_tag LOCUS_04380 407556 407044 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_04380 407751 408443 gene locus_tag LOCUS_04390 407751 408443 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_04390 408620 411625 gene locus_tag LOCUS_04400 gene pruA 408620 411625 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944006.1 protein_id gnl|my_center|LOCUS_04400 411639 412142 gene locus_tag LOCUS_04410 411639 412142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 413240 412353 gene locus_tag LOCUS_04420 413240 412353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 413403 416090 gene locus_tag LOCUS_04430 413403 416090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 417427 416087 gene locus_tag LOCUS_04440 417427 416087 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_04440 417912 417487 gene locus_tag LOCUS_04450 gene dksA 417912 417487 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_04450 418101 419009 gene locus_tag LOCUS_04460 418101 419009 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_04460 419023 419352 gene locus_tag LOCUS_04470 419023 419352 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940862.1 protein_id gnl|my_center|LOCUS_04470 419877 419419 gene locus_tag LOCUS_04480 419877 419419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 421783 419897 gene locus_tag LOCUS_04490 421783 419897 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_04490 421962 422171 gene locus_tag LOCUS_04500 421962 422171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 422211 422828 gene locus_tag LOCUS_04510 gene wrbA 422211 422828 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021213.1 protein_id gnl|my_center|LOCUS_04510 423550 422906 gene locus_tag LOCUS_04520 gene can 423550 422906 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_04520 423782 424975 gene locus_tag LOCUS_04530 gene purK 423782 424975 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_04530 424972 425472 gene locus_tag LOCUS_04540 gene purE 424972 425472 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_04540 425542 428493 gene locus_tag LOCUS_04550 425542 428493 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_04550 431037 428530 gene locus_tag LOCUS_04560 gene hrpB 431037 428530 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_04560 431138 432589 gene locus_tag LOCUS_04570 431138 432589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 433761 432586 gene locus_tag LOCUS_04580 433761 432586 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940761.1 protein_id gnl|my_center|LOCUS_04580 434894 433758 gene locus_tag LOCUS_04590 434894 433758 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_04590 435119 436453 gene locus_tag LOCUS_04600 435119 436453 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_04600 436541 437599 gene locus_tag LOCUS_04610 436541 437599 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_04610 437601 438173 gene locus_tag LOCUS_04620 437601 438173 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941844.1 protein_id gnl|my_center|LOCUS_04620 438296 439315 gene locus_tag LOCUS_04630 438296 439315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 439394 439747 gene locus_tag LOCUS_04640 439394 439747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941583.1 protein_id gnl|my_center|LOCUS_04640 439831 440169 gene locus_tag LOCUS_04650 439831 440169 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064420.1 protein_id gnl|my_center|LOCUS_04650 440214 441131 gene locus_tag LOCUS_04660 440214 441131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 441266 442024 gene locus_tag LOCUS_04670 441266 442024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 442372 445593 gene locus_tag LOCUS_04680 442372 445593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 445674 448091 gene locus_tag LOCUS_04690 445674 448091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 protein_id gnl|my_center|LOCUS_04690 451220 448119 gene locus_tag LOCUS_04700 451220 448119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 453698 451269 gene locus_tag LOCUS_04710 453698 451269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 453776 454714 gene locus_tag LOCUS_04720 453776 454714 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_04720 455255 454920 gene locus_tag LOCUS_04730 455255 454920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 455902 456531 gene locus_tag LOCUS_04740 455902 456531 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_04740 456543 458459 gene locus_tag LOCUS_04750 456543 458459 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941837.1 protein_id gnl|my_center|LOCUS_04750 458459 459238 gene locus_tag LOCUS_04760 458459 459238 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941838.1 protein_id gnl|my_center|LOCUS_04760 460144 459305 gene locus_tag LOCUS_04770 460144 459305 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_04770 462074 460731 gene locus_tag LOCUS_04780 gene glrR 462074 460731 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_04780 462670 462086 gene locus_tag LOCUS_04790 462670 462086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 464088 462667 gene locus_tag LOCUS_04800 464088 462667 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_04800 465453 464119 gene locus_tag LOCUS_04810 465453 464119 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_04810 465573 467279 gene locus_tag LOCUS_04820 465573 467279 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391741.1 protein_id gnl|my_center|LOCUS_04820 467427 469148 gene locus_tag LOCUS_04830 467427 469148 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_04830 469300 470976 gene locus_tag LOCUS_04840 469300 470976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 472683 470992 gene locus_tag LOCUS_04850 472683 470992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 474517 472823 gene locus_tag LOCUS_04860 474517 472823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 474724 475893 gene locus_tag LOCUS_04870 474724 475893 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_04870 476402 475923 gene locus_tag LOCUS_04880 476402 475923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 476642 477745 gene locus_tag LOCUS_04890 476642 477745 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792396.1 protein_id gnl|my_center|LOCUS_04890 478381 477815 gene locus_tag LOCUS_04900 478381 477815 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_04900 479265 478450 gene locus_tag LOCUS_04910 479265 478450 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339594.1 protein_id gnl|my_center|LOCUS_04910 479590 479778 gene locus_tag LOCUS_04920 479590 479778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 480672 479785 gene locus_tag LOCUS_04930 480672 479785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 482583 480691 gene locus_tag LOCUS_04940 gene dxs 482583 480691 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_04940 483570 482680 gene locus_tag LOCUS_04950 483570 482680 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_04950 483879 483652 gene locus_tag LOCUS_04960 gene xseB 483879 483652 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 protein_id gnl|my_center|LOCUS_04960 484872 484006 gene locus_tag LOCUS_04970 484872 484006 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_04970 486068 484869 gene locus_tag LOCUS_04980 gene xseA 486068 484869 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_04980 486171 487046 gene locus_tag LOCUS_04990 486171 487046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 488063 487062 gene locus_tag LOCUS_05000 488063 487062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 489426 488122 gene locus_tag LOCUS_05010 489426 488122 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_05010 490602 489457 gene locus_tag LOCUS_05020 490602 489457 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_05020 491835 490939 gene locus_tag LOCUS_05030 gene ftsX 491835 490939 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_05030 492493 491828 gene locus_tag LOCUS_05040 gene ftsE 492493 491828 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_05040 492911 492495 gene locus_tag LOCUS_05050 492911 492495 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_05050 493410 492919 gene locus_tag LOCUS_05060 493410 492919 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_05060 495992 493416 gene locus_tag LOCUS_05070 495992 493416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 496717 496061 gene locus_tag LOCUS_05080 496717 496061 CDS product type II secretion system protein PulP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942423.1 protein_id gnl|my_center|LOCUS_05080 497283 496714 gene locus_tag LOCUS_05090 497283 496714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 497845 497285 gene locus_tag LOCUS_05100 497845 497285 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942425.1 protein_id gnl|my_center|LOCUS_05100 498768 497842 gene locus_tag LOCUS_05110 498768 497842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 500494 498773 gene locus_tag LOCUS_05120 500494 498773 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_05120 501715 500507 gene locus_tag LOCUS_05130 501715 500507 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_05130 502990 501884 gene locus_tag LOCUS_05140 502990 501884 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942430.1 protein_id gnl|my_center|LOCUS_05140 503816 503007 gene locus_tag LOCUS_05150 503816 503007 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942431.1 protein_id gnl|my_center|LOCUS_05150 504998 503922 gene locus_tag LOCUS_05160 504998 503922 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_05160 505196 505120 gene locus_tag LOCUS_t00050 505196 505120 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 505281 505206 gene locus_tag LOCUS_t00060 505281 505206 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 505387 505311 gene locus_tag LOCUS_t00070 505387 505311 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 505776 505504 gene locus_tag LOCUS_05170 gene hupB 505776 505504 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_05170 508300 505883 gene locus_tag LOCUS_05180 gene lon 508300 505883 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_05180 509737 508487 gene locus_tag LOCUS_05190 gene clpX 509737 508487 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_05190 510365 509781 gene locus_tag LOCUS_05200 gene clpP 510365 509781 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_05200 511702 510368 gene locus_tag LOCUS_05210 gene tig 511702 510368 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_05210 511909 511827 gene locus_tag LOCUS_t00080 511909 511827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 512176 512101 gene locus_tag LOCUS_t00090 512176 512101 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 512337 512261 gene locus_tag LOCUS_t00100 512337 512261 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 512424 512348 gene locus_tag LOCUS_t00110 512424 512348 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 513012 515744 gene locus_tag LOCUS_05220 513012 515744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 516030 516230 gene locus_tag LOCUS_05230 516030 516230 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_05230 516357 516878 gene locus_tag LOCUS_05240 516357 516878 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_05240 517396 518709 gene locus_tag LOCUS_05250 gene ablA 517396 518709 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023873.1 protein_id gnl|my_center|LOCUS_05250 518702 519541 gene locus_tag LOCUS_05260 gene ablB 518702 519541 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878621.1 protein_id gnl|my_center|LOCUS_05260 519745 520305 gene locus_tag LOCUS_05270 519745 520305 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_05270 520749 520369 gene locus_tag LOCUS_05280 520749 520369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 522301 520787 gene locus_tag LOCUS_05290 522301 520787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 524687 522276 gene locus_tag LOCUS_05300 524687 522276 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942659.1 protein_id gnl|my_center|LOCUS_05300 525581 525000 gene locus_tag LOCUS_05310 525581 525000 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072173.1 protein_id gnl|my_center|LOCUS_05310 526731 525859 gene locus_tag LOCUS_05320 526731 525859 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_05320 527044 528003 gene locus_tag LOCUS_05330 527044 528003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_05330 528003 529004 gene locus_tag LOCUS_05340 528003 529004 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_05340 529113 531410 gene locus_tag LOCUS_05350 529113 531410 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943974.1 protein_id gnl|my_center|LOCUS_05350 531806 534178 gene locus_tag LOCUS_05360 gene ptsP 531806 534178 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_05360 535350 534406 gene locus_tag LOCUS_05370 535350 534406 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_05370 535527 536069 gene locus_tag LOCUS_05380 535527 536069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 536386 536168 gene locus_tag LOCUS_05390 536386 536168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 537297 536515 gene locus_tag LOCUS_05400 537297 536515 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_05400 538195 537461 gene locus_tag LOCUS_05410 538195 537461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 539599 538277 gene locus_tag LOCUS_05420 gene amt 539599 538277 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_05420 539974 539636 gene locus_tag LOCUS_05430 539974 539636 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_05430 541881 540307 gene locus_tag LOCUS_05440 541881 540307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 542663 542451 gene locus_tag LOCUS_05450 542663 542451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 542826 543992 gene locus_tag LOCUS_05460 542826 543992 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_05460 544154 545734 gene locus_tag LOCUS_05470 544154 545734 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 protein_id gnl|my_center|LOCUS_05470 547626 545896 gene locus_tag LOCUS_05480 547626 545896 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_05480 547889 548623 gene locus_tag LOCUS_05490 547889 548623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 548728 549210 gene locus_tag LOCUS_05500 gene ybaK 548728 549210 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_05500 549320 550153 gene locus_tag LOCUS_05510 549320 550153 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_05510 550300 551805 gene locus_tag LOCUS_05520 550300 551805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 552201 552560 gene locus_tag LOCUS_05530 552201 552560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 553571 552561 gene locus_tag LOCUS_05540 553571 552561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 554794 553604 gene locus_tag LOCUS_05550 554794 553604 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_05550 554984 556045 gene locus_tag LOCUS_05560 554984 556045 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_05560 556239 558476 gene locus_tag LOCUS_05570 556239 558476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 559154 558636 gene locus_tag LOCUS_05580 559154 558636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 559569 559216 gene locus_tag LOCUS_05590 559569 559216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 559821 559609 gene locus_tag LOCUS_05600 559821 559609 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384941.1 protein_id gnl|my_center|LOCUS_05600 560571 559852 gene locus_tag LOCUS_05610 560571 559852 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228738.1 protein_id gnl|my_center|LOCUS_05610 561713 561024 gene locus_tag LOCUS_05620 561713 561024 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_05620 563886 561787 gene locus_tag LOCUS_05630 563886 561787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 564705 563983 gene locus_tag LOCUS_05640 564705 563983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 565229 564732 gene locus_tag LOCUS_05650 565229 564732 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_05650 565696 565226 gene locus_tag LOCUS_05660 565696 565226 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_05660 566555 565728 gene locus_tag LOCUS_05670 566555 565728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 566490 566741 gene locus_tag LOCUS_05680 566490 566741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 567781 566795 gene locus_tag LOCUS_05690 567781 566795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 569917 567839 gene locus_tag LOCUS_05700 gene fusA 569917 567839 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_05700 570870 570097 gene locus_tag LOCUS_05710 570870 570097 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_05710 571927 570935 gene locus_tag LOCUS_05720 571927 570935 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_05720 572839 572018 gene locus_tag LOCUS_05730 gene nadC 572839 572018 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_05730 572997 573212 gene locus_tag LOCUS_05740 572997 573212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 574012 573326 gene locus_tag LOCUS_05750 574012 573326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942119.1 protein_id gnl|my_center|LOCUS_05750 574998 574045 gene locus_tag LOCUS_05760 574998 574045 CDS product PATAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942118.1 protein_id gnl|my_center|LOCUS_05760 576120 575125 gene locus_tag LOCUS_05770 576120 575125 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_05770 577424 576138 gene locus_tag LOCUS_05780 577424 576138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 579364 577433 gene locus_tag LOCUS_05790 579364 577433 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_05790 579717 582275 gene locus_tag LOCUS_05800 579717 582275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05800 583029 582310 gene locus_tag LOCUS_05810 583029 582310 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941679.1 protein_id gnl|my_center|LOCUS_05810 583765 583040 gene locus_tag LOCUS_05820 583765 583040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941676.1 protein_id gnl|my_center|LOCUS_05820 584631 583876 gene locus_tag LOCUS_05830 584631 583876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 586357 584633 gene locus_tag LOCUS_05840 586357 584633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 588059 586395 gene locus_tag LOCUS_05850 gene hflX 588059 586395 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_05850 588900 588130 gene locus_tag LOCUS_05860 588900 588130 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_05860 590198 588981 gene locus_tag LOCUS_05870 590198 588981 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_05870 590343 590999 gene locus_tag LOCUS_05880 590343 590999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941685.1 protein_id gnl|my_center|LOCUS_05880 592020 591037 gene locus_tag LOCUS_05890 592020 591037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 592375 592824 gene locus_tag LOCUS_05900 592375 592824 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940812.1 protein_id gnl|my_center|LOCUS_05900 593061 593849 gene locus_tag LOCUS_05910 593061 593849 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031318.1 protein_id gnl|my_center|LOCUS_05910 595309 593975 gene locus_tag LOCUS_05920 595309 593975 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_05920 595724 596683 gene locus_tag LOCUS_05930 gene dusB 595724 596683 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_05930 596689 597798 gene locus_tag LOCUS_05940 gene gnfL 596689 597798 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_05940 597858 599291 gene locus_tag LOCUS_05950 gene gnfM 597858 599291 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_05950 600824 599370 gene locus_tag LOCUS_05960 gene dnaB 600824 599370 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_05960 601506 600850 gene locus_tag LOCUS_05970 601506 600850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 602128 601511 gene locus_tag LOCUS_05980 602128 601511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05980 603009 602560 gene locus_tag LOCUS_05990 gene rplI 603009 602560 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_05990 603954 603025 gene locus_tag LOCUS_06000 603954 603025 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941328.1 protein_id gnl|my_center|LOCUS_06000 604234 603989 gene locus_tag LOCUS_06010 604234 603989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 604641 604270 gene locus_tag LOCUS_06020 gene rpsF 604641 604270 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941326.1 protein_id gnl|my_center|LOCUS_06020 605924 604830 gene locus_tag LOCUS_06030 gene ychF 605924 604830 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_06030 608046 606007 gene locus_tag LOCUS_06040 608046 606007 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_06040 608653 608078 gene locus_tag LOCUS_06050 gene pth 608653 608078 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_06050 609278 608670 gene locus_tag LOCUS_06060 609278 608670 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_06060 610284 609343 gene locus_tag LOCUS_06070 610284 609343 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_06070 610525 610451 gene locus_tag LOCUS_t00120 610525 610451 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 611434 610562 gene locus_tag LOCUS_06080 gene ispE 611434 610562 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_06080 611805 612803 gene locus_tag LOCUS_06090 611805 612803 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_06090 612909 615338 gene locus_tag LOCUS_06100 612909 615338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 615362 615808 gene locus_tag LOCUS_06110 615362 615808 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_06110 615839 616756 gene locus_tag LOCUS_06120 615839 616756 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_06120 617101 616820 gene locus_tag LOCUS_06130 617101 616820 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941687.1 protein_id gnl|my_center|LOCUS_06130 617475 617678 gene locus_tag LOCUS_06140 617475 617678 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_06140 617766 619151 gene locus_tag LOCUS_06150 gene rlmD 617766 619151 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942098.1 protein_id gnl|my_center|LOCUS_06150 619415 619188 gene locus_tag LOCUS_06160 619415 619188 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941049.1 protein_id gnl|my_center|LOCUS_06160 621442 619463 gene locus_tag LOCUS_06170 621442 619463 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_06170 622818 621439 gene locus_tag LOCUS_06180 622818 621439 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_06180 623052 623636 gene locus_tag LOCUS_06190 gene yedF 623052 623636 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943158.1 protein_id gnl|my_center|LOCUS_06190 624623 623658 gene locus_tag LOCUS_06200 624623 623658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 624818 624913 gene locus_tag LOCUS_t00130 624818 624913 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 625091 626287 gene locus_tag LOCUS_06210 625091 626287 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_06210 627036 626395 gene locus_tag LOCUS_06220 627036 626395 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687969.1 protein_id gnl|my_center|LOCUS_06220 627271 627660 gene locus_tag LOCUS_06230 627271 627660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 628457 629746 gene locus_tag LOCUS_06240 628457 629746 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_06240 629743 630546 gene locus_tag LOCUS_06250 629743 630546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 630560 630709 gene locus_tag LOCUS_06260 630560 630709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 630814 631269 gene locus_tag LOCUS_06270 630814 631269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 631567 632697 gene locus_tag LOCUS_06280 631567 632697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 632682 633152 gene locus_tag LOCUS_06290 632682 633152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 633480 634376 gene locus_tag LOCUS_06300 633480 634376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 634382 634642 gene locus_tag LOCUS_06310 634382 634642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 634750 635154 gene locus_tag LOCUS_06320 634750 635154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 635159 635860 gene locus_tag LOCUS_06330 635159 635860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 635961 636560 gene locus_tag LOCUS_06340 635961 636560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 636557 637279 gene locus_tag LOCUS_06350 636557 637279 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941514.1 protein_id gnl|my_center|LOCUS_06350 637321 637632 gene locus_tag LOCUS_06360 637321 637632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 637701 637967 gene locus_tag LOCUS_06370 637701 637967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 637964 638524 gene locus_tag LOCUS_06380 637964 638524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 638524 639369 gene locus_tag LOCUS_06390 638524 639369 CDS product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087335.1 protein_id gnl|my_center|LOCUS_06390 639366 640556 gene locus_tag LOCUS_06400 639366 640556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 640553 640945 gene locus_tag LOCUS_06410 640553 640945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 640950 643403 gene locus_tag LOCUS_06420 640950 643403 CDS product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087338.1 protein_id gnl|my_center|LOCUS_06420 643360 645405 gene locus_tag LOCUS_06430 643360 645405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 645418 646830 gene locus_tag LOCUS_06440 645418 646830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 646830 647456 gene locus_tag LOCUS_06450 646830 647456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 647431 648435 gene locus_tag LOCUS_06460 647431 648435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06460 648411 649184 gene locus_tag LOCUS_06470 648411 649184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 649285 649527 gene locus_tag LOCUS_06480 649285 649527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 649524 649787 gene locus_tag LOCUS_06490 649524 649787 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305108.1 protein_id gnl|my_center|LOCUS_06490 649893 650237 gene locus_tag LOCUS_06500 649893 650237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 650234 650794 gene locus_tag LOCUS_06510 650234 650794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 650808 651059 gene locus_tag LOCUS_06520 650808 651059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 651072 651821 gene locus_tag LOCUS_06530 651072 651821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 651892 655194 gene locus_tag LOCUS_06540 651892 655194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 655515 655213 gene locus_tag LOCUS_06550 655515 655213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 655660 655965 gene locus_tag LOCUS_06560 655660 655965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 656488 657153 gene locus_tag LOCUS_06570 656488 657153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 657323 657928 gene locus_tag LOCUS_06580 657323 657928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 659392 658283 gene locus_tag LOCUS_06590 659392 658283 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_06590 659587 659877 gene locus_tag LOCUS_06600 659587 659877 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_06600 659888 660187 gene locus_tag LOCUS_06610 659888 660187 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_06610 660426 660683 gene locus_tag LOCUS_06620 660426 660683 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074236.1 protein_id gnl|my_center|LOCUS_06620 660671 660979 gene locus_tag LOCUS_06630 660671 660979 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_06630 661130 661423 gene locus_tag LOCUS_06640 661130 661423 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_06640 661436 661813 gene locus_tag LOCUS_06650 661436 661813 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_06650 662156 661911 gene locus_tag LOCUS_06660 662156 661911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 663723 662416 gene locus_tag LOCUS_06670 663723 662416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 664020 664304 gene locus_tag LOCUS_06680 664020 664304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 665024 664458 gene locus_tag LOCUS_06690 665024 664458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 665476 665117 gene locus_tag LOCUS_06700 665476 665117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 666036 665596 gene locus_tag LOCUS_06710 666036 665596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 666220 666513 gene locus_tag LOCUS_06720 666220 666513 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_06720 666585 667388 gene locus_tag LOCUS_06730 666585 667388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 667768 667355 gene locus_tag LOCUS_06740 667768 667355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 667850 669070 gene locus_tag LOCUS_06750 667850 669070 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_06750 670333 670665 gene locus_tag LOCUS_06760 670333 670665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 671554 671294 gene locus_tag LOCUS_06770 671554 671294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 672013 671768 gene locus_tag LOCUS_06780 672013 671768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 672810 672001 gene locus_tag LOCUS_06790 gene istB 672810 672001 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_06790 674248 672800 gene locus_tag LOCUS_06800 gene istA 674248 672800 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_06800 675401 674610 gene locus_tag LOCUS_06810 gene istB 675401 674610 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_06810 676933 675398 gene locus_tag LOCUS_06820 676933 675398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 678653 677601 gene locus_tag LOCUS_06830 678653 677601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 679230 678673 gene locus_tag LOCUS_06840 679230 678673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 680057 680668 gene locus_tag LOCUS_06850 680057 680668 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_06850 680665 680904 gene locus_tag LOCUS_06860 680665 680904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 681177 681028 gene locus_tag LOCUS_06870 681177 681028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 681994 681191 gene locus_tag LOCUS_06880 681994 681191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 683280 681991 gene locus_tag LOCUS_06890 683280 681991 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_06890 684009 684710 gene locus_tag LOCUS_06900 684009 684710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 684717 685061 gene locus_tag LOCUS_06910 684717 685061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 685219 685845 gene locus_tag LOCUS_06920 685219 685845 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_06920 685863 686153 gene locus_tag LOCUS_06930 685863 686153 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_06930 686176 686463 gene locus_tag LOCUS_06940 686176 686463 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739893.1 protein_id gnl|my_center|LOCUS_06940 686921 686643 gene locus_tag LOCUS_06950 686921 686643 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_06950 687413 687099 gene locus_tag LOCUS_06960 687413 687099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 687704 687435 gene locus_tag LOCUS_06970 687704 687435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 688090 688296 gene locus_tag LOCUS_06980 688090 688296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 688312 688647 gene locus_tag LOCUS_06990 688312 688647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 690762 689707 gene locus_tag LOCUS_07000 690762 689707 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_07000 691216 692436 gene locus_tag LOCUS_07010 691216 692436 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_07010 693178 692903 gene locus_tag LOCUS_07020 693178 692903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 693548 693138 gene locus_tag LOCUS_07030 693548 693138 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942802.1 protein_id gnl|my_center|LOCUS_07030 694168 693620 gene locus_tag LOCUS_07040 694168 693620 CDS product CHC2 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942812.1 protein_id gnl|my_center|LOCUS_07040 695844 694180 gene locus_tag LOCUS_07050 695844 694180 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_07050 696796 695861 gene locus_tag LOCUS_07060 696796 695861 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_07060 697232 696888 gene locus_tag LOCUS_07070 697232 696888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 698206 697247 gene locus_tag LOCUS_07080 698206 697247 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_07080 698381 698647 gene locus_tag LOCUS_07090 698381 698647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 698613 699026 gene locus_tag LOCUS_07100 698613 699026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 699247 699023 gene locus_tag LOCUS_07110 699247 699023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 699402 699232 gene locus_tag LOCUS_07120 699402 699232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 700494 699499 gene locus_tag LOCUS_07130 700494 699499 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_07130 701636 700596 gene locus_tag LOCUS_07140 701636 700596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 702356 704200 gene locus_tag LOCUS_07150 702356 704200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 704213 704575 gene locus_tag LOCUS_07160 704213 704575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 704652 704825 gene locus_tag LOCUS_07170 704652 704825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 705300 704857 gene locus_tag LOCUS_07180 705300 704857 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 protein_id gnl|my_center|LOCUS_07180 705698 705300 gene locus_tag LOCUS_07190 705698 705300 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266691.1 protein_id gnl|my_center|LOCUS_07190 706247 705846 gene locus_tag LOCUS_07200 706247 705846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 707743 706280 gene locus_tag LOCUS_07210 707743 706280 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942773.1 protein_id gnl|my_center|LOCUS_07210 708590 707751 gene locus_tag LOCUS_07220 708590 707751 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942772.1 protein_id gnl|my_center|LOCUS_07220 709963 708572 gene locus_tag LOCUS_07230 709963 708572 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930439.1 protein_id gnl|my_center|LOCUS_07230 711326 709956 gene locus_tag LOCUS_07240 711326 709956 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942770.1 protein_id gnl|my_center|LOCUS_07240 712032 711301 gene locus_tag LOCUS_07250 712032 711301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 712447 712019 gene locus_tag LOCUS_07260 712447 712019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 712706 713215 gene locus_tag LOCUS_07270 712706 713215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 713196 713714 gene locus_tag LOCUS_07280 713196 713714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 714162 713917 gene locus_tag LOCUS_07290 714162 713917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 714959 714150 gene locus_tag LOCUS_07300 gene istB 714959 714150 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_07300 716397 714949 gene locus_tag LOCUS_07310 gene istA 716397 714949 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_07310 717007 718425 gene locus_tag LOCUS_07320 717007 718425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 719961 718438 gene locus_tag LOCUS_07330 719961 718438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 720185 719961 gene locus_tag LOCUS_07340 720185 719961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 720445 721131 gene locus_tag LOCUS_07350 720445 721131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 721503 721165 gene locus_tag LOCUS_07360 721503 721165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 721778 721500 gene locus_tag LOCUS_07370 721778 721500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 722411 721965 gene locus_tag LOCUS_07380 722411 721965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 722618 722896 gene locus_tag LOCUS_07390 722618 722896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 722893 723315 gene locus_tag LOCUS_07400 722893 723315 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_07400 726493 723347 gene locus_tag LOCUS_07410 726493 723347 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804239.1 protein_id gnl|my_center|LOCUS_07410 729195 726490 gene locus_tag LOCUS_07420 729195 726490 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804240.1 protein_id gnl|my_center|LOCUS_07420 729805 729338 gene locus_tag LOCUS_07430 729805 729338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 730386 729889 gene locus_tag LOCUS_07440 730386 729889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 731123 730668 gene locus_tag LOCUS_07450 731123 730668 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_07450 731673 731242 gene locus_tag LOCUS_07460 731673 731242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 731766 731984 gene locus_tag LOCUS_07470 731766 731984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 732527 732027 gene locus_tag LOCUS_07480 732527 732027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 733300 732557 gene locus_tag LOCUS_07490 733300 732557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 733744 733316 gene locus_tag LOCUS_07500 733744 733316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 734904 734164 gene locus_tag LOCUS_07510 gene istB 734904 734164 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_07510 736427 734901 gene locus_tag LOCUS_07520 gene istA 736427 734901 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_07520 737331 736654 gene locus_tag LOCUS_07530 737331 736654 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_07530 740572 737333 gene locus_tag LOCUS_07540 740572 737333 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_07540 742410 740572 gene locus_tag LOCUS_07550 742410 740572 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_07550 742744 743964 gene locus_tag LOCUS_07560 742744 743964 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_07560 745043 743952 gene locus_tag LOCUS_07570 745043 743952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 746112 745033 gene locus_tag LOCUS_07580 746112 745033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 746258 746551 gene locus_tag LOCUS_07590 746258 746551 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_07590 746623 747426 gene locus_tag LOCUS_07600 746623 747426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 748863 747445 gene locus_tag LOCUS_07610 748863 747445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 750534 748930 gene locus_tag LOCUS_07620 750534 748930 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_07620 751655 750726 gene locus_tag LOCUS_07630 751655 750726 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_07630 751953 751684 gene locus_tag LOCUS_07640 751953 751684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 753076 752387 gene locus_tag LOCUS_07650 753076 752387 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_07650 753861 753451 gene locus_tag LOCUS_07660 753861 753451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 754256 753957 gene locus_tag LOCUS_07670 754256 753957 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_07670 754927 754631 gene locus_tag LOCUS_07680 754927 754631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 756065 755679 gene locus_tag LOCUS_07690 756065 755679 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_07690 756298 756065 gene locus_tag LOCUS_07700 756298 756065 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_07700 756481 757467 gene locus_tag LOCUS_07710 756481 757467 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940966.1 protein_id gnl|my_center|LOCUS_07710 757881 757600 gene locus_tag LOCUS_07720 757881 757600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 758002 758151 gene locus_tag LOCUS_07730 758002 758151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 759807 758377 gene locus_tag LOCUS_07740 759807 758377 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942926.1 protein_id gnl|my_center|LOCUS_07740 760222 759902 gene locus_tag LOCUS_07750 760222 759902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 760405 760590 gene locus_tag LOCUS_07760 760405 760590 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943346.1 protein_id gnl|my_center|LOCUS_07760 761531 760641 gene locus_tag LOCUS_07770 761531 760641 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 protein_id gnl|my_center|LOCUS_07770 762064 761660 gene locus_tag LOCUS_07780 762064 761660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 762353 763816 gene locus_tag LOCUS_07790 762353 763816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_07790 764037 765440 gene locus_tag LOCUS_07800 764037 765440 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_07800 765975 767282 gene locus_tag LOCUS_07810 765975 767282 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 protein_id gnl|my_center|LOCUS_07810 767308 767856 gene locus_tag LOCUS_07820 767308 767856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 770928 767935 gene locus_tag LOCUS_07830 770928 767935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 771923 771033 gene locus_tag LOCUS_07840 771923 771033 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 protein_id gnl|my_center|LOCUS_07840 772634 774220 gene locus_tag LOCUS_07850 772634 774220 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_07850 775257 774352 gene locus_tag LOCUS_07860 775257 774352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 775738 775322 gene locus_tag LOCUS_07870 775738 775322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 777663 775807 gene locus_tag LOCUS_07880 gene aor 777663 775807 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_07880 778094 777870 gene locus_tag LOCUS_07890 778094 777870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 779537 778104 gene locus_tag LOCUS_07900 779537 778104 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_07900 780961 779537 gene locus_tag LOCUS_07910 780961 779537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 782210 780954 gene locus_tag LOCUS_07920 782210 780954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 782291 782851 gene locus_tag LOCUS_07930 782291 782851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 783524 782745 gene locus_tag LOCUS_07940 783524 782745 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 protein_id gnl|my_center|LOCUS_07940 785519 783552 gene locus_tag LOCUS_07950 785519 783552 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461725.1 protein_id gnl|my_center|LOCUS_07950 785767 788355 gene locus_tag LOCUS_07960 785767 788355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 788621 791626 gene locus_tag LOCUS_07970 gene fdnG 788621 791626 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:789185..789187,aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_07970 791623 792519 gene locus_tag LOCUS_07980 791623 792519 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_07980 792516 793775 gene locus_tag LOCUS_07990 gene hybB 792516 793775 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_07990 796252 793904 gene locus_tag LOCUS_08000 796252 793904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 797436 796252 gene locus_tag LOCUS_08010 797436 796252 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447219.1 protein_id gnl|my_center|LOCUS_08010 798852 797482 gene locus_tag LOCUS_08020 798852 797482 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_08020 799182 802214 gene locus_tag LOCUS_08030 gene fdnG 799182 802214 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 transl_except (pos:799737..799739,aa:Sec) note codon on position 186 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08030 802221 802994 gene locus_tag LOCUS_08040 802221 802994 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545194.1 protein_id gnl|my_center|LOCUS_08040 802998 803609 gene locus_tag LOCUS_08050 802998 803609 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_08050 803750 804340 gene locus_tag LOCUS_08060 803750 804340 CDS product disulfide bond formation protein D, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546591.1 transl_except (pos:803894..803896,aa:Sec) note codon on position 49 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08060 804345 805397 gene locus_tag LOCUS_08070 804345 805397 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_08070 805644 806522 gene locus_tag LOCUS_08080 805644 806522 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_08080 806691 808124 gene locus_tag LOCUS_08090 gene fdhD 806691 808124 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941444.1 protein_id gnl|my_center|LOCUS_08090 809471 808125 gene locus_tag LOCUS_08100 809471 808125 CDS product radical SAM/SPASM family putative metalloenzyme maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176675.1 protein_id gnl|my_center|LOCUS_08100 810399 809872 gene locus_tag LOCUS_08110 810399 809872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 810740 810468 gene locus_tag LOCUS_08120 810740 810468 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528685.1 protein_id gnl|my_center|LOCUS_08120 810895 810752 gene locus_tag LOCUS_08130 810895 810752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 812093 810915 gene locus_tag LOCUS_08140 812093 810915 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_08140 812632 813807 gene locus_tag LOCUS_08150 812632 813807 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939668.1 protein_id gnl|my_center|LOCUS_08150 813807 815015 gene locus_tag LOCUS_08160 813807 815015 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011369225.1 protein_id gnl|my_center|LOCUS_08160 815003 816382 gene locus_tag LOCUS_08170 815003 816382 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_08170 816493 817614 gene locus_tag LOCUS_08180 816493 817614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 817960 819165 gene locus_tag LOCUS_08190 gene mdo 817960 819165 CDS product NDMA-dependent methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731151.1 protein_id gnl|my_center|LOCUS_08190 819278 820177 gene locus_tag LOCUS_08200 819278 820177 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_08200 820180 821571 gene locus_tag LOCUS_08210 820180 821571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 821609 821920 gene locus_tag LOCUS_08220 821609 821920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 821926 823047 gene locus_tag LOCUS_08230 821926 823047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 823062 824978 gene locus_tag LOCUS_08240 823062 824978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 824975 825328 gene locus_tag LOCUS_08250 824975 825328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 825351 826211 gene locus_tag LOCUS_08260 825351 826211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 826646 826278 gene locus_tag LOCUS_08270 826646 826278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 826861 828501 gene locus_tag LOCUS_08280 826861 828501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808106.1 protein_id gnl|my_center|LOCUS_08280 828595 829296 gene locus_tag LOCUS_08290 828595 829296 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_08290 829827 829354 gene locus_tag LOCUS_08300 829827 829354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 831397 829904 gene locus_tag LOCUS_08310 831397 829904 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937928.1 protein_id gnl|my_center|LOCUS_08310 834029 831729 gene locus_tag LOCUS_08320 834029 831729 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_08320 834640 834143 gene locus_tag LOCUS_08330 834640 834143 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259518.1 protein_id gnl|my_center|LOCUS_08330 834864 834637 gene locus_tag LOCUS_08340 834864 834637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 835073 834861 gene locus_tag LOCUS_08350 835073 834861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 835057 835314 gene locus_tag LOCUS_08360 835057 835314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 835295 836338 gene locus_tag LOCUS_08370 gene mftC 835295 836338 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403490.1 protein_id gnl|my_center|LOCUS_08370 836483 838444 gene locus_tag LOCUS_08380 836483 838444 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_08380 838444 839472 gene locus_tag LOCUS_08390 838444 839472 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443441.1 protein_id gnl|my_center|LOCUS_08390 839469 840767 gene locus_tag LOCUS_08400 839469 840767 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_08400 840764 841048 gene locus_tag LOCUS_08410 840764 841048 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461371.1 protein_id gnl|my_center|LOCUS_08410 841060 841956 gene locus_tag LOCUS_08420 841060 841956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461370.1 protein_id gnl|my_center|LOCUS_08420 841953 843365 gene locus_tag LOCUS_08430 gene mftF 841953 843365 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727662.1 protein_id gnl|my_center|LOCUS_08430 843564 845294 gene locus_tag LOCUS_08440 843564 845294 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_08440 845420 845644 gene locus_tag LOCUS_08450 845420 845644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 845646 846464 gene locus_tag LOCUS_08460 845646 846464 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_08460 848099 846594 gene locus_tag LOCUS_08470 848099 846594 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_08470 849769 848123 gene locus_tag LOCUS_08480 849769 848123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08480 850956 849808 gene locus_tag LOCUS_08490 850956 849808 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_08490 851410 851213 gene locus_tag LOCUS_08500 851410 851213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 852023 853186 gene locus_tag LOCUS_08510 852023 853186 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_08510 853383 855113 gene locus_tag LOCUS_08520 853383 855113 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_08520 855378 856064 gene locus_tag LOCUS_08530 855378 856064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943339.1 protein_id gnl|my_center|LOCUS_08530 856067 856720 gene locus_tag LOCUS_08540 856067 856720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943340.1 protein_id gnl|my_center|LOCUS_08540 860145 856822 gene locus_tag LOCUS_08550 860145 856822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08550 860463 860672 gene locus_tag LOCUS_08560 860463 860672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 860958 862592 gene locus_tag LOCUS_08570 860958 862592 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940844.1 protein_id gnl|my_center|LOCUS_08570 862606 862944 gene locus_tag LOCUS_08580 862606 862944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 863266 863003 gene locus_tag LOCUS_08590 863266 863003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943411.1 protein_id gnl|my_center|LOCUS_08590 863523 863266 gene locus_tag LOCUS_08600 863523 863266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943412.1 protein_id gnl|my_center|LOCUS_08600 864671 863526 gene locus_tag LOCUS_08610 864671 863526 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943413.1 protein_id gnl|my_center|LOCUS_08610 864777 865334 gene locus_tag LOCUS_08620 864777 865334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 865328 865690 gene locus_tag LOCUS_08630 865328 865690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 866563 865736 gene locus_tag LOCUS_08640 866563 865736 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 protein_id gnl|my_center|LOCUS_08640 868619 866904 gene locus_tag LOCUS_08650 868619 866904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 869763 868603 gene locus_tag LOCUS_08660 869763 868603 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_08660 869960 871837 gene locus_tag LOCUS_08670 869960 871837 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_08670 872072 872935 gene locus_tag LOCUS_08680 gene ilvE 872072 872935 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528132.1 protein_id gnl|my_center|LOCUS_08680 873059 873307 gene locus_tag LOCUS_08690 873059 873307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 873821 873375 gene locus_tag LOCUS_08700 873821 873375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 874312 873740 gene locus_tag LOCUS_08710 874312 873740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 874749 875042 gene locus_tag LOCUS_08720 874749 875042 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_08720 875114 875917 gene locus_tag LOCUS_08730 875114 875917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 876629 876375 gene locus_tag LOCUS_08740 876629 876375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 878228 877008 gene locus_tag LOCUS_08750 878228 877008 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_08750 878986 878273 gene locus_tag LOCUS_08760 878986 878273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 880490 880714 gene locus_tag LOCUS_08770 880490 880714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 881403 884084 gene locus_tag LOCUS_08780 881403 884084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 884081 885175 gene locus_tag LOCUS_08790 884081 885175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 885326 886579 gene locus_tag LOCUS_08800 885326 886579 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_08800 887892 886813 gene locus_tag LOCUS_08810 887892 886813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 888372 888034 gene locus_tag LOCUS_08820 888372 888034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 888793 888560 gene locus_tag LOCUS_08830 888793 888560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 889552 889040 gene locus_tag LOCUS_08840 889552 889040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 890179 890532 gene locus_tag LOCUS_08850 890179 890532 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186249.1 protein_id gnl|my_center|LOCUS_08850 890763 891218 gene locus_tag LOCUS_08860 890763 891218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_08860 891223 891594 gene locus_tag LOCUS_08870 891223 891594 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940851.1 protein_id gnl|my_center|LOCUS_08870 891892 891650 gene locus_tag LOCUS_08880 891892 891650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 892787 891921 gene locus_tag LOCUS_08890 892787 891921 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817517.1 protein_id gnl|my_center|LOCUS_08890 892960 895014 gene locus_tag LOCUS_08900 892960 895014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 895077 896006 gene locus_tag LOCUS_08910 895077 896006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942306.1 protein_id gnl|my_center|LOCUS_08910 896675 896037 gene locus_tag LOCUS_08920 gene nalD 896675 896037 CDS product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_08920 896856 898004 gene locus_tag LOCUS_08930 896856 898004 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_08930 898004 901138 gene locus_tag LOCUS_08940 898004 901138 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_08940 901131 902537 gene locus_tag LOCUS_08950 901131 902537 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_08950 902781 902554 gene locus_tag LOCUS_08960 902781 902554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 903631 902978 gene locus_tag LOCUS_08970 903631 902978 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_08970 905526 903814 gene locus_tag LOCUS_08980 905526 903814 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_08980 906307 905858 gene locus_tag LOCUS_08990 906307 905858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 907740 906394 gene locus_tag LOCUS_09000 907740 906394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114010.1 protein_id gnl|my_center|LOCUS_09000 908006 910027 gene locus_tag LOCUS_09010 908006 910027 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_09010 910128 913463 gene locus_tag LOCUS_09020 gene treS 910128 913463 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942997.1 