COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3611010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 732..1571 product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1572..1838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 2775..3929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5137..5919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6166..7308 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7339..8544 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 8572..9984 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9950..10210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 10148..10666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 10699..11304 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11291..11947 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11940..13178 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13535..14320 product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 14308..14967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 14995..15804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 15801..16823 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16983..18332 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 18524..19801 product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene tviB CDS 19940..20980 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 21307..22758 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 22859..24616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 24980..25561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 25807..26109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 note possible pseudo, frameshifted CDS 26106..26975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 note possible pseudo, frameshifted CDS 27138..27557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 27573..28196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 28210..28704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(28831..28989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 29380..30183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 30174..30743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 30856..31242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(31451..32830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33020..33799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 note possible pseudo, frameshifted CDS 33982..34248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 34625..34861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 34858..36129 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(36310..36624) product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(36628..36924) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 37005..38171 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(38263..38916) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 39039..39773 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene elyC CDS 39890..40900 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(40882..41895) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024078840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 note possible pseudo, frameshifted CDS complement(41817..42101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 note possible pseudo, frameshifted CDS 42122..42442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 42435..44111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 44108..45982 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 45975..46385 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 46688..48067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(48576..48938) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(49265..49639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 49986..50843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 50883..53432 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 54050..54328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 54361..54702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 55120..55587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 55799..56116 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 56339..56794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(56863..57060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 56980..58041 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 58034..58747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 58772..59767 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene moaA CDS 60035..61714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 61835..62272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 62575..62766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 62844..63035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 63054..63266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 63428..65422 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 65602..66891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(66974..68578) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(68571..69671) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(69676..70746) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(70825..72687) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(72800..73345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 note possible pseudo, frameshifted CDS complement(73342..74013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 note possible pseudo, frameshifted CDS complement(74090..74857) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene gloB CDS 74926..75729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 75722..76201 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene rnhA CDS 76247..76996 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene dnaQ CDS 76996..77766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(77817..78128) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 78268..79308 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene sohB CDS complement(79305..79544) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 79434..79718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 79963..81879 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 82065..82745 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 82780..83553 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(83570..84955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 85105..86811 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(86805..87359) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 tRNA complement(87439..87528) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 87723..88091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 88183..88851 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 88925..89320 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene tusD CDS 89330..89713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 89742..90032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 90080..90385 product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 90393..90965 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(90978..91667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 note possible pseudo, frameshifted CDS complement(92262..92783) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene moaB CDS complement(92780..93100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(93202..94257) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(94269..94919) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene fdh3B CDS complement(94949..95677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 note possible pseudo, frameshifted CDS complement(95613..97808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 note possible pseudo, frameshifted CDS complement(97840..98043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(98121..98753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(98756..100465) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(100500..100961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(101030..101461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 101594..102445 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(102447..103079) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(103204..104157) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 104273..107020 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016415173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(107115..107756) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene pdxH CDS complement(107837..108394) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(108388..108759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100853.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(108756..109256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100856.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(109253..109579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(109834..110190) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(110238..110411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(110427..110813) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(110810..111100) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 111259..112416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 note possible pseudo, frameshifted CDS 112347..114119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 note possible pseudo, frameshifted CDS complement(114220..114567) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(114564..115268) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 115632..116462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 note possible pseudo, frameshifted CDS 116396..117151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 note possible pseudo, frameshifted CDS 117168..117350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 117430..117927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 note possible pseudo, frameshifted CDS 118041..118727 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(118833..119309) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(119402..119803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(119803..120426) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene wrbA CDS complement(120461..120808) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene arsC CDS complement(120892..121335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 121452..122066 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene smrA CDS complement(122119..122679) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(122672..124324) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(124460..125788) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(125844..129557) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene metH CDS 129857..130447 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene nfuA CDS complement(130654..131682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 131921..133108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 133133..133429 product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 133429..133815 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 133843..134268 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(134396..134575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 134513..135910 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(135949..136296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(136299..136745) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene hisI CDS complement(136790..137233) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene zur CDS complement(137301..138290) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(138296..139801) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(139850..140686) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 140977..141564 product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(141609..142004) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(142095..143360) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene ectB CDS complement(143452..144030) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene ectA CDS complement(144313..145692) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene gorA CDS 145858..146505 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene can CDS complement(146502..146981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 147123..147935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 note possible pseudo, frameshifted CDS 147989..148426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 note possible pseudo, frameshifted CDS 148434..149468 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(149497..150027) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene msrA CDS complement(150055..151248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 note possible pseudo, frameshifted CDS complement(151185..154085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 note possible pseudo, frameshifted CDS complement(154049..155932) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(155989..156900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 157125..157706 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene sodB CDS complement(157801..159087) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(159092..159982) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene galU CDS 160213..160938 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 160935..161600 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(161735..162499) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(162516..163292) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene ybgF CDS complement(163324..163860) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene pal CDS complement(163905..165191) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene tolB CDS complement(165191..166414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(166424..166861) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene tolR CDS complement(166874..167563) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene tolQ CDS complement(167575..167991) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene ybgC CDS complement(167988..168728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 note possible pseudo, frameshifted CDS complement(169037..169648) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene ruvA CDS complement(169801..170340) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene ruvC CDS complement(170479..171648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 note possible pseudo, frameshifted CDS complement(171648..172259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 note possible pseudo, frameshifted CDS complement(172313..172579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 172760..173692 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 173708..174622 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 174633..175577 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(175648..175920) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 176704..177207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 note possible pseudo, frameshifted CDS complement(177319..178254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 178389..179483 product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(179631..180548) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(180613..182028) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene cls CDS complement(182121..183626) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(183806..184630) product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene nei CDS complement(184815..186836) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene uvrB CDS complement(186865..187281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(187296..187493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 187674..188711 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609198.