protein_id gnl|my_center|LOCUS_09020 913480 915306 gene locus_tag LOCUS_09030 gene treZ 913480 915306 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_09030 915339 917765 gene locus_tag LOCUS_09040 915339 917765 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_09040 917765 920551 gene locus_tag LOCUS_09050 gene treY 917765 920551 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_09050 921986 921036 gene locus_tag LOCUS_09060 921986 921036 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_09060 922119 923183 gene locus_tag LOCUS_09070 gene corA 922119 923183 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_09070 923221 924432 gene locus_tag LOCUS_09080 923221 924432 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 protein_id gnl|my_center|LOCUS_09080 924505 925971 gene locus_tag LOCUS_09090 924505 925971 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_09090 927386 926064 gene locus_tag LOCUS_09100 927386 926064 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943127.1 protein_id gnl|my_center|LOCUS_09100 929491 928235 gene locus_tag LOCUS_09110 929491 928235 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990624.1 protein_id gnl|my_center|LOCUS_09110 930411 929848 gene locus_tag LOCUS_09120 930411 929848 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941133.1 protein_id gnl|my_center|LOCUS_09120 930634 931197 gene locus_tag LOCUS_09130 gene efp 930634 931197 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_09130 931204 932118 gene locus_tag LOCUS_09140 gene epmA 931204 932118 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_09140 933159 932113 gene locus_tag LOCUS_09150 933159 932113 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_09150 933680 933240 gene locus_tag LOCUS_09160 933680 933240 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_09160 934196 933696 gene locus_tag LOCUS_09170 934196 933696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 934399 934193 gene locus_tag LOCUS_09180 934399 934193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 934959 934480 gene locus_tag LOCUS_09190 934959 934480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 935270 936868 gene locus_tag LOCUS_09200 935270 936868 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942718.1 protein_id gnl|my_center|LOCUS_09200 936959 937498 gene locus_tag LOCUS_09210 936959 937498 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_09210 937504 938004 gene locus_tag LOCUS_09220 gene def 937504 938004 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_09220 939419 938010 gene locus_tag LOCUS_09230 gene hemG 939419 938010 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_09230 940019 939483 gene locus_tag LOCUS_09240 940019 939483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 940694 940080 gene locus_tag LOCUS_09250 940694 940080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 941091 940684 gene locus_tag LOCUS_09260 941091 940684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 941243 942151 gene locus_tag LOCUS_09270 941243 942151 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_09270 942355 942170 gene locus_tag LOCUS_09280 942355 942170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 943338 942352 gene locus_tag LOCUS_09290 gene hemH 943338 942352 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_09290 944378 943350 gene locus_tag LOCUS_09300 gene hemE 944378 943350 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_09300 945619 944504 gene locus_tag LOCUS_09310 945619 944504 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944064.1 protein_id gnl|my_center|LOCUS_09310 946888 945791 gene locus_tag LOCUS_09320 946888 945791 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942522.1 protein_id gnl|my_center|LOCUS_09320 947022 947969 gene locus_tag LOCUS_09330 947022 947969 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_09330 947966 948679 gene locus_tag LOCUS_09340 947966 948679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_09340 949387 948713 gene locus_tag LOCUS_09350 949387 948713 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943877.1 protein_id gnl|my_center|LOCUS_09350 949945 949559 gene locus_tag LOCUS_09360 949945 949559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 950132 951118 gene locus_tag LOCUS_09370 950132 951118 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943275.1 protein_id gnl|my_center|LOCUS_09370 952316 951186 gene locus_tag LOCUS_09380 952316 951186 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_09380 952534 955116 gene locus_tag LOCUS_09390 952534 955116 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_09390 956547 955198 gene locus_tag LOCUS_09400 gene gdhA 956547 955198 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_09400 959095 956858 gene locus_tag LOCUS_09410 gene priA 959095 956858 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_09410 960373 959177 gene locus_tag LOCUS_09420 960373 959177 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_09420 960596 960357 gene locus_tag LOCUS_09430 960596 960357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 960637 961401 gene locus_tag LOCUS_09440 960637 961401 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_09440 962454 961444 gene locus_tag LOCUS_09450 gene aroF 962454 961444 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_09450 962861 963184 gene locus_tag LOCUS_09460 962861 963184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 964342 963419 gene locus_tag LOCUS_09470 964342 963419 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643290.1 protein_id gnl|my_center|LOCUS_09470 965169 964372 gene locus_tag LOCUS_09480 965169 964372 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941330.1 protein_id gnl|my_center|LOCUS_09480 966069 965380 gene locus_tag LOCUS_09490 gene mip 966069 965380 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_09490 966405 968000 gene locus_tag LOCUS_09500 966405 968000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_09500 969497 968076 gene locus_tag LOCUS_09510 969497 968076 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_09510 970503 969862 gene locus_tag LOCUS_09520 970503 969862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 971071 970556 gene locus_tag LOCUS_09530 971071 970556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 971284 971108 gene locus_tag LOCUS_09540 971284 971108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 971553 971311 gene locus_tag LOCUS_09550 971553 971311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944021.1 protein_id gnl|my_center|LOCUS_09550 971909 971595 gene locus_tag LOCUS_09560 971909 971595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 972017 972340 gene locus_tag LOCUS_09570 972017 972340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 972590 973291 gene locus_tag LOCUS_09580 972590 973291 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941256.1 protein_id gnl|my_center|LOCUS_09580 973375 974262 gene locus_tag LOCUS_09590 973375 974262 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941254.1 protein_id gnl|my_center|LOCUS_09590 974284 974820 gene locus_tag LOCUS_09600 974284 974820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941253.1 protein_id gnl|my_center|LOCUS_09600 974944 975222 gene locus_tag LOCUS_09610 974944 975222 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941032.1 protein_id gnl|my_center|LOCUS_09610 975429 976112 gene locus_tag LOCUS_09620 975429 976112 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941391.1 protein_id gnl|my_center|LOCUS_09620 977276 976134 gene locus_tag LOCUS_09630 977276 976134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_09630 977482 977557 gene locus_tag LOCUS_t00140 977482 977557 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 977632 978723 gene locus_tag LOCUS_09640 977632 978723 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_09640 978743 979645 gene locus_tag LOCUS_09650 978743 979645 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938626.1 protein_id gnl|my_center|LOCUS_09650 979635 980393 gene locus_tag LOCUS_09660 gene trmB 979635 980393 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_09660 980390 981628 gene locus_tag LOCUS_09670 gene truD 980390 981628 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_09670 981724 982056 gene locus_tag LOCUS_09680 981724 982056 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941187.1 protein_id gnl|my_center|LOCUS_09680 982066 983592 gene locus_tag LOCUS_09690 982066 983592 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_09690 983705 984580 gene locus_tag LOCUS_09700 983705 984580 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941184.1 protein_id gnl|my_center|LOCUS_09700 985235 984783 gene locus_tag LOCUS_09710 985235 984783 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941183.1 protein_id gnl|my_center|LOCUS_09710 985556 986338 gene locus_tag LOCUS_09720 985556 986338 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_09720 986439 987248 gene locus_tag LOCUS_09730 986439 987248 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256946.1 protein_id gnl|my_center|LOCUS_09730 987855 987187 gene locus_tag LOCUS_09740 gene coaE 987855 987187 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_09740 987941 989758 gene locus_tag LOCUS_09750 987941 989758 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_09750 989912 991540 gene locus_tag LOCUS_09760 989912 991540 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940958.1 protein_id gnl|my_center|LOCUS_09760 991530 992840 gene locus_tag LOCUS_09770 991530 992840 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_09770 993403 992828 gene locus_tag LOCUS_09780 993403 992828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 993685 993416 gene locus_tag LOCUS_09790 993685 993416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 994350 993799 gene locus_tag LOCUS_09800 994350 993799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 996812 994347 gene locus_tag LOCUS_09810 996812 994347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 998109 996805 gene locus_tag LOCUS_09820 998109 996805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 998960 998310 gene locus_tag LOCUS_09830 998960 998310 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_09830 1000296 998965 gene locus_tag LOCUS_09840 1000296 998965 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_09840 1001255 1000293 gene locus_tag LOCUS_09850 1001255 1000293 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942736.1 protein_id gnl|my_center|LOCUS_09850 1002075 1001248 gene locus_tag LOCUS_09860 1002075 1001248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1002989 1002072 gene locus_tag LOCUS_09870 1002989 1002072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1005348 1003003 gene locus_tag LOCUS_09880 1005348 1003003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1007699 1005345 gene locus_tag LOCUS_09890 1007699 1005345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1007923 1009065 gene locus_tag LOCUS_09900 1007923 1009065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 1009050 1009370 gene locus_tag LOCUS_09910 1009050 1009370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09910 1009598 1010710 gene locus_tag LOCUS_09920 1009598 1010710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1011038 1010670 gene locus_tag LOCUS_09930 1011038 1010670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1011772 1011035 gene locus_tag LOCUS_09940 1011772 1011035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1014813 1011772 gene locus_tag LOCUS_09950 1014813 1011772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1014959 1014810 gene locus_tag LOCUS_09960 1014959 1014810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1015709 1015227 gene locus_tag LOCUS_09970 1015709 1015227 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_09970 1015849 1016562 gene locus_tag LOCUS_09980 1015849 1016562 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_09980 1016559 1018244 gene locus_tag LOCUS_09990 1016559 1018244 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_09990 1018260 1020542 gene locus_tag LOCUS_10000 1018260 1020542 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_10000 1020554 1021621 gene locus_tag LOCUS_10010 1020554 1021621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1021618 1022376 gene locus_tag LOCUS_10020 gene larB 1021618 1022376 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_10020 1022373 1023563 gene locus_tag LOCUS_10030 gene larC 1022373 1023563 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_10030 1023560 1024033 gene locus_tag LOCUS_10040 1023560 1024033 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_10040 1024056 1025306 gene locus_tag LOCUS_10050 1024056 1025306 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_10050 1025609 1027648 gene locus_tag LOCUS_10060 1025609 1027648 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940820.1 protein_id gnl|my_center|LOCUS_10060 1027645 1028214 gene locus_tag LOCUS_10070 gene thpR 1027645 1028214 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_10070 1028252 1029274 gene locus_tag LOCUS_10080 gene recA 1028252 1029274 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_10080 1029290 1030450 gene locus_tag LOCUS_10090 1029290 1030450 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_10090 1030425 1030901 gene locus_tag LOCUS_10100 1030425 1030901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1030908 1033556 gene locus_tag LOCUS_10110 gene alaS 1030908 1033556 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_10110 1033732 1034076 gene locus_tag LOCUS_10120 1033732 1034076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1034095 1035219 gene locus_tag LOCUS_10130 1034095 1035219 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_10130 1035320 1035850 gene locus_tag LOCUS_10140 gene hslV 1035320 1035850 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_10140 1035847 1037178 gene locus_tag LOCUS_10150 gene hslU 1035847 1037178 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_10150 1037257 1038144 gene locus_tag LOCUS_10160 gene argB 1037257 1038144 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_10160 1038226 1039422 gene locus_tag LOCUS_10170 1038226 1039422 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_10170 1039556 1040464 gene locus_tag LOCUS_10180 gene argF 1039556 1040464 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_10180 1040516 1041160 gene locus_tag LOCUS_10190 1040516 1041160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1041220 1042440 gene locus_tag LOCUS_10200 1041220 1042440 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_10200 1042471 1043001 gene locus_tag LOCUS_10210 1042471 1043001 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940830.1 protein_id gnl|my_center|LOCUS_10210 1043006 1044208 gene locus_tag LOCUS_10220 1043006 1044208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940831.1 protein_id gnl|my_center|LOCUS_10220 1044249 1045637 gene locus_tag LOCUS_10230 gene argH 1044249 1045637 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_10230 1045745 1046527 gene locus_tag LOCUS_10240 1045745 1046527 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940833.1 protein_id gnl|my_center|LOCUS_10240 1046638 1047891 gene locus_tag LOCUS_10250 gene lysA 1046638 1047891 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_10250 1048044 1048919 gene locus_tag LOCUS_10260 gene dapA 1048044 1048919 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_10260 1048973 1049776 gene locus_tag LOCUS_10270 gene dapB 1048973 1049776 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_10270 1049904 1051139 gene locus_tag LOCUS_10280 1049904 1051139 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_10280 1051194 1052306 gene locus_tag LOCUS_10290 gene dprA 1051194 1052306 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_10290 1052337 1052807 gene locus_tag LOCUS_10300 1052337 1052807 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979769.1 protein_id gnl|my_center|LOCUS_10300 1052897 1055245 gene locus_tag LOCUS_10310 gene topA 1052897 1055245 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943185.1 protein_id gnl|my_center|LOCUS_10310 1055337 1056689 gene locus_tag LOCUS_10320 gene trmFO 1055337 1056689 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_10320 1057204 1059258 gene locus_tag LOCUS_10330 1057204 1059258 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044972.1 protein_id gnl|my_center|LOCUS_10330 1059322 1059945 gene locus_tag LOCUS_10340 1059322 1059945 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_10340 1059977 1060663 gene locus_tag LOCUS_10350 1059977 1060663 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_10350 1060704 1062086 gene locus_tag LOCUS_10360 1060704 1062086 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_10360 1062086 1062730 gene locus_tag LOCUS_10370 1062086 1062730 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880861.1 protein_id gnl|my_center|LOCUS_10370 1062727 1064031 gene locus_tag LOCUS_10380 1062727 1064031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1064053 1064220 gene locus_tag LOCUS_10390 1064053 1064220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943178.1 protein_id gnl|my_center|LOCUS_10390 1065149 1064322 gene locus_tag LOCUS_10400 1065149 1064322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1066009 1065230 gene locus_tag LOCUS_10410 1066009 1065230 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_10410 1069033 1066088 gene locus_tag LOCUS_10420 1069033 1066088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1068927 1069142 gene locus_tag LOCUS_10430 1068927 1069142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1070567 1069197 gene locus_tag LOCUS_10440 1070567 1069197 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_10440 1072062 1070536 gene locus_tag LOCUS_10450 1072062 1070536 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_10450 1073028 1072090 gene locus_tag LOCUS_10460 1073028 1072090 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_10460 1073942 1073115 gene locus_tag LOCUS_10470 1073942 1073115 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_10470 1074425 1073997 gene locus_tag LOCUS_10480 1074425 1073997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943551.1 protein_id gnl|my_center|LOCUS_10480 1076912 1074516 gene locus_tag LOCUS_10490 1076912 1074516 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_10490 1077559 1076909 gene locus_tag LOCUS_10500 1077559 1076909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1078359 1077559 gene locus_tag LOCUS_10510 gene murI 1078359 1077559 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_10510 1078496 1078870 gene locus_tag LOCUS_10520 1078496 1078870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1078969 1079949 gene locus_tag LOCUS_10530 1078969 1079949 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943556.1 protein_id gnl|my_center|LOCUS_10530 1079946 1080731 gene locus_tag LOCUS_10540 1079946 1080731 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943557.1 protein_id gnl|my_center|LOCUS_10540 1080763 1081029 gene locus_tag LOCUS_10550 1080763 1081029 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943394.1 protein_id gnl|my_center|LOCUS_10550 1081409 1082428 gene locus_tag LOCUS_10560 1081409 1082428 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942716.1 protein_id gnl|my_center|LOCUS_10560 1082826 1084505 gene locus_tag LOCUS_10570 1082826 1084505 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942718.1 protein_id gnl|my_center|LOCUS_10570 1084644 1085921 gene locus_tag LOCUS_10580 1084644 1085921 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942717.1 protein_id gnl|my_center|LOCUS_10580 1086497 1086078 gene locus_tag LOCUS_10590 gene nikR 1086497 1086078 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_10590 1086791 1088779 gene locus_tag LOCUS_10600 1086791 1088779 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_10600 1088803 1088949 gene locus_tag LOCUS_10610 1088803 1088949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 1088953 1089651 gene locus_tag LOCUS_10620 1088953 1089651 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_10620 1089832 1090161 gene locus_tag LOCUS_10630 1089832 1090161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1090164 1090505 gene locus_tag LOCUS_10640 1090164 1090505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1090510 1091133 gene locus_tag LOCUS_10650 gene cbiM 1090510 1091133 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_10650 1091133 1092062 gene locus_tag LOCUS_10660 1091133 1092062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1092090 1093928 gene locus_tag LOCUS_10670 1092090 1093928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1093932 1094537 gene locus_tag LOCUS_10680 1093932 1094537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1097352 1094557 gene locus_tag LOCUS_10690 gene ppc 1097352 1094557 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_10690 1097735 1097442 gene locus_tag LOCUS_10700 1097735 1097442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944068.1 protein_id gnl|my_center|LOCUS_10700 1098076 1099473 gene locus_tag LOCUS_10710 gene ccoN 1098076 1099473 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_10710 1099489 1100361 gene locus_tag LOCUS_10720 1099489 1100361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1100365 1100517 gene locus_tag LOCUS_10730 1100365 1100517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1100536 1101027 gene locus_tag LOCUS_10740 1100536 1101027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1101024 1102091 gene locus_tag LOCUS_10750 1101024 1102091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1102088 1102285 gene locus_tag LOCUS_10760 1102088 1102285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1102282 1102455 gene locus_tag LOCUS_10770 1102282 1102455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1102452 1104866 gene locus_tag LOCUS_10780 1102452 1104866 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_10780 1104922 1105101 gene locus_tag LOCUS_10790 1104922 1105101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1105101 1105811 gene locus_tag LOCUS_10800 1105101 1105811 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_10800 1106694 1105798 gene locus_tag LOCUS_10810 1106694 1105798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_10810 1107644 1106691 gene locus_tag LOCUS_10820 1107644 1106691 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_10820 1108456 1107686 gene locus_tag LOCUS_10830 1108456 1107686 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_10830 1109057 1108533 gene locus_tag LOCUS_10840 1109057 1108533 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_10840 1109690 1109238 gene locus_tag LOCUS_10850 1109690 1109238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1110085 1110681 gene locus_tag LOCUS_10860 gene yihA 1110085 1110681 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_10860 1111042 1111563 gene locus_tag LOCUS_10870 gene cobO 1111042 1111563 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_10870 1111568 1112086 gene locus_tag LOCUS_10880 gene cobU 1111568 1112086 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_10880 1112106 1113167 gene locus_tag LOCUS_10890 gene cobT 1112106 1113167 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_10890 1113164 1113919 gene locus_tag LOCUS_10900 gene cobS 1113164 1113919 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_10900 1113916 1114521 gene locus_tag LOCUS_10910 gene cobC 1113916 1114521 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_10910 1114514 1115872 gene locus_tag LOCUS_10920 1114514 1115872 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_10920 1115869 1116279 gene locus_tag LOCUS_10930 1115869 1116279 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_10930 1116288 1116920 gene locus_tag LOCUS_10940 1116288 1116920 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_10940 1116923 1117699 gene locus_tag LOCUS_10950 1116923 1117699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 1117696 1117983 gene locus_tag LOCUS_10960 1117696 1117983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 1117980 1118750 gene locus_tag LOCUS_10970 gene cbiQ 1117980 1118750 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943632.1 protein_id gnl|my_center|LOCUS_10970 1118820 1119674 gene locus_tag LOCUS_10980 1118820 1119674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943631.1 protein_id gnl|my_center|LOCUS_10980 1119667 1120776 gene locus_tag LOCUS_10990 1119667 1120776 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_10990 1120773 1121987 gene locus_tag LOCUS_11000 1120773 1121987 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_11000 1121984 1122694 gene locus_tag LOCUS_11010 gene cobI 1121984 1122694 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_11010 1122739 1123032 gene locus_tag LOCUS_11020 1122739 1123032 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_11020 1123022 1123387 gene locus_tag LOCUS_11030 1123022 1123387 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_11030 1123392 1124165 gene locus_tag LOCUS_11040 gene cobM 1123392 1124165 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943624.1 protein_id gnl|my_center|LOCUS_11040 1124308 1125351 gene locus_tag LOCUS_11050 1124308 1125351 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_11050 1125483 1127855 gene locus_tag LOCUS_11060 1125483 1127855 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943622.1 protein_id gnl|my_center|LOCUS_11060 1127840 1128778 gene locus_tag LOCUS_11070 gene cbiB 1127840 1128778 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_11070 1128786 1129853 gene locus_tag LOCUS_11080 gene cobD 1128786 1129853 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_11080 1132159 1129871 gene locus_tag LOCUS_11090 1132159 1129871 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943956.1 protein_id gnl|my_center|LOCUS_11090 1133834 1132173 gene locus_tag LOCUS_11100 1133834 1132173 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943955.1 protein_id gnl|my_center|LOCUS_11100 1135099 1133843 gene locus_tag LOCUS_11110 1135099 1133843 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943954.1 protein_id gnl|my_center|LOCUS_11110 1137207 1135147 gene locus_tag LOCUS_11120 1137207 1135147 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943953.1 protein_id gnl|my_center|LOCUS_11120 1137871 1137419 gene locus_tag LOCUS_11130 1137871 1137419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1138725 1137976 gene locus_tag LOCUS_11140 1138725 1137976 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931876.1 protein_id gnl|my_center|LOCUS_11140 1139008 1139595 gene locus_tag LOCUS_11150 1139008 1139595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11150 1139605 1140726 gene locus_tag LOCUS_11160 1139605 1140726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1140816 1141100 gene locus_tag LOCUS_11170 1140816 1141100 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 1141497 1141279 gene locus_tag LOCUS_11180 1141497 1141279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1141823 1142227 gene locus_tag LOCUS_11190 gene gloA 1141823 1142227 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_11190 1142347 1143318 gene locus_tag LOCUS_11200 1142347 1143318 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_11200 1143405 1143647 gene locus_tag LOCUS_11210 1143405 1143647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1143921 1145144 gene locus_tag LOCUS_11220 1143921 1145144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1145144 1146742 gene locus_tag LOCUS_11230 1145144 1146742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1146735 1149707 gene locus_tag LOCUS_11240 1146735 1149707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1150870 1150616 gene locus_tag LOCUS_11250 1150870 1150616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1151054 1150860 gene locus_tag LOCUS_11260 1151054 1150860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1151272 1151051 gene locus_tag LOCUS_11270 1151272 1151051 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_11270 1151372 1153045 gene locus_tag LOCUS_11280 gene cas1 1151372 1153045 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_11280 1153051 1153338 gene locus_tag LOCUS_11290 gene cas2 1153051 1153338 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_11290 1153563 1155952 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcttccggggcatctctgccccggcctcattgaagc 1156728 1156486 gene locus_tag LOCUS_11300 1156728 1156486 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_11300 1156866 1157282 gene locus_tag LOCUS_11310 1156866 1157282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1157691 1157927 gene locus_tag LOCUS_11320 1157691 1157927 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947651.1 protein_id gnl|my_center|LOCUS_11320 1157924 1159171 gene locus_tag LOCUS_11330 1157924 1159171 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_11330 1159400 1159873 gene locus_tag LOCUS_11340 1159400 1159873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1160164 1159940 gene locus_tag LOCUS_11350 1160164 1159940 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_11350 1160355 1161158 gene locus_tag LOCUS_11360 1160355 1161158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890599.1 protein_id gnl|my_center|LOCUS_11360 1161400 1162278 gene locus_tag LOCUS_11370 1161400 1162278 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_11370 1162291 1162743 gene locus_tag LOCUS_11380 1162291 1162743 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868940.1 protein_id gnl|my_center|LOCUS_11380 1162743 1163198 gene locus_tag LOCUS_11390 1162743 1163198 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925080.1 protein_id gnl|my_center|LOCUS_11390 1164190 1163204 gene locus_tag LOCUS_11400 1164190 1163204 CDS product DUF1679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_11400 1165530 1164196 gene locus_tag LOCUS_11410 1165530 1164196 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_11410 1165740 1166546 gene locus_tag LOCUS_11420 1165740 1166546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1166620 1167750 gene locus_tag LOCUS_11430 1166620 1167750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_11430 1169115 1167811 gene locus_tag LOCUS_11440 1169115 1167811 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943942.1 protein_id gnl|my_center|LOCUS_11440 1171725 1169191 gene locus_tag LOCUS_11450 1171725 1169191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_11450 1172411 1171722 gene locus_tag LOCUS_11460 1172411 1171722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_11460 1172410 1173060 gene locus_tag LOCUS_11470 1172410 1173060 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_11470 1173151 1173387 gene locus_tag LOCUS_11480 1173151 1173387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1174603 1173416 gene locus_tag LOCUS_11490 1174603 1173416 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463782.1 protein_id gnl|my_center|LOCUS_11490 1174741 1175448 gene locus_tag LOCUS_11500 1174741 1175448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_11500 1175445 1177988 gene locus_tag LOCUS_11510 1175445 1177988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_11510 1177994 1179145 gene locus_tag LOCUS_11520 1177994 1179145 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_11520 1181496 1179151 gene locus_tag LOCUS_11530 1181496 1179151 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942687.1 protein_id gnl|my_center|LOCUS_11530 1182264 1181845 gene locus_tag LOCUS_11540 gene mscL 1182264 1181845 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_11540 1182412 1183884 gene locus_tag LOCUS_11550 1182412 1183884 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943381.1 protein_id gnl|my_center|LOCUS_11550 1184289 1184780 gene locus_tag LOCUS_11560 1184289 1184780 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_11560 1184814 1186517 gene locus_tag LOCUS_11570 1184814 1186517 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_11570 1186675 1188468 gene locus_tag LOCUS_11580 1186675 1188468 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_11580 1188697 1189062 gene locus_tag LOCUS_11590 1188697 1189062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943865.1 protein_id gnl|my_center|LOCUS_11590 1189113 1191632 gene locus_tag LOCUS_11600 1189113 1191632 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_11600 1191786 1195316 gene locus_tag LOCUS_11610 1191786 1195316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1195382 1196833 gene locus_tag LOCUS_11620 gene glgA 1195382 1196833 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_11620 1197537 1196875 gene locus_tag LOCUS_11630 1197537 1196875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1197935 1197621 gene locus_tag LOCUS_11640 1197935 1197621 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_11640 1198151 1198765 gene locus_tag LOCUS_11650 1198151 1198765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1198781 1199104 gene locus_tag LOCUS_11660 1198781 1199104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1199168 1200730 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcgcagggggcgac 1201555 1200764 gene locus_tag LOCUS_11670 gene istB 1201555 1200764 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_11670 1203087 1201552 gene locus_tag LOCUS_11680 1203087 1201552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1203283 1204115 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcgcagggggcgac 1204236 1205486 gene locus_tag LOCUS_11690 gene istA 1204236 1205486 CDS product IS21-like element ISSme2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970474.1 protein_id gnl|my_center|LOCUS_11690 1205480 1206280 gene locus_tag LOCUS_11700 gene istB 1205480 1206280 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_11700 1206303 1209129 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcgcagggggcgac 1209585 1209295 gene locus_tag LOCUS_11710 gene cas2 1209585 1209295 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_11710 1210621 1209590 gene locus_tag LOCUS_11720 gene cas1c 1210621 1209590 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_11720 1211243 1210566 gene locus_tag LOCUS_11730 gene cas4 1211243 1210566 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_11730 1212167 1211301 gene locus_tag LOCUS_11740 1212167 1211301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1213092 1212232 gene locus_tag LOCUS_11750 gene cas7c 1213092 1212232 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_11750 1214847 1213096 gene locus_tag LOCUS_11760 gene cas8c 1214847 1213096 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_11760 1215509 1214844 gene locus_tag LOCUS_11770 gene cas5c 1215509 1214844 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_11770 1217744 1215546 gene locus_tag LOCUS_11780 1217744 1215546 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_11780 1217974 1219326 gene locus_tag LOCUS_11790 gene trkA 1217974 1219326 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_11790 1219328 1220770 gene locus_tag LOCUS_11800 1219328 1220770 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_11800 1220816 1221670 gene locus_tag LOCUS_11810 1220816 1221670 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_11810 1222799 1222053 gene locus_tag LOCUS_11820 1222799 1222053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1225025 1222866 gene locus_tag LOCUS_11830 1225025 1222866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1226204 1225551 gene locus_tag LOCUS_11840 1226204 1225551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_11840 1227063 1226266 gene locus_tag LOCUS_11850 gene pgeF 1227063 1226266 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_11850 1228109 1227129 gene locus_tag LOCUS_11860 1228109 1227129 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_11860 1228379 1228110 gene locus_tag LOCUS_11870 1228379 1228110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940758.1 protein_id gnl|my_center|LOCUS_11870 1229238 1228504 gene locus_tag LOCUS_11880 1229238 1228504 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_11880 1229426 1230019 gene locus_tag LOCUS_11890 1229426 1230019 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_11890 1230121 1230786 gene locus_tag LOCUS_11900 gene elbB 1230121 1230786 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940751.1 protein_id gnl|my_center|LOCUS_11900 1230948 1231106 gene locus_tag LOCUS_11910 1230948 1231106 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_11910 1231126 1231317 gene locus_tag LOCUS_11920 1231126 1231317 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_11920 1231356 1232018 gene locus_tag LOCUS_11930 gene lipB 1231356 1232018 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056676.1 protein_id gnl|my_center|LOCUS_11930 1231990 1232883 gene locus_tag LOCUS_11940 gene lipA 1231990 1232883 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097595.1 protein_id gnl|my_center|LOCUS_11940 1232855 1233802 gene locus_tag LOCUS_11950 gene trxB 1232855 1233802 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_11950 1233862 1235058 gene locus_tag LOCUS_11960 1233862 1235058 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_11960 1235061 1235309 gene locus_tag LOCUS_11970 1235061 1235309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1235306 1235797 gene locus_tag LOCUS_11980 1235306 1235797 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_11980 1236213 1235812 gene locus_tag LOCUS_11990 1236213 1235812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1236471 1236271 gene locus_tag LOCUS_12000 1236471 1236271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1237439 1236855 gene locus_tag LOCUS_12010 1237439 1236855 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_12010 1237896 1237504 gene locus_tag LOCUS_12020 1237896 1237504 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_12020 1239112 1237898 gene locus_tag LOCUS_12030 gene odhB 1239112 1237898 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_12030 1241818 1239131 gene locus_tag LOCUS_12040 1241818 1239131 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_12040 1242422 1241952 gene locus_tag LOCUS_12050 1242422 1241952 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_12050 1243025 1242543 gene locus_tag LOCUS_12060 1243025 1242543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1243522 1243109 gene locus_tag LOCUS_12070 1243522 1243109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1244428 1243739 gene locus_tag LOCUS_12080 1244428 1243739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1246081 1244435 gene locus_tag LOCUS_12090 1246081 1244435 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_12090 1246484 1247986 gene locus_tag LOCUS_12100 1246484 1247986 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_12100 1248011 1248922 gene locus_tag LOCUS_12110 1248011 1248922 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_12110 1248951 1250657 gene locus_tag LOCUS_12120 1248951 1250657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1251155 1250670 gene locus_tag LOCUS_12130 1251155 1250670 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_12130 1253233 1251173 gene locus_tag LOCUS_12140 1253233 1251173 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_12140 1254728 1253358 gene locus_tag LOCUS_12150 gene ltrA 1254728 1253358 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_12150 1256162 1255158 gene locus_tag LOCUS_12160 1256162 1255158 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_12160 1257381 1256353 gene locus_tag LOCUS_12170 1257381 1256353 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942549.1 protein_id gnl|my_center|LOCUS_12170 1257469 1257780 gene locus_tag LOCUS_12180 1257469 1257780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1258622 1257891 gene locus_tag LOCUS_12190 1258622 1257891 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228813.1 protein_id gnl|my_center|LOCUS_12190 1259850 1258720 gene locus_tag LOCUS_12200 1259850 1258720 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943706.1 protein_id gnl|my_center|LOCUS_12200 1260038 1259963 gene locus_tag LOCUS_t00150 1260038 1259963 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1261901 1260147 gene locus_tag LOCUS_12210 gene rpoD 1261901 1260147 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_12210 1263830 1261971 gene locus_tag LOCUS_12220 gene dnaG 1263830 1261971 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_12220 1266199 1263827 gene locus_tag LOCUS_12230 1266199 1263827 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_12230 1266714 1266226 gene locus_tag LOCUS_12240 1266714 1266226 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_12240 1267202 1266756 gene locus_tag LOCUS_12250 1267202 1266756 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_12250 1267978 1267286 gene locus_tag LOCUS_12260 gene hisIE 1267978 1267286 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 protein_id gnl|my_center|LOCUS_12260 1268820 1268053 gene locus_tag LOCUS_12270 gene hisF 1268820 1268053 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_12270 1269607 1268876 gene locus_tag LOCUS_12280 gene hisA 1269607 1268876 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_12280 1270299 1269673 gene locus_tag LOCUS_12290 gene hisH 1270299 1269673 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_12290 1270886 1270296 gene locus_tag LOCUS_12300 gene hisB 1270886 1270296 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_12300 1272252 1270963 gene locus_tag LOCUS_12310 gene hisD 1272252 1270963 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_12310 1272924 1272262 gene locus_tag LOCUS_12320 gene hisG 1272924 1272262 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_12320 1274260 1273007 gene locus_tag LOCUS_12330 gene murA 1274260 1273007 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_12330 1275174 1274326 gene locus_tag LOCUS_12340 gene prmC 1275174 1274326 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_12340 1276273 1275176 gene locus_tag LOCUS_12350 gene prfA 1276273 1275176 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_12350 1276999 1276313 gene locus_tag LOCUS_12360 gene thyX 1276999 1276313 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_12360 1277344 1277132 gene locus_tag LOCUS_12370 gene rpmE 1277344 1277132 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_12370 1278696 1277449 gene locus_tag LOCUS_12380 gene rho 1278696 1277449 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_12380 1280007 1279207 gene locus_tag LOCUS_12390 1280007 1279207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1281190 1280279 gene locus_tag LOCUS_12400 gene gluQRS 1281190 1280279 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_12400 1281612 1282073 gene locus_tag LOCUS_12410 1281612 1282073 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393584.1 protein_id gnl|my_center|LOCUS_12410 1282474 1283178 gene locus_tag LOCUS_12420 1282474 1283178 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942361.1 protein_id gnl|my_center|LOCUS_12420 1283269 1284165 gene locus_tag LOCUS_12430 gene cysD 1283269 1284165 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_12430 1284165 1285892 gene locus_tag LOCUS_12440 gene cysN 1284165 1285892 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_12440 1286019 1287338 gene locus_tag LOCUS_12450 1286019 1287338 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943163.1 protein_id gnl|my_center|LOCUS_12450 1287441 1288394 gene locus_tag LOCUS_12460 gene cysK 1287441 1288394 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172232.1 protein_id gnl|my_center|LOCUS_12460 1291337 1288476 gene locus_tag LOCUS_12470 1291337 1288476 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_12470 1292247 1291420 gene locus_tag LOCUS_12480 1292247 1291420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1292816 1292244 gene locus_tag LOCUS_12490 1292816 1292244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1293730 1292816 gene locus_tag LOCUS_12500 1293730 1292816 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_12500 1295047 1293746 gene locus_tag LOCUS_12510 1295047 1293746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_12510 1295488 1295165 gene locus_tag LOCUS_12520 1295488 1295165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1296927 1295686 gene locus_tag LOCUS_12530 1296927 1295686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_12530 1297589 1296936 gene locus_tag LOCUS_12540 1297589 1296936 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 protein_id gnl|my_center|LOCUS_12540 1297933 1297586 gene locus_tag LOCUS_12550 1297933 1297586 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_12550 1298522 1297965 gene locus_tag LOCUS_12560 1298522 1297965 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_12560 1299879 1298515 gene locus_tag LOCUS_12570 1299879 1298515 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_12570 1300595 1299876 gene locus_tag LOCUS_12580 1300595 1299876 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_12580 1301176 1301469 gene locus_tag LOCUS_12590 1301176 1301469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1301609 1303696 gene locus_tag LOCUS_12600 1301609 1303696 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_12600 1303897 1304304 gene locus_tag LOCUS_12610 1303897 1304304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1304307 1304549 gene locus_tag LOCUS_12620 1304307 1304549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1304556 1306664 gene locus_tag LOCUS_12630 1304556 1306664 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791356.1 protein_id gnl|my_center|LOCUS_12630 1306679 1307116 gene locus_tag LOCUS_12640 1306679 1307116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940589.1 protein_id gnl|my_center|LOCUS_12640 1307251 1307826 gene locus_tag LOCUS_12650 1307251 1307826 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_12650 1307823 1308539 gene locus_tag LOCUS_12660 1307823 1308539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_12660 1308536 1309801 gene locus_tag LOCUS_12670 1308536 1309801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_12670 1309805 1310407 gene locus_tag LOCUS_12680 1309805 1310407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1311123 1310500 gene locus_tag LOCUS_12690 1311123 1310500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1312189 1311332 gene locus_tag LOCUS_12700 1312189 1311332 CDS product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_12700 1314510 1312273 gene locus_tag LOCUS_12710 1314510 1312273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1315119 1314580 gene locus_tag LOCUS_12720 1315119 1314580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1316328 1315123 gene locus_tag LOCUS_12730 1316328 1315123 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_12730 1319696 1316325 gene locus_tag LOCUS_12740 1319696 1316325 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930290.1 protein_id gnl|my_center|LOCUS_12740 1320258 1319677 gene locus_tag LOCUS_12750 1320258 1319677 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12750 1321700 1320270 gene locus_tag LOCUS_12760 1321700 1320270 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_12760 1322727 1322023 gene locus_tag LOCUS_12770 1322727 1322023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1325188 1322750 gene locus_tag LOCUS_12780 1325188 1322750 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942370.1 protein_id gnl|my_center|LOCUS_12780 1326435 1325188 gene locus_tag LOCUS_12790 1326435 1325188 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942369.1 protein_id gnl|my_center|LOCUS_12790 1326684 1326475 gene locus_tag LOCUS_12800 1326684 1326475 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266187.1 protein_id gnl|my_center|LOCUS_12800 1328569 1326698 gene locus_tag LOCUS_12810 1328569 1326698 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_12810 1329785 1328562 gene locus_tag LOCUS_12820 1329785 1328562 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015415380.1 protein_id gnl|my_center|LOCUS_12820 1331322 1329850 gene locus_tag LOCUS_12830 1331322 1329850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1332588 1331359 gene locus_tag LOCUS_12840 1332588 1331359 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948401.1 protein_id gnl|my_center|LOCUS_12840 1334249 1332585 gene locus_tag LOCUS_12850 1334249 1332585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1337079 1334278 gene locus_tag LOCUS_12860 1337079 1334278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1338907 1337288 gene locus_tag LOCUS_12870 1338907 1337288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1339319 1338876 gene locus_tag LOCUS_12880 1339319 1338876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1342098 1340446 gene locus_tag LOCUS_12890 1342098 1340446 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016117864.1 protein_id gnl|my_center|LOCUS_12890 1344199 1342091 gene locus_tag LOCUS_12900 1344199 1342091 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351437.1 protein_id gnl|my_center|LOCUS_12900 1345037 1344177 gene locus_tag LOCUS_12910 1345037 1344177 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 protein_id gnl|my_center|LOCUS_12910 1347009 1345180 gene locus_tag LOCUS_12920 gene glmS 1347009 1345180 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_12920 1348506 1347115 gene locus_tag LOCUS_12930 1348506 1347115 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_12930 1348665 1349198 gene locus_tag LOCUS_12940 1348665 1349198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_12940 1349208 1350347 gene locus_tag LOCUS_12950 1349208 1350347 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_12950 1350360 1352228 gene locus_tag LOCUS_12960 1350360 1352228 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940946.1 protein_id gnl|my_center|LOCUS_12960 1352510 1352289 gene locus_tag LOCUS_12970 1352510 1352289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1353550 1352696 gene locus_tag LOCUS_12980 1353550 1352696 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941877.1 protein_id gnl|my_center|LOCUS_12980 1356354 1353730 gene locus_tag LOCUS_12990 gene clpB 1356354 1353730 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_12990 1358036 1356543 gene locus_tag LOCUS_13000 1358036 1356543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1358527 1358252 gene locus_tag LOCUS_13010 1358527 1358252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1359652 1358675 gene locus_tag LOCUS_13020 1359652 1358675 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 protein_id gnl|my_center|LOCUS_13020 1361723 1359702 gene locus_tag LOCUS_13030 1361723 1359702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1362216 1361767 gene locus_tag LOCUS_13040 1362216 1361767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1362998 1362339 gene locus_tag LOCUS_13050 gene phoU 1362998 1362339 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_13050 1363873 1363016 gene locus_tag LOCUS_13060 gene pstB 1363873 1363016 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_13060 1365554 1363890 gene locus_tag LOCUS_13070 gene pstA 1365554 1363890 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_13070 1367853 1365568 gene locus_tag LOCUS_13080 1367853 1365568 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_13080 1368998 1368009 gene locus_tag LOCUS_13090 gene pstS 1368998 1368009 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_13090 1370998 1369226 gene locus_tag LOCUS_13100 gene phoR 1370998 1369226 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_13100 1371696 1371004 gene locus_tag LOCUS_13110 1371696 1371004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_13110 1373833 1371974 gene locus_tag LOCUS_13120 1373833 1371974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1376321 1374069 gene locus_tag LOCUS_13130 1376321 1374069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1377058 1376543 gene locus_tag LOCUS_13140 1377058 1376543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 1377723 1376947 gene locus_tag LOCUS_13150 1377723 1376947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 1378624 1377716 gene locus_tag LOCUS_13160 gene hybA 1378624 1377716 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941448.1 protein_id gnl|my_center|LOCUS_13160 1379729 1378629 gene locus_tag LOCUS_13170 1379729 1378629 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_13170 1380279 1379791 gene locus_tag LOCUS_13180 1380279 1379791 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_13180 1381865 1380303 gene locus_tag LOCUS_13190 1381865 1380303 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_13190 1383535 1382174 gene locus_tag LOCUS_13200 1383535 1382174 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_13200 1383870 1384211 gene locus_tag LOCUS_13210 gene hypA 1383870 1384211 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_13210 1384214 1384981 gene locus_tag LOCUS_13220 gene hypB 1384214 1384981 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_13220 1385121 1385354 gene locus_tag LOCUS_13230 1385121 1385354 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_13230 1385351 1386442 gene locus_tag LOCUS_13240 gene hypD 1385351 1386442 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_13240 1386515 1387528 gene locus_tag LOCUS_13250 gene hypE 1386515 1387528 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_13250 1387774 1387556 gene locus_tag LOCUS_13260 1387774 1387556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1388781 1387771 gene locus_tag LOCUS_13270 1388781 1387771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1390180 1388903 gene locus_tag LOCUS_13280 1390180 1388903 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_13280 1391122 1390388 gene locus_tag LOCUS_13290 1391122 1390388 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_13290 1393017 1391119 gene locus_tag LOCUS_13300 1393017 1391119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1393585 1393307 gene locus_tag LOCUS_13310 1393585 1393307 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092587997.1 protein_id gnl|my_center|LOCUS_13310 1393832 1393566 gene locus_tag LOCUS_13320 1393832 1393566 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740683.1 protein_id gnl|my_center|LOCUS_13320 1394979 1393945 gene locus_tag LOCUS_13330 1394979 1393945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1396187 1395111 gene locus_tag LOCUS_13340 1396187 1395111 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_13340 1396625 1396224 gene locus_tag LOCUS_13350 1396625 1396224 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_13350 1397552 1396662 gene locus_tag LOCUS_13360 1397552 1396662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1398396 1397560 gene locus_tag LOCUS_13370 1398396 1397560 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_13370 1400612 1398537 gene locus_tag LOCUS_13380 1400612 1398537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1401172 1400669 gene locus_tag LOCUS_13390 1401172 1400669 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_13390 1403328 1401220 gene locus_tag LOCUS_13400 1403328 1401220 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_13400 1403718 1403365 gene locus_tag LOCUS_13410 1403718 1403365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1404094 1403729 gene locus_tag LOCUS_13420 1404094 1403729 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072183.1 protein_id gnl|my_center|LOCUS_13420 1405641 1404409 gene locus_tag LOCUS_13430 1405641 1404409 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_13430 1408139 1405869 gene locus_tag LOCUS_13440 1408139 1405869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1408991 1408341 gene locus_tag LOCUS_13450 1408991 1408341 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941256.1 protein_id gnl|my_center|LOCUS_13450 1410009 1408996 gene locus_tag LOCUS_13460 1410009 1408996 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941257.1 protein_id gnl|my_center|LOCUS_13460 1410507 1410271 gene locus_tag LOCUS_13470 1410507 1410271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1410834 1410598 gene locus_tag LOCUS_13480 1410834 1410598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1411279 1410887 gene locus_tag LOCUS_13490 1411279 1410887 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941259.1 protein_id gnl|my_center|LOCUS_13490 1411579 1411331 gene locus_tag LOCUS_13500 1411579 1411331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1412199 1411945 gene locus_tag LOCUS_13510 1412199 1411945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942095.1 protein_id gnl|my_center|LOCUS_13510 1412436 1412927 gene locus_tag LOCUS_13520 1412436 1412927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1412932 1413648 gene locus_tag LOCUS_13530 1412932 