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(188712..189470) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(189544..191133) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166905.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene prfC CDS 191279..192553 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 192557..193126 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(193231..194004) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(194088..194534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 194639..195460 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 195579..195854 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 195978..196745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(196826..197485) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(197574..198275) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 198481..199377 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 199453..200319 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 200319..201206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 201309..202472 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 202444..202986 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 203037..203660 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(203795..204907) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene gcvT CDS complement(204985..206388) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 206886..207278 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene gcvH CDS 207383..210277 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene gcvP CDS complement(210383..211297) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 211396..212757 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene ppnN CDS complement(212877..213242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(213244..213708) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 213862..214071 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(214129..214428) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene ihfA CDS complement(214517..216913) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene pheT CDS complement(216947..217966) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene pheS CDS complement(218086..218439) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene rplT CDS complement(218475..218669) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene rpmI CDS complement(218777..219271) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene infC CDS complement(219353..221251) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene thrS CDS complement(221451..222113) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(222381..222848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(222892..223722) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene cysQ CDS 223936..224106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(224103..224510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 note possible pseudo, frameshifted CDS complement(224486..224857) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 224934..226232 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(226315..227253) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene cyoE CDS complement(227246..228319) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(228332..228880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(228880..229632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 229631..229825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(229866..230723) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(230720..231319) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(231352..232986) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene ctaD CDS complement(233020..234141) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene coxB CDS complement(234275..234448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 234611..234964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(235060..235794) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(235791..236147) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(236229..237038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 note possible pseudo, frameshifted CDS complement(236920..237858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 note possible pseudo, frameshifted tRNA 238069..238145 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 238491..239147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 239415..239618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 239742..244664 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 244664..245956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 note possible pseudo, frameshifted CDS 245857..247506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 note possible pseudo, frameshifted CDS 247538..248365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 248397..249752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 249868..253362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 253359..254621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 254637..257972 product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081615318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 257959..260607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 260604..261845 product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(262365..263105) product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene istB CDS complement(263092..264657) product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene istA CDS complement(264679..265959) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene ltrA CDS complement(266714..266956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(267029..268144) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 note possible pseudo, frameshifted CDS complement(268026..268283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 note possible pseudo, frameshifted CDS complement(268514..268909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 269085..270302 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024078840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(270357..270590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(270587..270892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(271004..271624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(271743..272090) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(272071..272337) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(272402..272713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(272961..274022) product IS1380-like element ISBdi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212447968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(273977..274342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(274421..275521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(276215..276991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(276994..278073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(278456..280579) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(280581..286061) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 note possible pseudo, frameshifted CDS complement(285952..287121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 note possible pseudo, frameshifted CDS complement(287153..287539) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(287541..287780) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(288007..289974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(290329..290799) product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050789038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(291773..294667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(295044..295928) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 note possible pseudo, frameshifted CDS complement(295922..296248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(296324..298486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(298584..301577) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 301949..302626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(302637..303101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(303217..304452) product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 304653..305051 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706193.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 305045..305737 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(305784..307208) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368848.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rmuC CDS 307447..308058 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(308145..309023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(309044..310291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(310288..310959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(310956..314636) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(314877..315059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 315175..316134 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(316204..316683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 316819..317667 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene nfo CDS 317664..318170 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 318265..319260 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 319261..319815 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 319812..321074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(321102..322487) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 322624..322821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(322839..323462) product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(323490..324617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(324720..325178) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 325359..328127 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 328194..328985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 note possible pseudo, internal stop codon, frameshifted CDS 329070..330857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 note possible pseudo, internal stop codon CDS 330854..332200 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(332197..334653) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene hrpB CDS 334733..335746 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 335743..336960 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene arsJ CDS 337033..337314 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 337325..337621 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(337602..338276) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 338514..339977 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene xdhA CDS 339961..342459 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene xdhB CDS 342456..343031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 note possible pseudo, frameshifted CDS 342992..343351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 343365..344681 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene guaD CDS 344826..346196 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(346262..346606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(346603..347208) product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(347224..348201) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene msrP CDS 348437..349426 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(349508..350503) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(350582..352348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 note possible pseudo, frameshifted CDS complement(352341..354026) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene cydD CDS complement(354030..355031) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene cydB CDS complement(355035..356453) product cyanide-insensitive cytochrome bd quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene cioA CDS complement(356842..357822) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 358030..359394 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 359391..361064 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene pqiB CDS 361141..361716 product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 361799..362317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 362467..363765 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(363838..364008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 364130..365365 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 365457..366188 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 366196..368055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 note possible pseudo, frameshifted CDS 368009..368566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 368583..369791 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 369853..370911 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene ansA CDS 371004..371240 product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(371255..371935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(372059..372745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(372875..374317) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene yegQ CDS 374516..375247 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene queC CDS 375247..375939 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene queE CDS 375939..376784 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 376781..377074 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(377086..377427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 377779..378399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(378392..379186) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene istB CDS complement(379186..380493) product IS21-like element ISSme2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene istA CDS 380580..380843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(380881..381258) product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(381637..383313) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsA CDS complement(383493..384191) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene cmk CDS complement(384188..386455) product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(386459..387550) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene pheA CDS complement(387556..388707) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene serC CDS complement(388697..391381) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene gyrA CDS complement(391504..391923) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 392090..393016 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene rdgC CDS 393021..394193 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 394218..395414 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 395490..395771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 395941..397425 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene thiI CDS 397512..400643 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(400818..401090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(401278..401613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 401767..403803 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene metG CDS 403808..404593 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rsxB CDS 404676..404885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 405092..405727 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene nth CDS 405814..406896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 406896..407660 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(407668..408675) product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(408683..408985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(409000..410676) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 410907..411536 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112838.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene coaE CDS 411591..411839 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 411829..412113 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 412128..412358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 412366..413244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(413626..413826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(413948..414358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 414438..415763 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene rimO CDS 415777..417684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 417727..419295 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 419341..420483 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 420480..421457 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(421449..422624) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(422734..423291) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(423367..424656) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(424703..425869) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(426135..426914) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(426925..427731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(427847..428527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 428650..429126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(429133..430050) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 note possible pseudo, frameshifted CDS complement(430058..430270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 note possible pseudo, frameshifted CDS complement(430283..430465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(430540..431793) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(433862..434974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(435118..436548) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(436598..437113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(437304..438368) product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189471990.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(438365..439243) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rfbA CDS complement(439310..440371) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene rfbB CDS complement(440549..441667) product ISAs1-like element ISEc1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(442201..442467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(442468..443307) product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(443304..443594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(443614..444042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(444101..444265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(444249..444419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 444511..445536 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(445579..447795) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(447826..448257) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 448483..449862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(450071..451096) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 451526..451807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 451927..452532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 452523..453314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 453311..454534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 note possible pseudo, frameshifted CDS 454590..455450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 455564..456142 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(456225..456923) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rsuA CDS complement(456923..457738) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 457887..458795 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rarD CDS complement(458861..460135) product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(460246..461439) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 461624..463336 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 463446..464579 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 464576..465397 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 465397..466335 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 466332..466937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 467027..467797 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene csiR CDS complement(467817..468131) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 468416..468625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(468647..469600) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(469597..470322) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(470319..471074) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(471121..472293) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(472404..473216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(473233..473910) product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(473970..475256) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(475253..475849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(475914..476978) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(477019..477822) product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(477904..478821) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 479078..480064 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 480071..480664 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 480690..481994 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(482002..483852) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(483858..485180) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(485194..486171) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(486173..487381) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(487556..488317) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(488307..489251) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(489248..490426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(490430..491392) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 491440..492411 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(492510..493991) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene cysS CDS complement(493988..495691) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 495995..496492 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 496572..497336 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene lpxH CDS complement(497325..498383) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(498570..500387) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene ppiD CDS complement(500506..500778) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene hupB CDS complement(500956..503361) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene lon CDS complement(503572..504852) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene clpX CDS complement(504961..505581) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene clpP CDS complement(505672..507033) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene tig tRNA complement(507308..507382) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(507440..507514) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(507553..507629) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(507698..507774) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 507981..508838 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene folD CDS 508911..509657 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene mtnN CDS 509671..510075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 note possible pseudo, internal stop codon CDS 510085..510591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(510673..511197) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene luxS CDS complement(511317..512354) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene pyrC CDS 512484..513416 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 513458..513895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(513972..515219) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(515400..515822) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(515794..516051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(516072..516512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(516656..517552) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene mmsB CDS complement(517600..518754) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(518773..519945) product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 520162..520611 product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 520683..522374 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 522538..522822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(522826..523509) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 523652..524035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 524035..526095 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 526203..526322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 526342..529074 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(529071..530198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(530306..530605) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(530809..532029) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 532209..532877 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene rnt CDS complement(532992..533327) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 533499..534419 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene argF CDS 534565..534870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 tRNA complement(535075..535150) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 535335..535982 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene uvrY CDS 536051..537865 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene uvrC CDS 537933..538481 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene pgsA tRNA 538541..538615 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 538650..538723 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 538754..538840 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 538900..540045 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 540026..541615 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene nadB CDS complement(541627..542019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(542000..542293) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 542485..542781 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene ihfB CDS 542841..543146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 543147..544328 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene lapB CDS complement(544336..545037) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene pyrF CDS 545361..545642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(545889..546296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 note possible pseudo, frameshifted CDS complement(546272..546640) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(546705..547466) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 547696..548232 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene fxsA CDS 548431..548724 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 548782..550425 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene groL CDS 550565..551305 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940021.