1413648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1413645 1414085 gene locus_tag LOCUS_13540 1413645 1414085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1414109 1414597 gene locus_tag LOCUS_13550 1414109 1414597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1414599 1417115 gene locus_tag LOCUS_13560 1414599 1417115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1417201 1417830 gene locus_tag LOCUS_13570 1417201 1417830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1417902 1418240 gene locus_tag LOCUS_13580 1417902 1418240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1418335 1418796 gene locus_tag LOCUS_13590 1418335 1418796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1418975 1419514 gene locus_tag LOCUS_13600 1418975 1419514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1419815 1421503 gene locus_tag LOCUS_13610 1419815 1421503 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941195.1 protein_id gnl|my_center|LOCUS_13610 1422068 1421529 gene locus_tag LOCUS_13620 1422068 1421529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1422358 1423701 gene locus_tag LOCUS_13630 1422358 1423701 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937379.1 protein_id gnl|my_center|LOCUS_13630 1423698 1424630 gene locus_tag LOCUS_13640 1423698 1424630 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943124.1 protein_id gnl|my_center|LOCUS_13640 1425724 1424627 gene locus_tag LOCUS_13650 1425724 1424627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943125.1 protein_id gnl|my_center|LOCUS_13650 1426441 1425761 gene locus_tag LOCUS_13660 1426441 1425761 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942283.1 protein_id gnl|my_center|LOCUS_13660 1427456 1426434 gene locus_tag LOCUS_13670 1427456 1426434 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240528.1 protein_id gnl|my_center|LOCUS_13670 1427584 1428066 gene locus_tag LOCUS_13680 gene zur 1427584 1428066 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_13680 1428070 1428807 gene locus_tag LOCUS_13690 gene znuC 1428070 1428807 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114128.1 protein_id gnl|my_center|LOCUS_13690 1428804 1429604 gene locus_tag LOCUS_13700 gene znuB 1428804 1429604 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341611.1 protein_id gnl|my_center|LOCUS_13700 1429724 1430596 gene locus_tag LOCUS_13710 1429724 1430596 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_13710 1431990 1430674 gene locus_tag LOCUS_13720 1431990 1430674 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_13720 1432421 1433131 gene locus_tag LOCUS_13730 1432421 1433131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1435215 1433293 gene locus_tag LOCUS_13740 1435215 1433293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1436833 1435478 gene locus_tag LOCUS_13750 gene cpsG 1436833 1435478 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_13750 1437246 1436872 gene locus_tag LOCUS_13760 1437246 1436872 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_13760 1438766 1437300 gene locus_tag LOCUS_13770 1438766 1437300 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_13770 1440298 1438820 gene locus_tag LOCUS_13780 1440298 1438820 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_13780 1442352 1440388 gene locus_tag LOCUS_13790 1442352 1440388 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457972.1 protein_id gnl|my_center|LOCUS_13790 1442745 1443014 gene locus_tag LOCUS_13800 1442745 1443014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1443011 1443310 gene locus_tag LOCUS_13810 1443011 1443310 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_13810 1443485 1443354 gene locus_tag LOCUS_13820 1443485 1443354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13820 1443908 1443501 gene locus_tag LOCUS_13830 1443908 1443501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13830 1444386 1444021 gene locus_tag LOCUS_13840 1444386 1444021 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_13840 1445461 1444520 gene locus_tag LOCUS_13850 1445461 1444520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_13850 1446768 1445662 gene locus_tag LOCUS_13860 1446768 1445662 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_13860 1447625 1447032 gene locus_tag LOCUS_13870 1447625 1447032 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_13870 1448484 1447972 gene locus_tag LOCUS_13880 1448484 1447972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1448927 1448526 gene locus_tag LOCUS_13890 1448927 1448526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1449044 1449328 gene locus_tag LOCUS_13900 1449044 1449328 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_13900 1449325 1449654 gene locus_tag LOCUS_13910 1449325 1449654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1449671 1449964 gene locus_tag LOCUS_13920 1449671 1449964 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_13920 1450036 1450839 gene locus_tag LOCUS_13930 1450036 1450839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 1452441 1451239 gene locus_tag LOCUS_13940 1452441 1451239 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_13940 1453029 1452550 gene locus_tag LOCUS_13950 1453029 1452550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1453568 1453026 gene locus_tag LOCUS_13960 1453568 1453026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1453900 1453580 gene locus_tag LOCUS_13970 1453900 1453580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1454214 1454047 gene locus_tag LOCUS_13980 1454214 1454047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1454980 1454351 gene locus_tag LOCUS_13990 1454980 1454351 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_13990 1455416 1455024 gene locus_tag LOCUS_14000 1455416 1455024 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_14000 1456080 1455481 gene locus_tag LOCUS_14010 1456080 1455481 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 protein_id gnl|my_center|LOCUS_14010 1457694 1456576 gene locus_tag LOCUS_14020 1457694 1456576 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_14020 1458758 1457691 gene locus_tag LOCUS_14030 1458758 1457691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1459637 1458963 gene locus_tag LOCUS_14040 1459637 1458963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1461435 1460464 gene locus_tag LOCUS_14050 1461435 1460464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1462139 1461486 gene locus_tag LOCUS_14060 1462139 1461486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1463309 1462155 gene locus_tag LOCUS_14070 1463309 1462155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1464621 1463311 gene locus_tag LOCUS_14080 1464621 1463311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1465886 1464618 gene locus_tag LOCUS_14090 1465886 1464618 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_14090 1466616 1466419 gene locus_tag LOCUS_14100 1466616 1466419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1468344 1467541 gene locus_tag LOCUS_14110 1468344 1467541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 1468709 1468416 gene locus_tag LOCUS_14120 1468709 1468416 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_14120 1469137 1468913 gene locus_tag LOCUS_14130 1469137 1468913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1469622 1469194 gene locus_tag LOCUS_14140 1469622 1469194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1470001 1469612 gene locus_tag LOCUS_14150 1470001 1469612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1470205 1470074 gene locus_tag LOCUS_14160 1470205 1470074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1470784 1470416 gene locus_tag LOCUS_14170 1470784 1470416 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_14170 1471095 1470781 gene locus_tag LOCUS_14180 1471095 1470781 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_14180 1471723 1471307 gene locus_tag LOCUS_14190 1471723 1471307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1471985 1471716 gene locus_tag LOCUS_14200 1471985 1471716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1472151 1472444 gene locus_tag LOCUS_14210 1472151 1472444 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_14210 1472516 1473319 gene locus_tag LOCUS_14220 1472516 1473319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 1474081 1473755 gene locus_tag LOCUS_14230 1474081 1473755 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_14230 1474263 1474078 gene locus_tag LOCUS_14240 1474263 1474078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1475249 1474965 gene locus_tag LOCUS_14250 1475249 1474965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1475581 1475246 gene locus_tag LOCUS_14260 1475581 1475246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1476771 1476517 gene locus_tag LOCUS_14270 1476771 1476517 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_14270 1476968 1476768 gene locus_tag LOCUS_14280 1476968 1476768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1477597 1477181 gene locus_tag LOCUS_14290 1477597 1477181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1477859 1477590 gene locus_tag LOCUS_14300 1477859 1477590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1478039 1479415 gene locus_tag LOCUS_14310 1478039 1479415 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272192.1 protein_id gnl|my_center|LOCUS_14310 1480167 1481474 gene locus_tag LOCUS_14320 1480167 1481474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1481777 1481547 gene locus_tag LOCUS_14330 1481777 1481547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1482181 1481774 gene locus_tag LOCUS_14340 1482181 1481774 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_14340 1482992 1482690 gene locus_tag LOCUS_14350 1482992 1482690 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_14350 1483344 1483054 gene locus_tag LOCUS_14360 1483344 1483054 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_14360 1483517 1483329 gene locus_tag LOCUS_14370 1483517 1483329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1484748 1484359 gene locus_tag LOCUS_14380 1484748 1484359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1485073 1484732 gene locus_tag LOCUS_14390 1485073 1484732 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_14390 1485964 1485554 gene locus_tag LOCUS_14400 1485964 1485554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1486296 1485961 gene locus_tag LOCUS_14410 1486296 1485961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1487567 1487250 gene locus_tag LOCUS_14420 1487567 1487250 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_14420 1487993 1487568 gene locus_tag LOCUS_14430 1487993 1487568 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_14430 1489594 1488377 gene locus_tag LOCUS_14440 1489594 1488377 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_14440 1490032 1489682 gene locus_tag LOCUS_14450 1490032 1489682 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261014.1 protein_id gnl|my_center|LOCUS_14450 1492912 1490093 gene locus_tag LOCUS_14460 1492912 1490093 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_14460 1494432 1492909 gene locus_tag LOCUS_14470 1494432 1492909 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942489.1 protein_id gnl|my_center|LOCUS_14470 1495244 1494558 gene locus_tag LOCUS_14480 1495244 1494558 CDS product DUF5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943660.1 protein_id gnl|my_center|LOCUS_14480 1495679 1495266 gene locus_tag LOCUS_14490 1495679 1495266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1496177 1495752 gene locus_tag LOCUS_14500 gene fliS 1496177 1495752 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_14500 1497523 1496177 gene locus_tag LOCUS_14510 gene fliD 1497523 1496177 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_14510 1497727 1498287 gene locus_tag LOCUS_14520 1497727 1498287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1498343 1500007 gene locus_tag LOCUS_14530 1498343 1500007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1501926 1499995 gene locus_tag LOCUS_14540 1501926 1499995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1504187 1502061 gene locus_tag LOCUS_14550 1504187 1502061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1504388 1507207 gene locus_tag LOCUS_14560 1504388 1507207 CDS product GPMC system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943112.1 protein_id gnl|my_center|LOCUS_14560 1507482 1507931 gene locus_tag LOCUS_14570 1507482 1507931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1507928 1508254 gene locus_tag LOCUS_14580 1507928 1508254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1509569 1508235 gene locus_tag LOCUS_14590 1509569 1508235 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943971.1 protein_id gnl|my_center|LOCUS_14590 1510257 1509550 gene locus_tag LOCUS_14600 1510257 1509550 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240630.1 protein_id gnl|my_center|LOCUS_14600 1511242 1510265 gene locus_tag LOCUS_14610 gene hemB 1511242 1510265 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_14610 1512844 1511291 gene locus_tag LOCUS_14620 gene cobA 1512844 1511291 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_14620 1513859 1512897 gene locus_tag LOCUS_14630 gene hemC 1513859 1512897 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_14630 1515322 1513979 gene locus_tag LOCUS_14640 gene hemA 1515322 1513979 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_14640 1516184 1515363 gene locus_tag LOCUS_14650 gene ccsB 1516184 1515363 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_14650 1516873 1516181 gene locus_tag LOCUS_14660 1516873 1516181 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_14660 1517441 1516863 gene locus_tag LOCUS_14670 1517441 1516863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1517793 1518122 gene locus_tag LOCUS_14680 gene trxA 1517793 1518122 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_14680 1518705 1518175 gene locus_tag LOCUS_14690 1518705 1518175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1519307 1518804 gene locus_tag LOCUS_14700 gene yjgA 1519307 1518804 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938274.1 protein_id gnl|my_center|LOCUS_14700 1519756 1519307 gene locus_tag LOCUS_14710 gene dtd 1519756 1519307 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_14710 1520393 1519764 gene locus_tag LOCUS_14720 1520393 1519764 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383799.1 protein_id gnl|my_center|LOCUS_14720 1521301 1520456 gene locus_tag LOCUS_14730 gene dapF 1521301 1520456 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_14730 1521512 1522669 gene locus_tag LOCUS_14740 1521512 1522669 CDS product arabinose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706056.1 protein_id gnl|my_center|LOCUS_14740 1522662 1524260 gene locus_tag LOCUS_14750 1522662 1524260 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_14750 1525240 1524362 gene locus_tag LOCUS_14760 gene ccsB 1525240 1524362 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_14760 1525689 1525273 gene locus_tag LOCUS_14770 1525689 1525273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14770 1526645 1525845 gene locus_tag LOCUS_14780 1526645 1525845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 1527179 1526787 gene locus_tag LOCUS_14790 1527179 1526787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1527531 1528994 gene locus_tag LOCUS_14800 1527531 1528994 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_14800 1529035 1531011 gene locus_tag LOCUS_14810 1529035 1531011 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941630.1 protein_id gnl|my_center|LOCUS_14810 1531008 1532384 gene locus_tag LOCUS_14820 1531008 1532384 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941631.1 protein_id gnl|my_center|LOCUS_14820 1532773 1533630 gene locus_tag LOCUS_14830 1532773 1533630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1533792 1533550 gene locus_tag LOCUS_14840 1533792 1533550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1533724 1533924 gene locus_tag LOCUS_14850 1533724 1533924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1534446 1533937 gene locus_tag LOCUS_14860 1534446 1533937 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084430.1 protein_id gnl|my_center|LOCUS_14860 1534500 1535255 gene locus_tag LOCUS_14870 1534500 1535255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_14870 1536614 1535370 gene locus_tag LOCUS_14880 gene pcnB 1536614 1535370 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095630.1 protein_id gnl|my_center|LOCUS_14880 1536762 1537697 gene locus_tag LOCUS_14890 gene miaA 1536762 1537697 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_14890 1538158 1537736 gene locus_tag LOCUS_14900 1538158 1537736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1539406 1538252 gene locus_tag LOCUS_14910 1539406 1538252 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941380.1 protein_id gnl|my_center|LOCUS_14910 1542544 1539464 gene locus_tag LOCUS_14920 1542544 1539464 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_14920 1543647 1542541 gene locus_tag LOCUS_14930 1543647 1542541 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081054.1 protein_id gnl|my_center|LOCUS_14930 1546228 1543835 gene locus_tag LOCUS_14940 1546228 1543835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1546691 1546347 gene locus_tag LOCUS_14950 1546691 1546347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1548956 1547115 gene locus_tag LOCUS_14960 1548956 1547115 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_14960 1549484 1549999 gene locus_tag LOCUS_14970 1549484 1549999 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171659.1 protein_id gnl|my_center|LOCUS_14970 1550082 1550828 gene locus_tag LOCUS_14980 1550082 1550828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1551039 1554035 gene locus_tag LOCUS_14990 1551039 1554035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1554762 1554172 gene locus_tag LOCUS_15000 1554762 1554172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1556518 1554977 gene locus_tag LOCUS_15010 1556518 1554977 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_15010 1557108 1556635 gene locus_tag LOCUS_15020 1557108 1556635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1558678 1557185 gene locus_tag LOCUS_15030 1558678 1557185 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937928.1 protein_id gnl|my_center|LOCUS_15030 1559212 1559090 gene locus_tag LOCUS_15040 1559212 1559090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1560404 1559532 gene locus_tag LOCUS_15050 gene sucD 1560404 1559532 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_15050 1561589 1560420 gene locus_tag LOCUS_15060 gene sucC 1561589 1560420 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_15060 1561982 1561812 gene locus_tag LOCUS_15070 1561982 1561812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1562716 1562069 gene locus_tag LOCUS_15080 gene fsa 1562716 1562069 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_15080 1563180 1562743 gene locus_tag LOCUS_15090 1563180 1562743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1563457 1563188 gene locus_tag LOCUS_15100 1563457 1563188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1563959 1563462 gene locus_tag LOCUS_15110 gene folK 1563959 1563462 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_15110 1564273 1563992 gene locus_tag LOCUS_15120 1564273 1563992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1564154 1565092 gene locus_tag LOCUS_15130 1564154 1565092 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942339.1 protein_id gnl|my_center|LOCUS_15130 1565125 1565952 gene locus_tag LOCUS_15140 1565125 1565952 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644821.1 protein_id gnl|my_center|LOCUS_15140 1565939 1567873 gene locus_tag LOCUS_15150 1565939 1567873 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942341.1 protein_id gnl|my_center|LOCUS_15150 1571796 1567852 gene locus_tag LOCUS_15160 1571796 1567852 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113331.1 protein_id gnl|my_center|LOCUS_15160 1573592 1571790 gene locus_tag LOCUS_15170 1573592 1571790 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_15170 1575044 1573728 gene locus_tag LOCUS_15180 1575044 1573728 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_15180 1577823 1575109 gene locus_tag LOCUS_15190 1577823 1575109 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_15190 1578607 1578020 gene locus_tag LOCUS_15200 1578607 1578020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1580433 1578685 gene locus_tag LOCUS_15210 1580433 1578685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1581929 1580430 gene locus_tag LOCUS_15220 1581929 1580430 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_15220 1583410 1581926 gene locus_tag LOCUS_15230 1583410 1581926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1583721 1583407 gene locus_tag LOCUS_15240 1583721 1583407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1584707 1583718 gene locus_tag LOCUS_15250 1584707 1583718 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_15250 1585006 1584704 gene locus_tag LOCUS_15260 1585006 1584704 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_15260 1585277 1584996 gene locus_tag LOCUS_15270 1585277 1584996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1585791 1585270 gene locus_tag LOCUS_15280 1585791 1585270 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_15280 1586344 1586177 gene locus_tag LOCUS_15290 1586344 1586177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1586530 1586700 gene locus_tag LOCUS_15300 1586530 1586700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1586898 1589672 gene locus_tag LOCUS_15310 gene ileS 1586898 1589672 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_15310 1589718 1590215 gene locus_tag LOCUS_15320 gene lspA 1589718 1590215 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_15320 1590318 1590674 gene locus_tag LOCUS_15330 gene dksA 1590318 1590674 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_15330 1590717 1593002 gene locus_tag LOCUS_15340 1590717 1593002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1593056 1593131 gene locus_tag LOCUS_t00160 1593056 1593131 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1593781 1593206 gene locus_tag LOCUS_15350 1593781 1593206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941688.1 protein_id gnl|my_center|LOCUS_15350 1593994 1596075 gene locus_tag LOCUS_15360 1593994 1596075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1596188 1596421 gene locus_tag LOCUS_15370 1596188 1596421 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798187.1 protein_id gnl|my_center|LOCUS_15370 1596859 1597176 gene locus_tag LOCUS_15380 1596859 1597176 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_15380 1597710 1597928 gene locus_tag LOCUS_15390 1597710 1597928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1597925 1598251 gene locus_tag LOCUS_15400 1597925 1598251 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388731.1 protein_id gnl|my_center|LOCUS_15400 1598341 1598583 gene locus_tag LOCUS_15410 1598341 1598583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1598568 1598903 gene locus_tag LOCUS_15420 1598568 1598903 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 protein_id gnl|my_center|LOCUS_15420 1599485 1599126 gene locus_tag LOCUS_15430 1599485 1599126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1600397 1599564 gene locus_tag LOCUS_15440 1600397 1599564 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_15440 1601084 1600683 gene locus_tag LOCUS_15450 1601084 1600683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1601348 1601097 gene locus_tag LOCUS_15460 1601348 1601097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1603801 1602119 gene locus_tag LOCUS_15470 1603801 1602119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679024.1 protein_id gnl|my_center|LOCUS_15470 1605388 1603853 gene locus_tag LOCUS_15480 1605388 1603853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1606451 1605537 gene locus_tag LOCUS_15490 1606451 1605537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1607673 1606534 gene locus_tag LOCUS_15500 1607673 1606534 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226009258.1 protein_id gnl|my_center|LOCUS_15500 1608866 1607730 gene locus_tag LOCUS_15510 1608866 1607730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1610068 1608863 gene locus_tag LOCUS_15520 gene glf 1610068 1608863 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_15520 1611015 1610065 gene locus_tag LOCUS_15530 1611015 1610065 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306711.1 protein_id gnl|my_center|LOCUS_15530 1611815 1611141 gene locus_tag LOCUS_15540 1611815 1611141 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061513.1 protein_id gnl|my_center|LOCUS_15540 1612552 1611830 gene locus_tag LOCUS_15550 1612552 1611830 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090507.1 protein_id gnl|my_center|LOCUS_15550 1613820 1612555 gene locus_tag LOCUS_15560 1613820 1612555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1614049 1613801 gene locus_tag LOCUS_15570 1614049 1613801 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966762.1 protein_id gnl|my_center|LOCUS_15570 1614646 1614074 gene locus_tag LOCUS_15580 1614646 1614074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1615336 1614650 gene locus_tag LOCUS_15590 1615336 1614650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1616388 1615339 gene locus_tag LOCUS_15600 gene pseI 1616388 1615339 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_15600 1617499 1616450 gene locus_tag LOCUS_15610 gene pseG 1617499 1616450 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_15610 1618115 1617474 gene locus_tag LOCUS_15620 gene pseF 1618115 1617474 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_15620 1619365 1618193 gene locus_tag LOCUS_15630 gene pseC 1619365 1618193 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_15630 1620390 1619362 gene locus_tag LOCUS_15640 gene pseB 1620390 1619362 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_15640 1622875 1620395 gene locus_tag LOCUS_15650 1622875 1620395 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_15650 1623448 1623131 gene locus_tag LOCUS_15660 1623448 1623131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1624890 1624087 gene locus_tag LOCUS_15670 1624890 1624087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 1625255 1624962 gene locus_tag LOCUS_15680 1625255 1624962 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_15680 1626112 1625732 gene locus_tag LOCUS_15690 1626112 1625732 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388817.1 protein_id gnl|my_center|LOCUS_15690 1626311 1626102 gene locus_tag LOCUS_15700 1626311 1626102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1626657 1626379 gene locus_tag LOCUS_15710 1626657 1626379 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 protein_id gnl|my_center|LOCUS_15710 1626892 1626647 gene locus_tag LOCUS_15720 1626892 1626647 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_15720 1627338 1628720 gene locus_tag LOCUS_15730 1627338 1628720 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869440.1 protein_id gnl|my_center|LOCUS_15730 1628773 1630044 gene locus_tag LOCUS_15740 gene larA 1628773 1630044 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_15740 1630072 1631637 gene locus_tag LOCUS_15750 1630072 1631637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1631643 1633019 gene locus_tag LOCUS_15760 1631643 1633019 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_15760 1633142 1634401 gene locus_tag LOCUS_15770 1633142 1634401 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020586886.1 protein_id gnl|my_center|LOCUS_15770 1634502 1634801 gene locus_tag LOCUS_15780 1634502 1634801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1634933 1635451 gene locus_tag LOCUS_15790 1634933 1635451 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_15790 1635541 1635960 gene locus_tag LOCUS_15800 1635541 1635960 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_15800 1635988 1637433 gene locus_tag LOCUS_15810 gene rtcB 1635988 1637433 CDS product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 protein_id gnl|my_center|LOCUS_15810 1637450 1638352 gene locus_tag LOCUS_15820 1637450 1638352 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_15820 1638424 1638630 gene locus_tag LOCUS_15830 1638424 1638630 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392792.1 protein_id gnl|my_center|LOCUS_15830 1639686 1638706 gene locus_tag LOCUS_15840 gene moaA 1639686 1638706 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943768.1 protein_id gnl|my_center|LOCUS_15840 1640887 1639808 gene locus_tag LOCUS_15850 1640887 1639808 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_15850 1641059 1642045 gene locus_tag LOCUS_15860 1641059 1642045 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947976.1 protein_id gnl|my_center|LOCUS_15860 1642144 1642335 gene locus_tag LOCUS_15870 1642144 1642335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1644664 1642598 gene locus_tag LOCUS_15880 1644664 1642598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1645376 1646686 gene locus_tag LOCUS_15890 gene thiC 1645376 1646686 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_15890 1647705 1646782 gene locus_tag LOCUS_15900 1647705 1646782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1648150 1647764 gene locus_tag LOCUS_15910 1648150 1647764 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_15910 1648383 1648150 gene locus_tag LOCUS_15920 1648383 1648150 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_15920 1648776 1648701 gene locus_tag LOCUS_t00170 1648776 1648701 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1649461 1648871 gene locus_tag LOCUS_15930 1649461 1648871 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_15930 1649971 1649474 gene locus_tag LOCUS_15940 1649971 1649474 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_15940 1653738 1650157 gene locus_tag LOCUS_15950 gene nifJ 1653738 1650157 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_15950 1654513 1653920 gene locus_tag LOCUS_15960 gene recR 1654513 1653920 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940773.1 protein_id gnl|my_center|LOCUS_15960 1655027 1654713 gene locus_tag LOCUS_15970 1655027 1654713 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_15970 1656846 1655080 gene locus_tag LOCUS_15980 gene dnaX 1656846 1655080 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_15980 1657221 1657134 gene locus_tag LOCUS_t00180 1657221 1657134 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1657622 1657320 gene locus_tag LOCUS_15990 1657622 1657320 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 protein_id gnl|my_center|LOCUS_15990 1659202 1657670 gene locus_tag LOCUS_16000 1659202 1657670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1659404 1660378 gene locus_tag LOCUS_16010 1659404 1660378 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_16010 1662131 1660482 gene locus_tag LOCUS_16020 gene groL 1662131 1660482 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_16020 1662462 1662172 gene locus_tag LOCUS_16030 gene groES 1662462 1662172 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_16030 1663292 1662750 gene locus_tag LOCUS_16040 1663292 1662750 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943950.1 protein_id gnl|my_center|LOCUS_16040 1663808 1664884 gene locus_tag LOCUS_16050 1663808 1664884 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_16050 1664978 1665496 gene locus_tag LOCUS_16060 gene def 1664978 1665496 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_16060 1665493 1666434 gene locus_tag LOCUS_16070 gene fmt 1665493 1666434 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_16070 1666444 1667223 gene locus_tag LOCUS_16080 1666444 1667223 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_16080 1667248 1668594 gene locus_tag LOCUS_16090 gene rsmB 1667248 1668594 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_16090 1668769 1669434 gene locus_tag LOCUS_16100 gene rpe 1668769 1669434 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_16100 1669431 1669997 gene locus_tag LOCUS_16110 1669431 1669997 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_16110 1670195 1671424 gene locus_tag LOCUS_16120 1670195 1671424 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940972.1 protein_id gnl|my_center|LOCUS_16120 1671505 1673355 gene locus_tag LOCUS_16130 1671505 1673355 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_16130 1673605 1673321 gene locus_tag LOCUS_16140 gene grxC 1673605 1673321 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369179.1 protein_id gnl|my_center|LOCUS_16140 1673757 1674179 gene locus_tag LOCUS_16150 1673757 1674179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1674404 1676425 gene locus_tag LOCUS_16160 1674404 1676425 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_16160 1676519 1679086 gene locus_tag LOCUS_16170 1676519 1679086 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_16170 1679217 1679534 gene locus_tag LOCUS_16180 1679217 1679534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1680657 1679638 gene locus_tag LOCUS_16190 gene mltG 1680657 1679638 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_16190 1681239 1680673 gene locus_tag LOCUS_16200 gene plsY 1681239 1680673 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_16200 1681535 1681459 gene locus_tag LOCUS_t00190 1681535 1681459 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1682798 1681620 gene locus_tag LOCUS_16210 1682798 1681620 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_16210 1683852 1683313 gene locus_tag LOCUS_16220 1683852 1683313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1684374 1683859 gene locus_tag LOCUS_16230 gene moaC 1684374 1683859 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_16230 1685745 1684381 gene locus_tag LOCUS_16240 gene radA 1685745 1684381 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_16240 1686442 1686017 gene locus_tag LOCUS_16250 1686442 1686017 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943666.1 protein_id gnl|my_center|LOCUS_16250 1686678 1686439 gene locus_tag LOCUS_16260 gene csrA 1686678 1686439 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_16260 1687706 1686816 gene locus_tag LOCUS_16270 gene flgL 1687706 1686816 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_16270 1689158 1687710 gene locus_tag LOCUS_16280 gene flgK 1689158 1687710 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_16280 1689527 1689162 gene locus_tag LOCUS_16290 1689527 1689162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1689900 1689514 gene locus_tag LOCUS_16300 1689900 1689514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1690344 1690030 gene locus_tag LOCUS_16310 1690344 1690030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1691469 1690363 gene locus_tag LOCUS_16320 1691469 1690363 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_16320 1692180 1691485 gene locus_tag LOCUS_16330 1692180 1691485 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_16330 1692901 1692182 gene locus_tag LOCUS_16340 1692901 1692182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1693727 1692942 gene locus_tag LOCUS_16350 gene flgG 1693727 1692942 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_16350 1694523 1693801 gene locus_tag LOCUS_16360 gene flgF 1694523 1693801 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_16360 1695041 1694607 gene locus_tag LOCUS_16370 1695041 1694607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1695824 1695078 gene locus_tag LOCUS_16380 1695824 1695078 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_16380 1696749 1695841 gene locus_tag LOCUS_16390 1696749 1695841 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_16390 1698106 1696763 gene locus_tag LOCUS_16400 gene flhF 1698106 1696763 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_16400 1700180 1698096 gene locus_tag LOCUS_16410 gene flhA 1700180 1698096 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_16410 1701241 1700177 gene locus_tag LOCUS_16420 gene flhB 1701241 1700177 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_16420 1702151 1701375 gene locus_tag LOCUS_16430 gene fliR 1702151 1701375 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_16430 1702428 1702159 gene locus_tag LOCUS_16440 gene fliQ 1702428 1702159 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_16440 1703173 1702439 gene locus_tag LOCUS_16450 gene fliP 1703173 1702439 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_16450 1703547 1703170 gene locus_tag LOCUS_16460 1703547 1703170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1703869 1703555 gene locus_tag LOCUS_16470 gene fliN 1703869 1703555 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941090.1 protein_id gnl|my_center|LOCUS_16470 1704898 1703915 gene locus_tag LOCUS_16480 gene fliM 1704898 1703915 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081085.1 protein_id gnl|my_center|LOCUS_16480 1705467 1704973 gene locus_tag LOCUS_16490 1705467 1704973 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941088.1 protein_id gnl|my_center|LOCUS_16490 1706386 1705622 gene locus_tag LOCUS_16500 1706386 1705622 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435983.1 protein_id gnl|my_center|LOCUS_16500 1707166 1706390 gene locus_tag LOCUS_16510 1707166 1706390 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_16510 1707575 1707348 gene locus_tag LOCUS_16520 1707575 1707348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1708890 1707628 gene locus_tag LOCUS_16530 1708890 1707628 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_16530 1709415 1709023 gene locus_tag LOCUS_16540 1709415 1709023 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_16540 1710080 1709418 gene locus_tag LOCUS_16550 1710080 1709418 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_16550 1711588 1710104 gene locus_tag LOCUS_16560 1711588 1710104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1712111 1711641 gene locus_tag LOCUS_16570 1712111 1711641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1712550 1712116 gene locus_tag LOCUS_16580 1712550 1712116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1714055 1712733 gene locus_tag LOCUS_16590 1714055 1712733 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_16590 1714735 1714055 gene locus_tag LOCUS_16600 1714735 1714055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1715735 1714728 gene locus_tag LOCUS_16610 gene fliG 1715735 1714728 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_16610 1717314 1715752 gene locus_tag LOCUS_16620 gene fliF 1717314 1715752 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_16620 1717676 1717380 gene locus_tag LOCUS_16630 1717676 1717380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1718117 1717686 gene locus_tag LOCUS_16640 gene flgC 1718117 1717686 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_16640 1718542 1718129 gene locus_tag LOCUS_16650 gene flgB 1718542 1718129 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462294.1 protein_id gnl|my_center|LOCUS_16650 1721046 1718617 gene locus_tag LOCUS_16660 1721046 1718617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1721371 1723824 gene locus_tag LOCUS_16670 1721371 1723824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1723832 1724713 gene locus_tag LOCUS_16680 1723832 1724713 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665509.1 protein_id gnl|my_center|LOCUS_16680 1724716 1725789 gene locus_tag LOCUS_16690 1724716 1725789 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_16690 1725786 1726274 gene locus_tag LOCUS_16700 1725786 1726274 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_16700 1726284 1727165 gene locus_tag LOCUS_16710 1726284 1727165 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_16710 1727162 1727554 gene locus_tag LOCUS_16720 1727162 1727554 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081498.1 protein_id gnl|my_center|LOCUS_16720 1727544 1728026 gene locus_tag LOCUS_16730 1727544 1728026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1728068 1728439 gene locus_tag LOCUS_16740 1728068 1728439 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_16740 1728463 1728924 gene locus_tag LOCUS_16750 1728463 1728924 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_16750 1728992 1729453 gene locus_tag LOCUS_16760 1728992 1729453 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_16760 1729472 1731412 gene locus_tag LOCUS_16770 1729472 1731412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1732992 1731481 gene locus_tag LOCUS_16780 1732992 1731481 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_16780 1733227 1733140 gene locus_tag LOCUS_t00200 1733227 1733140 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1733706 1733248 gene locus_tag LOCUS_16790 gene tadA 1733706 1733248 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_16790 1734183 1735061 gene locus_tag LOCUS_16800 1734183 1735061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1735142 1736461 gene locus_tag LOCUS_16810 1735142 1736461 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_16810 1737385 1737203 gene locus_tag LOCUS_16820 1737385 1737203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1737606 1737833 gene locus_tag LOCUS_16830 1737606 1737833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1739096 1737906 gene locus_tag LOCUS_16840 1739096 1737906 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095144.1 protein_id gnl|my_center|LOCUS_16840 1740462 1740136 gene locus_tag LOCUS_16850 1740462 1740136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1740993 1742048 gene locus_tag LOCUS_16860 1740993 1742048 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_16860 1743444 1743109 gene locus_tag LOCUS_16870 1743444 1743109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1743666 1743460 gene locus_tag LOCUS_16880 1743666 1743460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1744539 1744138 gene locus_tag LOCUS_16890 1744539 1744138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1744886 1744536 gene locus_tag LOCUS_16900 1744886 1744536 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810367.1 protein_id gnl|my_center|LOCUS_16900 1745257 1744883 gene locus_tag LOCUS_16910 1745257 1744883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1745929 1745459 gene locus_tag LOCUS_16920 1745929 1745459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385724.1 protein_id gnl|my_center|LOCUS_16920 1746868 1745933 gene locus_tag LOCUS_16930 1746868 1745933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1749452 1746963 gene locus_tag LOCUS_16940 1749452 1746963 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210762687.1 protein_id gnl|my_center|LOCUS_16940 1751098 1749452 gene locus_tag LOCUS_16950 1751098 1749452 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035470.1 protein_id gnl|my_center|LOCUS_16950 1752017 1751106 gene locus_tag LOCUS_16960 1752017 1751106 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385731.1 protein_id gnl|my_center|LOCUS_16960 1754082 1752304 gene locus_tag LOCUS_16970 1754082 1752304 CDS product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946812.1 protein_id gnl|my_center|LOCUS_16970 1755074 1754998 gene locus_tag LOCUS_t00210 1755074 1754998 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1755813 1755121 gene locus_tag LOCUS_16980 1755813 1755121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1755983 1755890 gene locus_tag LOCUS_t00220 1755983 1755890 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1756180 1756095 gene locus_tag LOCUS_t00230 1756180 1756095 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1757466 1756192 gene locus_tag LOCUS_16990 gene serS 1757466 1756192 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_16990 1758116 1757544 gene locus_tag LOCUS_17000 1758116 1757544 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_17000 1759082 1758210 gene locus_tag LOCUS_17010 1759082 1758210 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704666.1 protein_id gnl|my_center|LOCUS_17010 1759323 1760729 gene locus_tag LOCUS_17020 1759323 1760729 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_17020 1761070 1760756 gene locus_tag LOCUS_17030 1761070 1760756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1762194 1761067 gene locus_tag LOCUS_17040 1762194 1761067 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_17040 1763367 1762246 gene locus_tag LOCUS_17050 gene mutY 1763367 1762246 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_17050 1764419 1763367 gene locus_tag LOCUS_17060 gene hisC 1764419 1763367 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_17060 1765317 1764547 gene locus_tag LOCUS_17070 1765317 1764547 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_17070 1766459 1765395 gene locus_tag LOCUS_17080 gene mqnC 1766459 1765395 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044953.1 protein_id gnl|my_center|LOCUS_17080 1767645 1766560 gene locus_tag LOCUS_17090 gene mqnE 1767645 1766560 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_17090 1768272 1767673 gene locus_tag LOCUS_17100 1768272 1767673 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_17100 1769398 1768523 gene locus_tag LOCUS_17110 gene ubiA 1769398 1768523 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_17110 1771310 1769565 gene locus_tag LOCUS_17120 1771310 1769565 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_17120 1772210 1771662 gene locus_tag LOCUS_17130 1772210 1771662 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942462.1 protein_id gnl|my_center|LOCUS_17130 1773710 1772307 gene locus_tag LOCUS_17140 1773710 1772307 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941106.1 protein_id gnl|my_center|LOCUS_17140 1775286 1773826 gene locus_tag LOCUS_17150 1775286 1773826 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_17150 1776894 1775332 gene locus_tag LOCUS_17160 1776894 1775332 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_17160 1778908 1776938 gene locus_tag LOCUS_17170 gene nuoL 1778908 1776938 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_17170 1779255 1778953 gene locus_tag LOCUS_17180 gene nuoK 1779255 1778953 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_17180 1779782 1779279 gene locus_tag LOCUS_17190 1779782 1779279 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_17190 1780198 1779803 gene locus_tag LOCUS_17200 gene nuoI 1780198 1779803 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_17200 1781272 1780229 gene locus_tag LOCUS_17210 gene nuoH 1781272 1780229 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_17210 1782269 1781307 gene locus_tag LOCUS_17220 1782269 1781307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1784775 1782283 gene locus_tag LOCUS_17230 1784775 1782283 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941012.1 protein_id gnl|my_center|LOCUS_17230 1786592 1784811 gene locus_tag LOCUS_17240 gene nuoF 1786592 1784811 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941011.1 protein_id gnl|my_center|LOCUS_17240 1787149 1786646 gene locus_tag LOCUS_17250 1787149 1786646 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941010.1 protein_id gnl|my_center|LOCUS_17250 1788360 1787179 gene locus_tag LOCUS_17260 gene nuoD 1788360 1787179 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_17260 1788893 1788402 gene locus_tag LOCUS_17270 1788893 1788402 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_17270 1789452 1788943 gene locus_tag LOCUS_17280 1789452 1788943 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_17280 1789805 1789443 gene locus_tag LOCUS_17290 1789805 1789443 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_17290 1790265 1791485 gene locus_tag LOCUS_17300 1790265 1791485 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_17300 1792107 1791511 gene locus_tag LOCUS_17310 1792107 1791511 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_17310 1792721 1792107 gene locus_tag LOCUS_17320 gene rsxG 1792721 1792107 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261585.1 protein_id gnl|my_center|LOCUS_17320 1793730 1792735 gene locus_tag LOCUS_17330 1793730 1792735 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_17330 1795054 1793732 gene locus_tag LOCUS_17340 gene rsxC 1795054 1793732 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_17340 1795928 1795080 gene locus_tag LOCUS_17350 1795928 1795080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1796549 1795968 gene locus_tag LOCUS_17360 gene rsxA 1796549 1795968 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_17360 1796923 1798206 gene locus_tag LOCUS_17370 gene hemL 1796923 1798206 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_17370 1798289 1798555 gene locus_tag LOCUS_17380 1798289 1798555 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_17380 1798552 1798926 gene locus_tag LOCUS_17390 1798552 1798926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1798955 1799629 gene locus_tag LOCUS_17400 1798955 1799629 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_17400 1799719 1799988 gene locus_tag LOCUS_17410 gene atpE 1799719 1799988 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941001.1 protein_id gnl|my_center|LOCUS_17410 1800145 1802010 gene locus_tag LOCUS_17420 1800145 1802010 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_17420 1803937 1802096 gene locus_tag LOCUS_17430 1803937 1802096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1804506 1804979 gene locus_tag LOCUS_17440 1804506 1804979 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_17440 1804982 1805755 gene locus_tag LOCUS_17450 1804982 1805755 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_17450 1805757 1807007 gene locus_tag LOCUS_17460 gene nrfD 1805757 1807007 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_17460 1807345 1808808 gene locus_tag LOCUS_17470 1807345 1808808 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_17470 1808948 1809295 gene locus_tag LOCUS_17480 1808948 1809295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1811718 1809310 gene locus_tag LOCUS_17490 1811718 1809310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1812574 1811843 gene locus_tag LOCUS_17500 1812574 1811843 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085225034.1 protein_id gnl|my_center|LOCUS_17500 1813699 1812656 gene locus_tag LOCUS_17510 1813699 1812656 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941134.1 protein_id gnl|my_center|LOCUS_17510 1814584 1813877 gene locus_tag LOCUS_17520 1814584 1813877 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_17520 1814832 1815020 gene locus_tag LOCUS_17530 1814832 1815020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1815210 1815037 gene locus_tag LOCUS_17540 1815210 1815037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1815661 1815260 gene locus_tag LOCUS_17550 1815661 1815260 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_17550 1815802 1816902 gene locus_tag LOCUS_17560 1815802 1816902 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_17560 1818316 1816925 gene locus_tag LOCUS_17570 gene merA 1818316 1816925 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944034.1 protein_id gnl|my_center|LOCUS_17570 1820148 1818313 gene locus_tag LOCUS_17580 1820148 1818313 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_17580 1820352 1821401 gene locus_tag LOCUS_17590 1820352 1821401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1821406 1822551 gene locus_tag LOCUS_17600 1821406 1822551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1823439 1822624 gene locus_tag LOCUS_17610 gene ybgF 1823439 1822624 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_17610 1824098 1823529 gene locus_tag LOCUS_17620 gene pal 1824098 1823529 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_17620 1825586 1824285 gene locus_tag LOCUS_17630 gene tolB 1825586 1824285 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_17630 1826482 1825592 gene locus_tag LOCUS_17640 1826482 1825592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1826977 1826531 gene locus_tag LOCUS_17650 gene tolR 1826977 1826531 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_17650 1827647 1826982 gene locus_tag LOCUS_17660 gene tolQ 1827647 1826982 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_17660 1827798 1829006 gene locus_tag LOCUS_17670 gene ilvA 1827798 1829006 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941154.1 protein_id gnl|my_center|LOCUS_17670 1830046 1828982 gene locus_tag LOCUS_17680 1830046 1828982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1830126 1830830 gene locus_tag LOCUS_17690 1830126 1830830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1831326 1830859 gene locus_tag LOCUS_17700 1831326 1830859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1832133 1831375 gene locus_tag LOCUS_17710 1832133 1831375 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_17710 1833214 1832684 gene locus_tag LOCUS_17720 1833214 1832684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1833468 1833214 gene locus_tag LOCUS_17730 1833468 1833214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1835777 1833645 gene locus_tag LOCUS_17740 1835777 1833645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1836662 1835898 gene locus_tag LOCUS_17750 1836662 1835898 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_17750 1837318 1836677 gene locus_tag LOCUS_17760 1837318 1836677 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044955.1 protein_id gnl|my_center|LOCUS_17760 1838145 1837375 gene locus_tag LOCUS_17770 gene folE2 1838145 1837375 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_17770 1838831 1838157 gene locus_tag LOCUS_17780 gene queC 1838831 1838157 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_17780 1840281 1838833 gene locus_tag LOCUS_17790 gene pyk 1840281 1838833 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_17790 1840688 1840368 gene locus_tag LOCUS_17800 1840688 1840368 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943945.1 protein_id gnl|my_center|LOCUS_17800 1840830 1843238 gene locus_tag LOCUS_17810 1840830 1843238 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_17810 1844220 1843192 gene locus_tag LOCUS_17820 1844220 1843192 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_17820 1844902 1844252 gene locus_tag LOCUS_17830 gene nth 1844902 1844252 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_17830 1845774 1845043 gene locus_tag LOCUS_17840 1845774 1845043 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969675.1 protein_id gnl|my_center|LOCUS_17840 1846451 1845942 gene locus_tag LOCUS_17850 1846451 1845942 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_17850 1847478 1846477 gene locus_tag LOCUS_17860 1847478 1846477 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_17860 1848286 1847492 gene locus_tag LOCUS_17870 1848286 1847492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1850813 1848297 gene locus_tag LOCUS_17880 gene gyrA 1850813 1848297 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_17880 1853255 1850838 gene locus_tag LOCUS_17890 gene gyrB 1853255 1850838 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_17890 1854330 1853248 gene locus_tag LOCUS_17900 gene recF 1854330 1853248 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_17900 1855550 1854432 gene locus_tag LOCUS_17910 gene dnaN 1855550 1854432 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_17910 1857135 1855789 gene locus_tag LOCUS_17920 gene dnaA 1857135 1855789 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_17920 1857455 1857607 gene locus_tag LOCUS_17930 gene rpmH 1857455 1857607 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_17930 1857610 1857960 gene locus_tag LOCUS_17940 gene rnpA 1857610 1857960 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928789.1 protein_id gnl|my_center|LOCUS_17940 1857980 1858189 gene locus_tag LOCUS_17950 gene yidD 1857980 1858189 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434233.1 protein_id gnl|my_center|LOCUS_17950 1858222 1859820 gene locus_tag LOCUS_17960 gene yidC 1858222 1859820 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_17960 1859822 1861195 gene locus_tag LOCUS_17970 gene mnmE 1859822 1861195 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_17970 1861251 1863113 gene locus_tag LOCUS_17980 gene mnmG 1861251 1863113 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_17980 1863115 1863762 gene locus_tag LOCUS_17990 gene rsmG 1863115 1863762 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944072.1 protein_id gnl|my_center|LOCUS_17990 1863852 1864616 gene locus_tag LOCUS_18000 1863852 1864616 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_18000 1864618 1865487 gene locus_tag LOCUS_18010 1864618 1865487 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_18010 1865534 1865923 gene locus_tag LOCUS_18020 1865534 1865923 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_18020 1866223 1867527 gene locus_tag LOCUS_18030 1866223 1867527 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_18030 1867586 1868962 gene locus_tag LOCUS_18040 1867586 1868962 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_18040 1869690 1869250 gene locus_tag LOCUS_18050 1869690 1869250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1869839 1871845 gene locus_tag LOCUS_18060 gene tkt 1869839 1871845 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_18060 1871931 1873922 gene locus_tag LOCUS_18070 gene betT 1871931 1873922 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_18070 1875517 1874297 gene locus_tag LOCUS_18080 1875517 1874297 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_18080 1875617 1876846 gene locus_tag LOCUS_18090 1875617 1876846 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_18090 1876964 1878163 gene locus_tag LOCUS_18100 1876964 1878163 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939574.1 protein_id gnl|my_center|LOCUS_18100 1878160 1878999 gene locus_tag LOCUS_18110 1878160 1878999 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 protein_id gnl|my_center|LOCUS_18110 1879039 1879908 gene locus_tag LOCUS_18120 1879039 1879908 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_18120 1881788 1879983 gene locus_tag LOCUS_18130 1881788 1879983 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_18130 1881979 1883010 gene locus_tag LOCUS_18140 1881979 1883010 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940802.1 protein_id gnl|my_center|LOCUS_18140 1883110 1883367 gene locus_tag LOCUS_18150 1883110 1883367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1883377 1883691 gene locus_tag LOCUS_18160 1883377 1883691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1883688 1884302 gene locus_tag LOCUS_18170 1883688 1884302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1884992 1884354 gene locus_tag LOCUS_18180 1884992 1884354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1885990 1884989 gene locus_tag LOCUS_18190 1885990 1884989 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_18190 1886791 1885994 gene locus_tag LOCUS_18200 1886791 1885994 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_18200 1887920 1886775 gene locus_tag LOCUS_18210 1887920 1886775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_18210 1888094 1889314 gene locus_tag LOCUS_18220 1888094 1889314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103851.1 protein_id gnl|my_center|LOCUS_18220 1891735 1889330 gene locus_tag LOCUS_18230 1891735 1889330 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_18230 1891876 1892436 gene locus_tag LOCUS_18240 1891876 1892436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1892576 1892501 gene locus_tag LOCUS_t00240 1892576 1892501 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1892767 1894182 gene locus_tag LOCUS_18250 1892767 1894182 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_18250 1894531 1895550 gene locus_tag LOCUS_18260 gene aroF 1894531 1895550 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_18260 1895664 1895927 gene locus_tag LOCUS_18270 1895664 1895927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1896146 1897744 gene locus_tag LOCUS_18280 gene serA 1896146 1897744 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941855.1 protein_id gnl|my_center|LOCUS_18280 1898238 1899962 gene locus_tag LOCUS_18290 1898238 1899962 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_18290 1900019 1902919 gene locus_tag LOCUS_18300 1900019 1902919 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943912.1 protein_id gnl|my_center|LOCUS_18300 1903276 1903061 gene locus_tag LOCUS_18310 1903276 1903061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940891.1 protein_id gnl|my_center|LOCUS_18310 1904461 1903628 gene locus_tag LOCUS_18320 1904461 1903628 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_18320 1905198 1904458 gene locus_tag LOCUS_18330 gene mqnB 1905198 1904458 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_18330 1906371 1905259 gene locus_tag LOCUS_18340 1906371 1905259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1906632 1907192 gene locus_tag LOCUS_18350 1906632 1907192 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_18350 1907254 1908909 gene locus_tag LOCUS_18360 1907254 1908909 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_18360 1909047 1911047 gene locus_tag LOCUS_18370 gene uvrB 1909047 1911047 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_18370 1911800 1911243 gene locus_tag LOCUS_18380 1911800 1911243 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_18380 1911907 1912290 gene locus_tag LOCUS_18390 1911907 1912290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1912298 1912960 gene locus_tag LOCUS_18400 1912298 1912960 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_18400 1913532 1913095 gene locus_tag LOCUS_18410 1913532 1913095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1914321 1913557 gene locus_tag LOCUS_18420 1914321 1913557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 protein_id gnl|my_center|LOCUS_18420 1914453 1914767 gene locus_tag LOCUS_18430 1914453 1914767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1915095 1916069 gene locus_tag LOCUS_18440 1915095 1916069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1916118 1916651 gene locus_tag LOCUS_18450 1916118 1916651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1916670 1920071 gene locus_tag LOCUS_18460 1916670 1920071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1920417 1921448 gene locus_tag LOCUS_18470 1920417 1921448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1921459 1921806 gene locus_tag LOCUS_18480 1921459 1921806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1921921 1923123 gene locus_tag LOCUS_18490 1921921 1923123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1923136 1924188 gene locus_tag LOCUS_18500 1923136 1924188 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_18500 1925020 1924214 gene locus_tag LOCUS_18510 1925020 1924214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1925237 1925025 gene locus_tag LOCUS_18520 1925237 1925025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1925658 1927286 gene locus_tag LOCUS_18530 1925658 1927286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1927552 1928106 gene locus_tag LOCUS_18540 1927552 1928106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1929005 1928661 gene locus_tag LOCUS_18550 1929005 1928661 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_18550 1929306 1928995 gene locus_tag LOCUS_18560 1929306 1928995 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_18560 1929890 1929495 gene locus_tag LOCUS_18570 1929890 1929495 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545845.1 protein_id gnl|my_center|LOCUS_18570 1930092 1929883 gene locus_tag LOCUS_18580 1930092 1929883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1930701 1930492 gene locus_tag LOCUS_18590 1930701 1930492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1931073 1930741 gene locus_tag LOCUS_18600 1931073 1930741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1931315 1932343 gene locus_tag LOCUS_18610 gene hflK 1931315 1932343 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_18610 1932340 1933272 gene locus_tag LOCUS_18620 gene hflC 1932340 1933272 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_18620 1933721 1935091 gene locus_tag LOCUS_18630 gene ltrA 1933721 1935091 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_18630 1935280 1935957 gene locus_tag LOCUS_18640 1935280 1935957 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_18640 1935957 1937954 gene locus_tag LOCUS_18650 1935957 1937954 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_18650 1937956 1939929 gene locus_tag LOCUS_18660 1937956 1939929 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_18660 1940078 1940992 gene locus_tag LOCUS_18670 1940078 1940992 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_18670 1941006 1941644 gene locus_tag LOCUS_18680 1941006 1941644 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_18680 1941649 1943073 gene locus_tag LOCUS_18690 1941649 1943073 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_18690 1943070 1944578 gene locus_tag LOCUS_18700 1943070 1944578 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_18700 1944593 1945360 gene locus_tag LOCUS_18710 1944593 1945360 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_18710 1945642 1945442 gene locus_tag LOCUS_18720 1945642 1945442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1945580 1945837 gene locus_tag LOCUS_18730 1945580 1945837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1945816 1946142 gene locus_tag LOCUS_18740 1945816 1946142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1946799 1946299 gene locus_tag LOCUS_18750 1946799 1946299 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530520.1 protein_id gnl|my_center|LOCUS_18750 1947355 1946966 gene locus_tag LOCUS_18760 1947355 1946966 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_18760 1947839 1947393 gene locus_tag LOCUS_18770 1947839 1947393 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_18770 1948924 1948115 gene locus_tag LOCUS_18780 1948924 1948115 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_18780 1950693 1949164 gene locus_tag LOCUS_18790 1950693 1949164 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_18790 1951766 1950834 gene locus_tag LOCUS_18800 gene trxB 1951766 1950834 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722610.1 protein_id gnl|my_center|LOCUS_18800 1951921 1952883 gene locus_tag LOCUS_18810 1951921 1952883 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_18810 1952893 1953234 gene locus_tag LOCUS_18820 1952893 1953234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1954108 1953317 gene locus_tag LOCUS_18830 1954108 1953317 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_18830 1954464 1954928 gene locus_tag LOCUS_18840 1954464 1954928 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_18840 1954928 1955233 gene locus_tag LOCUS_18850 1954928 1955233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1955236 1955559 gene locus_tag LOCUS_18860 1955236 1955559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1955556 1955801 gene locus_tag LOCUS_18870 1955556 1955801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18870 1955798 1956070 gene locus_tag LOCUS_18880 1955798 1956070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1956067 1956546 gene locus_tag LOCUS_18890 1956067 1956546 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_18890 1956548 1956937 gene locus_tag LOCUS_18900 1956548 1956937 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_18900 1956934 1958424 gene locus_tag LOCUS_18910 1956934 1958424 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_18910 1958476 1959957 gene locus_tag LOCUS_18920 1958476 1959957 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_18920 1959954 1960214 gene locus_tag LOCUS_18930 1959954 1960214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1960207 1961994 gene locus_tag LOCUS_18940 1960207 1961994 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_18940 1962222 1962695 gene locus_tag LOCUS_18950 1962222 1962695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1962730 1963863 gene locus_tag LOCUS_18960 gene hemW 1962730 1963863 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_18960 1964020 1965060 gene locus_tag LOCUS_18970 gene hrcA 1964020 1965060 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_18970 1965078 1965701 gene locus_tag LOCUS_18980 gene grpE 1965078 1965701 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_18980 1965757 1967676 gene locus_tag LOCUS_18990 gene dnaK 1965757 1967676 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_18990 1967793 1968911 gene locus_tag LOCUS_19000 gene dnaJ 1967793 1968911 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_19000 1968928 1970796 gene locus_tag LOCUS_19010 1968928 1970796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1970784 1971635 gene locus_tag LOCUS_19020 1970784 1971635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1972680 1972498 gene locus_tag LOCUS_19030 1972680 1972498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1972717 1974450 gene locus_tag LOCUS_19040 1972717 1974450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1974447 1974740 gene locus_tag LOCUS_19050 1974447 1974740 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_19050 1974812 1975615 gene locus_tag LOCUS_19060 1974812 1975615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 1975561 1975875 gene locus_tag LOCUS_19070 1975561 1975875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1975889 1976785 gene locus_tag LOCUS_19080 1975889 1976785 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_19080 1976912 1977658 gene locus_tag LOCUS_19090 1976912 1977658 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_19090 1977910 1980510 gene locus_tag LOCUS_19100 1977910 1980510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1980524 1981414 gene locus_tag LOCUS_19110 1980524 1981414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1981588 1982334 gene locus_tag LOCUS_19120 1981588 1982334 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_19120 1982492 1983379 gene locus_tag LOCUS_19130 1982492 1983379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1984397 1983489 gene locus_tag LOCUS_19140 1984397 1983489 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_19140 1984658 1985137 gene locus_tag LOCUS_19150 1984658 1985137 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_19150 1985263 1985958 gene locus_tag LOCUS_19160 gene ispD 1985263 1985958 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_19160 1985955 1986461 gene locus_tag LOCUS_19170 gene ispF 1985955 1986461 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_19170 1986527 1988227 gene locus_tag LOCUS_19180 1986527 1988227 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_19180 1988217 1990109 gene locus_tag LOCUS_19190 1988217 1990109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1990123 1990668 gene locus_tag LOCUS_19200 1990123 1990668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1990751 1992526 gene locus_tag LOCUS_19210 1990751 1992526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1992543 1994645 gene locus_tag LOCUS_19220 1992543 1994645 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_19220 1994805 1995851 gene locus_tag LOCUS_19230 gene cheB 1994805 1995851 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_19230 1996011 1997456 gene locus_tag LOCUS_19240 gene cysS 1996011 1997456 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_19240 1997470 1997862 gene locus_tag LOCUS_19250 1997470 1997862 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_19250 1997859 1998209 gene locus_tag LOCUS_19260 1997859 1998209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1998264 1998674 gene locus_tag LOCUS_19270 gene mce 1998264 1998674 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_19270 1999021 1999527 gene locus_tag LOCUS_19280 1999021 1999527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1999839 1999982 gene locus_tag LOCUS_19290 1999839 1999982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2000071 2001414 gene locus_tag LOCUS_19300 2000071 2001414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2001888 2003636 gene locus_tag LOCUS_19310 2001888 2003636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2004036 2004854 gene locus_tag LOCUS_19320 2004036 2004854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2004851 2005513 gene locus_tag LOCUS_19330 2004851 2005513 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_19330 2005605 2005829 gene locus_tag LOCUS_19340 2005605 2005829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2005820 2006269 gene locus_tag LOCUS_19350 2005820 2006269 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391796.1 protein_id gnl|my_center|LOCUS_19350 2006886 2009000 gene locus_tag LOCUS_19360 2006886 2009000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2009068 2010723 gene locus_tag LOCUS_19370 2009068 2010723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2010757 2012337 gene locus_tag LOCUS_19380 2010757 2012337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2012360 2014363 gene locus_tag LOCUS_19390 2012360 2014363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2014416 2015531 gene locus_tag LOCUS_19400 2014416 2015531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2015646 2017505 gene locus_tag LOCUS_19410 2015646 2017505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2017705 2020059 gene locus_tag LOCUS_19420 2017705 2020059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2020084 2021181 gene locus_tag LOCUS_19430 2020084 2021181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2021882 2021541 gene locus_tag LOCUS_19440 2021882 2021541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2022537 2022175 gene locus_tag LOCUS_19450 2022537 2022175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2023059 2025017 gene locus_tag LOCUS_19460 2023059 2025017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2025055 2026329 gene locus_tag LOCUS_19470 2025055 2026329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2026473 2026733 gene locus_tag LOCUS_19480 2026473 2026733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2026730 2027011 gene locus_tag LOCUS_19490 2026730 2027011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2027322 2027053 gene locus_tag LOCUS_19500 2027322 2027053 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 protein_id gnl|my_center|LOCUS_19500 2027590 2027306 gene locus_tag LOCUS_19510 2027590 2027306 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_19510 2028106 2029251 gene locus_tag LOCUS_19520 2028106 2029251 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_19520 2029256 2030968 gene locus_tag LOCUS_19530 2029256 2030968 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_19530 2030999 2031649 gene locus_tag LOCUS_19540 gene cybH 2030999 2031649 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_19540 2031649 2032128 gene locus_tag LOCUS_19550 2031649 2032128 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_19550 2032269 2032700 gene locus_tag LOCUS_19560 2032269 2032700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2034634 2032781 gene locus_tag LOCUS_19570 2034634 2032781 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_19570 2035038 2036612 gene locus_tag LOCUS_19580 gene pckA 2035038 2036612 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_19580 2036738 2037055 gene locus_tag LOCUS_19590 2036738 2037055 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_19590 2037052 2037372 gene locus_tag LOCUS_19600 2037052 2037372 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_19600 2038745 2037390 gene locus_tag LOCUS_19610 2038745 2037390 CDS product NlpC/P60 family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524287.1 protein_id gnl|my_center|LOCUS_19610 2038799 2039503 gene locus_tag LOCUS_19620 2038799 2039503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2039494 2040261 gene locus_tag LOCUS_19630 2039494 2040261 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931055.1 protein_id gnl|my_center|LOCUS_19630 2040455 2042803 gene locus_tag LOCUS_19640 gene lon 2040455 2042803 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_19640 2042800 2043783 gene locus_tag LOCUS_19650 gene thiL 2042800 2043783 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_19650 2044051 2044956 gene locus_tag LOCUS_19660 2044051 2044956 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044926.1 protein_id gnl|my_center|LOCUS_19660 2044956 2046236 gene locus_tag LOCUS_19670 2044956 2046236 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943814.1 protein_id gnl|my_center|LOCUS_19670 2046242 2046739 gene locus_tag LOCUS_19680 2046242 2046739 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_19680 2046730 2047098 gene locus_tag LOCUS_19690 2046730 2047098 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943816.1 protein_id gnl|my_center|LOCUS_19690 2047170 2049068 gene locus_tag LOCUS_19700 2047170 2049068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2049065 2049685 gene locus_tag LOCUS_19710 2049065 2049685 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_19710 2049682 2050173 gene locus_tag LOCUS_19720 2049682 2050173 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_19720 2050352 2051140 gene locus_tag LOCUS_19730 2050352 2051140 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943820.1 protein_id gnl|my_center|LOCUS_19730 2051222 2051713 gene locus_tag LOCUS_19740 2051222 2051713 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_19740 2051768 2053108 gene locus_tag LOCUS_19750 gene rimO 2051768 2053108 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19750 2053113 2054105 gene locus_tag LOCUS_19760 2053113 2054105 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_19760 2054102 2054494 gene locus_tag LOCUS_19770 2054102 2054494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2054475 2055050 gene locus_tag LOCUS_19780 2054475 2055050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2055047 2056816 gene locus_tag LOCUS_19790 2055047 2056816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_19790 2056828 2058597 gene locus_tag LOCUS_19800 2056828 2058597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_19800 2058617 2059075 gene locus_tag LOCUS_19810 2058617 2059075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2059983 2059120 gene locus_tag LOCUS_19820 gene hslO 2059983 2059120 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_19820 2060266 2061264 gene locus_tag LOCUS_19830 2060266 2061264 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_19830 2062655 2061519 gene locus_tag LOCUS_19840 2062655 2061519 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_19840 2063160 2062639 gene locus_tag LOCUS_19850 2063160 2062639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2063298 2064896 gene locus_tag LOCUS_19860 2063298 2064896 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_19860 2067273 2064898 gene locus_tag LOCUS_19870 2067273 2064898 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_19870 2068112 2067378 gene locus_tag LOCUS_19880 2068112 2067378 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941514.1 protein_id gnl|my_center|LOCUS_19880 2068541 2068248 gene locus_tag LOCUS_19890 2068541 2068248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2068756 2068538 gene locus_tag LOCUS_19900 2068756 2068538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2069575 2068880 gene locus_tag LOCUS_19910 gene radC 2069575 2068880 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_19910 2070243 2069746 gene locus_tag LOCUS_19920 2070243 2069746 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_19920 2070422 2070640 gene locus_tag LOCUS_19930 2070422 2070640 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940870.1 protein_id gnl|my_center|LOCUS_19930 2071466 2070681 gene locus_tag LOCUS_19940 2071466 2070681 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_19940 2072337 2071528 gene locus_tag LOCUS_19950 2072337 2071528 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_19950 2072492 2074168 gene locus_tag LOCUS_19960 2072492 2074168 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941246.1 protein_id gnl|my_center|LOCUS_19960 2074372 2074178 gene locus_tag LOCUS_19970 2074372 2074178 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_19970 2074553 2075605 gene locus_tag LOCUS_19980 gene dctP 2074553 2075605 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_19980 2075751 2076794 gene locus_tag LOCUS_19990 2075751 2076794 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940088.1 protein_id gnl|my_center|LOCUS_19990 2076916 2077413 gene locus_tag LOCUS_20000 2076916 2077413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2077420 2078715 gene locus_tag LOCUS_20010 2077420 2078715 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_20010 2078813 2079238 gene locus_tag LOCUS_20020 2078813 2079238 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200939.1 protein_id gnl|my_center|LOCUS_20020 2080168 2081439 gene locus_tag LOCUS_20030 2080168 2081439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2081716 2082165 gene locus_tag LOCUS_20040 2081716 2082165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2082284 2082448 gene locus_tag LOCUS_20050 2082284 2082448 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820212.1 protein_id gnl|my_center|LOCUS_20050 2082736 2083119 gene locus_tag LOCUS_20060 2082736 2083119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2083154 2084005 gene locus_tag LOCUS_20070 gene cpaB 2083154 2084005 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_20070 2084169 2085737 gene locus_tag LOCUS_20080 2084169 2085737 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_20080 2085734 2086006 gene locus_tag LOCUS_20090 2085734 2086006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2086021 2086464 gene locus_tag LOCUS_20100 2086021 2086464 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542282.1 protein_id gnl|my_center|LOCUS_20100 2086468 2087724 gene locus_tag LOCUS_20110 2086468 2087724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2087763 2088926 gene locus_tag LOCUS_20120 2087763 2088926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2088941 2090323 gene locus_tag LOCUS_20130 2088941 2090323 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_20130 2090339 2091316 gene locus_tag LOCUS_20140 2090339 2091316 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_20140 2091326 2092315 gene locus_tag LOCUS_20150 2091326 2092315 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_20150 2092325 2093263 gene locus_tag LOCUS_20160 2092325 2093263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2093287 2093730 gene locus_tag LOCUS_20170 2093287 2093730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2093786 2094442 gene locus_tag LOCUS_20180 2093786 2094442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2094470 2096053 gene locus_tag LOCUS_20190 2094470 2096053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2096050 2097459 gene locus_tag LOCUS_20200 2096050 2097459 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_20200 2098973 2097543 gene locus_tag LOCUS_20210 gene cls 2098973 2097543 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_20210 2099578 2099246 gene locus_tag LOCUS_20220 2099578 2099246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2100211 2099702 gene locus_tag LOCUS_20230 2100211 2099702 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_20230 2100970 2100314 gene locus_tag LOCUS_20240 gene ktrA 2100970 2100314 CDS product potassium uptake protein KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243377.1 protein_id gnl|my_center|LOCUS_20240 2102367 2100991 gene locus_tag LOCUS_20250 2102367 2100991 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_20250 2102800 2102375 gene locus_tag LOCUS_20260 2102800 2102375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2102971 2103423 gene locus_tag LOCUS_20270 2102971 2103423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2103905 2103504 gene locus_tag LOCUS_20280 2103905 2103504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2107086 2104228 gene locus_tag LOCUS_20290 gene uvrA 2107086 2104228 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_20290 2108040 2107507 gene locus_tag LOCUS_20300 2108040 2107507 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_20300 2109773 2108364 gene locus_tag LOCUS_20310 2109773 2108364 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_20310 2110774 2109770 gene locus_tag LOCUS_20320 gene pdxA 2110774 2109770 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_20320 2111765 2110803 gene locus_tag LOCUS_20330 2111765 2110803 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_20330 2112741 2111824 gene locus_tag LOCUS_20340 2112741 2111824 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_20340 2116289 2112795 gene locus_tag LOCUS_20350 gene mfd 2116289 2112795 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_20350 2117344 2116430 gene locus_tag LOCUS_20360 gene nadA 2117344 2116430 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_20360 2117519 2117929 gene locus_tag LOCUS_20370 2117519 2117929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2117919 2118704 gene locus_tag LOCUS_20380 2117919 2118704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2118789 2119733 gene locus_tag LOCUS_20390 2118789 2119733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_20390 2119723 2120514 gene locus_tag LOCUS_20400 2119723 2120514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_20400 2121151 2120582 gene locus_tag LOCUS_20410 2121151 2120582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2122198 2121329 gene locus_tag LOCUS_20420 2122198 2121329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2123003 2122293 gene locus_tag LOCUS_20430 2123003 2122293 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_20430 2123207 2123995 gene locus_tag LOCUS_20440 2123207 2123995 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943982.1 protein_id gnl|my_center|LOCUS_20440 2125174 2123978 gene locus_tag LOCUS_20450 gene dinB 2125174 2123978 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_20450 2125262 2125981 gene locus_tag LOCUS_20460 2125262 2125981 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_20460 2126497 2126081 gene locus_tag LOCUS_20470 2126497 2126081 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_20470 2127971 2126565 gene locus_tag LOCUS_20480 gene atpD 2127971 2126565 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_20480 2128888 2128022 gene locus_tag LOCUS_20490 gene atpG 2128888 2128022 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_20490 2130425 2128914 gene locus_tag LOCUS_20500 gene atpA 2130425 2128914 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_20500 2130977 2130435 gene locus_tag LOCUS_20510 gene atpH 2130977 2130435 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_20510 2131573 2130974 gene locus_tag LOCUS_20520 2131573 2130974 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940785.1 protein_id gnl|my_center|LOCUS_20520 2132003 2131578 gene locus_tag LOCUS_20530 2132003 2131578 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_20530 2132884 2132153 gene locus_tag LOCUS_20540 2132884 2132153 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941540.1 protein_id gnl|my_center|LOCUS_20540 2133262 2133032 gene locus_tag LOCUS_20550 2133262 2133032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2135786 2133633 gene locus_tag LOCUS_20560 2135786 2133633 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_20560 2136666 2135965 gene locus_tag LOCUS_20570 2136666 2135965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2137134 2136775 gene locus_tag LOCUS_20580 2137134 2136775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2139237 2137405 gene locus_tag LOCUS_20590 2139237 2137405 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256503.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 2139758 2139180 gene locus_tag LOCUS_20600 2139758 2139180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2140189 2139755 gene locus_tag LOCUS_20610 2140189 2139755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2142726 2140186 gene locus_tag LOCUS_20620 2142726 2140186 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_20620 2142897 2144549 gene locus_tag LOCUS_20630 gene pgi 2142897 2144549 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_20630 2144542 2145810 gene locus_tag LOCUS_20640 2144542 2145810 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_20640 2145839 2146894 gene locus_tag LOCUS_20650 2145839 2146894 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_20650 2147042 2146869 gene locus_tag LOCUS_20660 2147042 2146869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2147932 2147285 gene locus_tag LOCUS_20670 2147932 2147285 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942917.1 protein_id gnl|my_center|LOCUS_20670 2149470 2148235 gene locus_tag LOCUS_20680 2149470 2148235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2149848 2149609 gene locus_tag LOCUS_20690 2149848 2149609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2151541 2149940 gene locus_tag LOCUS_20700 2151541 2149940 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_20700 2152073 2151567 gene locus_tag LOCUS_20710 2152073 2151567 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_20710 2152873 2152226 gene locus_tag LOCUS_20720 2152873 2152226 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_20720 2153022 2153171 gene locus_tag LOCUS_20730 2153022 2153171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2155245 2153182 gene locus_tag LOCUS_20740 gene fusA 2155245 2153182 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943165.1 protein_id gnl|my_center|LOCUS_20740 2156119 2155340 gene locus_tag LOCUS_20750 2156119 2155340 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_20750 2158553 2156160 gene locus_tag LOCUS_20760 2158553 2156160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2158579 2158869 gene locus_tag LOCUS_20770 2158579 2158869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2160052 2158937 gene locus_tag LOCUS_20780 2160052 2158937 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_20780 2161507 2160362 gene locus_tag LOCUS_20790 gene metC 2161507 2160362 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_20790 2162736 2161585 gene locus_tag LOCUS_20800 2162736 2161585 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393485.1 protein_id gnl|my_center|LOCUS_20800 2163776 2163102 gene locus_tag LOCUS_20810 2163776 2163102 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_20810 2165206 2163773 gene locus_tag LOCUS_20820 2165206 2163773 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_20820 2165406 2166116 gene locus_tag LOCUS_20830 2165406 2166116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2166181 2166678 gene locus_tag LOCUS_20840 2166181 2166678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2166887 2168329 gene locus_tag LOCUS_20850 2166887 2168329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2168304 2168951 gene locus_tag LOCUS_20860 2168304 2168951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2169252 2170493 gene locus_tag LOCUS_20870 2169252 2170493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943367.1 protein_id gnl|my_center|LOCUS_20870 2170512 2171366 gene locus_tag LOCUS_20880 2170512 2171366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2172508 2171606 gene locus_tag LOCUS_20890 2172508 2171606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2172961 2172578 gene locus_tag LOCUS_20900 2172961 2172578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2174098 2173442 gene locus_tag LOCUS_20910 2174098 2173442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2174443 2174192 gene locus_tag LOCUS_20920 2174443 2174192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2176066 2174588 gene locus_tag LOCUS_20930 gene pap 2176066 2174588 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_20930 2176917 2176264 gene locus_tag LOCUS_20940 2176917 2176264 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_20940 2178716 2176992 gene locus_tag LOCUS_20950 2178716 2176992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2178975 2180813 gene locus_tag LOCUS_20960 2178975 2180813 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_20960 2180810 2183065 gene locus_tag LOCUS_20970 2180810 2183065 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_20970 2183224 2184105 gene locus_tag LOCUS_20980 2183224 2184105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2184102 2186333 gene locus_tag LOCUS_20990 2184102 2186333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2186576 2187133 gene locus_tag LOCUS_21000 2186576 2187133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2187160 2187930 gene locus_tag LOCUS_21010 2187160 2187930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2187980 2188567 gene locus_tag LOCUS_21020 2187980 2188567 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788696.1 protein_id gnl|my_center|LOCUS_21020 2188574 2188789 gene locus_tag LOCUS_21030 2188574 2188789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2188792 2189793 gene locus_tag LOCUS_21040 2188792 2189793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2189846 2191285 gene locus_tag LOCUS_21050 2189846 2191285 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_21050 2192077 2191331 gene locus_tag LOCUS_21060 2192077 2191331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970204.1 protein_id gnl|my_center|LOCUS_21060 2193476 2192064 gene locus_tag LOCUS_21070 2193476 2192064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2193846 2195633 gene locus_tag LOCUS_21080 2193846 2195633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2196643 2195630 gene locus_tag LOCUS_21090 2196643 2195630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_21090 2198116 2196725 gene locus_tag LOCUS_21100 2198116 2196725 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_21100 2199625 2198210 gene locus_tag LOCUS_21110 2199625 2198210 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_21110 2200301 2199627 gene locus_tag LOCUS_21120 2200301 2199627 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_21120 2201173 2200367 gene locus_tag LOCUS_21130 2201173 2200367 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_21130 2201345 2202262 gene locus_tag LOCUS_21140 gene prmA 2201345 2202262 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_21140 2202263 2203036 gene locus_tag LOCUS_21150 2202263 2203036 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_21150 2203033 2204391 gene locus_tag LOCUS_21160 2203033 2204391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2205042 2204428 gene locus_tag LOCUS_21170 2205042 2204428 CDS product hydroxyacylglutathione hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933700.1 protein_id gnl|my_center|LOCUS_21170 2205266 2205048 gene locus_tag LOCUS_21180 2205266 2205048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2205331 2206647 gene locus_tag LOCUS_21190 2205331 2206647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2206745 2207128 gene locus_tag LOCUS_21200 2206745 2207128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2207321 2207530 gene locus_tag LOCUS_21210 2207321 2207530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2207739 2209883 gene locus_tag LOCUS_21220 2207739 2209883 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_21220 2209880 2211253 gene locus_tag LOCUS_21230 2209880 2211253 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_21230 2211250 2212953 gene locus_tag LOCUS_21240 2211250 2212953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2213243 2216233 gene locus_tag LOCUS_21250 2213243 2216233 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_21250 2216472 2217131 gene locus_tag LOCUS_21260 2216472 2217131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2217128 2217631 gene locus_tag LOCUS_21270 2217128 2217631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2217628 2218026 gene locus_tag LOCUS_21280 2217628 2218026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2220429 2218117 gene locus_tag LOCUS_21290 2220429 2218117 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546258.1 protein_id gnl|my_center|LOCUS_21290 2222172 2220529 gene locus_tag LOCUS_21300 2222172 2220529 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_21300 2223266 2222160 gene locus_tag LOCUS_21310 2223266 2222160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_21310 2223777 2223702 gene locus_tag LOCUS_t00250 2223777 2223702 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2224901 2223837 gene locus_tag LOCUS_21320 2224901 2223837 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_21320 2225088 2226824 gene locus_tag LOCUS_21330 2225088 2226824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2226886 2228670 gene locus_tag LOCUS_21340 2226886 2228670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2228667 2229113 gene locus_tag LOCUS_21350 2228667 2229113 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_21350 2229388 2229870 gene locus_tag LOCUS_21360 2229388 2229870 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_21360 2229956 2231047 gene locus_tag LOCUS_21370 2229956 2231047 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940810.1 protein_id gnl|my_center|LOCUS_21370 2231181 2233121 gene locus_tag LOCUS_21380 2231181 2233121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2233438 2234112 gene locus_tag LOCUS_21390 2233438 2234112 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 protein_id gnl|my_center|LOCUS_21390 2234109 2235626 gene locus_tag LOCUS_21400 2234109 2235626 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_21400 2235623 2236567 gene locus_tag LOCUS_21410 2235623 2236567 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_21410 2237056 2236589 gene locus_tag LOCUS_21420 2237056 2236589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2239168 2237123 gene locus_tag LOCUS_21430 2239168 2237123 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922337.1 protein_id gnl|my_center|LOCUS_21430 2240407 2239466 gene locus_tag LOCUS_21440 2240407 2239466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807174.1 protein_id gnl|my_center|LOCUS_21440 2241009 2240404 gene locus_tag LOCUS_21450 2241009 2240404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2241232 2241498 gene locus_tag LOCUS_21460 2241232 2241498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2241482 2242234 gene locus_tag LOCUS_21470 2241482 2242234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_21470 2242231 2244591 gene locus_tag LOCUS_21480 2242231 2244591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_21480 2244597 2245808 gene locus_tag LOCUS_21490 2244597 2245808 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_21490 2246251 2246051 gene locus_tag LOCUS_21500 2246251 2246051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2246217 2247143 gene locus_tag LOCUS_21510 2246217 2247143 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_21510 2247444 2248529 gene locus_tag LOCUS_21520 2247444 2248529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2248507 2249517 gene locus_tag LOCUS_21530 2248507 2249517 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603918.1 protein_id gnl|my_center|LOCUS_21530 2249510 2249992 gene locus_tag LOCUS_21540 2249510 2249992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2249998 2251083 gene locus_tag LOCUS_21550 2249998 2251083 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_21550 2251218 2251457 gene locus_tag LOCUS_21560 2251218 2251457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2251458 2251889 gene locus_tag LOCUS_21570 2251458 2251889 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_21570 2252390 2252001 gene locus_tag LOCUS_21580 2252390 2252001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2252643 2252377 gene locus_tag LOCUS_21590 2252643 2252377 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_21590 2253612 2253037 gene locus_tag LOCUS_21600 2253612 2253037 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_21600 2255808 2253904 gene locus_tag LOCUS_21610 2255808 2253904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2256298 2255894 gene locus_tag LOCUS_21620 2256298 2255894 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_21620 2256464 2258992 gene locus_tag LOCUS_21630 2256464 2258992 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_21630 2259048 2260562 gene locus_tag LOCUS_21640 gene rng 2259048 2260562 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_21640 2260666 2260974 gene locus_tag LOCUS_21650 gene rplU 2260666 2260974 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_21650 2260994 2261248 gene locus_tag LOCUS_21660 gene rpmA 2260994 2261248 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_21660 2261375 2262436 gene locus_tag LOCUS_21670 gene obgE 2261375 2262436 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_21670 2262489 2263631 gene locus_tag LOCUS_21680 gene proB 2262489 2263631 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_21680 2263677 2264933 gene locus_tag LOCUS_21690 2263677 2264933 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_21690 2264993 2265649 gene locus_tag LOCUS_21700 gene nadD 2264993 2265649 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_21700 2265653 2266033 gene locus_tag LOCUS_21710 gene rsfS 2265653 2266033 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_21710 2266030 2266506 gene locus_tag LOCUS_21720 2266030 2266506 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_21720 2266537 2266890 gene locus_tag LOCUS_21730 2266537 2266890 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_21730 2267081 2268439 gene locus_tag LOCUS_21740 2267081 2268439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2268442 2269980 gene locus_tag LOCUS_21750 gene gpmI 2268442 2269980 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_21750 2269994 2270764 gene locus_tag LOCUS_21760 2269994 2270764 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_21760 2270791 2271750 gene locus_tag LOCUS_21770 2270791 2271750 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_21770 2271771 2272919 gene locus_tag LOCUS_21780 2271771 2272919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2273095 2274048 gene locus_tag LOCUS_21790 2273095 2274048 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_21790 2276314 2274155 gene locus_tag LOCUS_21800 2276314 2274155 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393788.1 protein_id gnl|my_center|LOCUS_21800 2276933 2276370 gene locus_tag LOCUS_21810 2276933 2276370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2277463 2279064 gene locus_tag LOCUS_21820 2277463 2279064 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 protein_id gnl|my_center|LOCUS_21820 2279228 2280661 gene locus_tag LOCUS_21830 2279228 2280661 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942268.1 protein_id gnl|my_center|LOCUS_21830 2280648 2281952 gene locus_tag LOCUS_21840 2280648 2281952 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_21840 2282397 2283086 gene locus_tag LOCUS_21850 2282397 2283086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2283276 2284868 gene locus_tag LOCUS_21860 2283276 2284868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2285780 2284932 gene locus_tag LOCUS_21870 2285780 2284932 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_21870 2286940 2285810 gene locus_tag LOCUS_21880 2286940 2285810 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_21880 2287132 2287422 gene locus_tag LOCUS_21890 2287132 2287422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2287841 2289598 gene locus_tag LOCUS_21900 gene ettA 2287841 2289598 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_21900 2290570 2289683 gene locus_tag LOCUS_21910 gene htpX 2290570 2289683 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_21910 2291181 2292017 gene locus_tag LOCUS_21920 2291181 2292017 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943683.1 protein_id gnl|my_center|LOCUS_21920 2292014 2293426 gene locus_tag LOCUS_21930 gene gltA 2292014 2293426 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943682.1 protein_id gnl|my_center|LOCUS_21930 2294208 2293558 gene locus_tag LOCUS_21940 2294208 2293558 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_21940 2294447 2294734 gene locus_tag LOCUS_21950 gene gatC 2294447 2294734 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_21950 2294780 2296237 gene locus_tag LOCUS_21960 gene gatA 2294780 2296237 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_21960 2296334 2297785 gene locus_tag LOCUS_21970 gene gatB 2296334 2297785 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_21970 2297789 2298835 gene locus_tag LOCUS_21980 gene mtnA 2297789 2298835 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_21980 2298836 2302024 gene locus_tag LOCUS_21990 gene glnE 2298836 2302024 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_21990 2302087 2303991 gene locus_tag LOCUS_22000 2302087 2303991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2304833 2304039 gene locus_tag LOCUS_22010 2304833 2304039 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942981.1 protein_id gnl|my_center|LOCUS_22010 2305775 2305014 gene locus_tag LOCUS_22020 gene ttcA 2305775 2305014 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_22020 2305961 2306416 gene locus_tag LOCUS_22030 2305961 2306416 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_22030 2308078 2306522 gene locus_tag LOCUS_22040 2308078 2306522 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942718.1 protein_id gnl|my_center|LOCUS_22040 2311518 2308342 gene locus_tag LOCUS_22050 2311518 2308342 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_22050 2312705 2311515 gene locus_tag LOCUS_22060 2312705 2311515 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 protein_id gnl|my_center|LOCUS_22060 2314135 2312702 gene locus_tag LOCUS_22070 2314135 2312702 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_22070 2314767 2314132 gene locus_tag LOCUS_22080 gene psrA 2314767 2314132 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_22080 2314887 2316314 gene locus_tag LOCUS_22090 2314887 2316314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 protein_id gnl|my_center|LOCUS_22090 2316395 2316958 gene locus_tag LOCUS_22100 gene gnfR 2316395 2316958 CDS product nitrogen fixation two-component system response regulator GnfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943448.1 protein_id gnl|my_center|LOCUS_22100 2316969 2317769 gene locus_tag LOCUS_22110 2316969 2317769 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_22110 2317766 2318665 gene locus_tag LOCUS_22120 gene draG 2317766 2318665 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943427.1 protein_id gnl|my_center|LOCUS_22120 2319118 2319510 gene locus_tag LOCUS_22130 gene ndhC 2319118 2319510 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_22130 2319483 2320064 gene locus_tag LOCUS_22140 2319483 2320064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2320069 2320587 gene locus_tag LOCUS_22150 2320069 2320587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2320584 2321696 gene locus_tag LOCUS_22160 gene nuoD 2320584 2321696 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621441.1 protein_id gnl|my_center|LOCUS_22160 2321693 2322685 gene locus_tag LOCUS_22170 gene nuoH 2321693 2322685 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_22170 2322682 2323125 gene locus_tag LOCUS_22180 gene nuoI 2322682 2323125 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886374.1 protein_id gnl|my_center|LOCUS_22180 2323122 2323646 gene locus_tag LOCUS_22190 2323122 2323646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2323643 2323960 gene locus_tag LOCUS_22200 gene nuoK 2323643 2323960 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_22200 2323966 2325474 gene locus_tag LOCUS_22210 2323966 2325474 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_22210 2325471 2325719 gene locus_tag LOCUS_22220 2325471 2325719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2325709 2327472 gene locus_tag LOCUS_22230 2325709 2327472 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_22230 2327589 2329196 gene locus_tag LOCUS_22240 2327589 2329196 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_22240 2329210 2330634 gene locus_tag LOCUS_22250 2329210 2330634 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_22250 2331144 2331503 gene locus_tag LOCUS_22260 2331144 2331503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2331535 2332053 gene locus_tag LOCUS_22270 2331535 2332053 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_22270 2332139 2333518 gene locus_tag LOCUS_22280 2332139 2333518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2333970 2334848 gene locus_tag LOCUS_22290 gene nifH 2333970 2334848 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_22290 2334966 2336435 gene locus_tag LOCUS_22300 gene nifD 2334966 2336435 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943446.1 protein_id gnl|my_center|LOCUS_22300 2336554 2338011 gene locus_tag LOCUS_22310 gene nifK 2336554 2338011 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943445.1 protein_id gnl|my_center|LOCUS_22310 2338147 2338527 gene locus_tag LOCUS_22320 gene nifX 2338147 2338527 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943432.1 protein_id gnl|my_center|LOCUS_22320 2338687 2338956 gene locus_tag LOCUS_22330 gene fdxB 2338687 2338956 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943431.1 protein_id gnl|my_center|LOCUS_22330 2338974 2339351 gene locus_tag LOCUS_22340 2338974 2339351 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943430.1 protein_id gnl|my_center|LOCUS_22340 2339660 2340529 gene locus_tag LOCUS_22350 2339660 2340529 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943426.1 protein_id gnl|my_center|LOCUS_22350 2340755 2341483 gene locus_tag LOCUS_22360 gene modA 2340755 2341483 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943593.1 protein_id gnl|my_center|LOCUS_22360 2341544 2342233 gene locus_tag LOCUS_22370 gene modB 2341544 2342233 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932140.1 protein_id gnl|my_center|LOCUS_22370 2342230 2343276 gene locus_tag LOCUS_22380 gene modC 2342230 2343276 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943591.1 protein_id gnl|my_center|LOCUS_22380 2343300 2343968 gene locus_tag LOCUS_22390 2343300 2343968 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_22390 2344256 2346433 gene locus_tag LOCUS_22400 2344256 2346433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2346501 2346773 gene locus_tag LOCUS_22410 2346501 2346773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2346894 2347232 gene locus_tag LOCUS_22420 2346894 2347232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2347299 2348951 gene locus_tag LOCUS_22430 2347299 2348951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2349455 2351986 gene locus_tag LOCUS_22440 2349455 2351986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2352151 2354466 gene locus_tag LOCUS_22450 2352151 2354466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2354705 2355859 gene locus_tag LOCUS_22460 gene nifV 2354705 2355859 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_22460 2358417 2355880 gene locus_tag LOCUS_22470 2358417 2355880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2358697 2358621 gene locus_tag LOCUS_t00260 2358697 2358621 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2358861 2359943 gene locus_tag LOCUS_22480 gene mnmH 2358861 2359943 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941848.1 protein_id gnl|my_center|LOCUS_22480 2360184 2361488 gene locus_tag LOCUS_22490 2360184 2361488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2361782 2364136 gene locus_tag LOCUS_22500 2361782 2364136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2364167 2364499 gene locus_tag LOCUS_22510 2364167 2364499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2366109 2364577 gene locus_tag LOCUS_22520 2366109 2364577 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941180.1 protein_id gnl|my_center|LOCUS_22520 2366494 2366294 gene locus_tag LOCUS_22530 2366494 2366294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2367587 2366718 gene locus_tag LOCUS_22540 2367587 2366718 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_22540 2368837 2367719 gene locus_tag LOCUS_22550 2368837 2367719 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_22550 2369676 2368837 gene locus_tag LOCUS_22560 2369676 2368837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2369893 2371401 gene locus_tag LOCUS_22570 2369893 2371401 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_22570 2371493 2371675 gene locus_tag LOCUS_22580 2371493 2371675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2371867 2372067 gene locus_tag LOCUS_22590 2371867 2372067 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_22590 2372292 2373899 gene locus_tag LOCUS_22600 gene serA 2372292 2373899 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_22600 2373994 2375289 gene locus_tag LOCUS_22610 2373994 2375289 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_22610 2375311 2376606 gene locus_tag LOCUS_22620 2375311 2376606 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_22620 2376718 2376793 gene locus_tag LOCUS_t00270 2376718 2376793 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2376798 2376875 gene locus_tag LOCUS_t00280 2376798 2376875 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2376947 2377414 gene locus_tag LOCUS_22630 gene rnhA 2376947 2377414 