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene trmJ CDS complement(551454..552803) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(553130..553345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 553478..553615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(554612..555700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(555807..556163) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(556304..557599) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(557599..558144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(558232..559323) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene dctP CDS 559495..560268 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(560289..561575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(561572..562513) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(562515..562871) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974541.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(563037..564314) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(564311..564856) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(564922..565989) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene dctP CDS complement(566143..566805) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 566740..566946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(566953..568323) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(568361..570007) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(570073..571128) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(571160..572434) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(572699..573637) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 573769..575016 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 575100..576650 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 576736..577719 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 577716..578552 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 578567..580192 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 580233..581627 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 581624..582556 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 582553..582999 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 583033..584139 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(584230..584490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(584697..584879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 585054..586268 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 586265..586390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 586585..587532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 note possible pseudo, frameshifted CDS 587414..588034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 note possible pseudo, frameshifted CDS 588115..588819 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 588816..589544 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 589570..590391 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 590556..592007 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 591997..592392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(592671..593600) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene arcC CDS complement(593613..594623) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(594635..595891) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene arcA CDS complement(595995..597434) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(597549..598622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 note possible pseudo, frameshifted CDS complement(598619..599041) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(599246..599506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 note possible pseudo, frameshifted CDS complement(599637..600008) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 600227..601675 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 601745..603367 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(603583..603954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 note possible pseudo, internal stop codon CDS complement(603983..604513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(604675..605661) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 605792..606733 product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(606912..608087) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 608371..609540 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 609551..611158 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 611176..612024 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 612021..614087 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 614092..614991 product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene liuE CDS complement(615130..615561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(615558..615989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(616084..616347) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(616344..616586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(616737..617057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211291926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(617179..617415) product Rad51 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(617556..617939) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 note possible pseudo, internal stop codon CDS complement(618197..618694) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 618927..619892 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(620027..620752) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 620895..621026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(621235..622614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 622801..622965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(622975..624891) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 625057..626349 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 626445..627293 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969685.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 627562..628599 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 628615..629184 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 629181..630485 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 630489..631190 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(631338..633548) product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 633668..634297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(634327..634527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(634531..635349) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(635481..637043) product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 637275..637865 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(637830..638684) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(639084..639473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(639579..641264) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(641370..641723) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(641720..642130) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(642127..642972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(643061..644308) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(644436..644651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(644651..645241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 note possible pseudo, frameshifted CDS complement(645238..645900) product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(646044..646622) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(646742..647662) product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene mntD CDS complement(647659..648870) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(648870..649667) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(649667..650530) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(650802..651863) product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene bla CDS complement(651860..652993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(653044..653409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 653616..654092 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 654219..655379 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 655384..657363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 657444..657836 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(657895..659952) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(659952..661292) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(661289..662416) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(662413..664980) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(665069..666295) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(666306..666656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 666803..667126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 667227..667505 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 667635..668576 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 668573..669334 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 669401..670399 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene yejK CDS 670532..671635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, frameshifted CDS 671611..671907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(671822..672259) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene trxC CDS 672431..674236 product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene hcuC CDS complement(674249..676654) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(676660..676962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(676959..677729) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(677787..678194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(678216..678530) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(678534..679481) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(679478..680836) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 681121..683724 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene acnB CDS 683930..684418 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rraA CDS 684513..686396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(686506..688347) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ggt CDS complement(688599..690971) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ppsA CDS 691241..692074 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(692071..693276) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(693447..694628) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(694821..696455) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 696454..697512 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 697589..698443 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 698447..699637 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(699660..700232) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 700337..701620 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(701653..702105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 702348..704069 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 704083..704736 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 704884..705021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(705005..706213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(706207..706563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(707051..707560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(707599..708135) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rfaH CDS 708305..709684 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(709722..711560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(711624..712868) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 712994..714175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 note possible pseudo, frameshifted CDS 714108..714902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 note possible pseudo, frameshifted CDS 714939..715955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 716030..716596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(716708..719356) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene ppc CDS complement(719353..720270) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene mazG CDS complement(720267..722543) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene relA CDS complement(722536..724008) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rlmD CDS complement(724010..724912) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene cysM CDS 725029..727716 product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene gacS CDS complement(727713..728090) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene acpS CDS complement(728094..728495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 note possible pseudo, frameshifted CDS 728482..728910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(728930..729631) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene recO CDS complement(729638..730537) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene era CDS complement(730534..731238) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rnc CDS complement(731318..732121) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene lepB CDS complement(732149..733966) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene lepA CDS complement(734345..734905) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020333947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 735319..736371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 736374..737039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 737032..738060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 738057..738698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 738695..740764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(740722..741021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(741063..741491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(741488..742111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(742327..743748) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(743860..744840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(744857..745546) product anti sigma-E factor RseA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(745732..746337) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene rpoE CDS 746678..747766 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(747833..749971) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene dinG CDS complement(749976..751253) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene rhlB CDS 751406..751660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 751660..752487 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene xthA CDS complement(752670..753416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(753416..753778) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(753814..754380) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(754364..756073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(756291..757241) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(757256..758005) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 758356..760020 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(760312..761136) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(761133..761750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(761723..763357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(763354..763911) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(763935..764783) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 764973..766256 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 766264..767991 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene menD CDS 767981..768745 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene menH CDS complement(768764..770233) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 770573..772357 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene frdA CDS 772354..773079 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 773089..773481 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene frdC CDS 773483..773863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 773892..774752 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene menB CDS 774772..775755 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene menC CDS 775748..777169 product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(777157..777492) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(777507..778505) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(778496..779137) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene tmk CDS complement(779148..780155) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene mltG CDS complement(780177..780992) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene pabC CDS complement(781012..782229) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene fabF CDS complement(782448..782681) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene acpP CDS complement(782813..783556) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene fabG CDS complement(783587..784564) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene fabD CDS complement(784561..785490) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene plsX note possible pseudo, frameshifted CDS complement(785728..785898) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rpmF CDS complement(785931..786521) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene yceD CDS 786561..787142 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(787134..788240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(788244..788897) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(788964..789911) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rluC CDS 790474..793611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(793721..794749) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene murB CDS complement(794746..795225) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(795222..796022) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene kdsB CDS complement(796022..796234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(796242..797312) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018915793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene lpxK CDS complement(797392..799152) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene msbA CDS complement(799149..799586) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(799583..800281) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(800324..802600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 802736..803278 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(803395..804132) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene lolD CDS complement(804140..805381) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(805479..807740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(807737..808537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 808702..809745 product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 809924..810826 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(811000..812244) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(812310..812939) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420493.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene upp CDS complement(813057..813740) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene ung CDS complement(813759..814238) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene gpt CDS complement(814243..814788) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(814831..816132) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(816360..816989) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 817396..818454 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene metN CDS 818435..819088 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 819172..819966 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene metQ CDS 820026..820493 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 tRNA complement(820592..820668) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(820690..820766) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(820928..821950) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene gap CDS 822237..823697 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene pyk CDS 823744..825036 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene eno CDS 825191..826093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 note possible pseudo, frameshifted CDS 825981..826766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 note possible pseudo, frameshifted CDS 826808..827059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 827116..827838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 note possible pseudo, frameshifted CDS 827736..828953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 note possible pseudo, frameshifted CDS 829180..830292 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 note possible pseudo, frameshifted CDS 830437..830916 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mgsA CDS 831121..831339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 831323..831718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 831715..832464 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene tpiA CDS 833101..833889 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene glpF CDS 834138..835337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 note possible pseudo, frameshifted CDS 835310..835633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 note possible pseudo, frameshifted CDS 835748..837631 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene glpD CDS 837628..838392 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 838544..840049 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene glpD CDS complement(840442..840600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 note possible pseudo, frameshifted CDS complement(840597..841823) product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene fumC CDS 842035..842421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 842593..843129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(843157..843858) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene hda CDS complement(843855..844931) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 845097..846164 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene purM CDS 846161..846892 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene purN CDS complement(846988..847554) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene dcd CDS complement(847656..848531) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene apbC CDS complement(848615..849631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(849810..850553) product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(850550..851173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(851175..851849) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 851943..852980 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(852993..853244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 853150..854076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(854115..854342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(854457..855875) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(856518..857579) product IS1380-like element ISBdi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212447968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 858070..859368 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(859459..860262) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene ugpQ CDS 860448..861002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 861103..862080 product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(862151..862381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(862429..863070) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene ureG CDS complement(863112..863846) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(863824..864348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(864358..866061) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene ureC CDS complement(866058..866378) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(866536..866844) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418034.