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942713.1 protein_id gnl|my_center|LOCUS_22630 2377516 2377962 gene locus_tag LOCUS_22640 2377516 2377962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2377959 2380346 gene locus_tag LOCUS_22650 2377959 2380346 CDS product NADH-quinone oxidoreductase subunit B/C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944054.1 protein_id gnl|my_center|LOCUS_22650 2380482 2380970 gene locus_tag LOCUS_22660 gene nuoE 2380482 2380970 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_22660 2380979 2382301 gene locus_tag LOCUS_22670 gene nuoF 2380979 2382301 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944051.1 protein_id gnl|my_center|LOCUS_22670 2382364 2384781 gene locus_tag LOCUS_22680 gene nuoG 2382364 2384781 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944049.1 protein_id gnl|my_center|LOCUS_22680 2384774 2385769 gene locus_tag LOCUS_22690 gene nuoH 2384774 2385769 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_22690 2385850 2386380 gene locus_tag LOCUS_22700 gene nuoI 2385850 2386380 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944044.1 protein_id gnl|my_center|LOCUS_22700 2386445 2386963 gene locus_tag LOCUS_22710 2386445 2386963 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944043.1 protein_id gnl|my_center|LOCUS_22710 2386960 2387265 gene locus_tag LOCUS_22720 gene nuoK 2386960 2387265 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944042.1 protein_id gnl|my_center|LOCUS_22720 2387268 2389130 gene locus_tag LOCUS_22730 gene nuoL 2387268 2389130 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944041.1 protein_id gnl|my_center|LOCUS_22730 2389138 2390643 gene locus_tag LOCUS_22740 2389138 2390643 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944040.1 protein_id gnl|my_center|LOCUS_22740 2390640 2392055 gene locus_tag LOCUS_22750 2390640 2392055 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944039.1 protein_id gnl|my_center|LOCUS_22750 2392169 2392624 gene locus_tag LOCUS_22760 2392169 2392624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2392681 2394027 gene locus_tag LOCUS_22770 2392681 2394027 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689268.1 protein_id gnl|my_center|LOCUS_22770 2394027 2395187 gene locus_tag LOCUS_22780 2394027 2395187 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337389.1 protein_id gnl|my_center|LOCUS_22780 2395174 2395953 gene locus_tag LOCUS_22790 2395174 2395953 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208715.1 protein_id gnl|my_center|LOCUS_22790 2395946 2396563 gene locus_tag LOCUS_22800 2395946 2396563 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_22800 2396567 2397178 gene locus_tag LOCUS_22810 gene nqrE 2396567 2397178 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_22810 2397343 2398569 gene locus_tag LOCUS_22820 gene nqrF 2397343 2398569 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418137.1 protein_id gnl|my_center|LOCUS_22820 2398573 2398770 gene locus_tag LOCUS_22830 2398573 2398770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2398911 2400104 gene locus_tag LOCUS_22840 2398911 2400104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2400237 2400779 gene locus_tag LOCUS_22850 2400237 2400779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2401641 2400796 gene locus_tag LOCUS_22860 2401641 2400796 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940908.1 protein_id gnl|my_center|LOCUS_22860 2401838 2402608 gene locus_tag LOCUS_22870 2401838 2402608 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_22870 2402902 2403618 gene locus_tag LOCUS_22880 2402902 2403618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2403618 2405069 gene locus_tag LOCUS_22890 2403618 2405069 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706263.1 protein_id gnl|my_center|LOCUS_22890 2405127 2406047 gene locus_tag LOCUS_22900 2405127 2406047 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_22900 2406457 2408496 gene locus_tag LOCUS_22910 2406457 2408496 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_22910 2408608 2408796 gene locus_tag LOCUS_22920 2408608 2408796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2408927 2409271 gene locus_tag LOCUS_22930 2408927 2409271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2411120 2409360 gene locus_tag LOCUS_22940 2411120 2409360 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971954.1 protein_id gnl|my_center|LOCUS_22940 2411326 2411117 gene locus_tag LOCUS_22950 2411326 2411117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2413251 2411584 gene locus_tag LOCUS_22960 2413251 2411584 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_22960 2414941 2413268 gene locus_tag LOCUS_22970 2414941 2413268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2415282 2416691 gene locus_tag LOCUS_22980 2415282 2416691 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933704.1 protein_id gnl|my_center|LOCUS_22980 2416675 2417832 gene locus_tag LOCUS_22990 2416675 2417832 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_22990 2417909 2420269 gene locus_tag LOCUS_23000 2417909 2420269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23000 2420227 2421090 gene locus_tag LOCUS_23010 2420227 2421090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23010 2421592 2421185 gene locus_tag LOCUS_23020 2421592 2421185 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_23020 2422476 2421682 gene locus_tag LOCUS_23030 2422476 2421682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_23030 2423411 2422473 gene locus_tag LOCUS_23040 2423411 2422473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_23040 2425918 2423411 gene locus_tag LOCUS_23050 2425918 2423411 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_23050 2427229 2426012 gene locus_tag LOCUS_23060 gene rpsA 2427229 2426012 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_23060 2428449 2427364 gene locus_tag LOCUS_23070 2428449 2427364 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_23070 2428604 2429707 gene locus_tag LOCUS_23080 gene ald 2428604 2429707 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_23080 2430954 2430091 gene locus_tag LOCUS_23090 gene nudC 2430954 2430091 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941705.1 protein_id gnl|my_center|LOCUS_23090 2431479 2430958 gene locus_tag LOCUS_23100 2431479 2430958 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460247.1 protein_id gnl|my_center|LOCUS_23100 2432661 2431828 gene locus_tag LOCUS_23110 2432661 2431828 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_23110 2433065 2432796 gene locus_tag LOCUS_23120 2433065 2432796 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876114.1 protein_id gnl|my_center|LOCUS_23120 2433556 2434797 gene locus_tag LOCUS_23130 2433556 2434797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943367.1 protein_id gnl|my_center|LOCUS_23130 2434816 2435661 gene locus_tag LOCUS_23140 2434816 2435661 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943366.1 protein_id gnl|my_center|LOCUS_23140 2435700 2438204 gene locus_tag LOCUS_23150 gene omcC 2435700 2438204 CDS product C-type polyheme cytochrome OmcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943365.1 protein_id gnl|my_center|LOCUS_23150 2438704 2438303 gene locus_tag LOCUS_23160 2438704 2438303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2438952 2438701 gene locus_tag LOCUS_23170 2438952 2438701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2439341 2439129 gene locus_tag LOCUS_23180 2439341 2439129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2439228 2440088 gene locus_tag LOCUS_23190 2439228 2440088 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_23190 2440545 2440114 gene locus_tag LOCUS_23200 2440545 2440114 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_23200 2440786 2440550 gene locus_tag LOCUS_23210 2440786 2440550 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_23210 2444039 2440938 gene locus_tag LOCUS_23220 2444039 2440938 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_23220 2445184 2444078 gene locus_tag LOCUS_23230 2445184 2444078 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957813.1 protein_id gnl|my_center|LOCUS_23230 2446739 2445171 gene locus_tag LOCUS_23240 2446739 2445171 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_23240 2447356 2446757 gene locus_tag LOCUS_23250 2447356 2446757 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939852.1 protein_id gnl|my_center|LOCUS_23250 2448139 2447504 gene locus_tag LOCUS_23260 2448139 2447504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23260 2449424 2448090 gene locus_tag LOCUS_23270 2449424 2448090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23270 2450318 2449494 gene locus_tag LOCUS_23280 2450318 2449494 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_23280 2450710 2451519 gene locus_tag LOCUS_23290 gene proC 2450710 2451519 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_23290 2453846 2451582 gene locus_tag LOCUS_23300 2453846 2451582 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_23300 2454624 2454019 gene locus_tag LOCUS_23310 2454624 2454019 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_23310 2454950 2462761 gene locus_tag LOCUS_23320 2454950 2462761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2465843 2463309 gene locus_tag LOCUS_23330 2465843 2463309 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_23330 2466483 2465998 gene locus_tag LOCUS_23340 2466483 2465998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2467978 2466650 gene locus_tag LOCUS_23350 2467978 2466650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2469465 2467984 gene locus_tag LOCUS_23360 2469465 2467984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2470416 2469517 gene locus_tag LOCUS_23370 2470416 2469517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2471156 2470416 gene locus_tag LOCUS_23380 2471156 2470416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2472410 2471385 gene locus_tag LOCUS_23390 2472410 2471385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2472775 2474238 gene locus_tag LOCUS_23400 2472775 2474238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2474430 2476859 gene locus_tag LOCUS_23410 2474430 2476859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_23410 2476934 2477980 gene locus_tag LOCUS_23420 2476934 2477980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2477977 2478789 gene locus_tag LOCUS_23430 2477977 2478789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2478686 2479168 gene locus_tag LOCUS_23440 2478686 2479168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2479168 2480253 gene locus_tag LOCUS_23450 2479168 2480253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2480276 2481613 gene locus_tag LOCUS_23460 2480276 2481613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2481610 2482659 gene locus_tag LOCUS_23470 2481610 2482659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2482656 2483576 gene locus_tag LOCUS_23480 2482656 2483576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2484007 2487090 gene locus_tag LOCUS_23490 2484007 2487090 CDS product CxxxxCH/CxxCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044907.1 protein_id gnl|my_center|LOCUS_23490 2487092 2488720 gene locus_tag LOCUS_23500 2487092 2488720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2488668 2492126 gene locus_tag LOCUS_23510 2488668 2492126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2492410 2493969 gene locus_tag LOCUS_23520 2492410 2493969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23520 2493966 2500568 gene locus_tag LOCUS_23530 2493966 2500568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23530 2501320 2500637 gene locus_tag LOCUS_23540 2501320 2500637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2501417 2502619 gene locus_tag LOCUS_23550 2501417 2502619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2502774 2504129 gene locus_tag LOCUS_23560 gene mgtE 2502774 2504129 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_23560 2504701 2504222 gene locus_tag LOCUS_23570 2504701 2504222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2505028 2505798 gene locus_tag LOCUS_23580 gene recO 2505028 2505798 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_23580 2505917 2506789 gene locus_tag LOCUS_23590 gene glyQ 2505917 2506789 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_23590 2506858 2508924 gene locus_tag LOCUS_23600 gene glyS 2506858 2508924 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_23600 2508999 2511662 gene locus_tag LOCUS_23610 gene ppdK 2508999 2511662 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_23610 2511835 2512269 gene locus_tag LOCUS_23620 2511835 2512269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943969.1 protein_id gnl|my_center|LOCUS_23620 2512305 2513003 gene locus_tag LOCUS_23630 gene nfi 2512305 2513003 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_23630 2513714 2513058 gene locus_tag LOCUS_23640 2513714 2513058 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_23640 2513941 2515149 gene locus_tag LOCUS_23650 2513941 2515149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2517177 2515171 gene locus_tag LOCUS_23660 2517177 2515171 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_23660 2519198 2517174 gene locus_tag LOCUS_23670 2519198 2517174 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044858.1 protein_id gnl|my_center|LOCUS_23670 2519836 2519195 gene locus_tag LOCUS_23680 2519836 2519195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2521872 2519824 gene locus_tag LOCUS_23690 2521872 2519824 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_23690 2522242 2523222 gene locus_tag LOCUS_23700 2522242 2523222 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_23700 2523643 2523957 gene locus_tag LOCUS_23710 2523643 2523957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2525253 2524009 gene locus_tag LOCUS_23720 2525253 2524009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2526103 2525477 gene locus_tag LOCUS_23730 2526103 2525477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23730 2528646 2526082 gene locus_tag LOCUS_23740 2528646 2526082 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23740 2529731 2528643 gene locus_tag LOCUS_23750 2529731 2528643 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_23750 2529678 2529932 gene locus_tag LOCUS_23760 2529678 2529932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2531188 2529881 gene locus_tag LOCUS_23770 gene thiC 2531188 2529881 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_23770 2532821 2531409 gene locus_tag LOCUS_23780 gene thiD 2532821 2531409 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941267.1 protein_id gnl|my_center|LOCUS_23780 2533122 2532934 gene locus_tag LOCUS_23790 2533122 2532934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2533282 2534403 gene locus_tag LOCUS_23800 gene alr 2533282 2534403 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_23800 2534530 2535762 gene locus_tag LOCUS_23810 2534530 2535762 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_23810 2535829 2537394 gene locus_tag LOCUS_23820 gene purH 2535829 2537394 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_23820 2537495 2538772 gene locus_tag LOCUS_23830 gene purD 2537495 2538772 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_23830 2538944 2539267 gene locus_tag LOCUS_23840 2538944 2539267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2539947 2539615 gene locus_tag LOCUS_23850 2539947 2539615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2539966 2541186 gene locus_tag LOCUS_23860 2539966 2541186 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_23860 2541233 2542303 gene locus_tag LOCUS_23870 2541233 2542303 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_23870 2542530 2543537 gene locus_tag LOCUS_23880 2542530 2543537 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941278.1 protein_id gnl|my_center|LOCUS_23880 2543580 2544677 gene locus_tag LOCUS_23890 2543580 2544677 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_23890 2544908 2545615 gene locus_tag LOCUS_23900 2544908 2545615 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_23900 2545909 2548170 gene locus_tag LOCUS_23910 2545909 2548170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161598787.1 protein_id gnl|my_center|LOCUS_23910 2548293 2549048 gene locus_tag LOCUS_23920 2548293 2549048 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_23920 2549545 2549015 gene locus_tag LOCUS_23930 2549545 2549015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2549802 2549542 gene locus_tag LOCUS_23940 2549802 2549542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941301.1 protein_id gnl|my_center|LOCUS_23940 2549999 2550250 gene locus_tag LOCUS_23950 2549999 2550250 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941302.1 protein_id gnl|my_center|LOCUS_23950 2550371 2551720 gene locus_tag LOCUS_23960 gene ffh 2550371 2551720 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_23960 2551809 2552072 gene locus_tag LOCUS_23970 gene rpsP 2551809 2552072 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_23970 2552134 2552367 gene locus_tag LOCUS_23980 2552134 2552367 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_23980 2552367 2552915 gene locus_tag LOCUS_23990 gene rimM 2552367 2552915 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_23990 2552927 2553664 gene locus_tag LOCUS_24000 gene trmD 2552927 2553664 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_24000 2553763 2554110 gene locus_tag LOCUS_24010 gene rplS 2553763 2554110 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941309.1 protein_id gnl|my_center|LOCUS_24010 2554423 2554241 gene locus_tag LOCUS_24020 2554423 2554241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2554579 2555223 gene locus_tag LOCUS_24030 2554579 2555223 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_24030 2555220 2555582 gene locus_tag LOCUS_24040 2555220 2555582 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_24040 2555607 2557577 gene locus_tag LOCUS_24050 2555607 2557577 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_24050 2557588 2558427 gene locus_tag LOCUS_24060 gene rsmI 2557588 2558427 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_24060 2558745 2558467 gene locus_tag LOCUS_24070 2558745 2558467 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_24070 2560763 2558742 gene locus_tag LOCUS_24080 gene ligA 2560763 2558742 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_24080 2560913 2562172 gene locus_tag LOCUS_24090 2560913 2562172 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_24090 2562370 2562813 gene locus_tag LOCUS_24100 gene mraZ 2562370 2562813 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 protein_id gnl|my_center|LOCUS_24100 2562817 2563770 gene locus_tag LOCUS_24110 gene rsmH 2562817 2563770 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_24110 2563792 2564112 gene locus_tag LOCUS_24120 2563792 2564112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2564141 2566126 gene locus_tag LOCUS_24130 2564141 2566126 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_24130 2566159 2567679 gene locus_tag LOCUS_24140 2566159 2567679 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_24140 2567679 2569073 gene locus_tag LOCUS_24150 2567679 2569073 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_24150 2569082 2570158 gene locus_tag LOCUS_24160 gene mraY 2569082 2570158 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_24160 2570164 2571528 gene locus_tag LOCUS_24170 gene murD 2570164 2571528 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_24170 2571531 2572637 gene locus_tag LOCUS_24180 gene ftsW 2571531 2572637 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_24180 2572634 2573716 gene locus_tag LOCUS_24190 gene murG 2572634 2573716 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_24190 2573791 2575191 gene locus_tag LOCUS_24200 gene murC 2573791 2575191 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_24200 2575246 2576175 gene locus_tag LOCUS_24210 2575246 2576175 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_24210 2576217 2577059 gene locus_tag LOCUS_24220 2576217 2577059 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943690.1 protein_id gnl|my_center|LOCUS_24220 2577085 2578314 gene locus_tag LOCUS_24230 gene ftsA 2577085 2578314 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_24230 2578381 2579544 gene locus_tag LOCUS_24240 gene ftsZ 2578381 2579544 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_24240 2579930 2581573 gene locus_tag LOCUS_24250 2579930 2581573 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_24250 2581657 2581977 gene locus_tag LOCUS_24260 gene sugE 2581657 2581977 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_24260 2582080 2582598 gene locus_tag LOCUS_24270 gene tpx 2582080 2582598 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_24270 2582942 2582748 gene locus_tag LOCUS_24280 2582942 2582748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2583102 2584163 gene locus_tag LOCUS_24290 2583102 2584163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943970.1 protein_id gnl|my_center|LOCUS_24290 2584279 2585463 gene locus_tag LOCUS_24300 2584279 2585463 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941022.1 protein_id gnl|my_center|LOCUS_24300 2585577 2585990 gene locus_tag LOCUS_24310 2585577 2585990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941023.1 protein_id gnl|my_center|LOCUS_24310 2586002 2586373 gene locus_tag LOCUS_24320 2586002 2586373 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317410.1 protein_id gnl|my_center|LOCUS_24320 2586432 2586860 gene locus_tag LOCUS_24330 2586432 2586860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2586895 2588142 gene locus_tag LOCUS_24340 2586895 2588142 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_24340 2588168 2588746 gene locus_tag LOCUS_24350 2588168 2588746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2589860 2588763 gene locus_tag LOCUS_24360 2589860 2588763 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_24360 2589987 2590436 gene locus_tag LOCUS_24370 2589987 2590436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2592644 2590497 gene locus_tag LOCUS_24380 2592644 2590497 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_24380 2593075 2594112 gene locus_tag LOCUS_24390 2593075 2594112 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368234.1 protein_id gnl|my_center|LOCUS_24390 2594455 2594225 gene locus_tag LOCUS_24400 2594455 2594225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2594748 2594521 gene locus_tag LOCUS_24410 2594748 2594521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2595170 2595045 gene locus_tag LOCUS_24420 2595170 2595045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2595716 2595483 gene locus_tag LOCUS_24430 2595716 2595483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2595980 2595753 gene locus_tag LOCUS_24440 2595980 2595753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2596484 2596750 gene locus_tag LOCUS_24450 2596484 2596750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2597514 2597215 gene locus_tag LOCUS_24460 2597514 2597215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2597856 2597545 gene locus_tag LOCUS_24470 2597856 2597545 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_24470 2598107 2597853 gene locus_tag LOCUS_24480 2598107 2597853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2598335 2598577 gene locus_tag LOCUS_24490 2598335 2598577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2598574 2598963 gene locus_tag LOCUS_24500 2598574 2598963 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_24500 2599676 2599140 gene locus_tag LOCUS_24510 2599676 2599140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2600212 2599679 gene locus_tag LOCUS_24520 2600212 2599679 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_24520 2600503 2600979 gene locus_tag LOCUS_24530 2600503 2600979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2601809 2601045 gene locus_tag LOCUS_24540 2601809 2601045 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_24540 2603186 2602194 gene locus_tag LOCUS_24550 gene murB 2603186 2602194 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013593.1 protein_id gnl|my_center|LOCUS_24550 2603657 2603367 gene locus_tag LOCUS_24560 2603657 2603367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2603538 2606243 gene locus_tag LOCUS_24570 gene pgaA 2603538 2606243 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 protein_id gnl|my_center|LOCUS_24570 2606247 2608181 gene locus_tag LOCUS_24580 gene pgaB 2606247 2608181 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 protein_id gnl|my_center|LOCUS_24580 2608181 2609467 gene locus_tag LOCUS_24590 gene pgaC 2608181 2609467 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 protein_id gnl|my_center|LOCUS_24590 2609464 2609898 gene locus_tag LOCUS_24600 2609464 2609898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2610696 2610046 gene locus_tag LOCUS_24610 2610696 2610046 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_24610 2611877 2610849 gene locus_tag LOCUS_24620 2611877 2610849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2613262 2611874 gene locus_tag LOCUS_24630 gene gltD 2613262 2611874 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081679.1 protein_id gnl|my_center|LOCUS_24630 2617697 2613276 gene locus_tag LOCUS_24640 gene gltB 2617697 2613276 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240188.1 protein_id gnl|my_center|LOCUS_24640 2619314 2617800 gene locus_tag LOCUS_24650 gene malQ 2619314 2617800 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_24650 2619576 2619403 gene locus_tag LOCUS_24660 2619576 2619403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2620118 2619573 gene locus_tag LOCUS_24670 2620118 2619573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2620376 2622148 gene locus_tag LOCUS_24680 2620376 2622148 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_24680 2622203 2623942 gene locus_tag LOCUS_24690 gene ngg 2622203 2623942 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111433.1 protein_id gnl|my_center|LOCUS_24690 2624046 2625167 gene locus_tag LOCUS_24700 2624046 2625167 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975326.1 protein_id gnl|my_center|LOCUS_24700 2625269 2626129 gene locus_tag LOCUS_24710 2625269 2626129 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791673.1 protein_id gnl|my_center|LOCUS_24710 2626444 2628009 gene locus_tag LOCUS_24720 2626444 2628009 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_24720 2630281 2628149 gene locus_tag LOCUS_24730 2630281 2628149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2630390 2631850 gene locus_tag LOCUS_24740 gene asnS 2630390 2631850 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 protein_id gnl|my_center|LOCUS_24740 2632440 2631916 gene locus_tag LOCUS_24750 2632440 2631916 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_24750 2633274 2632645 gene locus_tag LOCUS_24760 2633274 2632645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2635320 2633374 gene locus_tag LOCUS_24770 2635320 2633374 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_24770 2635602 2635336 gene locus_tag LOCUS_24780 2635602 2635336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2636476 2636655 gene locus_tag LOCUS_24790 2636476 2636655 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941208.1 protein_id gnl|my_center|LOCUS_24790 2636844 2636665 gene locus_tag LOCUS_24800 2636844 2636665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2637915 2636950 gene locus_tag LOCUS_24810 gene trpS 2637915 2636950 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_24810 2638198 2637971 gene locus_tag LOCUS_24820 2638198 2637971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2640799 2638325 gene locus_tag LOCUS_24830 gene lon 2640799 2638325 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882677.1 protein_id gnl|my_center|LOCUS_24830 2642206 2640947 gene locus_tag LOCUS_24840 2642206 2640947 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943308.1 protein_id gnl|my_center|LOCUS_24840 2642906 2642451 gene locus_tag LOCUS_24850 2642906 2642451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2643180 2650085 gene locus_tag LOCUS_24860 2643180 2650085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2650121 2650384 gene locus_tag LOCUS_24870 2650121 2650384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2650459 2651472 gene locus_tag LOCUS_24880 2650459 2651472 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314081.1 protein_id gnl|my_center|LOCUS_24880 2651563 2652027 gene locus_tag LOCUS_24890 2651563 2652027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2652036 2652587 gene locus_tag LOCUS_24900 2652036 2652587 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_24900 2652719 2655391 gene locus_tag LOCUS_24910 gene polA 2652719 2655391 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_24910 2655397 2656653 gene locus_tag LOCUS_24920 gene zraS 2655397 2656653 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704019.1 protein_id gnl|my_center|LOCUS_24920 2656821 2658128 gene locus_tag LOCUS_24930 2656821 2658128 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_24930 2658587 2658195 gene locus_tag LOCUS_24940 2658587 2658195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2658865 2661972 gene locus_tag LOCUS_24950 2658865 2661972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2662035 2662613 gene locus_tag LOCUS_24960 2662035 2662613 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_24960 2663402 2662626 gene locus_tag LOCUS_24970 2663402 2662626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2663732 2664526 gene locus_tag LOCUS_24980 2663732 2664526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2664629 2664844 gene locus_tag LOCUS_24990 2664629 2664844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943297.1 protein_id gnl|my_center|LOCUS_24990 2664867 2665322 gene locus_tag LOCUS_25000 2664867 2665322 CDS product iron-sulfur cluster-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943298.1 protein_id gnl|my_center|LOCUS_25000 2665326 2665886 gene locus_tag LOCUS_25010 2665326 2665886 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_25010 2667047 2665926 gene locus_tag LOCUS_25020 2667047 2665926 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_25020 2668241 2667069 gene locus_tag LOCUS_25030 2668241 2667069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2668478 2670418 gene locus_tag LOCUS_25040 2668478 2670418 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_25040 2671009 2670485 gene locus_tag LOCUS_25050 2671009 2670485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2671431 2671006 gene locus_tag LOCUS_25060 2671431 2671006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_25060 2672260 2671451 gene locus_tag LOCUS_25070 gene larE 2672260 2671451 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_25070 2673257 2672337 gene locus_tag LOCUS_25080 gene cysK 2673257 2672337 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_25080 2673754 2673284 gene locus_tag LOCUS_25090 2673754 2673284 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_25090 2673902 2674444 gene locus_tag LOCUS_25100 2673902 2674444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2675231 2674479 gene locus_tag LOCUS_25110 2675231 2674479 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943939.1 protein_id gnl|my_center|LOCUS_25110 2675608 2677623 gene locus_tag LOCUS_25120 2675608 2677623 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196531.1 protein_id gnl|my_center|LOCUS_25120 2677884 2678810 gene locus_tag LOCUS_25130 2677884 2678810 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_25130 2678810 2679742 gene locus_tag LOCUS_25140 2678810 2679742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2680909 2679779 gene locus_tag LOCUS_25150 2680909 2679779 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_25150 2681075 2680899 gene locus_tag LOCUS_25160 2681075 2680899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2681165 2681494 gene locus_tag LOCUS_25170 2681165 2681494 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_25170 2681984 2681556 gene locus_tag LOCUS_25180 2681984 2681556 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_25180 2682767 2682108 gene locus_tag LOCUS_25190 2682767 2682108 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_25190 2683013 2686213 gene locus_tag LOCUS_25200 gene carB 2683013 2686213 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_25200 2686468 2686274 gene locus_tag LOCUS_25210 2686468 2686274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2686735 2688093 gene locus_tag LOCUS_25220 2686735 2688093 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_25220 2688136 2689803 gene locus_tag LOCUS_25230 2688136 2689803 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_25230 2690982 2689882 gene locus_tag LOCUS_25240 gene asd 2690982 2689882 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943507.1 protein_id gnl|my_center|LOCUS_25240 2692092 2691145 gene locus_tag LOCUS_25250 2692092 2691145 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556010.1 protein_id gnl|my_center|LOCUS_25250 2692175 2692327 gene locus_tag LOCUS_25260 2692175 2692327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2692332 2694011 gene locus_tag LOCUS_25270 2692332 2694011 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_25270 2694172 2695182 gene locus_tag LOCUS_25280 2694172 2695182 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_25280 2695211 2696896 gene locus_tag LOCUS_25290 2695211 2696896 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103094.1 protein_id gnl|my_center|LOCUS_25290 2696923 2697972 gene locus_tag LOCUS_25300 2696923 2697972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390643.1 protein_id gnl|my_center|LOCUS_25300 2698397 2697969 gene locus_tag LOCUS_25310 2698397 2697969 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941887.1 protein_id gnl|my_center|LOCUS_25310 2698636 2699976 gene locus_tag LOCUS_25320 2698636 2699976 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_25320 2701222 2700062 gene locus_tag LOCUS_25330 gene nspC 2701222 2700062 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937726.1 protein_id gnl|my_center|LOCUS_25330 2702518 2701325 gene locus_tag LOCUS_25340 2702518 2701325 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_25340 2702903 2702703 gene locus_tag LOCUS_25350 2702903 2702703 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_25350 2704122 2703139 gene locus_tag LOCUS_25360 2704122 2703139 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_25360 2705248 2704253 gene locus_tag LOCUS_25370 2705248 2704253 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_25370 2705960 2705274 gene locus_tag LOCUS_25380 gene ybgF 2705960 2705274 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_25380 2706168 2707373 gene locus_tag LOCUS_25390 2706168 2707373 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_25390 2708286 2707621 gene locus_tag LOCUS_25400 2708286 2707621 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_25400 2708936 2708343 gene locus_tag LOCUS_25410 2708936 2708343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940753.1 protein_id gnl|my_center|LOCUS_25410 2710010 2709024 gene locus_tag LOCUS_25420 2710010 2709024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2710756 2710214 gene locus_tag LOCUS_25430 2710756 2710214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2711494 2710787 gene locus_tag LOCUS_25440 2711494 2710787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2713283 2711583 gene locus_tag LOCUS_25450 2713283 2711583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 2715481 2714012 gene locus_tag LOCUS_25460 2715481 2714012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2717031 2715628 gene locus_tag LOCUS_25470 2717031 2715628 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_25470 2717786 2717211 gene locus_tag LOCUS_25480 2717786 2717211 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_25480 2718364 2717900 gene locus_tag LOCUS_25490 2718364 2717900 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_25490 2719072 2718554 gene locus_tag LOCUS_25500 2719072 2718554 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_25500 2719628 2719233 gene locus_tag LOCUS_25510 2719628 2719233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2720412 2719825 gene locus_tag LOCUS_25520 2720412 2719825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2720777 2722627 gene locus_tag LOCUS_25530 gene uvrC 2720777 2722627 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_25530 2723520 2722705 gene locus_tag LOCUS_25540 2723520 2722705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_25540 2724001 2723807 gene locus_tag LOCUS_25550 2724001 2723807 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_25550 2724572 2724039 gene locus_tag LOCUS_25560 2724572 2724039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2725155 2724892 gene locus_tag LOCUS_25570 2725155 2724892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2725186 2725743 gene locus_tag LOCUS_25580 2725186 2725743 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942328.1 protein_id gnl|my_center|LOCUS_25580 2726523 2725753 gene locus_tag LOCUS_25590 2726523 2725753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2726678 2727793 gene locus_tag LOCUS_25600 2726678 2727793 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140528.1 protein_id gnl|my_center|LOCUS_25600 2727817 2728272 gene locus_tag LOCUS_25610 2727817 2728272 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940871.1 protein_id gnl|my_center|LOCUS_25610 2728438 2729808 gene locus_tag LOCUS_25620 2728438 2729808 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072761.1 protein_id gnl|my_center|LOCUS_25620 2731533 2729914 gene locus_tag LOCUS_25630 2731533 2729914 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364240.1 protein_id gnl|my_center|LOCUS_25630 2732721 2731708 gene locus_tag LOCUS_25640 2732721 2731708 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_25640 2732753 2733160 gene locus_tag LOCUS_25650 2732753 2733160 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762404.1 protein_id gnl|my_center|LOCUS_25650 2733480 2733301 gene locus_tag LOCUS_25660 2733480 2733301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2734088 2733507 gene locus_tag LOCUS_25670 2734088 2733507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2734418 2734215 gene locus_tag LOCUS_25680 2734418 2734215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2734699 2735499 gene locus_tag LOCUS_25690 gene zupT 2734699 2735499 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262376.1 protein_id gnl|my_center|LOCUS_25690 2735521 2735949 gene locus_tag LOCUS_25700 gene cdd 2735521 2735949 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_25700 2735942 2736742 gene locus_tag LOCUS_25710 gene udp 2735942 2736742 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705364.1 protein_id gnl|my_center|LOCUS_25710 2737308 2736886 gene locus_tag LOCUS_25720 2737308 2736886 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_25720 2737541 2737305 gene locus_tag LOCUS_25730 2737541 2737305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2738138 2737701 gene locus_tag LOCUS_25740 2738138 2737701 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943011.1 protein_id gnl|my_center|LOCUS_25740 2738459 2738175 gene locus_tag LOCUS_25750 2738459 2738175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2738712 2738542 gene locus_tag LOCUS_25760 2738712 2738542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2739225 2738983 gene locus_tag LOCUS_25770 2739225 2738983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2740013 2739435 gene locus_tag LOCUS_25780 2740013 2739435 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_25780 2741227 2740007 gene locus_tag LOCUS_25790 2741227 2740007 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460346.1 protein_id gnl|my_center|LOCUS_25790 2742105 2741224 gene locus_tag LOCUS_25800 2742105 2741224 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_25800 2742963 2742238 gene locus_tag LOCUS_25810 2742963 2742238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2743226 2742960 gene locus_tag LOCUS_25820 2743226 2742960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2745064 2743220 gene locus_tag LOCUS_25830 2745064 2743220 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937349.1 protein_id gnl|my_center|LOCUS_25830 2745460 2745957 gene locus_tag LOCUS_25840 2745460 2745957 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_25840 2746155 2746847 gene locus_tag LOCUS_25850 gene sfsA 2746155 2746847 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_25850 2747716 2746901 gene locus_tag LOCUS_25860 2747716 2746901 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870484.1 protein_id gnl|my_center|LOCUS_25860 2748131 2747730 gene locus_tag LOCUS_25870 2748131 2747730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2748291 2748479 gene locus_tag LOCUS_25880 2748291 2748479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2748501 2749775 gene locus_tag LOCUS_25890 2748501 2749775 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_25890 2751462 2749975 gene locus_tag LOCUS_25900 2751462 2749975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2751703 2752017 gene locus_tag LOCUS_25910 gene clpS 2751703 2752017 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_25910 2752048 2754276 gene locus_tag LOCUS_25920 gene clpA 2752048 2754276 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_25920 2754401 2755084 gene locus_tag LOCUS_25930 gene aat 2754401 2755084 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_25930 2756270 2755107 gene locus_tag LOCUS_25940 gene rdgC 2756270 2755107 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940809.1 protein_id gnl|my_center|LOCUS_25940 2756821 2756354 gene locus_tag LOCUS_25950 2756821 2756354 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_25950 2757608 2756850 gene locus_tag LOCUS_25960 2757608 2756850 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943383.1 protein_id gnl|my_center|LOCUS_25960 2758526 2757792 gene locus_tag LOCUS_25970 2758526 2757792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2759286 2758738 gene locus_tag LOCUS_25980 2759286 2758738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2760243 2759320 gene locus_tag LOCUS_25990 2760243 2759320 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_25990 2760358 2761482 gene locus_tag LOCUS_26000 2760358 2761482 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_26000 2761595 2761795 gene locus_tag LOCUS_26010 gene rpsU 2761595 2761795 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066968.1 protein_id gnl|my_center|LOCUS_26010 2763320 2761875 gene locus_tag LOCUS_26020 2763320 2761875 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 protein_id gnl|my_center|LOCUS_26020 2763872 2763396 gene locus_tag LOCUS_26030 2763872 2763396 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944057.1 protein_id gnl|my_center|LOCUS_26030 2765662 2763896 gene locus_tag LOCUS_26040 2765662 2763896 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_26040 2766163 2765771 gene locus_tag LOCUS_26050 2766163 2765771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2766903 2766352 gene locus_tag LOCUS_26060 2766903 2766352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2767642 2767016 gene locus_tag LOCUS_26070 gene thiE 2767642 2767016 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_26070 2768774 2767647 gene locus_tag LOCUS_26080 gene thiH 2768774 2767647 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_26080 2769659 2768886 gene locus_tag LOCUS_26090 2769659 2768886 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_26090 2769892 2769692 gene locus_tag LOCUS_26100 gene thiS 2769892 2769692 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941252.1 protein_id gnl|my_center|LOCUS_26100 2770786 2769980 gene locus_tag LOCUS_26110 gene thiF 2770786 2769980 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_26110 2771157 2771480 gene locus_tag LOCUS_26120 2771157 2771480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2771558 2772439 gene locus_tag LOCUS_26130 2771558 2772439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2772451 2772954 gene locus_tag LOCUS_26140 2772451 2772954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2772947 2773903 gene locus_tag LOCUS_26150 2772947 2773903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2773968 2775008 gene locus_tag LOCUS_26160 2773968 2775008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2775002 2775880 gene locus_tag LOCUS_26170 2775002 2775880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2775943 2776848 gene locus_tag LOCUS_26180 gene bamB 2775943 2776848 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261368.1 protein_id gnl|my_center|LOCUS_26180 2776944 2778302 gene locus_tag LOCUS_26190 2776944 2778302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2778390 2778995 gene locus_tag LOCUS_26200 2778390 2778995 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943539.1 protein_id gnl|my_center|LOCUS_26200 2779013 2779936 gene locus_tag LOCUS_26210 2779013 2779936 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_26210 2779933 2781471 gene locus_tag LOCUS_26220 2779933 2781471 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_26220 2781713 2781871 gene locus_tag LOCUS_26230 2781713 2781871 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_26230 2781899 2782189 gene locus_tag LOCUS_26240 2781899 2782189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2783161 2782229 gene locus_tag LOCUS_26250 2783161 2782229 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_26250 2783343 2784554 gene locus_tag LOCUS_26260 gene lhgO 2783343 2784554 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_26260 2785681 2784611 gene locus_tag LOCUS_26270 2785681 2784611 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_26270 2786345 2785995 gene locus_tag LOCUS_26280 2786345 2785995 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268933.1 protein_id gnl|my_center|LOCUS_26280 2789211 2786389 gene locus_tag LOCUS_26290 2789211 2786389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2789380 2789856 gene locus_tag LOCUS_26300 2789380 2789856 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940911.1 protein_id gnl|my_center|LOCUS_26300 2790027 2792525 gene locus_tag LOCUS_26310 2790027 2792525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2792525 2793427 gene locus_tag LOCUS_26320 2792525 2793427 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_26320 2793575 2795878 gene locus_tag LOCUS_26330 2793575 2795878 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_26330 2795939 2796523 gene locus_tag LOCUS_26340 2795939 2796523 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_26340 2796530 2797630 gene locus_tag LOCUS_26350 gene ispG 2796530 2797630 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_26350 2799515 2797833 gene locus_tag LOCUS_26360 2799515 2797833 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_26360 2799867 2800379 gene locus_tag LOCUS_26370 2799867 2800379 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_26370 2801897 2800404 gene locus_tag LOCUS_26380 2801897 2800404 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943374.1 protein_id gnl|my_center|LOCUS_26380 2802063 2803781 gene locus_tag LOCUS_26390 2802063 2803781 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_26390 2803828 2805054 gene locus_tag LOCUS_26400 2803828 2805054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2805054 2805827 gene locus_tag LOCUS_26410 gene pyrF 2805054 2805827 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_26410 2806110 2805784 gene locus_tag LOCUS_26420 2806110 2805784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2806000 2806530 gene locus_tag LOCUS_26430 2806000 2806530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2806685 2807044 gene locus_tag LOCUS_26440 2806685 2807044 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942264.1 protein_id gnl|my_center|LOCUS_26440 2807102 2807968 gene locus_tag LOCUS_26450 2807102 2807968 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_26450 2808427 2809797 gene locus_tag LOCUS_26460 gene ltrA 2808427 2809797 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_26460 2810734 2813694 gene locus_tag LOCUS_26470 2810734 2813694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2813847 2816078 gene locus_tag LOCUS_26480 gene rlmKL 2813847 2816078 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_26480 2816198 2816273 gene locus_tag LOCUS_t00290 2816198 2816273 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2816326 2816410 gene locus_tag LOCUS_t00300 2816326 2816410 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2816532 2816608 gene locus_tag LOCUS_t00310 2816532 2816608 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2816642 2816717 gene locus_tag LOCUS_t00320 2816642 2816717 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2816848 2818038 gene locus_tag LOCUS_26490 gene tuf 2816848 2818038 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_26490 2818099 2818248 gene locus_tag LOCUS_26500 gene rpmG 2818099 2818248 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_26500 2818301 2818377 gene locus_tag LOCUS_t00330 2818301 2818377 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2818414 2818599 gene locus_tag LOCUS_26510 gene secE 2818414 2818599 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_26510 2818617 2819150 gene locus_tag LOCUS_26520 gene nusG 2818617 2819150 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_26520 2819197 2819619 gene locus_tag LOCUS_26530 gene rplK 2819197 2819619 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_26530 2819648 2820349 gene locus_tag LOCUS_26540 gene rplA 2819648 2820349 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_26540 2820586 2821080 gene locus_tag LOCUS_26550 gene rplJ 2820586 2821080 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_26550 2821137 2821517 gene locus_tag LOCUS_26560 gene rplL 2821137 2821517 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_26560 2821608 2825717 gene locus_tag LOCUS_26570 gene rpoB 2821608 2825717 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_26570 2825744 2829901 gene locus_tag LOCUS_26580 gene rpoC 2825744 2829901 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_26580 2830098 2830469 gene locus_tag LOCUS_26590 gene rpsL 2830098 2830469 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_26590 2830496 2830966 gene locus_tag LOCUS_26600 gene rpsG 2830496 2830966 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_26600 2831014 2833092 gene locus_tag LOCUS_26610 gene fusA 2831014 2833092 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_26610 2833113 2834303 gene locus_tag LOCUS_26620 gene tuf 2833113 2834303 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_26620 2834319 2834627 gene locus_tag LOCUS_26630 gene rpsJ 2834319 2834627 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_26630 2834694 2835293 gene locus_tag LOCUS_26640 gene rplC 2834694 2835293 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_26640 2835322 2835945 gene locus_tag LOCUS_26650 gene rplD 2835322 2835945 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943485.1 protein_id gnl|my_center|LOCUS_26650 2835942 2836229 gene locus_tag LOCUS_26660 2835942 2836229 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_26660 2836262 2837083 gene locus_tag LOCUS_26670 gene rplB 2836262 2837083 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_26670 2837112 2837396 gene locus_tag LOCUS_26680 gene rpsS 2837112 2837396 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_26680 2837422 2837754 gene locus_tag LOCUS_26690 gene rplV 2837422 2837754 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_26690 2837776 2838417 gene locus_tag LOCUS_26700 gene rpsC 2837776 2838417 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_26700 2838443 2838868 gene locus_tag LOCUS_26710 gene rplP 2838443 2838868 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_26710 2838858 2839046 gene locus_tag LOCUS_26720 gene rpmC 2838858 2839046 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943478.1 protein_id gnl|my_center|LOCUS_26720 2839065 2839331 gene locus_tag LOCUS_26730 gene rpsQ 2839065 2839331 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_26730 2839344 2839712 gene locus_tag LOCUS_26740 gene rplN 2839344 2839712 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_26740 2839745 2840074 gene locus_tag LOCUS_26750 gene rplX 2839745 2840074 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_26750 2840089 2840628 gene locus_tag LOCUS_26760 gene rplE 2840089 2840628 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_26760 2840653 2840838 gene locus_tag LOCUS_26770 2840653 2840838 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_26770 2840859 2841257 gene locus_tag LOCUS_26780 gene rpsH 2840859 2841257 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_26780 2841281 2841820 gene locus_tag LOCUS_26790 gene rplF 2841281 2841820 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_26790 2841862 2842230 gene locus_tag LOCUS_26800 gene rplR 2841862 2842230 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_26800 2842246 2842743 gene locus_tag LOCUS_26810 gene rpsE 2842246 2842743 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_26810 2842765 2842944 gene locus_tag LOCUS_26820 gene rpmD 2842765 2842944 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_26820 2842963 2843403 gene locus_tag LOCUS_26830 gene rplO 2842963 2843403 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_26830 2843405 2844715 gene locus_tag LOCUS_26840 gene secY 2843405 2844715 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_26840 2844734 2845378 gene locus_tag LOCUS_26850 2844734 2845378 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943465.1 protein_id gnl|my_center|LOCUS_26850 2845383 2846129 gene locus_tag LOCUS_26860 gene map 2845383 2846129 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_26860 2846333 2846701 gene locus_tag LOCUS_26870 gene rpsM 2846333 2846701 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_26870 2846713 2847108 gene locus_tag LOCUS_26880 gene rpsK 2846713 2847108 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_26880 2847129 2847758 gene locus_tag LOCUS_26890 gene rpsD 2847129 2847758 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_26890 2847806 2848822 gene locus_tag LOCUS_26900 2847806 2848822 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_26900 2848858 2849391 gene locus_tag LOCUS_26910 2848858 2849391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2849540 2851021 gene locus_tag LOCUS_26920 gene trpE 2849540 2851021 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_26920 2851024 2851590 gene locus_tag LOCUS_26930 2851024 2851590 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_26930 2851601 2852674 gene locus_tag LOCUS_26940 gene trpD 2851601 2852674 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_26940 2852671 2853450 gene locus_tag LOCUS_26950 gene trpC 2852671 2853450 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_26950 2853471 2854826 gene locus_tag LOCUS_26960 2853471 2854826 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_26960 2854841 2855458 gene locus_tag LOCUS_26970 2854841 2855458 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_26970 2855514 2856707 gene locus_tag LOCUS_26980 gene trpB 2855514 2856707 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_26980 2856758 2858032 gene locus_tag LOCUS_26990 2856758 2858032 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_26990 2858047 2858574 gene locus_tag LOCUS_27000 2858047 2858574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2858667 2859470 gene locus_tag LOCUS_27010 gene trpA 2858667 2859470 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_27010 2859596 2860444 gene locus_tag LOCUS_27020 gene accD 2859596 2860444 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_27020 2860449 2861720 gene locus_tag LOCUS_27030 2860449 2861720 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_27030 2861717 2863816 gene locus_tag LOCUS_27040 gene lptD 2861717 2863816 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_27040 2863949 2864245 gene locus_tag LOCUS_27050 2863949 2864245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2864349 2864705 gene locus_tag LOCUS_27060 2864349 2864705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2864763 2866427 gene locus_tag LOCUS_27070 gene argS 2864763 2866427 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_27070 2866446 2867153 gene locus_tag LOCUS_27080 2866446 2867153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2867264 2867340 gene locus_tag LOCUS_t00340 2867264 2867340 