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene ureA CDS complement(866870..867760) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(868172..868870) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene urtE CDS complement(868870..869709) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene urtD CDS complement(869706..870872) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene urtC CDS complement(870876..872471) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene urtB CDS complement(872692..874035) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene urtA CDS complement(874355..875836) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(875856..876338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(876437..877438) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(877585..878346) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(878391..880094) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(880168..880995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(881158..882618) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(882763..883866) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene hppD CDS 884227..885378 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene cfa CDS 885510..887495 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(887506..888162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(888162..889730) product sigma-54-dependent phenylalanine hydroxylase transcriptional regulator PhhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 889921..890259 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 890260..891447 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 891652..893166 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(893249..894175) product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(894268..895485) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene argJ CDS complement(895516..898245) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene secA CDS complement(898305..898676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 898792..899253 product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(899342..900253) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene lpxC CDS complement(900366..901541) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ftsZ CDS complement(901576..902865) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene ftsA CDS complement(903060..903785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(903782..904711) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(904708..906183) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene murC CDS complement(906173..907255) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene murG CDS complement(907258..908529) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene ftsW CDS complement(908526..909905) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene murD CDS complement(909938..911023) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene mraY CDS complement(911033..912418) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(912415..913941) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(913993..915702) product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene ftsI CDS complement(915699..916022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(916033..916989) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene rsmH CDS complement(917454..918311) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rsmI CDS 918361..920109 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 920093..920461 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 920499..921092 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 921098..921676 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(921780..922274) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(922324..922950) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene sspA CDS complement(923093..923860) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(923860..925119) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(925119..925526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(925937..926326) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene rpsI CDS complement(926340..926768) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene rplM CDS complement(926942..928129) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene zapE CDS 928324..928773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(929036..929797) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 929900..931153 product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene algW CDS complement(931238..932557) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene hisD CDS complement(932677..933327) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene hisG CDS complement(933347..934609) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene murA CDS complement(934622..934954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(935000..935335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(935332..935985) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(936030..936494) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene mlaD CDS complement(936549..937337) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene mlaE CDS complement(937334..938191) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene mlaF CDS 938313..939269 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 939302..940297 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene kdsD CDS 940324..940881 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 940886..941470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 941467..941973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 941982..942713 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene lptB CDS 942868..944280 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 944451..944759 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene hpf CDS 944767..945231 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene ptsN CDS 945275..946195 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rapZ CDS 946198..946467 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(946626..947966) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene pmbA CDS 948081..948620 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene yjgA CDS complement(948622..950079) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene tldD CDS complement(950076..953909) product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103968156.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(953914..955377) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene rng CDS complement(955458..956075) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(956089..956583) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene mreD CDS complement(956583..957452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, frameshifted CDS complement(957536..957874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, frameshifted CDS complement(957766..958578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 note possible pseudo, frameshifted CDS 958751..959038 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene gatC CDS 959068..960528 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene gatA CDS 960528..961997 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene gatB CDS 962010..962561 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(962584..962754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(962910..964430) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(964427..965860) product putrescine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene spuC CDS complement(965886..966662) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 966832..968202 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(968346..969044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(969304..970596) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(970627..971469) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(971472..972383) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(972435..973568) product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene potA CDS complement(973755..974861) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(974969..976315) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(976352..977659) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(977871..978617) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(978620..979120) product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene dadR CDS complement(979302..980162) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene prmC CDS complement(980162..981253) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene prfA CDS complement(981262..982530) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene hemA CDS 982693..984453 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 984491..985108 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene lolB CDS 985125..986027 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene ispE CDS 986068..986997 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 987106..987741 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 987841..988428 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene pth CDS 988503..989594 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene ychF CDS 989754..990155 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene msrB CDS 990250..991218 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene ylqF CDS 991261..992490 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 992629..993531 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene htpX CDS complement(993666..993986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211291926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(994055..994636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 994859..996238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(996582..997022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(997408..997731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(997792..997950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(998060..998839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(998928..999344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1000188..1000685) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1001031..1002212) product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene pdxB CDS 1002306..1002593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1002598..1002945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1003028..1005268) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene rlmKL CDS 1005477..1005683 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1005790..1006815) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1006935..1011776) product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene gdhB CDS complement(1011954..1013081) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene trmA CDS complement(1013127..1013906) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene murI CDS complement(1014049..1014597) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1014775..1016124 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene rarA CDS complement(1016272..1016901) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene lolA CDS complement(1017059..1020451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1020603..1021379 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene aat CDS 1021376..1022113 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1022235..1022453 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene infA CDS complement(1022547..1024823) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene clpA CDS complement(1024968..1025318) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene clpS CDS complement(1025568..1027802) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1028086..1028724 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1028721..1029170 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1029243..1030379 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007019485.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene mnmA CDS 1030376..1031017 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767416.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene hflD CDS 1031068..1032456 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene purB CDS 1032453..1033628 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1033788..1034225 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1034553..1036148 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1036332..1036814) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1037073..1037354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1037506..1037973) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1038357..1038581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1038642..1039820) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1039912..1040541) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1040762..1043227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1043464..1044756 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1044905..1045510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1045577..1045819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1045942..1046127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1046211..1046399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1046420..1047811 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045970399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1047822..1048877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1048969..1049412 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1049551..1051524 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485008.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene rnb CDS complement(1051674..1052546) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene sucD CDS complement(1052546..1053712) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene sucC CDS complement(1053851..1054735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 note possible pseudo, internal stop codon CDS complement(1054763..1055296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 note possible pseudo, internal stop codon CDS complement(1055361..1056890) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene odhB CDS complement(1056931..1059741) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1060021..1060725) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1060737..1062509) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene sdhA CDS complement(1062513..1062860) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene sdhD CDS complement(1062854..1063180) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene sdhC CDS 1063684..1064967 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene gltA CDS 1065284..1065979 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 note possible pseudo, frameshifted tRNA complement(1066433..1066508) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(1066529..1066604) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(1066661..1068142) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene gltX CDS 1068293..1069033 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1069170..1069760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1069780..1070376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1070448..1070771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1070929..1071735 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1071760..1071996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1072472..1072813 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1072824..1073126 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1073123..1073350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1073493..1074452 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene dusA CDS complement(1074463..1074708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 note possible pseudo, frameshifted CDS 1074932..1075591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1075657..1076274 product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene nalD CDS complement(1076306..1077061) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1077131..1078543) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1078536..1081679) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1081679..1082914) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1083280..1084113 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1084203..1084709) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1084844..1085158 product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1085210..1085767) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1085846..1086481 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1086577..1087173 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1087173..1088756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1088753..1089403 product two-component system response regulator BfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene bfiR CDS complement(1089571..1090089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 note possible pseudo, frameshifted CDS complement(1089978..1090628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 note possible pseudo, frameshifted CDS complement(1090791..1092239) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene cls CDS complement(1092236..1092718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 note possible pseudo, frameshifted CDS complement(1092667..1093032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 note possible pseudo, frameshifted CDS complement(1093048..1093596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1093917..1094414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 note possible pseudo, frameshifted CDS 1094411..1094695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 note possible pseudo, frameshifted CDS 1094826..1095104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1095035..1095820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 note possible pseudo, frameshifted CDS 1095711..1096082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 note possible pseudo, frameshifted CDS complement(1096058..1096915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 note possible pseudo, frameshifted CDS complement(1096954..1097247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 note possible pseudo, frameshifted CDS 1097395..1097823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1097968..1099104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1099055..1099699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1099729..1100790 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1101026..1101613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1101645..1102445) product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene istB CDS complement(1102462..1103979) product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene istA CDS 1104157..1104459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1104580..1104825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1104891..1105259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1105331..1105993) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1105993..1106226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1106319..1106711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1106803..1107624) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene lgt CDS complement(1107602..1108021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1108180..1108956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1109019..1109882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1109965..1111629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1111697..1112080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1112287..1112652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1112771..1113373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1113454..1115958 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1115955..1116137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1116245..1116562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1116650..1117756 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1117771..1117932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1117929..1118369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1118473..1119939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1120114..1121487) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene trkA CDS complement(1121492..1122229) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1122222..1124912) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1124922..1125545) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene kdpC CDS complement(1125557..1127638) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene kdpB CDS complement(1127650..1129341) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene kdpA CDS complement(1129575..1131041) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1131126..1131566) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1131660..1132505) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1132557..1132907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1132969..1134048) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1134232..1135224 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1135255..1135680 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1135769..1136542) product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1136730..1137578) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1137615..1139246) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1139327..1141120) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1141218..1142639) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1142883..1143518) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1143579..1143986 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1144069..1144473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1144485..1145414 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1145439..1146845) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene cpsB CDS complement(1146842..1148410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1148534..1149502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1149609..1150223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 note possible pseudo, frameshifted CDS 1150195..1152123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1152120..1152932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1152929..1153762 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1153781..1154911) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene ribA CDS 1154997..1155836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1155943..1156143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1156823..1157485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1157745..1158854) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1158899..1159297) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1159299..1160327) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1160629..1161303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1161568..1162236 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene tenA CDS 1162313..1164217 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene thiC CDS 1164333..1164614 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 note possible pseudo, frameshifted CDS 1164679..1165086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 note possible pseudo, frameshifted CDS 1165143..1165724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1165781..1167562 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1167638..1168858) product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1168855..1169787) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1169999..1170502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1170631..1171563) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1171705..1172889 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1172886..1175060 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene pta CDS 1175245..1176399 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1176529..1177212) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1177325..1177534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 note possible pseudo, internal stop codon CDS complement(1177583..1178905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 note possible pseudo, internal stop codon CDS complement(1178902..1181256) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1181341..1182348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1182345..1183037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1183102..1183602) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene tpx CDS complement(1183673..1184248) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1184334..1185230 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1185372..1186064) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene nfi CDS complement(1186087..1186893) product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene blaOXA CDS 1187012..1187947 product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene ampR CDS 1188031..1189326 product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406534.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1189323..1192643 product exonuclease SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1192679..1193623) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1193703..1194650) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1194723..1195166) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1195327..1196235 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1196217..1196426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1196386..1197126 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1197154..1197912 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1198011..1198565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1198492..1199460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 note possible pseudo, frameshifted CDS 1199680..1200018 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1200015..1200296 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1200407..1200994) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1201174..1201407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1201404..1201727 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110754436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1202087..1203016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1203013..1203264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1203254..1204702) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1205121..1205846) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1205910..1206071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1206114..1207838) product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1207980..1208273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1208330..1209193 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1209233..1210648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1210893..1211768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1212014..1212592 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1212663..1212908 product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1213046..1213510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1213507..1214307) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1214236..1214415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1214631..1216016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1216123..1216533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1216624..1216953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1216950..1218680) product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1218677..1220059) product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene hsdS CDS complement(1220056..1221723) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1221720..1222880) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1223139..1226675) product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene hsdR CDS complement(1226759..1227238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1227444..1228577) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1228603..1229919 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene argE CDS 1229941..1230669 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1230695..1231678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1231790..1233499) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1233943..1234392 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1234662..1235666) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1235763..1236680) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1236798..1237643 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1237856..1239562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1239690..1241558 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1241575..1243206) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1243219..1243452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1243354..1244073 product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1244367..1245719 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1245807..1247105 product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene nasR CDS complement(1247139..1249835) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1250360..1251688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1251690..1253516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 note possible pseudo, frameshifted