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2867379 2867455 gene locus_tag LOCUS_t00350 2867379 2867455 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2867863 2867576 gene locus_tag LOCUS_27090 2867863 2867576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2867768 2868910 gene locus_tag LOCUS_27100 gene tilS 2867768 2868910 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27100 2869006 2870913 gene locus_tag LOCUS_27110 gene ftsH 2869006 2870913 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_27110 2870917 2871765 gene locus_tag LOCUS_27120 gene folP 2870917 2871765 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_27120 2871790 2872569 gene locus_tag LOCUS_27130 gene cdaA 2871790 2872569 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942452.1 protein_id gnl|my_center|LOCUS_27130 2872580 2873275 gene locus_tag LOCUS_27140 2872580 2873275 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545937.1 protein_id gnl|my_center|LOCUS_27140 2873275 2874645 gene locus_tag LOCUS_27150 gene glmM 2873275 2874645 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_27150 2874642 2875367 gene locus_tag LOCUS_27160 2874642 2875367 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_27160 2875370 2875753 gene locus_tag LOCUS_27170 2875370 2875753 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_27170 2875750 2877297 gene locus_tag LOCUS_27180 2875750 2877297 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_27180 2877310 2877759 gene locus_tag LOCUS_27190 2877310 2877759 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_27190 2877756 2878253 gene locus_tag LOCUS_27200 gene tsaE 2877756 2878253 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 protein_id gnl|my_center|LOCUS_27200 2878250 2879647 gene locus_tag LOCUS_27210 gene lpdA 2878250 2879647 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_27210 2879708 2880940 gene locus_tag LOCUS_27220 2879708 2880940 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_27220 2881028 2882605 gene locus_tag LOCUS_27230 gene cimA 2881028 2882605 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_27230 2882602 2883162 gene locus_tag LOCUS_27240 2882602 2883162 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942442.1 protein_id gnl|my_center|LOCUS_27240 2883335 2883463 gene locus_tag LOCUS_27250 2883335 2883463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012648007.1 protein_id gnl|my_center|LOCUS_27250 2883674 2884270 gene locus_tag LOCUS_27260 2883674 2884270 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691652.1 protein_id gnl|my_center|LOCUS_27260 2884572 2885174 gene locus_tag LOCUS_27270 2884572 2885174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2885377 2886000 gene locus_tag LOCUS_27280 2885377 2886000 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_27280 2886218 2887531 gene locus_tag LOCUS_27290 2886218 2887531 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867173.1 protein_id gnl|my_center|LOCUS_27290 2887524 2888105 gene locus_tag LOCUS_27300 2887524 2888105 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249022.1 protein_id gnl|my_center|LOCUS_27300 2888240 2888692 gene locus_tag LOCUS_27310 2888240 2888692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2888706 2888951 gene locus_tag LOCUS_27320 2888706 2888951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2889411 2888959 gene locus_tag LOCUS_27330 2889411 2888959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2890110 2889700 gene locus_tag LOCUS_27340 2890110 2889700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2892127 2890250 gene locus_tag LOCUS_27350 gene gor 2892127 2890250 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_27350 2892641 2892135 gene locus_tag LOCUS_27360 2892641 2892135 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_27360 2892806 2893522 gene locus_tag LOCUS_27370 2892806 2893522 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_27370 2893544 2894755 gene locus_tag LOCUS_27380 2893544 2894755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2894964 2894752 gene locus_tag LOCUS_27390 2894964 2894752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2894848 2895555 gene locus_tag LOCUS_27400 2894848 2895555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2897698 2895590 gene locus_tag LOCUS_27410 gene fadJ 2897698 2895590 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425010.1 protein_id gnl|my_center|LOCUS_27410 2898094 2899080 gene locus_tag LOCUS_27420 gene pdhA 2898094 2899080 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_27420 2899120 2900097 gene locus_tag LOCUS_27430 2899120 2900097 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_27430 2900213 2901595 gene locus_tag LOCUS_27440 2900213 2901595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2901681 2904095 gene locus_tag LOCUS_27450 2901681 2904095 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_27450 2907654 2904118 gene locus_tag LOCUS_27460 2907654 2904118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2908667 2907732 gene locus_tag LOCUS_27470 2908667 2907732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2912962 2908703 gene locus_tag LOCUS_27480 2912962 2908703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2914544 2912964 gene locus_tag LOCUS_27490 2914544 2912964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2915008 2914541 gene locus_tag LOCUS_27500 2915008 2914541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2915415 2915083 gene locus_tag LOCUS_27510 2915415 2915083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2917871 2915439 gene locus_tag LOCUS_27520 2917871 2915439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2918811 2918008 gene locus_tag LOCUS_27530 2918811 2918008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2919829 2918828 gene locus_tag LOCUS_27540 2919829 2918828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2920800 2919835 gene locus_tag LOCUS_27550 2920800 2919835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2925772 2920814 gene locus_tag LOCUS_27560 2925772 2920814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2926201 2925785 gene locus_tag LOCUS_27570 2926201 2925785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2926793 2926242 gene locus_tag LOCUS_27580 2926793 2926242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2928647 2928168 gene locus_tag LOCUS_27590 2928647 2928168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 2929190 2928660 gene locus_tag LOCUS_27600 2929190 2928660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2930884 2929205 gene locus_tag LOCUS_27610 2930884 2929205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2931961 2930966 gene locus_tag LOCUS_27620 2931961 2930966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2932509 2933297 gene locus_tag LOCUS_27630 2932509 2933297 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_27630 2933421 2934212 gene locus_tag LOCUS_27640 2933421 2934212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_27640 2934199 2934645 gene locus_tag LOCUS_27650 gene mlaD 2934199 2934645 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_27650 2934668 2935429 gene locus_tag LOCUS_27660 2934668 2935429 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_27660 2935452 2936057 gene locus_tag LOCUS_27670 2935452 2936057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2936062 2936529 gene locus_tag LOCUS_27680 2936062 2936529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2936824 2938977 gene locus_tag LOCUS_27690 gene ppk1 2936824 2938977 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_27690 2938989 2939468 gene locus_tag LOCUS_27700 2938989 2939468 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_27700 2939482 2941038 gene locus_tag LOCUS_27710 2939482 2941038 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_27710 2941035 2941790 gene locus_tag LOCUS_27720 2941035 2941790 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_27720 2942141 2943106 gene locus_tag LOCUS_27730 2942141 2943106 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_27730 2945067 2943154 gene locus_tag LOCUS_27740 2945067 2943154 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881379.1 protein_id gnl|my_center|LOCUS_27740 2945620 2945384 gene locus_tag LOCUS_27750 2945620 2945384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2947335 2945617 gene locus_tag LOCUS_27760 2947335 2945617 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_27760 2947664 2947359 gene locus_tag LOCUS_27770 2947664 2947359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2947925 2948638 gene locus_tag LOCUS_27780 gene ubiE 2947925 2948638 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_27780 2951857 2948666 gene locus_tag LOCUS_27790 2951857 2948666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2952940 2952059 gene locus_tag LOCUS_27800 2952940 2952059 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_27800 2953282 2953019 gene locus_tag LOCUS_27810 2953282 2953019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2953169 2953423 gene locus_tag LOCUS_27820 2953169 2953423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2953488 2954792 gene locus_tag LOCUS_27830 2953488 2954792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2954850 2955041 gene locus_tag LOCUS_27840 2954850 2955041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2954981 2955334 gene locus_tag LOCUS_27850 2954981 2955334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2955739 2955392 gene locus_tag LOCUS_27860 2955739 2955392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2956289 2955792 gene locus_tag LOCUS_27870 2956289 2955792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2956329 2957891 gene locus_tag LOCUS_27880 gene rny 2956329 2957891 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_27880 2957911 2958249 gene locus_tag LOCUS_27890 2957911 2958249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27890 2958240 2958689 gene locus_tag LOCUS_27900 2958240 2958689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27900 2958737 2959966 gene locus_tag LOCUS_27910 gene tyrS 2958737 2959966 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_27910 2960420 2961975 gene locus_tag LOCUS_r00010 2960420 2961975 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2962141 2962217 gene locus_tag LOCUS_t00360 2962141 2962217 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2962226 2962301 gene locus_tag LOCUS_t00370 2962226 2962301 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2962408 2965361 gene locus_tag LOCUS_r00020 2962408 2965361 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2965498 2965608 gene locus_tag LOCUS_r00030 2965498 2965608 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2965973 2967526 gene locus_tag LOCUS_r00040 2965973 2967526 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2967692 2967768 gene locus_tag LOCUS_t00380 2967692 2967768 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2967777 2967852 gene locus_tag LOCUS_t00390 2967777 2967852 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2967959 2970912 gene locus_tag LOCUS_r00050 2967959 2970912 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2971049 2971159 gene locus_tag LOCUS_r00060 2971049 2971159 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2972626 2971265 gene locus_tag LOCUS_27920 2972626 2971265 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_27920 2974906 2972642 gene locus_tag LOCUS_27930 2974906 2972642 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_27930 2975973 2975044 gene locus_tag LOCUS_27940 gene lpxC 2975973 2975044 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073895.1 protein_id gnl|my_center|LOCUS_27940 2977851 2976160 gene locus_tag LOCUS_27950 2977851 2976160 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_27950 2978209 2977883 gene locus_tag LOCUS_27960 2978209 2977883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2979242 2978265 gene locus_tag LOCUS_27970 2979242 2978265 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_27970 2979485 2979276 gene locus_tag LOCUS_27980 2979485 2979276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2980042 2979503 gene locus_tag LOCUS_27990 2980042 2979503 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_27990 2982177 2980132 gene locus_tag LOCUS_28000 2982177 2980132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2982585 2982214 gene locus_tag LOCUS_28010 2982585 2982214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2983934 2982615 gene locus_tag LOCUS_28020 2983934 2982615 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942582.1 protein_id gnl|my_center|LOCUS_28020 2985101 2984076 gene locus_tag LOCUS_28030 gene ruvB 2985101 2984076 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_28030 2985731 2985132 gene locus_tag LOCUS_28040 gene ruvA 2985731 2985132 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_28040 2986286 2985786 gene locus_tag LOCUS_28050 gene ruvC 2986286 2985786 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_28050 2987071 2986325 gene locus_tag LOCUS_28060 2987071 2986325 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_28060 2988083 2987256 gene locus_tag LOCUS_28070 2988083 2987256 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942570.1 protein_id gnl|my_center|LOCUS_28070 2989160 2988168 gene locus_tag LOCUS_28080 gene glpX 2989160 2988168 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_28080 2989468 2989229 gene locus_tag LOCUS_28090 2989468 2989229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2989467 2990207 gene locus_tag LOCUS_28100 2989467 2990207 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_28100 2990289 2990933 gene locus_tag LOCUS_28110 2990289 2990933 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_28110 2991046 2992212 gene locus_tag LOCUS_28120 2991046 2992212 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_28120 2992297 2992518 gene locus_tag LOCUS_28130 2992297 2992518 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_28130 2992549 2992743 gene locus_tag LOCUS_28140 2992549 2992743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941149.1 protein_id gnl|my_center|LOCUS_28140 2993947 2992808 gene locus_tag LOCUS_28150 2993947 2992808 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_28150 2994339 2993944 gene locus_tag LOCUS_28160 2994339 2993944 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_28160 2995166 2994336 gene locus_tag LOCUS_28170 2995166 2994336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2995300 2996202 gene locus_tag LOCUS_28180 gene xerC 2995300 2996202 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_28180 2996352 2996954 gene locus_tag LOCUS_28190 2996352 2996954 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_28190 2998684 2997098 gene locus_tag LOCUS_28200 2998684 2997098 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941158.1 protein_id gnl|my_center|LOCUS_28200 2999790 2999041 gene locus_tag LOCUS_28210 2999790 2999041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2999699 2999929 gene locus_tag LOCUS_28220 2999699 2999929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3000833 2999976 gene locus_tag LOCUS_28230 gene rpoH 3000833 2999976 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941316.1 protein_id gnl|my_center|LOCUS_28230 3001420 3000983 gene locus_tag LOCUS_28240 3001420 3000983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3002615 3001566 gene locus_tag LOCUS_28250 3002615 3001566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3003451 3002648 gene locus_tag LOCUS_28260 gene ccsB 3003451 3002648 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_28260 3003594 3004418 gene locus_tag LOCUS_28270 gene bioW 3003594 3004418 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 protein_id gnl|my_center|LOCUS_28270 3004418 3005596 gene locus_tag LOCUS_28280 gene bioF 3004418 3005596 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_28280 3005636 3006439 gene locus_tag LOCUS_28290 3005636 3006439 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_28290 3006436 3007239 gene locus_tag LOCUS_28300 gene bioC 3006436 3007239 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943265.1 protein_id gnl|my_center|LOCUS_28300 3008452 3007280 gene locus_tag LOCUS_28310 3008452 3007280 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_28310 3008745 3008458 gene locus_tag LOCUS_28320 3008745 3008458 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943263.1 protein_id gnl|my_center|LOCUS_28320 3008958 3009905 gene locus_tag LOCUS_28330 3008958 3009905 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404152.1 protein_id gnl|my_center|LOCUS_28330 3009902 3010786 gene locus_tag LOCUS_28340 3009902 3010786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3010880 3012532 gene locus_tag LOCUS_28350 3010880 3012532 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_28350 3012569 3012763 gene locus_tag LOCUS_28360 3012569 3012763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706655.1 protein_id gnl|my_center|LOCUS_28360 3013164 3012805 gene locus_tag LOCUS_28370 3013164 3012805 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_28370 3015355 3013223 gene locus_tag LOCUS_28380 3015355 3013223 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941831.1 protein_id gnl|my_center|LOCUS_28380 3015774 3015980 gene locus_tag LOCUS_28390 3015774 3015980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3016788 3016027 gene locus_tag LOCUS_28400 3016788 3016027 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940970.1 protein_id gnl|my_center|LOCUS_28400 3017509 3016859 gene locus_tag LOCUS_28410 3017509 3016859 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_28410 3017614 3018924 gene locus_tag LOCUS_28420 3017614 3018924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_28420 3018982 3021546 gene locus_tag LOCUS_28430 3018982 3021546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3022472 3021585 gene locus_tag LOCUS_28440 3022472 3021585 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_28440 3025042 3022469 gene locus_tag LOCUS_28450 3025042 3022469 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_28450 3028685 3025302 gene locus_tag LOCUS_28460 3028685 3025302 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_28460 3029736 3028756 gene locus_tag LOCUS_28470 3029736 3028756 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_28470 3031193 3029730 gene locus_tag LOCUS_28480 3031193 3029730 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_28480 3031389 3032333 gene locus_tag LOCUS_28490 3031389 3032333 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941034.1 protein_id gnl|my_center|LOCUS_28490 3032829 3032377 gene locus_tag LOCUS_28500 3032829 3032377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3032975 3034561 gene locus_tag LOCUS_28510 3032975 3034561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3034598 3035566 gene locus_tag LOCUS_28520 3034598 3035566 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_28520 3035656 3038160 gene locus_tag LOCUS_28530 3035656 3038160 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943129.1 protein_id gnl|my_center|LOCUS_28530 3038329 3039711 gene locus_tag LOCUS_28540 3038329 3039711 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_28540 3040163 3041911 gene locus_tag LOCUS_28550 3040163 3041911 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_28550 3042150 3044426 gene locus_tag LOCUS_28560 gene hypF 3042150 3044426 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_28560 3044657 3044427 gene locus_tag LOCUS_28570 3044657 3044427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3046211 3044892 gene locus_tag LOCUS_28580 3046211 3044892 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_28580 3051949 3046388 gene locus_tag LOCUS_28590 gene uvrA 3051949 3046388 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214185119.1 protein_id gnl|my_center|LOCUS_28590 3053037 3052075 gene locus_tag LOCUS_28600 gene pfkA 3053037 3052075 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942710.1 protein_id gnl|my_center|LOCUS_28600 3053331 3055715 gene locus_tag LOCUS_28610 gene lon 3053331 3055715 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941591.1 protein_id gnl|my_center|LOCUS_28610 3055807 3057306 gene locus_tag LOCUS_28620 3055807 3057306 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_28620 3057303 3058721 gene locus_tag LOCUS_28630 3057303 3058721 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_28630 3058816 3060054 gene locus_tag LOCUS_28640 3058816 3060054 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070528.1 protein_id gnl|my_center|LOCUS_28640 3060142 3060570 gene locus_tag LOCUS_28650 3060142 3060570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3060749 3062557 gene locus_tag LOCUS_28660 gene recQ 3060749 3062557 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_28660 3062604 3063923 gene locus_tag LOCUS_28670 3062604 3063923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3064023 3064667 gene locus_tag LOCUS_28680 3064023 3064667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3064818 3065381 gene locus_tag LOCUS_28690 3064818 3065381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3065625 3066005 gene locus_tag LOCUS_28700 3065625 3066005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3066010 3066327 gene locus_tag LOCUS_28710 3066010 3066327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3066394 3067767 gene locus_tag LOCUS_28720 3066394 3067767 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_28720 3068483 3067761 gene locus_tag LOCUS_28730 3068483 3067761 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_28730 3068618 3069025 gene locus_tag LOCUS_28740 3068618 3069025 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_28740 3069114 3069707 gene locus_tag LOCUS_28750 3069114 3069707 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_28750 3069890 3070132 gene locus_tag LOCUS_28760 3069890 3070132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3070248 3071522 gene locus_tag LOCUS_28770 3070248 3071522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3071544 3071984 gene locus_tag LOCUS_28780 3071544 3071984 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_28780 3072196 3073257 gene locus_tag LOCUS_28790 3072196 3073257 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_28790 3073351 3074424 gene locus_tag LOCUS_28800 3073351 3074424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3074424 3075155 gene locus_tag LOCUS_28810 gene rph 3074424 3075155 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_28810 3075160 3075753 gene locus_tag LOCUS_28820 3075160 3075753 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_28820 3075988 3076299 gene locus_tag LOCUS_28830 3075988 3076299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 3076366 3077874 gene locus_tag LOCUS_28840 3076366 3077874 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937393.1 protein_id gnl|my_center|LOCUS_28840 3077904 3078383 gene locus_tag LOCUS_28850 3077904 3078383 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_28850 3079316 3078393 gene locus_tag LOCUS_28860 3079316 3078393 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_28860 3081526 3079370 gene locus_tag LOCUS_28870 3081526 3079370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3081697 3082113 gene locus_tag LOCUS_28880 gene ndk 3081697 3082113 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941771.1 protein_id gnl|my_center|LOCUS_28880 3082205 3083044 gene locus_tag LOCUS_28890 3082205 3083044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28890 3082945 3083256 gene locus_tag LOCUS_28900 3082945 3083256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28900 3083284 3084153 gene locus_tag LOCUS_28910 gene mtnP 3083284 3084153 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_28910 3084267 3085208 gene locus_tag LOCUS_28920 3084267 3085208 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_28920 3085192 3085734 gene locus_tag LOCUS_28930 3085192 3085734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3085744 3086496 gene locus_tag LOCUS_28940 3085744 3086496 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_28940 3086535 3087419 gene locus_tag LOCUS_28950 3086535 3087419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3087430 3087960 gene locus_tag LOCUS_28960 3087430 3087960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3087957 3088787 gene locus_tag LOCUS_28970 3087957 3088787 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_28970 3088937 3089326 gene locus_tag LOCUS_28980 3088937 3089326 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_28980 3089360 3089812 gene locus_tag LOCUS_28990 3089360 3089812 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_28990 3089950 3091098 gene locus_tag LOCUS_29000 3089950 3091098 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_29000 3091095 3092687 gene locus_tag LOCUS_29010 3091095 3092687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_29010 3092684 3093871 gene locus_tag LOCUS_29020 3092684 3093871 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_29020 3093875 3094492 gene locus_tag LOCUS_29030 3093875 3094492 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_29030 3094519 3095721 gene locus_tag LOCUS_29040 gene coaBC 3094519 3095721 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_29040 3096638 3095724 gene locus_tag LOCUS_29050 3096638 3095724 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_29050 3096753 3097478 gene locus_tag LOCUS_29060 3096753 3097478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 3097903 3097529 gene locus_tag LOCUS_29070 3097903 3097529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 3099540 3098149 gene locus_tag LOCUS_29080 3099540 3098149 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_29080 3100065 3100661 gene locus_tag LOCUS_29090 3100065 3100661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3100666 3101127 gene locus_tag LOCUS_29100 3100666 3101127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3101129 3102469 gene locus_tag LOCUS_29110 gene tssK 3101129 3102469 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521949.1 protein_id gnl|my_center|LOCUS_29110 3102470 3103234 gene locus_tag LOCUS_29120 3102470 3103234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3103231 3104214 gene locus_tag LOCUS_29130 3103231 3104214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3103837 3103846 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3104216 3104836 gene locus_tag LOCUS_29140 3104216 3104836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3104837 3105601 gene locus_tag LOCUS_29150 3104837 3105601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3105598 3109218 gene locus_tag LOCUS_29160 gene tssM 3105598 3109218 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_29160 3109413 3110354 gene locus_tag LOCUS_29170 3109413 3110354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3110351 3111898 gene locus_tag LOCUS_29180 3110351 3111898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3112079 3112591 gene locus_tag LOCUS_29190 gene tssB 3112079 3112591 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211662.1 protein_id gnl|my_center|LOCUS_29190 3112604 3114139 gene locus_tag LOCUS_29200 gene tssC 3112604 3114139 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214707.1 protein_id gnl|my_center|LOCUS_29200 3114344 3114829 gene locus_tag LOCUS_29210 3114344 3114829 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 protein_id gnl|my_center|LOCUS_29210 3114916 3115332 gene locus_tag LOCUS_29220 3114916 3115332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3115325 3117058 gene locus_tag LOCUS_29230 gene tssF 3115325 3117058 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211940.1 protein_id gnl|my_center|LOCUS_29230 3117022 3117987 gene locus_tag LOCUS_29240 gene tssG 3117022 3117987 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533373.1 protein_id gnl|my_center|LOCUS_29240 3117994 3120750 gene locus_tag LOCUS_29250 gene tssH 3117994 3120750 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211927.1 protein_id gnl|my_center|LOCUS_29250 3120818 3122881 gene locus_tag LOCUS_29260 3120818 3122881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3123039 3123485 gene locus_tag LOCUS_29270 3123039 3123485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3123522 3124055 gene locus_tag LOCUS_29280 3123522 3124055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3124052 3126796 gene locus_tag LOCUS_29290 3124052 3126796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3126790 3127581 gene locus_tag LOCUS_29300 3126790 3127581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3127622 3128290 gene locus_tag LOCUS_29310 3127622 3128290 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_29310 3128435 3129226 gene locus_tag LOCUS_29320 3128435 3129226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3129217 3130434 gene locus_tag LOCUS_29330 3129217 3130434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3130442 3131503 gene locus_tag LOCUS_29340 3130442 3131503 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123798.1 protein_id gnl|my_center|LOCUS_29340 3131494 3132594 gene locus_tag LOCUS_29350 3131494 3132594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3132674 3132979 gene locus_tag LOCUS_29360 3132674 3132979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 3135004 3133661 gene locus_tag LOCUS_29370 3135004 3133661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 3135389 3137824 gene locus_tag LOCUS_29380 3135389 3137824 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_29380 3137806 3139272 gene locus_tag LOCUS_29390 3137806 3139272 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_29390 3139287 3140366 gene locus_tag LOCUS_29400 3139287 3140366 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_29400 3140359 3140550 gene locus_tag LOCUS_29410 3140359 3140550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3140547 3141212 gene locus_tag LOCUS_29420 3140547 3141212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3141245 3142465 gene locus_tag LOCUS_29430 3141245 3142465 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_29430 3142506 3142709 gene locus_tag LOCUS_29440 3142506 3142709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3142721 3143296 gene locus_tag LOCUS_29450 3142721 3143296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3143964 3144560 gene locus_tag LOCUS_29460 3143964 3144560 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084435184.1 protein_id gnl|my_center|LOCUS_29460 3144562 3145476 gene locus_tag LOCUS_29470 3144562 3145476 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_29470 3145593 3145820 gene locus_tag LOCUS_29480 3145593 3145820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3146029 3147117 gene locus_tag LOCUS_29490 gene yedE 3146029 3147117 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_29490 3147144 3147356 gene locus_tag LOCUS_29500 3147144 3147356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3147325 3148518 gene locus_tag LOCUS_29510 3147325 3148518 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_29510 3148543 3148773 gene locus_tag LOCUS_29520 3148543 3148773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 3148896 3150218 gene locus_tag LOCUS_29530 3148896 3150218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3151638 3150259 gene locus_tag LOCUS_29540 gene mgtE 3151638 3150259 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_29540 3152380 3151949 gene locus_tag LOCUS_29550 3152380 3151949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3152654 3152935 gene locus_tag LOCUS_29560 3152654 3152935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3153216 3153455 gene locus_tag LOCUS_29570 3153216 3153455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3153803 3154984 gene locus_tag LOCUS_29580 3153803 3154984 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170105.1 protein_id gnl|my_center|LOCUS_29580 3155506 3154970 gene locus_tag LOCUS_29590 gene trmH 3155506 3154970 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_29590 3155846 3156673 gene locus_tag LOCUS_29600 3155846 3156673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3156766 3157284 gene locus_tag LOCUS_29610 3156766 3157284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3157295 3158452 gene locus_tag LOCUS_29620 3157295 3158452 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941993.1 protein_id gnl|my_center|LOCUS_29620 3158613 3159323 gene locus_tag LOCUS_29630 3158613 3159323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_29630 3159336 3159602 gene locus_tag LOCUS_29640 3159336 3159602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3159599 3159889 gene locus_tag LOCUS_29650 3159599 3159889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3160034 3160783 gene locus_tag LOCUS_29660 gene kdsB 3160034 3160783 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_29660 3160981 3162585 gene locus_tag LOCUS_29670 3160981 3162585 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_29670 3162587 3163417 gene locus_tag LOCUS_29680 gene kdsA 3162587 3163417 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_29680 3163419 3164390 gene locus_tag LOCUS_29690 3163419 3164390 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_29690 3164390 3164920 gene locus_tag LOCUS_29700 3164390 3164920 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_29700 3165080 3165589 gene locus_tag LOCUS_29710 3165080 3165589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 3165589 3166071 gene locus_tag LOCUS_29720 gene lptA 3165589 3166071 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_29720 3166068 3166793 gene locus_tag LOCUS_29730 gene lptB 3166068 3166793 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_29730 3166928 3168385 gene locus_tag LOCUS_29740 gene rpoN 3166928 3168385 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_29740 3168493 3169041 gene locus_tag LOCUS_29750 gene raiA 3168493 3169041 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_29750 3169056 3169589 gene locus_tag LOCUS_29760 3169056 3169589 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_29760 3169602 3170576 gene locus_tag LOCUS_29770 gene hprK 3169602 3170576 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_29770 3170573 3171439 gene locus_tag LOCUS_29780 gene rapZ 3170573 3171439 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_29780 3171443 3171844 gene locus_tag LOCUS_29790 3171443 3171844 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_29790 3171880 3172368 gene locus_tag LOCUS_29800 3171880 3172368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29800 3172370 3173062 gene locus_tag LOCUS_29810 3172370 3173062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3173070 3173822 gene locus_tag LOCUS_29820 3173070 3173822 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721898.1 protein_id gnl|my_center|LOCUS_29820 3173839 3174105 gene locus_tag LOCUS_29830 3173839 3174105 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_29830 3174083 3175870 gene locus_tag LOCUS_29840 gene ptsP 3174083 3175870 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_29840 3175961 3177130 gene locus_tag LOCUS_29850 gene metK 3175961 3177130 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_29850 3177443 3178546 gene locus_tag LOCUS_29860 3177443 3178546 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403653.1 protein_id gnl|my_center|LOCUS_29860 3178543 3179598 gene locus_tag LOCUS_29870 3178543 3179598 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_29870 3179811 3180545 gene locus_tag LOCUS_29880 3179811 3180545 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944071.1 protein_id gnl|my_center|LOCUS_29880 3180692 3182101 gene locus_tag LOCUS_29890 gene ahcY 3180692 3182101 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_29890 3183035 3182181 gene locus_tag LOCUS_29900 3183035 3182181 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942569.1 protein_id gnl|my_center|LOCUS_29900 3184206 3183121 gene locus_tag LOCUS_29910 gene lptG 3184206 3183121 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_29910 3185399 3184203 gene locus_tag LOCUS_29920 gene lptF 3185399 3184203 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_29920 3185596 3186393 gene locus_tag LOCUS_29930 gene rpsB 3185596 3186393 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_29930 3186524 3187435 gene locus_tag LOCUS_29940 gene tsf 3186524 3187435 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_29940 3187462 3188190 gene locus_tag LOCUS_29950 gene pyrH 3187462 3188190 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_29950 3188196 3188753 gene locus_tag LOCUS_29960 gene frr 3188196 3188753 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_29960 3188808 3188972 gene locus_tag LOCUS_29970 3188808 3188972 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_29970 3189224 3189868 gene locus_tag LOCUS_29980 3189224 3189868 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_29980 3189948 3190664 gene locus_tag LOCUS_29990 3189948 3190664 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_29990 3190678 3191835 gene locus_tag LOCUS_30000 3190678 3191835 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_30000 3191847 3193175 gene locus_tag LOCUS_30010 gene rseP 3191847 3193175 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_30010 3193172 3193888 gene locus_tag LOCUS_30020 gene tsaB 3193172 3193888 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_30020 3193985 3194215 gene locus_tag LOCUS_30030 3193985 3194215 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_30030 3194390 3196063 gene locus_tag LOCUS_30040 gene ilvD 3194390 3196063 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942557.1 protein_id gnl|my_center|LOCUS_30040 3196148 3197845 gene locus_tag LOCUS_30050 gene ilvB 3196148 3197845 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_30050 3198040 3198534 gene locus_tag LOCUS_30060 gene ilvN 3198040 3198534 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_30060 3198688 3199704 gene locus_tag LOCUS_30070 gene ilvC 3198688 3199704 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_30070 3199776 3200420 gene locus_tag LOCUS_30080 3199776 3200420 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_30080 3200935 3202473 gene locus_tag LOCUS_30090 3200935 3202473 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_30090 3202624 3203904 gene locus_tag LOCUS_30100 3202624 3203904 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_30100 3203998 3204528 gene locus_tag LOCUS_30110 3203998 3204528 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_30110 3204662 3205750 gene locus_tag LOCUS_30120 gene leuB 3204662 3205750 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_30120 3205828 3206847 gene locus_tag LOCUS_30130 3205828 3206847 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_30130 3206954 3207748 gene locus_tag LOCUS_30140 3206954 3207748 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869898.1 protein_id gnl|my_center|LOCUS_30140 3207730 3208461 gene locus_tag LOCUS_30150 gene truA 3207730 3208461 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_30150 3208540 3208992 gene locus_tag LOCUS_30160 3208540 3208992 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_30160 3209116 3209544 gene locus_tag LOCUS_30170 gene rplM 3209116 3209544 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_30170 3209563 3209955 gene locus_tag LOCUS_30180 gene rpsI 3209563 3209955 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_30180 3210023 3211060 gene locus_tag LOCUS_30190 gene argC 3210023 3211060 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_30190 3211213 3212250 gene locus_tag LOCUS_30200 gene queA 3211213 3212250 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_30200 3212373 3213407 gene locus_tag LOCUS_30210 gene tgt 3212373 3213407 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_30210 3213464 3213769 gene locus_tag LOCUS_30220 gene yajC 3213464 3213769 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_30220 3213848 3215452 gene locus_tag LOCUS_30230 gene secD 3213848 3215452 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_30230 3215471 3216412 gene locus_tag LOCUS_30240 gene secF 3215471 3216412 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_30240 3216409 3216969 gene locus_tag LOCUS_30250 3216409 3216969 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943253.1 protein_id gnl|my_center|LOCUS_30250 3217075 3217932 gene locus_tag LOCUS_30260 3217075 3217932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3217920 3219641 gene locus_tag LOCUS_30270 gene recJ 3217920 3219641 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_30270 3220870 3219680 gene locus_tag LOCUS_30280 3220870 3219680 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_30280 3221063 3222139 gene locus_tag LOCUS_30290 gene pheA 3221063 3222139 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_30290 3222142 3223020 gene locus_tag LOCUS_30300 3222142 3223020 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_30300 3223057 3224349 gene locus_tag LOCUS_30310 gene aroA 3223057 3224349 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_30310 3224397 3225089 gene locus_tag LOCUS_30320 gene cmk 3224397 3225089 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_30320 3225089 3225934 gene locus_tag LOCUS_30330 gene ispH 3225089 3225934 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_30330 3226043 3227782 gene locus_tag LOCUS_30340 3226043 3227782 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_30340 3227875 3228741 gene locus_tag LOCUS_30350 gene sppA 3227875 3228741 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_30350 3228760 3229050 gene locus_tag LOCUS_30360 3228760 3229050 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_30360 3229659 3230630 gene locus_tag LOCUS_30370 3229659 3230630 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_30370 3230624 3231403 gene locus_tag LOCUS_30380 gene lgt 3230624 3231403 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_30380 3231923 3231498 gene locus_tag LOCUS_30390 3231923 3231498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_30390 3232278 3231943 gene locus_tag LOCUS_30400 3232278 3231943 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_30400 3235688 3232458 gene locus_tag LOCUS_30410 3235688 3232458 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942076.1 protein_id gnl|my_center|LOCUS_30410 3235919 3235698 gene locus_tag LOCUS_30420 3235919 3235698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3237487 3235919 gene locus_tag LOCUS_30430 3237487 3235919 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_30430 3237729 3239378 gene locus_tag LOCUS_30440 3237729 3239378 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_30440 3239380 3240156 gene locus_tag LOCUS_30450 3239380 3240156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3240181 3241794 gene locus_tag LOCUS_30460 3240181 3241794 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_30460 3241870 3242844 gene locus_tag LOCUS_30470 3241870 3242844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_30470 3242861 3243502 gene locus_tag LOCUS_30480 3242861 3243502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3243499 3244353 gene locus_tag LOCUS_30490 3243499 3244353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_30490 3244380 3244817 gene locus_tag LOCUS_30500 3244380 3244817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3244817 3245632 gene locus_tag LOCUS_30510 gene mutM 3244817 3245632 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_30510 3245657 3246058 gene locus_tag LOCUS_30520 3245657 3246058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3246488 3246682 gene locus_tag LOCUS_30530 3246488 3246682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3247435 3246977 gene locus_tag LOCUS_30540 3247435 3246977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3247719 3247432 gene locus_tag LOCUS_30550 3247719 3247432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3248634 3248176 gene locus_tag LOCUS_30560 3248634 3248176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30560 3248786 3249025 gene locus_tag LOCUS_30570 3248786 3249025 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_30570 3249025 3249318 gene locus_tag LOCUS_30580 3249025 3249318 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_30580 3249700 3252888 gene locus_tag LOCUS_30590 3249700 3252888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3253086 3253298 gene locus_tag LOCUS_30600 3253086 3253298 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_30600 3253282 3253548 gene locus_tag LOCUS_30610 3253282 3253548 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_30610 3254164 3253595 gene locus_tag LOCUS_30620 3254164 3253595 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 protein_id gnl|my_center|LOCUS_30620 3254260 3254523 gene locus_tag LOCUS_30630 3254260 3254523 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_30630 3255209 3254727 gene locus_tag LOCUS_30640 3255209 3254727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3255530 3256624 gene locus_tag LOCUS_30650 3255530 3256624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3256519 3257964 gene locus_tag LOCUS_30660 3256519 3257964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 3258402 3258175 gene locus_tag LOCUS_30670 3258402 3258175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_30670 3258988 3260619 gene locus_tag LOCUS_30680 3258988 3260619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3261250 3260513 gene locus_tag LOCUS_30690 3261250 3260513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3261525 3261247 gene locus_tag LOCUS_30700 3261525 3261247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3261591 3262643 gene locus_tag LOCUS_30710 3261591 3262643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3263022 3262777 gene locus_tag LOCUS_30720 3263022 3262777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3263819 3263010 gene locus_tag LOCUS_30730 gene istB 3263819 3263010 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_30730 3265257 3263809 gene locus_tag LOCUS_30740 gene istA 3265257 3263809 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_30740 3265834 3267204 gene locus_tag LOCUS_30750 gene ltrA 3265834 3267204 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_30750 3267429 3267710 gene locus_tag LOCUS_30760 3267429 3267710 CDS product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312252.1 protein_id gnl|my_center|LOCUS_30760 3267711 3268010 gene locus_tag LOCUS_30770 3267711 3268010 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036266.1 protein_id gnl|my_center|LOCUS_30770 3268374 3268511 gene locus_tag LOCUS_30780 3268374 3268511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3270500 3268785 gene locus_tag LOCUS_30790 3270500 3268785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3270930 3270493 gene locus_tag LOCUS_30800 3270930 3270493 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_30800 3272765 3270927 gene locus_tag LOCUS_30810 3272765 3270927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3274314 3272770 gene locus_tag LOCUS_30820 3274314 3272770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3275794 3275273 gene locus_tag LOCUS_30830 3275794 3275273 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940903.1 protein_id gnl|my_center|LOCUS_30830 3276469 3276056 gene locus_tag LOCUS_30840 3276469 3276056 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646035.1 protein_id gnl|my_center|LOCUS_30840 3278322 3276703 gene locus_tag LOCUS_30850 3278322 3276703 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_30850 3278527 3279780 gene locus_tag LOCUS_30860 3278527 3279780 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266536.1 protein_id gnl|my_center|LOCUS_30860 3279905 3281413 gene locus_tag LOCUS_30870 gene ilvA 3279905 3281413 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_30870 3281558 3281746 gene locus_tag LOCUS_30880 3281558 3281746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942313.1 protein_id gnl|my_center|LOCUS_30880 3282095 3283714 gene locus_tag LOCUS_30890 3282095 3283714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3283880 3284608 gene locus_tag LOCUS_30900 gene cysE 3283880 3284608 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_30900 3284613 3285047 gene locus_tag LOCUS_30910 3284613 3285047 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_30910 3285077 3286243 gene locus_tag LOCUS_30920 gene nifS 3285077 3286243 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_30920 3286319 3286693 gene locus_tag LOCUS_30930 gene nifU 3286319 3286693 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_30930 3286866 3287951 gene locus_tag LOCUS_30940 gene mnmA 3286866 3287951 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_30940 3287948 3289243 gene locus_tag LOCUS_30950 gene mtaB 3287948 3289243 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_30950 3289254 3290207 gene locus_tag LOCUS_30960 3289254 3290207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3291024 3290131 gene locus_tag LOCUS_30970 3291024 3290131 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082180.1 protein_id gnl|my_center|LOCUS_30970 3291274 3291041 gene locus_tag LOCUS_30980 3291274 3291041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_30980 3291514 3292296 gene locus_tag LOCUS_30990 3291514 3292296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3293629 3292409 gene locus_tag LOCUS_31000 3293629 3292409 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_31000 3293910 3293662 gene locus_tag LOCUS_31010 3293910 3293662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3293845 3296721 gene locus_tag LOCUS_31020 3293845 3296721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3296758 3297462 gene locus_tag LOCUS_31030 3296758 3297462 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_31030 3298896 3298093 gene locus_tag LOCUS_31040 3298896 3298093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31040 3299261 3298968 gene locus_tag LOCUS_31050 3299261 3298968 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_31050 3299697 3300464 gene locus_tag LOCUS_31060 3299697 3300464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3301290 3300574 gene locus_tag LOCUS_31070 3301290 3300574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31070 3301292 3301627 gene locus_tag LOCUS_31080 3301292 3301627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3301827 3301624 gene locus_tag LOCUS_31090 3301827 3301624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3303270 3301960 gene locus_tag LOCUS_31100 3303270 3301960 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_31100 3303406 3304047 gene locus_tag LOCUS_31110 3303406 3304047 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_31110 3304332 3304057 gene locus_tag LOCUS_31120 3304332 3304057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3304988 3304626 gene locus_tag LOCUS_31130 3304988 3304626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3306357 3305071 gene locus_tag LOCUS_31140 3306357 3305071 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 protein_id gnl|my_center|LOCUS_31140 3306932 3307336 gene locus_tag LOCUS_31150 3306932 3307336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943969.1 protein_id gnl|my_center|LOCUS_31150 3309272 3307677 gene locus_tag LOCUS_31160 3309272 3307677 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_31160 3309442 3310785 gene locus_tag LOCUS_31170 gene miaB 3309442 3310785 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_31170 3310820 3312706 gene locus_tag LOCUS_31180 3310820 3312706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3312713 3314185 gene locus_tag LOCUS_31190 3312713 3314185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3314182 3314832 gene locus_tag LOCUS_31200 3314182 3314832 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_31200 3315083 3316153 gene locus_tag LOCUS_31210 3315083 3316153 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_31210 3316357 3317832 gene locus_tag LOCUS_31220 gene guaB 3316357 3317832 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_31220 3317928 3319490 gene locus_tag LOCUS_31230 gene guaA 3317928 3319490 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_31230 3319501 3320262 gene locus_tag LOCUS_31240 3319501 3320262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3320281 3321258 gene locus_tag LOCUS_31250 gene galE 3320281 3321258 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880665.1 protein_id gnl|my_center|LOCUS_31250 3321358 3322725 gene locus_tag LOCUS_31260 3321358 3322725 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_31260 3322758 3323144 gene locus_tag LOCUS_31270 3322758 3323144 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_31270 3323215 3324207 gene locus_tag LOCUS_31280 3323215 3324207 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_31280 3324278 3324706 gene locus_tag LOCUS_31290 3324278 3324706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3324861 3325469 gene locus_tag LOCUS_31300 3324861 3325469 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_31300 3325666 3329136 gene locus_tag LOCUS_31310 gene dnaE 3325666 3329136 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_31310 3329179 3330132 gene locus_tag LOCUS_31320 3329179 3330132 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_31320 3330138 3330971 gene locus_tag LOCUS_31330 3330138 3330971 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_31330 3332143 3331022 gene locus_tag LOCUS_31340 gene tgt 3332143 3331022 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 protein_id gnl|my_center|LOCUS_31340 3332265 3333203 gene locus_tag LOCUS_31350 3332265 3333203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3333271 3333582 gene locus_tag LOCUS_31360 3333271 3333582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3333764 3335638 gene locus_tag LOCUS_31370 gene ftsH 3333764 3335638 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941840.1 protein_id gnl|my_center|LOCUS_31370 3336494 3336099 gene locus_tag LOCUS_31380 3336494 3336099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3337571 3336588 gene locus_tag LOCUS_31390 3337571 3336588 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_31390 3338504 3337656 gene locus_tag LOCUS_31400 3338504 3337656 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941472.1 protein_id gnl|my_center|LOCUS_31400 3338979 3338452 gene locus_tag LOCUS_31410 3338979 3338452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3340492 3338954 gene locus_tag LOCUS_31420 gene citF 3340492 3338954 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_31420 3341399 3340479 gene locus_tag LOCUS_31430 gene citE 3341399 3340479 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547014.1 protein_id gnl|my_center|LOCUS_31430 3341878 3341396 gene locus_tag LOCUS_31440 3341878 3341396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3342145 3341879 gene locus_tag LOCUS_31450 3342145 3341879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 3343170 3342145 gene locus_tag LOCUS_31460 gene citC 3343170 3342145 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098683.1 protein_id gnl|my_center|LOCUS_31460 3344755 3343466 gene locus_tag LOCUS_31470 gene eno 3344755 3343466 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_31470 3345002 3345982 gene locus_tag LOCUS_31480 3345002 3345982 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_31480 3346081 3348423 gene locus_tag LOCUS_31490 3346081 3348423 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_31490 3348437 3348775 gene locus_tag LOCUS_31500 3348437 3348775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3348759 3349484 gene locus_tag LOCUS_31510 3348759 3349484 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_31510 3349601 3350416 gene locus_tag LOCUS_31520 3349601 3350416 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_31520 3350413 3351945 gene locus_tag LOCUS_31530 gene lnt 3350413 3351945 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_31530 3352467 3351961 gene locus_tag LOCUS_31540 3352467 3351961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3352854 3353942 gene locus_tag LOCUS_31550 gene prfB 3352854 3353942 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_31550 3354043 3355524 gene locus_tag LOCUS_31560 gene lysS 3354043 3355524 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_31560 3355563 3356813 gene locus_tag LOCUS_31570 3355563 3356813 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_31570 3356838 3357506 gene locus_tag LOCUS_31580 3356838 3357506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_31580 3357596 3359878 gene locus_tag LOCUS_31590 gene bamA 3357596 3359878 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_31590 3359924 3360445 gene locus_tag LOCUS_31600 3359924 3360445 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_31600 3360486 3361517 gene locus_tag LOCUS_31610 gene lpxD 3360486 3361517 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_31610 3361524 3361967 gene locus_tag LOCUS_31620 gene fabZ 3361524 3361967 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_31620 3361972 3362742 gene locus_tag LOCUS_31630 gene lpxA 3361972 3362742 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_31630 3362760 3363710 gene locus_tag LOCUS_31640 3362760 3363710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_31640 3363863 3364957 gene locus_tag LOCUS_31650 3363863 3364957 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_31650 3364962 3366146 gene locus_tag LOCUS_31660 gene lpxB 3364962 3366146 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_31660 3366143 3367882 gene locus_tag LOCUS_31670 gene msbA 3366143 3367882 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_31670 3367879 3368559 gene locus_tag LOCUS_31680 3367879 3368559 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_31680 3368543 3369853 gene locus_tag LOCUS_31690 3368543 3369853 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_31690 3369850 3370926 gene locus_tag LOCUS_31700 gene lpxK 3369850 3370926 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_31700 3370951 3371118 gene locus_tag LOCUS_31710 3370951 3371118 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_31710 3371148 3372089 gene locus_tag LOCUS_31720 3371148 3372089 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870019.1 protein_id gnl|my_center|LOCUS_31720 3372130 3373128 gene locus_tag LOCUS_31730 gene wbpB 3372130 3373128 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 protein_id gnl|my_center|LOCUS_31730 3373145 3373789 gene locus_tag LOCUS_31740 3373145 3373789 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_31740 3373843 3374949 gene locus_tag LOCUS_31750 gene wbpE 3373843 3374949 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 protein_id gnl|my_center|LOCUS_31750 3375004 3376098 gene locus_tag LOCUS_31760 3375004 3376098 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_31760 3376095 3377102 gene locus_tag LOCUS_31770 3376095 3377102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3377103 3378050 gene locus_tag LOCUS_31780 3377103 3378050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 3378059 3379285 gene locus_tag LOCUS_31790 3378059 3379285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3379376 3380530 gene locus_tag LOCUS_31800 3379376 3380530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3380656 3381246 gene locus_tag LOCUS_31810 3380656 3381246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3381568 3382314 gene locus_tag LOCUS_31820 3381568 3382314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3383512 3382433 gene locus_tag LOCUS_31830 gene waaC 3383512 3382433 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_31830 3383655 3384776 gene locus_tag LOCUS_31840 gene gmd 3383655 3384776 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_31840 3384850 3385233 gene locus_tag LOCUS_31850 3384850 3385233 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_31850 3385305 3386252 gene locus_tag LOCUS_31860 3385305 3386252 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_31860 3386263 3386844 gene locus_tag LOCUS_31870 gene gmhA 3386263 3386844 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_31870 3386841 3387800 gene locus_tag LOCUS_31880 3386841 3387800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_31880 3387808 3389280 gene locus_tag LOCUS_31890 gene rfaE1 3387808 3389280 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_31890 3389300 3389869 gene locus_tag LOCUS_31900 gene gmhB 3389300 3389869 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_31900 3389866 3390894 gene locus_tag LOCUS_31910 3389866 3390894 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_31910 3392352 3390964 gene locus_tag LOCUS_31920 gene thrC 3392352 3390964 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_31920 3394751 3392484 gene locus_tag LOCUS_31930 3394751 3392484 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_31930 3395283 3395777 gene locus_tag LOCUS_31940 3395283 3395777 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_31940 3395833 3396330 gene locus_tag LOCUS_31950 3395833 3396330 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_31950 3396559 3397161 gene locus_tag LOCUS_31960 3396559 3397161 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_31960 3397162 3397575 gene locus_tag LOCUS_31970 3397162 3397575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3397572 3398540 gene locus_tag LOCUS_31980 3397572 3398540 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_31980 3398720 3400711 gene locus_tag LOCUS_31990 3398720 3400711 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942348.1 protein_id gnl|my_center|LOCUS_31990 3401883 3400876 gene locus_tag LOCUS_32000 3401883 3400876 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_32000 3402824 3401880 gene locus_tag LOCUS_32010 3402824 3401880 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072569.1 protein_id gnl|my_center|LOCUS_32010 3402991 3404097 gene locus_tag LOCUS_32020 3402991 3404097 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_32020 3404107 3405456 gene locus_tag LOCUS_32030 3404107 3405456 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_32030 3405478 3405942 gene locus_tag LOCUS_32040 3405478 3405942 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941789.1 protein_id gnl|my_center|LOCUS_32040 3405939 3406343 gene locus_tag LOCUS_32050 3405939 3406343 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813571.1 protein_id gnl|my_center|LOCUS_32050 3406424 3406960 gene locus_tag LOCUS_32060 3406424 3406960 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_32060 3406970 3407719 gene locus_tag LOCUS_32070 3406970 3407719 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_32070 3407781 3408212 gene locus_tag LOCUS_32080 3407781 3408212 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_32080 3408272 3410242 gene locus_tag LOCUS_32090 gene feoB 3408272 3410242 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_32090 3410424 3411071 gene locus_tag LOCUS_32100 3410424 3411071 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_32100 3411623 3411072 gene locus_tag LOCUS_32110 gene amrA 3411623 3411072 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_32110 3412009 3411836 gene locus_tag LOCUS_32120 3412009 3411836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942719.1 protein_id gnl|my_center|LOCUS_32120 3414125 3412314 gene locus_tag LOCUS_32130 gene typA 3414125 3412314 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_32130 3414311 3415621 gene locus_tag LOCUS_32140 3414311 3415621 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_32140 3415621 3416145 gene locus_tag LOCUS_32150 3415621 3416145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3416897 3416220 gene locus_tag LOCUS_32160 3416897 3416220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941338.1 protein_id gnl|my_center|LOCUS_32160 3418050 3416890 gene locus_tag LOCUS_32170 3418050 3416890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_32170 3418446 3418066 gene locus_tag LOCUS_32180 3418446 3418066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3418863 3418540 gene locus_tag LOCUS_32190 3418863 3418540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3419876 3419064 gene locus_tag LOCUS_32200 3419876 3419064 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_32200 3420462 3420199 gene locus_tag LOCUS_32210 3420462 3420199 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943200.1 protein_id gnl|my_center|LOCUS_32210 3421021 3420455 gene locus_tag LOCUS_32220 3421021 3420455 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_32220 3421159 3421881 gene locus_tag LOCUS_32230 3421159 3421881 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_32230 3422456 3421875 gene locus_tag LOCUS_32240 3422456 3421875 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_32240 3423415 3422453 gene locus_tag LOCUS_32250 3423415 3422453 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_32250 3424203 3423415 gene locus_tag LOCUS_32260 3424203 3423415 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_32260 3424791 3424312 gene locus_tag LOCUS_32270 gene arfB 3424791 3424312 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_32270 3427065 3424834 gene locus_tag LOCUS_32280 3427065 3424834 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_32280 3427425 3428798 gene locus_tag LOCUS_32290 gene atoC 3427425 3428798 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_32290 3429003 3429536 gene locus_tag LOCUS_32300 3429003 3429536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3429541 3430371 gene locus_tag LOCUS_32310 3429541 3430371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3430368 3431456 gene locus_tag LOCUS_32320 3430368 3431456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3431584 3432465 gene locus_tag LOCUS_32330 3431584 3432465 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943532.1 protein_id gnl|my_center|LOCUS_32330 3432467 3433015 gene locus_tag LOCUS_32340 3432467 3433015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943531.1 protein_id gnl|my_center|LOCUS_32340 3433027 3434088 gene locus_tag LOCUS_32350 gene yedE 3433027 3434088 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943530.1 protein_id gnl|my_center|LOCUS_32350 3434154 3434468 gene locus_tag LOCUS_32360 3434154 3434468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3434461 3435468 gene locus_tag LOCUS_32370 3434461 3435468 CDS product GeoRSP system radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044909.1 protein_id gnl|my_center|LOCUS_32370 3435715 3436647 gene locus_tag LOCUS_32380 3435715 3436647 CDS product GeoRSP system SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943533.1 protein_id gnl|my_center|LOCUS_32380 3436684 3437835 gene locus_tag LOCUS_32390 3436684 3437835 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_32390 3437864 3438139 gene locus_tag LOCUS_32400 3437864 3438139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3438179 3439495 gene locus_tag LOCUS_32410 3438179 3439495 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_32410 3439576 3440610 gene locus_tag LOCUS_32420 gene tsaD 3439576 3440610 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_32420 3440616 3441113 gene locus_tag LOCUS_32430 3440616 3441113 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_32430 3441141 3441932 gene locus_tag LOCUS_32440 gene rsmA 3441141 3441932 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_32440 3441957 3442829 gene locus_tag LOCUS_32450 3441957 3442829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3443101 3447882 gene locus_tag LOCUS_32460 3443101 3447882 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_32460 3448187 3447930 gene locus_tag LOCUS_32470 3448187 3447930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3448298 3448891 gene locus_tag LOCUS_32480 3448298 3448891 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 protein_id gnl|my_center|LOCUS_32480 3449219 3450022 gene locus_tag LOCUS_32490 gene panB 3449219 3450022 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_32490 3450042 3450902 gene locus_tag LOCUS_32500 gene panC 3450042 3450902 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_32500 3450899 3451294 gene locus_tag LOCUS_32510 3450899 3451294 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948614.1 protein_id gnl|my_center|LOCUS_32510 3451304 3452596 gene locus_tag LOCUS_32520 3451304 3452596 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_32520 3452612 3452686 gene locus_tag LOCUS_t00400 3452612 3452686 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3452978 3453940 gene locus_tag LOCUS_32530 3452978 3453940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941881.1 protein_id gnl|my_center|LOCUS_32530 3453921 3455432 gene locus_tag LOCUS_32540 3453921 3455432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_32540 3455429 3456208 gene locus_tag LOCUS_32550 3455429 3456208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_32550 3456224 3457093 gene locus_tag LOCUS_32560 3456224 3457093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_32560 3457095 3458183 gene locus_tag LOCUS_32570 3457095 3458183 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_32570 3459180 3458269 gene locus_tag LOCUS_32580 3459180 3458269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3460190 3459291 gene locus_tag LOCUS_32590 3460190 3459291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3460717 3460187 gene locus_tag LOCUS_32600 3460717 3460187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3462111 3460714 gene locus_tag LOCUS_32610 3462111 3460714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3463082 3462126 gene locus_tag LOCUS_32620 gene gspK 3463082 3462126 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_32620 3463693 3463079 gene locus_tag LOCUS_32630 3463693 3463079 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053413.1 protein_id gnl|my_center|LOCUS_32630 3464052 3463690 gene locus_tag LOCUS_32640 3464052 3463690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3464591 3464088 gene locus_tag LOCUS_32650 3464591 3464088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3465036 3464596 gene locus_tag LOCUS_32660 gene gspG 3465036 3464596 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_32660 3466360 3465140 gene locus_tag LOCUS_32670 gene gspF 3466360 3465140 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_32670 3468062 3466362 gene locus_tag LOCUS_32680 gene gspE 3468062 3466362 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_32680 3470131 3468059 gene locus_tag LOCUS_32690 gene gspD 3470131 3468059 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_32690 3471221 3470283 gene locus_tag LOCUS_32700 3471221 3470283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3472430 3471423 gene locus_tag LOCUS_32710 3472430 3471423 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_32710 3472512 3472931 gene locus_tag LOCUS_32720 3472512 3472931 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_32720 3473534 3472995 gene locus_tag LOCUS_32730 3473534 3472995 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_32730 3475120 3473534 gene locus_tag LOCUS_32740 3475120 3473534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3475410 3475649 gene locus_tag LOCUS_32750 3475410 3475649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3475788 3477635 gene locus_tag LOCUS_32760 gene htpG 3475788 3477635 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141812.1 protein_id gnl|my_center|LOCUS_32760 3478726 3477716 gene locus_tag LOCUS_32770 3478726 3477716 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_32770 3479833 3478766 gene locus_tag LOCUS_32780 3479833 3478766 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_32780 3480758 3479838 gene locus_tag LOCUS_32790 3480758 3479838 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_32790 3481044 3480745 gene locus_tag LOCUS_32800 3481044 3480745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 3481436 3481083 gene locus_tag LOCUS_32810 3481436 3481083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 3483452 3481638 gene locus_tag LOCUS_32820 3483452 3481638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3484124 3483663 gene locus_tag LOCUS_32830 3484124 3483663 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_32830 3484658 3485278 gene locus_tag LOCUS_32840 3484658 3485278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3486169 3485300 gene locus_tag LOCUS_32850 3486169 3485300 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_32850 3486392 3487465 gene locus_tag LOCUS_32860 3486392 3487465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3488710 3487484 gene locus_tag LOCUS_32870 3488710 3487484 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965297.1 protein_id gnl|my_center|LOCUS_32870 3489518 3488724 gene locus_tag LOCUS_32880 3489518 3488724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3490215 3491069 gene locus_tag LOCUS_32890 3490215 3491069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3492346 3496788 gene locus_tag LOCUS_32900 3492346 3496788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3497185 3497901 gene locus_tag LOCUS_32910 3497185 3497901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3497921 3499273 gene locus_tag LOCUS_32920 3497921 3499273 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942633.1 protein_id gnl|my_center|LOCUS_32920 3499530 3499961 gene locus_tag LOCUS_32930 3499530 3499961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942632.1 protein_id gnl|my_center|LOCUS_32930 3499954 3502608 gene locus_tag LOCUS_32940 3499954 3502608 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_32940 3502617 3503972 gene locus_tag LOCUS_32950 3502617 3503972 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_32950 3504128 3504934 gene locus_tag LOCUS_32960 3504128 3504934 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_32960 3504944 3506551 gene locus_tag LOCUS_32970 3504944 3506551 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_32970 3506572 3507435 gene locus_tag LOCUS_32980 3506572 3507435 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_32980 3508043 3507555 gene locus_tag LOCUS_32990 3508043 3507555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 3508314 3509588 gene locus_tag LOCUS_33000 3508314 3509588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3509797 3510969 gene locus_tag LOCUS_33010 3509797 3510969 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_33010 3510966 3511847 gene locus_tag LOCUS_33020 3510966 3511847 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_33020 3511986 3513029 gene locus_tag LOCUS_33030 3511986 3513029 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_33030 3513123 3514394 gene locus_tag LOCUS_33040 3513123 3514394 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_33040 3514493 3515575 gene locus_tag LOCUS_33050 gene wecB 3514493 3515575 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_33050 3515673 3516914 gene locus_tag LOCUS_33060 3515673 3516914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3518561 3517254 gene locus_tag LOCUS_33070 3518561 3517254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3518925 3519158 gene locus_tag LOCUS_33080 3518925 3519158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3519158 3519460 gene locus_tag LOCUS_33090 3519158 3519460 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330696.1 protein_id gnl|my_center|LOCUS_33090 3519722 3520039 gene locus_tag LOCUS_33100 3519722 3520039 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_33100 3520026 3520409 gene locus_tag LOCUS_33110 3520026 3520409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3520675 3520860 gene locus_tag LOCUS_33120 3520675 3520860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3520848 3521144 gene locus_tag LOCUS_33130 3520848 3521144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3521392 3521808 gene locus_tag LOCUS_33140 3521392 3521808 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 protein_id gnl|my_center|LOCUS_33140 3521796 3522242 gene locus_tag LOCUS_33150 3521796 3522242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3522602 3522895 gene locus_tag LOCUS_33160 3522602 3522895 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_33160 3522892 3523230 gene locus_tag LOCUS_33170 3522892 3523230 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_33170 3523263 3524483 gene locus_tag LOCUS_33180 3523263 3524483 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_33180 3524868 3525113 gene locus_tag LOCUS_33190 3524868 3525113 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_33190 3525067 3525348 gene locus_tag LOCUS_33200 3525067 3525348 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_33200 3525664 3526005 gene locus_tag LOCUS_33210 3525664 3526005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3526002 3526391 gene locus_tag LOCUS_33220 3526002 3526391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3526872 3527108 gene locus_tag LOCUS_33230 3526872 3527108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 3527113 3527313 gene locus_tag LOCUS_33240 3527113 3527313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3527759 3528598 gene locus_tag LOCUS_33250 3527759 3528598 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_33250 3528667 3528924 gene locus_tag LOCUS_33260 3528667 3528924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3529536 3529318 gene locus_tag LOCUS_33270 3529536 3529318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3530023 3530385 gene locus_tag LOCUS_33280 3530023 3530385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3530442 3531938 gene locus_tag LOCUS_33290 3530442 3531938 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528104.1 protein_id gnl|my_center|LOCUS_33290 3531957 3533231 gene locus_tag LOCUS_33300 3531957 3533231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3533303 3534094 gene locus_tag LOCUS_33310 3533303 3534094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3534148 3535119 gene locus_tag LOCUS_33320 3534148 3535119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3535151 3536263 gene locus_tag LOCUS_33330 3535151 3536263 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_33330 3536940 3537611 gene locus_tag LOCUS_33340 3536940 3537611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3537679 3538650 gene locus_tag LOCUS_33350 3537679 3538650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3538654 3540000 gene locus_tag LOCUS_33360 3538654 3540000 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_33360 3540078 3541013 gene locus_tag LOCUS_33370 3540078 3541013 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029280.1 protein_id gnl|my_center|LOCUS_33370 3541010 3542152 gene locus_tag LOCUS_33380 3541010 3542152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 3542262 3542993 gene locus_tag LOCUS_33390 3542262 3542993 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_33390 3543214 3543594 gene locus_tag LOCUS_33400 3543214 3543594 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_33400 3543591 3543857 gene locus_tag LOCUS_33410 3543591 3543857 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_33410 3543955 3544758 gene locus_tag LOCUS_33420 3543955 3544758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33420 3544959 3545669 gene locus_tag LOCUS_33430 3544959 3545669 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_33430 3545748 3545915 gene locus_tag LOCUS_33440 3545748 3545915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3546072 3547061 gene locus_tag LOCUS_33450 3546072 3547061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 3547098 3549251 gene locus_tag LOCUS_33460 3547098 3549251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3549248 3550375 gene locus_tag LOCUS_33470 3549248 3550375 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_33470 3550365 3551600 gene locus_tag LOCUS_33480 3550365 3551600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3551607 3552734 gene locus_tag LOCUS_33490 3551607 3552734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3552755 3553942 gene locus_tag LOCUS_33500 3552755 3553942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3554492 3554226 gene locus_tag LOCUS_33510 3554492 3554226 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_33510 3554691 3554470 gene locus_tag LOCUS_33520 3554691 3554470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3555201 3555461 gene locus_tag LOCUS_33530 3555201 3555461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3555984 3555700 gene locus_tag LOCUS_33540 3555984 3555700 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_33540 3556428 3559157 gene locus_tag LOCUS_33550 3556428 3559157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 3559157 3560398 gene locus_tag LOCUS_33560 3559157 3560398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3560619 3561443 gene locus_tag LOCUS_33570 3560619 3561443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3561932 3561528 gene locus_tag LOCUS_33580 3561932 3561528 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142297.1 protein_id gnl|my_center|LOCUS_33580 3562165 3561929 gene locus_tag LOCUS_33590 3562165 3561929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 3562548 3564440 gene locus_tag LOCUS_33600 3562548 3564440 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_33600 3564701 3566008 gene locus_tag LOCUS_33610 3564701 3566008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 3566223 3567572 gene locus_tag LOCUS_33620 3566223 3567572 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_33620 3568427 3568026 gene locus_tag LOCUS_33630 3568427 3568026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3568699 3568424 gene locus_tag LOCUS_33640 3568699 3568424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3568823 3569059 gene locus_tag LOCUS_33650 3568823 3569059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3570080 3569040 gene locus_tag LOCUS_33660 3570080 3569040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 3570595 3570077 gene locus_tag LOCUS_33670 3570595 3570077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 3571091 3571240 gene locus_tag LOCUS_33680 3571091 3571240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33680 3571770 3573035 gene locus_tag LOCUS_33690 3571770 3573035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3573302 3574096 gene locus_tag LOCUS_33700 gene xrt 3573302 3574096 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_33700 3574089 3574715 gene locus_tag LOCUS_33710 3574089 3574715 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_33710 3574712 3576742 gene locus_tag LOCUS_33720 gene prsK 3574712 3576742 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_33720 3576806 3577177 gene locus_tag LOCUS_33730 3576806 3577177 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_33730 3577228 3578616 gene locus_tag LOCUS_33740 gene prsR 3577228 3578616 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_33740 3580950 3578698 gene locus_tag LOCUS_33750 3580950 3578698 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942584.1 protein_id gnl|my_center|LOCUS_33750 3581627 3581382 gene locus_tag LOCUS_33760 3581627 3581382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3582424 3581615 gene locus_tag LOCUS_33770 gene istB 3582424 3581615 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_33770 3583862 3582414 gene locus_tag LOCUS_33780 gene istA 3583862 3582414 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_33780 3584208 3585962 gene locus_tag LOCUS_33790 3584208 3585962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3586795 3586049 gene locus_tag LOCUS_33800 3586795 3586049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 3587874 3588641 gene locus_tag LOCUS_33810 3587874 3588641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 3589168 3588704 gene locus_tag LOCUS_33820 3589168 3588704 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_33820 3589467 3589255 gene locus_tag LOCUS_33830 3589467 3589255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3589710 3589796 gene locus_tag LOCUS_t00410 3589710 3589796 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3589981 3590430 gene locus_tag LOCUS_33840 3589981 3590430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3590427 3592625 gene locus_tag LOCUS_33850 3590427 3592625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 3593531 3592647 gene locus_tag LOCUS_33860 gene carH 3593531 3592647 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_33860 3593636 3594046 gene locus_tag LOCUS_33870 3593636 3594046 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_33870 3594058 3594849 gene locus_tag LOCUS_33880 3594058 3594849 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_33880 3594842 3596122 gene locus_tag LOCUS_33890 3594842 3596122 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_33890 3596119 3598089 gene locus_tag LOCUS_33900 3596119 3598089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 3598101 3598436 gene locus_tag LOCUS_33910 3598101 3598436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3598536 3598874 gene locus_tag LOCUS_33920 3598536 3598874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3599166 3598828 gene locus_tag LOCUS_33930 3599166 3598828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3599586 3599335 gene locus_tag LOCUS_33940 3599586 3599335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022267.1 protein_id gnl|my_center|LOCUS_33940 3600399 3599815 gene locus_tag LOCUS_33950 3600399 3599815 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941388.1 protein_id gnl|my_center|LOCUS_33950 3600536 3601216 gene locus_tag LOCUS_33960 3600536 3601216 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_33960 3601385 3601747 gene locus_tag LOCUS_33970 3601385 3601747 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943861.1 protein_id gnl|my_center|LOCUS_33970 3601999 3602745 gene locus_tag LOCUS_33980 3601999 3602745 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_33980 3603062 3603454 gene locus_tag LOCUS_33990 3603062 3603454 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_33990 3603533 3604078 gene locus_tag LOCUS_34000 gene cobO 3603533 3604078 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_34000 3604148 3604552 gene locus_tag LOCUS_34010 3604148 3604552 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_34010 3604564 3605505 gene locus_tag LOCUS_34020 gene meaB 3604564 3605505 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_34020 3605585 3605659 gene locus_tag LOCUS_t00420 3605585 3605659 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3607231 3605885 gene locus_tag LOCUS_34030 3607231 3605885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3607554 3607955 gene locus_tag LOCUS_34040 3607554 3607955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 3608133 3608720 gene locus_tag LOCUS_34050 3608133 3608720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 3608778 3609500 gene locus_tag LOCUS_34060 3608778 3609500 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_34060 3609548 3610768 gene locus_tag LOCUS_34070 3609548 3610768 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_34070 3610765 3612255 gene locus_tag LOCUS_34080 3610765 3612255 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_34080 3612246 3613481 gene locus_tag LOCUS_34090 3612246 3613481 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_34090 3613474 3613731 gene locus_tag LOCUS_34100 3613474 3613731 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_34100 3613744 3614547 gene locus_tag LOCUS_34110 3613744 3614547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3614550 3615884 gene locus_tag LOCUS_34120 3614550 3615884 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_34120 3615887 3617518 gene locus_tag LOCUS_34130 gene hutH 3615887 3617518 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 protein_id gnl|my_center|LOCUS_34130 3617589 3617978 gene locus_tag LOCUS_34140 3617589 3617978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 3617975 3618592 gene locus_tag LOCUS_34150 3617975 3618592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3618741 3620966 gene locus_tag LOCUS_34160 3618741 3620966 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941123.1 protein_id gnl|my_center|LOCUS_34160 3621164 3621652 gene locus_tag LOCUS_34170 3621164 3621652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3621633 3622010 gene locus_tag LOCUS_34180 3621633 3622010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 3622016 3622477 gene locus_tag LOCUS_34190 3622016 3622477 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_34190 3622474 3623607 gene locus_tag LOCUS_34200 3622474 3623607 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_34200 3623604 3624311 gene locus_tag LOCUS_34210 3623604 3624311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3625580 3624498 gene locus_tag LOCUS_34220 3625580 3624498 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_34220 3625701 3626330 gene locus_tag LOCUS_34230 3625701 3626330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3626394 3627665 gene locus_tag LOCUS_34240 3626394 3627665 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_34240 3627662 3629038 gene locus_tag LOCUS_34250 3627662 3629038 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_34250 3629035 3630495 gene locus_tag LOCUS_34260 3629035 3630495 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_34260 3630488 3631657 gene locus_tag LOCUS_34270 3630488 3631657 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_34270 3631740 3632612 gene locus_tag LOCUS_34280 3631740 3632612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 3632616 3632870 gene locus_tag LOCUS_34290 3632616 3632870 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_34290 3632867 3634069 gene locus_tag LOCUS_34300 3632867 3634069 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_34300 3634066 3635142 gene locus_tag LOCUS_34310 3634066 3635142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3635180 3635701 gene locus_tag LOCUS_34320 3635180 3635701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 3635717 3636154 gene locus_tag LOCUS_34330 3635717 3636154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 protein_id gnl|my_center|LOCUS_34330 3636223 3637158 gene locus_tag LOCUS_34340 3636223 3637158 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_34340 3637434 3637988 gene locus_tag LOCUS_34350 3637434 3637988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3638047 3639375 gene locus_tag LOCUS_34360 3638047 3639375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_34360 3639587 3639856 gene locus_tag LOCUS_34370 3639587 3639856 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 protein_id gnl|my_center|LOCUS_34370 3640013 3640531 gene locus_tag LOCUS_34380 3640013 3640531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3641752 3640604 gene locus_tag LOCUS_34390 3641752 3640604 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_34390 3643063 3641768 gene locus_tag LOCUS_34400 3643063 3641768 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965310.1 protein_id gnl|my_center|LOCUS_34400 3643651 3643229 gene locus_tag LOCUS_34410 3643651 3643229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 3644252 3645703 gene locus_tag LOCUS_34420 3644252 3645703 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_34420 3647999 3645843 gene locus_tag LOCUS_34430 3647999 3645843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 3648487 3648720 gene locus_tag LOCUS_34440 3648487 3648720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 3648762 3649484 gene locus_tag LOCUS_34450 3648762 3649484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020975.1 protein_id gnl|my_center|LOCUS_34450 3649471 3650406 gene locus_tag LOCUS_34460 3649471 3650406 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_34460 3650423 3651490 gene locus_tag LOCUS_34470 3650423 3651490 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941716.1 protein_id gnl|my_center|LOCUS_34470 3651498 3651755 gene locus_tag LOCUS_34480 3651498 3651755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3651752 3653149 gene locus_tag LOCUS_34490 3651752 3653149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34490 3653153 3654496 gene locus_tag LOCUS_34500 3653153 3654496 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_34500 3654713 3655552 gene locus_tag LOCUS_34510 3654713 3655552 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546663.1 protein_id gnl|my_center|LOCUS_34510 3656200 3655691 gene locus_tag LOCUS_34520 3656200 3655691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 3656754 3656197 gene locus_tag LOCUS_34530 3656754 3656197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3658429 3657089 gene locus_tag LOCUS_34540 gene zraR 3658429 3657089 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_34540 3659681 3658422 gene locus_tag LOCUS_34550 3659681 3658422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3660019 3659672 gene locus_tag LOCUS_34560 3660019 3659672 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_34560 3660186 3660593 gene locus_tag LOCUS_34570 3660186 3660593 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670476.1 protein_id gnl|my_center|LOCUS_34570 3660778 3661770 gene locus_tag LOCUS_34580 3660778 3661770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256430.1 protein_id gnl|my_center|LOCUS_34580 3661921 3665517 gene locus_tag LOCUS_34590 3661921 3665517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3665720 3666502 gene locus_tag LOCUS_34600 gene map 3665720 3666502 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_34600 3666868 3666671 gene locus_tag LOCUS_34610 3666868 3666671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942210.1 protein_id gnl|my_center|LOCUS_34610 3667139 3667053 gene locus_tag LOCUS_t00430 3667139 3667053 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3667562 3667194 gene locus_tag LOCUS_34620 gene secG 3667562 3667194 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_34620 3668401 3667643 gene locus_tag LOCUS_34630 gene tpiA 3668401 3667643 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_34630 3669607 3668417 gene locus_tag LOCUS_34640 3669607 3668417 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_34640 3670698 3669697 gene locus_tag LOCUS_34650 gene gap 3670698 3669697 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_34650 3671015 3671788 gene locus_tag LOCUS_34660 3671015 3671788 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_34660 3671995 3673290 gene locus_tag LOCUS_34670 gene purB 3671995 3673290 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 protein_id gnl|my_center|LOCUS_34670 3673389 3676379 gene locus_tag LOCUS_34680 3673389 3676379 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_34680 3676384 3677214 gene locus_tag LOCUS_34690 3676384 3677214 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_34690 3677324 3678733 gene locus_tag LOCUS_34700 gene purF 3677324 3678733 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_34700 3678862 3679419 gene locus_tag LOCUS_34710 gene pyrE 3678862 3679419 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_34710 3679693 3679484 gene locus_tag LOCUS_34720 3679693 3679484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942473.1 protein_id gnl|my_center|LOCUS_34720 3679968 3679696 gene locus_tag LOCUS_34730 3679968 3679696 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_34730 3681608 3680010 gene locus_tag LOCUS_34740 gene nadB 3681608 3680010 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_34740 3681859 3682395 gene locus_tag LOCUS_34750 3681859 3682395 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_34750 3682473 3682547 gene locus_tag LOCUS_t00440 3682473 3682547 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3682792 3682956 gene locus_tag LOCUS_34760 3682792 3682956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 3682953 3683615 gene locus_tag LOCUS_34770 3682953 3683615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3683881 3684429 gene locus_tag LOCUS_34780 3683881 3684429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3684445 3685263 gene locus_tag LOCUS_34790 gene xthA 3684445 3685263 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942186.1 protein_id gnl|my_center|LOCUS_34790 3685275 3685691 gene locus_tag LOCUS_34800 3685275 3685691 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_34800 3687877 3685688 gene locus_tag LOCUS_34810 3687877 3685688 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_34810 3689973 3687874 gene locus_tag LOCUS_34820 gene glgX 3689973 3687874 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_34820 3690873 3689998 gene locus_tag LOCUS_34830 3690873 3689998 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943761.1 protein_id gnl|my_center|LOCUS_34830 3692939 3690870 gene locus_tag LOCUS_34840 3692939 3690870 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_34840 3693557 3692997 gene locus_tag LOCUS_34850 3693557 3692997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 3694109 3693582 gene locus_tag LOCUS_34860 3694109 3693582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 3694269 3695819 gene locus_tag LOCUS_34870 3694269 3695819 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_34870 3695842 3697209 gene locus_tag LOCUS_34880 gene lat 3695842 3697209 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_34880 3697242 3698591 gene locus_tag LOCUS_34890 3697242 3698591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3698657 3700120 gene locus_tag LOCUS_34900 3698657 3700120 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_34900 3700144 3701448 gene locus_tag LOCUS_34910 3700144 3701448 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_34910 3701778 3702878 gene locus_tag LOCUS_34920 3701778 3702878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 3702944 3703972 gene locus_tag LOCUS_34930 3702944 3703972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 3704082 3704570 gene locus_tag LOCUS_34940 3704082 3704570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 3704733 3704882 gene locus_tag LOCUS_34950 3704733 3704882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 3705150 3705962 gene locus_tag LOCUS_34960 gene moeB 3705150 3705962 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_34960 3706003 3706953 gene locus_tag LOCUS_34970 3706003 3706953 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_34970 3706963 3707193 gene locus_tag LOCUS_34980 3706963 3707193 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942005.1 protein_id gnl|my_center|LOCUS_34980 3707340 3709601 gene locus_tag LOCUS_34990 gene copA 3707340 3709601 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_34990 3709721 3709948 gene locus_tag LOCUS_35000 3709721 3709948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 3709949 3710236 gene locus_tag LOCUS_35010 3709949 3710236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35010 3710755 3710255 gene locus_tag LOCUS_35020 3710755 3710255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3711824 3710778 gene locus_tag LOCUS_35030 3711824 3710778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3712312 3711821 gene locus_tag LOCUS_35040 3712312 3711821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3713853 3712309 gene locus_tag LOCUS_35050 3713853 3712309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3714994 3713972 gene locus_tag LOCUS_35060 3714994 3713972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3715294 3716562 gene locus_tag LOCUS_35070 3715294 3716562 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_35070 3716658 3718106 gene locus_tag LOCUS_35080 3716658 3718106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3718273 3721503 gene locus_tag LOCUS_35090 3718273 3721503 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_35090 3721718 3722263 gene locus_tag LOCUS_35100 3721718 3722263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3723013 3722525 gene locus_tag LOCUS_35110 3723013 3722525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3723537 3725312 gene locus_tag LOCUS_35120 3723537 3725312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3725299 3726855 gene locus_tag LOCUS_35130 3725299 3726855 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_35130 3726852 3727553 gene locus_tag LOCUS_35140 3726852 3727553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_35140 3727557 3728825 gene locus_tag LOCUS_35150 3727557 3728825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_35150 3729218 3728949 gene locus_tag LOCUS_35160 3729218 3728949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3729402 3730100 gene locus_tag LOCUS_35170 3729402 3730100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_35170 3730127 3731545 gene locus_tag LOCUS_35180 3730127 3731545 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_35180 3731599 3732000 gene locus_tag LOCUS_35190 3731599 3732000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3732091 3733425 gene locus_tag LOCUS_35200 3732091 3733425 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_35200 3734543 3733422 gene locus_tag LOCUS_35210 3734543 3733422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3736218 3734581 gene locus_tag LOCUS_35220 3736218 3734581 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943864.1 protein_id gnl|my_center|LOCUS_35220 3736628 3736320 gene locus_tag LOCUS_35230 3736628 3736320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3736846 3739488 gene locus_tag LOCUS_35240 gene pepN 3736846 3739488 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_35240 3739512 3740408 gene locus_tag LOCUS_35250 3739512 3740408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_35250 3740411 3740641 gene locus_tag LOCUS_35260 3740411 3740641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3740687 3742300 gene locus_tag LOCUS_35270 3740687 3742300 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 protein_id gnl|my_center|LOCUS_35270 3742328 3743842 gene locus_tag LOCUS_35280 gene glpK 3742328 3743842 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_35280 3744182 3745021 gene locus_tag LOCUS_35290 3744182 3745021 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_35290 3745379 3745573 gene locus_tag LOCUS_35300 3745379 3745573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3746916 3745570 gene locus_tag LOCUS_35310 gene bioA 3746916 3745570 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_35310 3747686 3746937 gene locus_tag LOCUS_35320 gene bioD 3747686 3746937 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_35320 3748650 3747676 gene locus_tag LOCUS_35330 gene bioB 3748650 3747676 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_35330 3748862 3749428 gene locus_tag LOCUS_35340 3748862 3749428 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_35340 3749514 3750080 gene locus_tag LOCUS_35350 3749514 3750080 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_35350 3750103 3751362 gene locus_tag LOCUS_35360 3750103 3751362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 3751541 3751825 gene locus_tag LOCUS_35370 3751541 3751825 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_35370 3751996 3752532 gene locus_tag LOCUS_35380 3751996 3752532 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_35380 3752623 3754125 gene locus_tag LOCUS_35390 3752623 3754125 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942390.1 protein_id gnl|my_center|LOCUS_35390 3754122 3754598 gene locus_tag LOCUS_35400 3754122 3754598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 3754612 3755097 gene locus_tag LOCUS_35410 3754612 3755097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3755099 3755740 gene locus_tag LOCUS_35420 3755099 3755740 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942388.1 protein_id gnl|my_center|LOCUS_35420 3755844 3757544 gene locus_tag LOCUS_35430 3755844 3757544 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_35430 3757695 3759464 gene locus_tag LOCUS_35440 gene iorA 3757695 3759464 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_35440 3759454 3760032 gene locus_tag LOCUS_35450 3759454 3760032 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_35450 3760091 3761395 gene locus_tag LOCUS_35460 3760091 3761395 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_35460 3761420 3761851 gene locus_tag LOCUS_35470 3761420 3761851 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_35470 3761912 3763213 gene locus_tag LOCUS_35480 3761912 3763213 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_35480 3763313 3763389 gene locus_tag LOCUS_t00450 3763313 3763389 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3763668 3764762 gene locus_tag LOCUS_35490 3763668 3764762 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_35490 3766701 3764848 gene locus_tag LOCUS_35500 3766701 3764848 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_35500 3767387 3766698 gene locus_tag LOCUS_35510 3767387 3766698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3768079 3767387 gene locus_tag LOCUS_35520 3768079 3767387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 3768543 3768094 gene locus_tag LOCUS_35530 3768543 3768094 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_35530 3770341 3768536 gene locus_tag LOCUS_35540 3770341 3768536 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_35540 3770949 3770344 gene locus_tag LOCUS_35550 3770949 3770344 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_35550 3772349 3770949 gene locus_tag LOCUS_35560 3772349 3770949 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_35560 3772831 3773244 gene locus_tag LOCUS_35570 gene crcB 3772831 3773244 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085425.1 protein_id gnl|my_center|LOCUS_35570 3773298 3773636 gene locus_tag LOCUS_35580 3773298 3773636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3773640 3773981 gene locus_tag LOCUS_35590 3773640 3773981 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_35590 3775060 3774053 gene locus_tag LOCUS_35600 3775060 3774053 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_35600 3775989 3775183 gene locus_tag LOCUS_35610 3775989 3775183 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_35610 3778389 3776239 gene locus_tag LOCUS_35620 gene recG 3778389 3776239 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_35620 3778617 3778405 gene locus_tag LOCUS_35630 3778617 3778405 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941933.1 protein_id gnl|my_center|LOCUS_35630 3779217 3778741 gene locus_tag LOCUS_35640 gene greA 3779217 3778741 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_35640 3782565 3779308 gene locus_tag LOCUS_35650 gene carB 3782565 3779308 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_35650 3783753 3782620 gene locus_tag LOCUS_35660 gene carA 3783753 3782620 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_35660 3785042 3783771 gene locus_tag LOCUS_35670 3785042 3783771 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_35670 3786001 3785072 gene locus_tag LOCUS_35680 3786001 3785072 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_35680 3786552 3786025 gene locus_tag LOCUS_35690 gene pyrR 3786552 3786025 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_35690 3787456 3786794 gene locus_tag LOCUS_35700 gene lepB 3787456 3786794 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_35700 3789259 3787460 gene locus_tag LOCUS_35710 gene lepA 3789259 3787460 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_35710 3790016 3789345 gene locus_tag LOCUS_35720 3790016 3789345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3791155 3790046 gene locus_tag LOCUS_35730 3791155 3790046 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 protein_id gnl|my_center|LOCUS_35730 3791768 3791220 gene locus_tag LOCUS_35740 3791768 3791220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3792313 3791768 gene locus_tag LOCUS_35750 3792313 3791768 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_35750 3793081 3792401 gene locus_tag LOCUS_35760 3793081 3792401 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_35760 3793484 3793134 gene locus_tag LOCUS_35770 3793484 3793134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3793747 3794787 gene locus_tag LOCUS_35780 3793747 3794787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 3795064 3794795 gene locus_tag LOCUS_35790 3795064 3794795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 3795134 3796720 gene locus_tag LOCUS_35800 3795134 3796720 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941960.1 protein_id gnl|my_center|LOCUS_35800 3796717 3797568 gene locus_tag LOCUS_35810 3796717 3797568 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_35810 3797837 3797586 gene locus_tag LOCUS_35820 3797837 3797586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3798615 3797854 gene locus_tag LOCUS_35830 gene hisF 3798615 3797854 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_35830 3798913 3798647 gene locus_tag LOCUS_35840 3798913 3798647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3799104 3800519 gene locus_tag LOCUS_35850 3799104 3800519 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_35850 3800549 3802048 gene locus_tag LOCUS_35860 gene cls 3800549 3802048 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340260.1 protein_id gnl|my_center|LOCUS_35860 3803345 3802059 gene locus_tag LOCUS_35870 3803345 3802059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941247.1 protein_id gnl|my_center|LOCUS_35870 3804655 3803438 gene locus_tag LOCUS_35880 3804655 3803438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3805654 3804755 gene locus_tag LOCUS_35890 3805654 3804755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 3805889 3807613 gene locus_tag LOCUS_35900 gene glgP 3805889 3807613 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_35900 3808047 3807700 gene locus_tag LOCUS_35910 3808047 3807700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 3810114 3808075 gene locus_tag LOCUS_35920 3810114 3808075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3810267 3810593 gene locus_tag LOCUS_35930 gene yhbY 3810267 3810593 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_35930 3812630 3810567 gene locus_tag LOCUS_35940 3812630 3810567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 3814110 3812974 gene locus_tag LOCUS_35950 3814110 3812974 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_35950 3814221 3814811 gene locus_tag LOCUS_35960 gene rsmD 3814221 3814811 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_35960 3814808 3815305 gene locus_tag LOCUS_35970 gene coaD 3814808 3815305 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_35970 3815324 3815521 gene locus_tag LOCUS_35980 3815324 3815521 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941897.1 protein_id gnl|my_center|LOCUS_35980 3816247 3815531 gene locus_tag LOCUS_35990 3816247 3815531 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_35990 3816967 3816278 gene locus_tag LOCUS_36000 3816967 3816278 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_36000 3817382 3817011 gene locus_tag LOCUS_36010 gene queD 3817382 3817011 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_36010 3817587 3817399 gene locus_tag LOCUS_36020 3817587 3817399 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360265.1 protein_id gnl|my_center|LOCUS_36020 3817778 3818866 gene locus_tag LOCUS_36030 3817778 3818866 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_36030 3818997 3818921 gene locus_tag LOCUS_t00460 3818997 3818921 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3819740 3819222 gene locus_tag LOCUS_36040 3819740 3819222 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_36040 3820770 3819793 gene locus_tag LOCUS_36050 3820770 3819793 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942172.1 protein_id gnl|my_center|LOCUS_36050 3821634 3820843 gene locus_tag LOCUS_36060 3821634 3820843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3822303 3821710 gene locus_tag LOCUS_36070 3822303 3821710 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_36070 3822960 3822307 gene locus_tag LOCUS_36080 3822960 3822307 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_36080 3823743 3822970 gene locus_tag LOCUS_36090 gene surE 3823743 3822970 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_36090 3824133 3823750 gene locus_tag LOCUS_36100 3824133 3823750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3824461 3824183 gene locus_tag LOCUS_36110 3824461 3824183 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_36110 3826960 3824543 gene locus_tag LOCUS_36120 gene pheT 3826960 3824543 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_36120 3828035 3827019 gene locus_tag LOCUS_36130 gene pheS 3828035 3827019 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_36130 3828561 3828205 gene locus_tag LOCUS_36140 gene rplT 3828561 3828205 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_36140 3828887 3828690 gene locus_tag LOCUS_36150 gene rpmI 3828887 3828690 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_36150 3829257 3828919 gene locus_tag LOCUS_36160 3829257 3828919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3829144 3829452 gene locus_tag LOCUS_36170 3829144 3829452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 3831230 3829449 gene locus_tag LOCUS_36180 gene thrS 3831230 3829449 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_36180 3831117 3831344 gene locus_tag LOCUS_36190 3831117 3831344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3831510 3831436 gene locus_tag LOCUS_t00470 3831510 3831436 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3832970 3831660 gene locus_tag LOCUS_36200 3832970 3831660 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_36200 3833405 3833043 gene locus_tag LOCUS_36210 3833405 3833043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 3834022 3833510 gene locus_tag LOCUS_36220 gene nusB 3834022 3833510 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_36220 3834543 3834079 gene locus_tag LOCUS_36230 gene ribE 3834543 3834079 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_36230 3835773 3834568 gene locus_tag LOCUS_36240 3835773 3834568 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_36240 3836456 3835806 gene locus_tag LOCUS_36250 3836456 3835806 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_36250 3837546 3836437 gene locus_tag LOCUS_36260 gene ribD 3837546 3836437 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_36260 3838090 3837629 gene locus_tag LOCUS_36270 gene nrdR 3838090 3837629 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_36270 3838566 3838087 gene locus_tag LOCUS_36280 3838566 3838087 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_36280 3839828 3838578 gene locus_tag LOCUS_36290 3839828 3838578 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_36290 3840527 3840069 gene locus_tag LOCUS_36300 gene rpiB 3840527 3840069 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_36300 3841853 3840621 gene locus_tag LOCUS_36310 gene fabF 3841853 3840621 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_36310 3842214 3841981 gene locus_tag LOCUS_36320 gene acpP 3842214 3841981 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_36320 3843011 3842274 gene locus_tag LOCUS_36330 gene fabG 3843011 3842274 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_36330 3843936 3843022 gene locus_tag LOCUS_36340 gene fabD 3843936 3843022 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_36340 3844952 3843972 gene locus_tag LOCUS_36350 3844952 3843972 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_36350 3846036 3844975 gene locus_tag LOCUS_36360 gene plsX 3846036 3844975 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_36360 3846231 3846049 gene locus_tag LOCUS_36370 gene rpmF 3846231 3846049 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_36370 3846853 3846308 gene locus_tag LOCUS_36380 3846853 3846308 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_36380 3847109 3847807 gene locus_tag LOCUS_36390 gene mazG 3847109 3847807 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_36390 3848026 3848418 gene locus_tag LOCUS_36400 3848026 3848418 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_36400 3848965 3848399 gene locus_tag LOCUS_36410 3848965 3848399 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645658.1 protein_id gnl|my_center|LOCUS_36410 3850544 3848955 gene locus_tag LOCUS_36420 gene murJ 3850544 3848955 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_36420 3850777 3851040 gene locus_tag LOCUS_36430 gene rpsT 3850777 3851040 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_36430 3852099 3851095 gene locus_tag LOCUS_36440 gene holA 3852099 3851095 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_36440 3852724 3852215 gene locus_tag LOCUS_36450 3852724 3852215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3855296 3852741 gene locus_tag LOCUS_36460 gene leuS 3855296 3852741 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_36460 3855682 3855464 gene locus_tag LOCUS_36470 gene infA 3855682 3855464 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_36470 3857048 3855933 gene locus_tag LOCUS_36480 3857048 3855933 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_36480 3857926 3857045 gene locus_tag LOCUS_36490 3857926 3857045 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_36490 3859949 3857934 gene locus_tag LOCUS_36500 3859949 3857934 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942856.1 protein_id gnl|my_center|LOCUS_36500 3860574 3860056 gene locus_tag LOCUS_36510 3860574 3860056 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942858.1 protein_id gnl|my_center|LOCUS_36510 3860939 3860571 gene locus_tag LOCUS_36520 3860939 3860571 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942859.1 protein_id gnl|my_center|LOCUS_36520 3861687 3860953 gene locus_tag LOCUS_36530 3861687 3860953 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942860.1 protein_id gnl|my_center|LOCUS_36530 3862579 3861773 gene locus_tag LOCUS_36540 3862579 3861773 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_36540 3864614 3862572 gene locus_tag LOCUS_36550 3864614 3862572 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_36550 3864993 3864625 gene locus_tag LOCUS_36560 3864993 3864625 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_36560 3866613 3865300 gene locus_tag LOCUS_36570 gene der 3866613 3865300 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_36570 3867582 3866677 gene locus_tag LOCUS_36580 gene era 3867582 3866677 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_36580 3868298 3867579 gene locus_tag LOCUS_36590 gene rnc 3868298 3867579 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_36590 3868473 3869123 gene locus_tag LOCUS_36600 gene tmk 3868473 3869123 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_36600 3869120 3870085 gene locus_tag LOCUS_36610 gene holB 3869120 3870085 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_36610 3870229 3871347 gene locus_tag LOCUS_36620 3870229 3871347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 3871361 3872893 gene locus_tag LOCUS_36630 gene metG 3871361 3872893 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_36630 3872960 3874345 gene locus_tag LOCUS_36640 3872960 3874345 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_36640 3874737 3874456 gene locus_tag LOCUS_36650 3874737 3874456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 3877874 3874752 gene locus_tag LOCUS_36660 3877874 3874752 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_36660 3878944 3877874 gene locus_tag LOCUS_36670 3878944 3877874 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_36670 3879723 3879340 gene locus_tag LOCUS_36680 3879723 3879340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 3881438 3879798 gene locus_tag LOCUS_36690 gene hcp 3881438 3879798 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_36690 3884277 3881740 gene locus_tag LOCUS_36700 3884277 3881740 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 protein_id gnl|my_center|LOCUS_36700 3884438 3884364 gene locus_tag LOCUS_t00480 3884438 3884364 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3885772 3884480 gene locus_tag LOCUS_36710 3885772 3884480 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942824.1 protein_id gnl|my_center|LOCUS_36710 3887132 3885828 gene locus_tag LOCUS_36720 3887132 3885828 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_36720 3888117 3887260 gene locus_tag LOCUS_36730 3888117 3887260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 3888248 3889138 gene locus_tag LOCUS_36740 3888248 3889138 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_36740 3890728 3889319 gene locus_tag LOCUS_36750 gene glnA 3890728 3889319 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_36750 3891163 3890825 gene locus_tag LOCUS_36760 3891163 3890825 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_36760 3891593 3893263 gene locus_tag LOCUS_36770 3891593 3893263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3893411 3894205 gene locus_tag LOCUS_36780 gene lpxA 3893411 3894205 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_36780 3894656 3894237 gene locus_tag LOCUS_36790 3894656 3894237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3896421 3894754 gene locus_tag LOCUS_36800 3896421 3894754 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_36800 3896551 3897837 gene locus_tag LOCUS_36810 3896551 3897837 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_36810 3899823 3897946 gene locus_tag LOCUS_36820 3899823 3897946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 3900071 3900886 gene locus_tag LOCUS_36830 3900071 3900886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3900896 3901786 gene locus_tag LOCUS_36840 3900896 3901786 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943684.1 protein_id gnl|my_center|LOCUS_36840 3901789 3902715 gene locus_tag LOCUS_36850 3901789 3902715 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_36850 3902839 3905316 gene locus_tag LOCUS_36860 3902839 3905316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3905366 3907174 gene locus_tag LOCUS_36870 3905366 3907174 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_36870 3907665 3907309 gene locus_tag LOCUS_36880 3907665 3907309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 3908941 3908123 gene locus_tag LOCUS_36890 3908941 3908123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 3910235 3908946 gene locus_tag LOCUS_36900 3910235 3908946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3912844 3911180 gene locus_tag LOCUS_36910 3912844 3911180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 3913791 3912859 gene locus_tag LOCUS_36920 3913791 3912859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3914069 3914701 gene locus_tag LOCUS_36930 3914069 3914701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3914957 3916309 gene locus_tag LOCUS_36940 gene nifE 3914957 3916309 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_36940 3916297 3917592 gene locus_tag LOCUS_36950 gene nifN 3916297 3917592 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533487.1 protein_id gnl|my_center|LOCUS_36950 3917592 3918611 gene locus_tag LOCUS_36960 3917592 3918611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3919300 3918608 gene locus_tag LOCUS_36970 3919300 3918608 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919645.1 protein_id gnl|my_center|LOCUS_36970 3920632 3919406 gene locus_tag LOCUS_36980 3920632 3919406 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_36980 3920552 3920791 gene locus_tag LOCUS_36990 3920552 3920791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3920918 3921430 gene locus_tag LOCUS_37000 3920918 3921430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 3921427 3921804 gene locus_tag LOCUS_37010 3921427 3921804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_37010 3921872 3922048 gene locus_tag LOCUS_37020 3921872 3922048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 3922288 3923526 gene locus_tag LOCUS_37030 3922288 3923526 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_37030 3923650 3925626 gene locus_tag LOCUS_37040 3923650 3925626 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_37040 3925874 3925704 gene locus_tag LOCUS_37050 3925874 3925704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 3925971 3930326 gene locus_tag LOCUS_37060 3925971 3930326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3930484 3931902 gene locus_tag LOCUS_37070 gene selA 3930484 3931902 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_37070 3931895 3933820 gene locus_tag LOCUS_37080 gene selB 3931895 3933820 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_37080 3933949 3934905 gene locus_tag LOCUS_37090 gene selD 3933949 3934905 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_37090 3935719 3934922 gene locus_tag LOCUS_37100 3935719 3934922 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_37100 3935890 3936600 gene locus_tag LOCUS_37110 3935890 3936600 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941430.1 protein_id gnl|my_center|LOCUS_37110 3936597 3936920 gene locus_tag LOCUS_37120 3936597 3936920 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941431.1 protein_id gnl|my_center|LOCUS_37120 3937588 3937127 gene locus_tag LOCUS_37130 3937588 3937127 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_37130 3939870 3937585 gene locus_tag LOCUS_37140 3939870 3937585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 3941490 3939898 gene locus_tag LOCUS_37150 3941490 3939898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3943757 3941676 gene locus_tag LOCUS_37160 3943757 3941676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044992.1 protein_id gnl|my_center|LOCUS_37160 3944214 3943978 gene locus_tag LOCUS_37170 3944214 3943978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3944995 3944429 gene locus_tag LOCUS_37180 3944995 3944429 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404018.1 protein_id gnl|my_center|LOCUS_37180 3945494 3946921 gene locus_tag LOCUS_37190 3945494 3946921 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525361.1 protein_id gnl|my_center|LOCUS_37190 3947583 3947029 gene locus_tag LOCUS_37200 3947583 3947029 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808796.1 protein_id gnl|my_center|LOCUS_37200 3948046 3947702 gene locus_tag LOCUS_37210 3948046 3947702 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_37210 3948248 3948517 gene locus_tag LOCUS_37220 3948248 3948517 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_37220 3948514 3948792 gene locus_tag LOCUS_37230 3948514 3948792 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_37230 3949410 3949192 gene locus_tag LOCUS_37240 3949410 3949192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37240 3949813 3949514 gene locus_tag LOCUS_37250 3949813 3949514 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_37250 3950652 3950332 gene locus_tag LOCUS_37260 3950652 3950332 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546474.1 protein_id gnl|my_center|LOCUS_37260 3951268 3950966 gene locus_tag LOCUS_37270 3951268 3950966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 3951570 3951265 gene locus_tag LOCUS_37280 3951570 3951265 CDS product DUF3024 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222124.1 protein_id gnl|my_center|LOCUS_37280 3951868 3951701 gene locus_tag LOCUS_37290 3951868 3951701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3952203 3951868 gene locus_tag LOCUS_37300 3952203 3951868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3952823 3952599 gene locus_tag LOCUS_37310 3952823 3952599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 3953198 3953680 gene locus_tag LOCUS_37320 3953198 3953680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3953701 3954030 gene locus_tag LOCUS_37330 3953701 3954030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 3954382 3954209 gene locus_tag LOCUS_37340 3954382 3954209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 3955349 3954486 gene locus_tag LOCUS_37350 3955349 3954486 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942015.1 protein_id gnl|my_center|LOCUS_37350 3955843 3955463 gene locus_tag LOCUS_37360 3955843 3955463 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_37360 3957313 3956333 gene locus_tag LOCUS_37370 3957313 3956333 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942015.1 protein_id gnl|my_center|LOCUS_37370 3957522 3957310 gene locus_tag LOCUS_37380 3957522 3957310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 3958345 3959637 gene locus_tag LOCUS_37390 3958345 3959637 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_37390 3959634 3960437 gene locus_tag LOCUS_37400 3959634 3960437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 3960451 3960618 gene locus_tag LOCUS_37410 3960451 3960618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 3960716 3961906 gene locus_tag LOCUS_37420 3960716 3961906 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_37420 3962167 3961949 gene locus_tag LOCUS_37430 3962167 3961949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3962518 3962706 gene locus_tag LOCUS_37440 3962518 3962706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 3963361 3962852 gene locus_tag LOCUS_37450 3963361 3962852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 3963388 3964077 gene locus_tag LOCUS_37460 3963388 3964077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37460 3965226 3964330 gene locus_tag LOCUS_37470 3965226 3964330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 3966205 3966672 gene locus_tag LOCUS_37480 gene bfr 3966205 3966672 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_37480 3968139 3967108 gene locus_tag LOCUS_37490 3968139 3967108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3969674 3968247 gene locus_tag LOCUS_37500 3969674 3968247 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_37500 3970457 3969687 gene locus_tag LOCUS_37510 3970457 3969687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 3970608 3971066 gene locus_tag LOCUS_37520 3970608 3971066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 3971352 3971276 gene locus_tag LOCUS_t00490 3971352 3971276 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3971679 3972542 gene locus_tag LOCUS_37530 3971679 3972542 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943349.1 protein_id gnl|my_center|LOCUS_37530 3972840 3972556 gene locus_tag LOCUS_37540 3972840 3972556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 3973599 3972931 gene locus_tag LOCUS_37550 3973599 3972931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 3973790 3974287 gene locus_tag LOCUS_37560 3973790 3974287 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942287.1 protein_id gnl|my_center|LOCUS_37560 3975194 3974373 gene locus_tag LOCUS_37570 3975194 3974373 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942292.1 protein_id gnl|my_center|LOCUS_37570 3976303 3975203 gene locus_tag LOCUS_37580 3976303 3975203 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_37580 3976746 3976312 gene locus_tag LOCUS_37590 3976746 3976312 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_37590 3976847 3977797 gene locus_tag LOCUS_37600 gene gshB 3976847 3977797 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918030.1 protein_id gnl|my_center|LOCUS_37600 3978495 3977806 gene locus_tag LOCUS_37610 3978495 3977806 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_37610 3978669 3979193 gene locus_tag LOCUS_37620 gene hpt 3978669 3979193 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019295.1 protein_id gnl|my_center|LOCUS_37620 3979226 3980737 gene locus_tag LOCUS_37630 3979226 3980737 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943347.1 protein_id gnl|my_center|LOCUS_37630 3981054 3980851 gene locus_tag LOCUS_37640 3981054 3980851 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_37640 3981357 3981187 gene locus_tag LOCUS_37650 3981357 3981187 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_37650 3981646 3982911 gene locus_tag LOCUS_37660 3981646 3982911 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_37660 3984013 3983012 gene locus_tag LOCUS_37670 gene pta 3984013 3983012 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_37670 3984193 3985122 gene locus_tag LOCUS_37680 3984193 3985122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 3986612 3985131 gene locus_tag LOCUS_37690 gene gcvPB 3986612 3985131 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_37690 3987958 3986609 gene locus_tag LOCUS_37700 gene gcvPA 3987958 3986609 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_37700 3988426 3988043 gene locus_tag LOCUS_37710 gene gcvH 3988426 3988043 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 protein_id gnl|my_center|LOCUS_37710 3989614 3988520 gene locus_tag LOCUS_37720 gene gcvT 3989614 3988520 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_37720 3990526 3989669 gene locus_tag LOCUS_37730 3990526 3989669 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_37730 3991177 3990536 gene locus_tag LOCUS_37740 3991177 3990536 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_37740 3992291 3991440 gene locus_tag LOCUS_37750 gene folD 3992291 3991440 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_37750 3992763 3992503 gene locus_tag LOCUS_37760 3992763 3992503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 3993148 3992855 gene locus_tag LOCUS_37770 3993148 3992855 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_37770 3993705 3993145 gene locus_tag LOCUS_37780 3993705 3993145 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_37780 3994014 3993721 gene locus_tag LOCUS_37790 3994014 3993721 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_37790 3994544 3994158 gene locus_tag LOCUS_37800 3994544 3994158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 3994832 3995029 gene locus_tag LOCUS_37810 3994832 3995029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 3995262 3995570 gene locus_tag LOCUS_37820 3995262 3995570 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018860.1 protein_id gnl|my_center|LOCUS_37820 3995628 3996920 gene locus_tag LOCUS_37830 gene chrA 3995628 3996920 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_37830 3996963 3997331 gene locus_tag LOCUS_37840 3996963 3997331 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250605.1 protein_id gnl|my_center|LOCUS_37840 3997307 3997960 gene locus_tag LOCUS_37850 3997307 3997960 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548243.1 protein_id gnl|my_center|LOCUS_37850 3997957 3998754 gene locus_tag LOCUS_37860 3997957 3998754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478879.1 protein_id gnl|my_center|LOCUS_37860 3998771 3999196 gene locus_tag LOCUS_37870 3998771 3999196 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259144.1 protein_id gnl|my_center|LOCUS_37870 3999862 3999185 gene locus_tag LOCUS_37880 3999862 3999185 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 protein_id gnl|my_center|LOCUS_37880 4000892 3999834 gene locus_tag LOCUS_37890 4000892 3999834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 4002101 4001100 gene locus_tag LOCUS_37900 4002101 4001100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 4002335 4003984 gene locus_tag LOCUS_37910 4002335 4003984 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_37910 4006199 4004052 gene locus_tag LOCUS_37920 4006199 4004052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 4006565 4007509 gene locus_tag LOCUS_37930 4006565 4007509 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_37930 4007975 4007562 gene locus_tag LOCUS_37940 4007975 4007562 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_37940 4008234 4010909 gene locus_tag LOCUS_37950 4008234 4010909 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_37950 4010931 4011497 gene locus_tag LOCUS_37960 4010931 4011497 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_37960 4011883 4011494 gene locus_tag LOCUS_37970 4011883 4011494 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_37970 4013469 4011883 gene locus_tag LOCUS_37980 4013469 4011883 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_37980 4015460 4013466 gene locus_tag LOCUS_37990 4015460 4013466 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_37990 4016791 4015550 gene locus_tag LOCUS_38000 gene arsJ 4016791 4015550 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_38000 4017881 4016874 gene locus_tag LOCUS_38010 4017881 4016874 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_38010 4018604 4018374 gene locus_tag LOCUS_38020 4018604 4018374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 <4020091 4018713 gene locus_tag LOCUS_38030 <4020091 4018713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895677.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein >Feature sequence3 182 1108 gene locus_tag LOCUS_38040 182 1108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_38040 2363 1695 gene locus_tag LOCUS_38050 2363 1695 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_38050 2825 2442 gene locus_tag LOCUS_38060 2825 2442 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 protein_id gnl|my_center|LOCUS_38060 3325 2861 gene locus_tag LOCUS_38070 3325 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3447 4790 gene locus_tag LOCUS_38080 3447 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 5198 5428 gene locus_tag LOCUS_38090 5198 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 5990 5436 gene locus_tag LOCUS_38100 5990 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 6820 7431 gene locus_tag LOCUS_38110 6820 7431 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_38110 7612 8031 gene locus_tag LOCUS_38120 7612 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_38120 8417 8049 gene locus_tag LOCUS_38130 8417 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 8703 8404 gene locus_tag LOCUS_38140 8703 8404 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940838.1 protein_id gnl|my_center|LOCUS_38140 8854 9237 gene locus_tag LOCUS_38150 8854 9237 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390973.1 protein_id gnl|my_center|LOCUS_38150 9269 9937 gene locus_tag LOCUS_38160 9269 9937 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 protein_id gnl|my_center|LOCUS_38160 10840 10628 gene locus_tag LOCUS_38170 10840 10628 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_38170 11810 12547 gene locus_tag LOCUS_38180 11810 12547 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_38180 12567 13190 gene locus_tag LOCUS_38190 12567 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_38190 13378 14574 gene locus_tag LOCUS_38200 gene chrA 13378 14574 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_38200 14958 15227 gene locus_tag LOCUS_38210 14958 15227 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975041.1 protein_id gnl|my_center|LOCUS_38210 16839 15790 gene locus_tag LOCUS_38220 16839 15790 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_38220 17706 17242 gene locus_tag LOCUS_38230 17706 17242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 18055 17810 gene locus_tag LOCUS_38240 18055 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 18894 18088 gene locus_tag LOCUS_38250 18894 18088 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_38250 19769 18915 gene locus_tag LOCUS_38260 19769 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 21225 19900 gene locus_tag LOCUS_38270 21225 19900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957892.1 protein_id gnl|my_center|LOCUS_38270 21897 21325 gene locus_tag LOCUS_38280 21897 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 23325 22000 gene locus_tag LOCUS_38290 23325 22000 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_38290 24268 23354 gene locus_tag LOCUS_38300 24268 23354 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957633.1 protein_id gnl|my_center|LOCUS_38300 26273 24270 gene locus_tag LOCUS_38310 26273 24270 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389694.1 protein_id gnl|my_center|LOCUS_38310 27070 26276 gene locus_tag LOCUS_38320 27070 26276 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_38320 28682 27075 gene locus_tag LOCUS_38330 28682 27075 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_38330 29919 28750 gene locus_tag LOCUS_38340 29919 28750 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_38340 31525 30305 gene locus_tag LOCUS_38350 31525 30305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 32398 31688 gene locus_tag LOCUS_38360 32398 31688 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_38360 33718 32894 gene locus_tag LOCUS_38370 33718 32894 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814689.1 protein_id gnl|my_center|LOCUS_38370 34387 33734 gene locus_tag LOCUS_38380 34387 33734 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_38380 35094 34402 gene locus_tag LOCUS_38390 35094 34402 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 protein_id gnl|my_center|LOCUS_38390 36910 35072 gene locus_tag LOCUS_38400 36910 35072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 37624 37151 gene locus_tag LOCUS_38410 37624 37151 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_38410 38977 37667 gene locus_tag LOCUS_38420 38977 37667 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_38420 39429 38989 gene locus_tag LOCUS_38430 39429 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 40496 39513 gene locus_tag LOCUS_38440 40496 39513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 41683 40862 gene locus_tag LOCUS_38450 41683 40862 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_38450 42659 41685 gene locus_tag LOCUS_38460 42659 41685 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_38460 42658 42813 gene locus_tag LOCUS_38470 42658 42813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 43977 42829 gene locus_tag LOCUS_38480 gene acdA 43977 42829 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_38480 45148 43991 gene locus_tag LOCUS_38490 45148 43991 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_38490 45948 45166 gene locus_tag LOCUS_38500 45948 45166 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_38500 46861 46010 gene locus_tag LOCUS_38510 46861 46010 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230294.1 protein_id gnl|my_center|LOCUS_38510 48103 46928 gene locus_tag LOCUS_38520 48103 46928 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_38520 49117 48179 gene locus_tag LOCUS_38530 49117 48179 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_38530 49901 49128 gene locus_tag LOCUS_38540 49901 49128 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_38540 51980 49995 gene locus_tag LOCUS_38550 51980 49995 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_38550 54119 52353 gene locus_tag LOCUS_38560 54119 52353 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816048.1 protein_id gnl|my_center|LOCUS_38560 54469 57759 gene locus_tag LOCUS_38570 54469 57759 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_38570 57790 58956 gene locus_tag LOCUS_38580 57790 58956 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_38580 58969 60075 gene locus_tag LOCUS_38590 58969 60075 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943943.1 protein_id gnl|my_center|LOCUS_38590 60531 60352 gene locus_tag LOCUS_38600 60531 60352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 60722 61348 gene locus_tag LOCUS_38610 60722 61348 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_38610 61546 61358 gene locus_tag LOCUS_38620 61546 61358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 62002 61706 gene locus_tag LOCUS_38630 62002 61706 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_38630 63579 62056 gene locus_tag LOCUS_38640 63579 62056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 63986 63579 gene locus_tag LOCUS_38650 gene tnpA 63986 63579 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_38650 65428 64244 gene locus_tag LOCUS_38660 gene ltrA 65428 64244 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_38660 65646 65425 gene locus_tag LOCUS_38670 65646 65425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 66396 66118 gene locus_tag LOCUS_38680 66396 66118 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence4 839 429 gene locus_tag LOCUS_38690 839 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 1329 1580 gene locus_tag LOCUS_38700 1329 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 1597 1728 gene locus_tag LOCUS_38710 1597 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 1715 2404 gene locus_tag LOCUS_38720 1715 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38720 2456 2722 gene locus_tag LOCUS_38730 2456 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 2866 3471 gene locus_tag LOCUS_38740 2866 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38740 4019 4195 gene locus_tag LOCUS_38750 4019 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4522 4382 gene locus_tag LOCUS_38760 4522 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4737 6707 gene locus_tag LOCUS_38770 4737 6707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_38770 6902 10810 gene locus_tag LOCUS_38780 gene cobN 6902 10810 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_38780 10822 12456 gene locus_tag LOCUS_38790 10822 12456 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_38790 12747 13301 gene locus_tag LOCUS_38800 12747 13301 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_38800 13305 13622 gene locus_tag LOCUS_38810 13305 13622 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_38810 13788 14597 gene locus_tag LOCUS_38820 13788 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 14746 16101 gene locus_tag LOCUS_38830 gene pvdR 14746 16101 CDS product pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114507.1 protein_id gnl|my_center|LOCUS_38830 16101 18074 gene locus_tag LOCUS_38840 16101 18074 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397097.1 protein_id gnl|my_center|LOCUS_38840 18079 19521 gene locus_tag LOCUS_38850 18079 19521 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_38850 19913 19518 gene locus_tag LOCUS_38860 19913 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 20364 20744 gene locus_tag LOCUS_38870 20364 20744 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_38870 20768 21175 gene locus_tag LOCUS_38880 20768 21175 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942060.1 protein_id gnl|my_center|LOCUS_38880 21182 22150 gene locus_tag LOCUS_38890 21182 22150 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_38890 22161 22463 gene locus_tag LOCUS_38900 22161 22463 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_38900 22487 22888 gene locus_tag LOCUS_38910 22487 22888 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942057.1 protein_id gnl|my_center|LOCUS_38910 22995 23699 gene locus_tag LOCUS_38920 22995 23699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190866.1 protein_id gnl|my_center|LOCUS_38920 23692 24930 gene locus_tag LOCUS_38930 23692 24930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704579.1 protein_id gnl|my_center|LOCUS_38930 25017 25760 gene locus_tag LOCUS_38940 25017 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 25852 27171 gene locus_tag LOCUS_38950 25852 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 27467 27183 gene locus_tag LOCUS_38960 27467 27183 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_38960 >Feature sequence5 2902 119 gene locus_tag LOCUS_38970 2902 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 3552 2899 gene locus_tag LOCUS_38980 3552 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4267 3542 gene locus_tag LOCUS_38990 4267 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 4544 4284 gene locus_tag LOCUS_39000 4544 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 5074 4556 gene locus_tag LOCUS_39010 5074 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 5493 5071 gene locus_tag LOCUS_39020 5493 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 6164 5586 gene locus_tag LOCUS_39030 6164 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 7279 6401 gene locus_tag LOCUS_39040 7279 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39040 8003 7380 gene locus_tag LOCUS_39050 8003 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39050 9025 8000 gene locus_tag LOCUS_39060 9025 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 10269 10000 gene locus_tag LOCUS_39070 10269 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 13604 11823 gene locus_tag LOCUS_39080 13604 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 16308 13843 gene locus_tag LOCUS_39090 16308 13843 CDS product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087338.1 protein_id gnl|my_center|LOCUS_39090 16603 16310 gene locus_tag LOCUS_39100 16603 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 17910 16741 gene locus_tag LOCUS_39110 17910 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 18788 17907 gene locus_tag LOCUS_39120 18788 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 19339 18785 gene locus_tag LOCUS_39130 19339 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 19599 19336 gene locus_tag LOCUS_39140 19599 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 19965 19663 gene locus_tag LOCUS_39150 19965 19663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 20700 19999 gene locus_tag LOCUS_39160 20700 19999 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941514.1 protein_id gnl|my_center|LOCUS_39160 21347 20697 gene locus_tag LOCUS_39170 21347 20697 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942814.1 protein_id gnl|my_center|LOCUS_39170 21824 21480 gene locus_tag LOCUS_39180 21824 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 22701 21811 gene locus_tag LOCUS_39190 22701 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 23067 24515 gene locus_tag LOCUS_39200 gene istA 23067 24515 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_39200 24505 25314 gene locus_tag LOCUS_39210 gene istB 24505 25314 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_39210 25302 25547 gene locus_tag LOCUS_39220 25302 25547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 26546 25998 gene locus_tag LOCUS_39230 26546 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 26701 26543 gene locus_tag LOCUS_39240 26701 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 27181 26765 gene locus_tag LOCUS_39250 27181 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 27920 27219 gene locus_tag LOCUS_39260 27920 27219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 28388 28663 gene locus_tag LOCUS_39270 28388 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 28666 29382 gene locus_tag LOCUS_39280 28666 29382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 29366 30727 gene locus_tag LOCUS_39290 29366 30727 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942770.1 protein_id gnl|my_center|LOCUS_39290 30730 32346 gene locus_tag LOCUS_39300 30730 32346 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930439.1 protein_id gnl|my_center|LOCUS_39300 32346 33194 gene locus_tag LOCUS_39310 32346 33194 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942772.1 protein_id gnl|my_center|LOCUS_39310 33210 33914 gene locus_tag LOCUS_39320 33210 33914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 33866 35323 gene locus_tag LOCUS_39330 33866 35323 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942773.1 protein_id gnl|my_center|LOCUS_39330 35353 35829 gene locus_tag LOCUS_39340 35353 35829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 35999 37693 gene locus_tag LOCUS_39350 35999 37693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 38039 37875 gene locus_tag LOCUS_39360 38039 37875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 38618 38319 gene locus_tag LOCUS_39370 38618 38319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 40375 38612 gene locus_tag LOCUS_39380 gene recJ 40375 38612 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_39380 41356 40796 gene locus_tag LOCUS_39390 41356 40796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 41777 41349 gene locus_tag LOCUS_39400 41777 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 42444 42088 gene locus_tag LOCUS_39410 42444 42088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 42715 42434 gene locus_tag LOCUS_39420 42715 42434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 43119 42922 gene locus_tag LOCUS_39430 43119 42922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 43542 43282 gene locus_tag LOCUS_39440 43542 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 44042 43725 gene locus_tag LOCUS_39450 44042 43725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 44202 44365 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaactggtcaaaaaacctaccta 45801 44728 gene locus_tag LOCUS_39460 45801 44728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 46076 45813 gene locus_tag LOCUS_39470 46076 45813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 46785 46108 gene locus_tag LOCUS_39480 46785 46108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890570.1 protein_id gnl|my_center|LOCUS_39480 46982 47170 gene locus_tag LOCUS_39490 46982 47170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 47184 47420 gene locus_tag LOCUS_39500 47184 47420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 47620 47931 gene locus_tag LOCUS_39510 47620 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 47947 49023 gene locus_tag LOCUS_39520 gene dndB 47947 49023 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_39520 49052 50182 gene locus_tag LOCUS_39530 49052 50182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 50179 51156 gene locus_tag LOCUS_39540 50179 51156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 51359 51523 gene locus_tag LOCUS_39550 51359 51523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 51553 51819 gene locus_tag LOCUS_39560 51553 51819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 51867 52208 gene locus_tag LOCUS_39570 51867 52208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 52210 53193 gene locus_tag LOCUS_39580 52210 53193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040412236.1 protein_id gnl|my_center|LOCUS_39580 53670 53918 gene locus_tag LOCUS_39590 53670 53918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 54059 55255 gene locus_tag LOCUS_39600 54059 55255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 55630 56565 gene locus_tag LOCUS_39610 55630 56565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 57401 56562 gene locus_tag LOCUS_39620 57401 56562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 57909 58109 gene locus_tag LOCUS_39630 57909 58109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 58162 58287 gene locus_tag LOCUS_39640 58162 58287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 58440 58853 gene locus_tag LOCUS_39650 58440 58853 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_39650 58963 60045 gene locus_tag LOCUS_39660 58963 60045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 60333 61631 gene locus_tag LOCUS_39670 60333 61631 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267012.1 protein_id gnl|my_center|LOCUS_39670 61644 61865 gene locus_tag LOCUS_39680 61644 61865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 61950 62927 gene locus_tag LOCUS_39690 61950 62927 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_39690 63013 63195 gene locus_tag LOCUS_39700 63013 63195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 63183 63389 gene locus_tag LOCUS_39710 63183 63389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 63383 63556 gene locus_tag LOCUS_39720 63383 63556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 63655 64590 gene locus_tag LOCUS_39730 63655 64590 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_39730 64587 64976 gene locus_tag LOCUS_39740 64587 64976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 65052 66011 gene locus_tag LOCUS_39750 65052 66011 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_39750 66086 68068 gene locus_tag LOCUS_39760 66086 68068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 68140 68700 gene locus_tag LOCUS_39770 68140 68700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942807.1 protein_id gnl|my_center|LOCUS_39770 68687 68845 gene locus_tag LOCUS_39780 68687 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 68946 72275 gene locus_tag LOCUS_39790 68946 72275 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942809.1 protein_id gnl|my_center|LOCUS_39790 72361 72633 gene locus_tag LOCUS_39800 72361 72633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 72649 73206 gene locus_tag LOCUS_39810 72649 73206 CDS product CHC2 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942812.1 protein_id gnl|my_center|LOCUS_39810 73203 73343 gene locus_tag LOCUS_39820 73203 73343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 73410 73625 gene locus_tag LOCUS_39830 73410 73625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 73697 73927 gene locus_tag LOCUS_39840 73697 73927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 73924 74817 gene locus_tag LOCUS_39850 73924 74817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 74830 75084 gene locus_tag LOCUS_39860 74830 75084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 75077 75292 gene locus_tag LOCUS_39870 75077 75292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 75311 75730 gene locus_tag LOCUS_39880 75311 75730 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942179.1 protein_id gnl|my_center|LOCUS_39880 75744 76112 gene locus_tag LOCUS_39890 75744 76112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 76497 76691 gene locus_tag LOCUS_39900 76497 76691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 76691 77080 gene locus_tag LOCUS_39910 76691 77080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 77091 79403 gene locus_tag LOCUS_39920 77091 79403 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_39920 79651 79908 gene locus_tag LOCUS_39930 79651 79908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 81407 79920 gene locus_tag LOCUS_39940 81407 79920 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769933.1 protein_id gnl|my_center|LOCUS_39940 81715 81404 gene locus_tag LOCUS_39950 81715 81404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 81986 81774 gene locus_tag LOCUS_39960 81986 81774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 82396 82536 gene locus_tag LOCUS_39970 82396 82536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 82619 82783 gene locus_tag LOCUS_39980 82619 82783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 83791 82805 gene locus_tag LOCUS_39990 83791 82805 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061396.1 protein_id gnl|my_center|LOCUS_39990 84030 83788 gene locus_tag LOCUS_40000 84030 83788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 84585 84064 gene locus_tag LOCUS_40010 84585 84064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 84682 84900 gene locus_tag LOCUS_40020 84682 84900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 85650 85081 gene locus_tag LOCUS_40030 85650 85081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 86140 85643 gene locus_tag LOCUS_40040 86140 85643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 87242 86616 gene locus_tag LOCUS_40050 87242 86616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 89213 87300 gene locus_tag LOCUS_40060 89213 87300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 89693 89223 gene locus_tag LOCUS_40070 89693 89223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 89925 89695 gene locus_tag LOCUS_40080 89925 89695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 90289 89915 gene locus_tag LOCUS_40090 90289 89915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 90683 90468 gene locus_tag LOCUS_40100 90683 90468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 90862 90677 gene locus_tag LOCUS_40110 90862 90677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 91134 90880 gene locus_tag LOCUS_40120 91134 90880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 91923 91519 gene locus_tag LOCUS_40130 91923 91519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 92382 91945 gene locus_tag LOCUS_40140 92382 91945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 92962 92309 gene locus_tag LOCUS_40150 92962 92309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 93089 94537 gene locus_tag LOCUS_40160 gene istA 93089 94537 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_40160 94527 95336 gene locus_tag LOCUS_40170 gene istB 94527 95336 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_40170 95324 95569 gene locus_tag LOCUS_40180 95324 95569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 96449 96177 gene locus_tag LOCUS_40190 96449 96177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 96739 96449 gene locus_tag LOCUS_40200 96739 96449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 97031 96744 gene locus_tag LOCUS_40210 97031 96744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 98012 97050 gene locus_tag LOCUS_40220 98012 97050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 98123 98713 gene locus_tag LOCUS_40230 98123 98713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 98724 99770 gene locus_tag LOCUS_40240 98724 99770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 99918 100337 gene locus_tag LOCUS_40250 99918 100337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229189.1 protein_id gnl|my_center|LOCUS_40250 101437 100355 gene locus_tag LOCUS_40260 101437 100355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 102480 101434 gene locus_tag LOCUS_40270 102480 101434 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_40270 106047 102523 gene locus_tag LOCUS_40280 106047 102523 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344102.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence6 243 620 gene locus_tag LOCUS_40290 243 620 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 protein_id gnl|my_center|LOCUS_40290 1119 2273 gene locus_tag LOCUS_40300 1119 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 2380 2988 gene locus_tag LOCUS_40310 2380 2988 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429495.1 protein_id gnl|my_center|LOCUS_40310 3652 4173 gene locus_tag LOCUS_40320 3652 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4247 4627 gene locus_tag LOCUS_40330 4247 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 5318 4530 gene locus_tag LOCUS_40340 5318 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 5542 5315 gene locus_tag LOCUS_40350 5542 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 6014 5499 gene locus_tag LOCUS_40360 6014 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40360 6850 5954 gene locus_tag LOCUS_40370 6850 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40370 8163 7492 gene locus_tag LOCUS_40380 8163 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40380 8573 8127 gene locus_tag LOCUS_40390 8573 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40390 8887 9474 gene locus_tag LOCUS_40400 8887 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 9916 9671 gene locus_tag LOCUS_40410 9916 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 10087 10377 gene locus_tag LOCUS_40420 10087 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 10604 10389 gene locus_tag LOCUS_40430 10604 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 11485 10625 gene locus_tag LOCUS_40440 11485 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812228.1 protein_id gnl|my_center|LOCUS_40440 11702 12121 gene locus_tag LOCUS_40450 11702 12121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_40450 13191 12460 gene locus_tag LOCUS_40460 13191 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 14408 13188 gene locus_tag LOCUS_40470 14408 13188 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_40470 14747 14445 gene locus_tag LOCUS_40480 14747 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 17054 14871 gene locus_tag LOCUS_40490 17054 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 17468 18094 gene locus_tag LOCUS_40500 17468 18094 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_40500 18292 18104 gene locus_tag LOCUS_40510 18292 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 19108 18404 gene locus_tag LOCUS_40520 19108 18404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_40520 19617 19105 gene locus_tag LOCUS_40530 19617 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_40530 20121 19807 gene locus_tag LOCUS_40540 20121 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 21232 21708 gene locus_tag LOCUS_40550 21232 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40550 21712 22491 gene locus_tag LOCUS_40560 21712 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40560 23102 22767 gene locus_tag LOCUS_40570 23102 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 23324 23118 gene locus_tag LOCUS_40580 23324 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 23526 23705 gene locus_tag LOCUS_40590 23526 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 24194 23796 gene locus_tag LOCUS_40600 24194 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 24566 24291 gene locus_tag LOCUS_40610 24566 24291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 24936 24526 gene locus_tag LOCUS_40620 24936 24526 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942802.1 protein_id gnl|my_center|LOCUS_40620 25557 25009 gene locus_tag LOCUS_40630 25557 25009 CDS product CHC2 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942812.1 protein_id gnl|my_center|LOCUS_40630 27233 25569 gene locus_tag LOCUS_40640 27233 25569 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_40640 28185 27250 gene locus_tag LOCUS_40650 28185 27250 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_40650 28621 28277 gene locus_tag LOCUS_40660 28621 28277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 29595 28636 gene locus_tag LOCUS_40670 29595 28636 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_40670 29767 30024 gene locus_tag LOCUS_40680 29767 30024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 30154 30029 gene locus_tag LOCUS_40690 30154 30029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 30309 30139 gene locus_tag LOCUS_40700 30309 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 31405 30410 gene locus_tag LOCUS_40710 31405 30410 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_40710 32547 31612 gene locus_tag LOCUS_40720 32547 31612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 33239 33616 gene locus_tag LOCUS_40730 33239 33616 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_40730 34090 33647 gene locus_tag LOCUS_40740 34090 33647 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210981.1 protein_id gnl|my_center|LOCUS_40740 34488 34090 gene locus_tag LOCUS_40750 34488 34090 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266691.1 protein_id gnl|my_center|LOCUS_40750 35038 34637 gene locus_tag LOCUS_40760 35038 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 36534 35071 gene locus_tag LOCUS_40770 36534 35071 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942773.1 protein_id gnl|my_center|LOCUS_40770 37381 36542 gene locus_tag LOCUS_40780 37381 36542 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942772.1 protein_id gnl|my_center|LOCUS_40780 38757 37363 gene locus_tag LOCUS_40790 38757 37363 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930439.1 protein_id gnl|my_center|LOCUS_40790 40120 38750 gene locus_tag LOCUS_40800 40120 38750 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942770.1 protein_id gnl|my_center|LOCUS_40800 40826 40095 gene locus_tag LOCUS_40810 40826 40095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 41241 40813 gene locus_tag LOCUS_40820 41241 40813 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_40820 41419 43503 gene locus_tag LOCUS_40830 41419 43503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 43875 43537 gene locus_tag LOCUS_40840 43875 43537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 44150 43872 gene locus_tag LOCUS_40850 44150 43872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 44783 44337 gene locus_tag LOCUS_40860 44783 44337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 44926 45264 gene locus_tag LOCUS_40870 44926 45264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 45261 45683 gene locus_tag LOCUS_40880 45261 45683 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_40880 46346 45849 gene locus_tag LOCUS_40890 46346 45849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 47083 46628 gene locus_tag LOCUS_40900 47083 46628 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_40900 47633 47202 gene locus_tag LOCUS_40910 47633 47202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 47739 47933 gene locus_tag LOCUS_40920 47739 47933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 48487 47987 gene locus_tag LOCUS_40930 48487 47987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 48720 49010 gene locus_tag LOCUS_40940 48720 49010 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_40940 49446 49129 gene locus_tag LOCUS_40950 49446 49129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 50685 49516 gene locus_tag LOCUS_40960 50685 49516 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_40960 50807 51766 gene locus_tag LOCUS_40970 50807 51766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 51785 55165 gene locus_tag LOCUS_40980 51785 55165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_40980 55165 56001 gene locus_tag LOCUS_40990 55165 56001 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_40990 56975 56010 gene locus_tag LOCUS_41000 56975 56010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 57904 56972 gene locus_tag LOCUS_41010 57904 56972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 59771 57894 gene locus_tag LOCUS_41020 59771 57894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 61399 59780 gene locus_tag LOCUS_41030 61399 59780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 62456 63676 gene locus_tag LOCUS_41040 62456 63676 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_41040 64181 63660 gene locus_tag LOCUS_41050 64181 63660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 65877 64252 gene locus_tag LOCUS_41060 65877 64252 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_41060 66666 66139 gene locus_tag LOCUS_41070 66666 66139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 67257 67075 gene locus_tag LOCUS_41080 67257 67075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 67405 67581 gene locus_tag LOCUS_41090 67405 67581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 68191 67553 gene locus_tag LOCUS_41100 68191 67553 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002888.1 protein_id gnl|my_center|LOCUS_41100 68977 68288 gene locus_tag LOCUS_41110 68977 68288 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_41110