CDS 1253465..1254223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 note possible pseudo, frameshifted CDS 1254238..1254663 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene nirD CDS 1254750..1255775 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1256013..1257413 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1257453..1259276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1259273..1260778) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1260775..1262223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1262216..1262860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1262907..1264262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1264381..1265583) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene trpB CDS complement(1265714..1266382) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1266463..1268232) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1268465..1268671) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1268872..1270521) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1270758..1272269) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1272451..1273371 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1273473..1273988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1273999..1274565) product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1274712..1275290 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1275275..1275745) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene pgpA CDS complement(1275745..1276380) product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1276626..1278059 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1278041..1278886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 note possible pseudo, frameshifted CDS complement(1278883..1279260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 note possible pseudo, frameshifted CDS complement(1279430..1279837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 note possible pseudo, frameshifted CDS complement(1279813..1280187) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1280272..1282011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1282287..1283819 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1283816..1284982 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1285060..1285854 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1285904..1286452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1286620..1287729 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1287796..1288299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1288296..1289633 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1289785..1290447 product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1290466..1290894 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene dksA CDS 1290894..1292114 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene zigA CDS 1292118..1293212 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1293313..1293993) product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene ybiX CDS complement(1294003..1296264) product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene piuA CDS complement(1296498..1297349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 note possible pseudo, frameshifted CDS complement(1297306..1297854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 note possible pseudo, frameshifted CDS complement(1298135..1299031) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415118.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1299040..1299834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1299824..1300429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1300430..1301326) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1301337..1302698) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1302773..1303951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1304044..1304943 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene folE2 CDS 1305342..1306691 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene mgtE CDS 1306843..1307451 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene ybjG CDS 1307551..1307796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1307847..1308122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1308271..1308552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1309143..1309562) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene crcB CDS complement(1309559..1309951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1310165..1311916 product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929446.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1312031..1313800 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene fadD CDS 1313794..1314696 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1314722..1315411 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1315417..1316370) product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1316606..1316890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1317283..1317555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1317652..1320891) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1321118..1321858) product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104614758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1321858..1322808) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1323034..1324167) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1324184..1325587) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1325584..1327575) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 tRNA complement(1327668..1327744) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 1327892..1328530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1328535..1329809) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1330001..1331821) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1332015..1334246 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1334436..1335350 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1335435..1336310 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1336429..1337592 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1337681..1338919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 note possible pseudo, frameshifted CDS 1338813..1339181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1339178..1340566 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1340732..1341181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1341236..1341604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1342034..1343674 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1343733..1344458) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1344455..1346377) product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162808153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1346521..1346916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1347243..1348169 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1348129..1351101) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene fdhF CDS complement(1351113..1352837) product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1353038..1353838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 note possible pseudo, frameshifted CDS complement(1353943..1354395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 note possible pseudo, frameshifted CDS complement(1354463..1355167) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023518284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene mtgA CDS complement(1355302..1356159) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027907389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene fghA CDS complement(1356238..1357401) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1357472..1358419 product glutathione-dependent formaldehyde neutralization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene gfnR CDS complement(1358527..1359516) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1359519..1360406) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1360465..1361685) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1361800..1362558) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1362555..1363328) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1363687..1364343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1364535..1366106 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142741014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1366188..1368038) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene rpoD CDS complement(1368277..1369821) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene dnaG note possible pseudo, frameshifted CDS complement(1370289..1370504) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene rpsU CDS 1370765..1371793 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene tsaD CDS complement(1372017..1372625) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene plsY CDS 1372793..1373158 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene folB CDS 1373158..1373676 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene folK CDS complement(1373683..1374837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1374841..1375161) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269136.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene glpE CDS complement(1375203..1376021) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110655318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1376054..1376452) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene apaG CDS complement(1376449..1377279) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene rsmA CDS complement(1377348..1378391) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene pdxA CDS complement(1378391..1379065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1379107..1381536) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene lptD CDS 1381693..1382715 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1382712..1383386 product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene murU CDS 1383454..1384809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1385168..1385587 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1385754..1386398) product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene coq7 CDS complement(1386568..1386909) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1386947..1387819) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1387819..1388259) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1388270..1389571) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene purD CDS complement(1389645..1390097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1390208..1390921 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1390936..1391511) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1391630..1392901) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1392971..1393426) product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1393423..1394976) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1394969..1396363) product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1396641..1397045) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene mnhG CDS complement(1397038..1397307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 note possible pseudo, internal stop codon CDS complement(1397329..1397802) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1397799..1399376) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1399373..1399720) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1399751..1400182) product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1400175..1402505) product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1402901..1405717 product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1405717..1406058 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1406055..1407596 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1407593..1408090 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1408084..1408353 product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1408364..1408813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1408838..1409938) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene hemH CDS 1410060..1410458 product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1410548..1410838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1410934..1411227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1411327..1415472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1415613..1416059) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene rplI CDS complement(1416075..1416929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1416939..1417166) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rpsR CDS complement(1417200..1417568) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rpsF CDS complement(1417720..1418514) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene rlmB CDS complement(1418590..1420995) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene rnr tRNA 1421241..1421327 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 1421397..1421483 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 1421524..1421610 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(1421723..1422586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1422683..1422907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1423066..1423533) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1423735..1424049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1424138..1425688) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1425716..1426999) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1427016..1428938) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1429193..1431205) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 tRNA complement(1431410..1431486) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(1431490..1431566) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(1431619..1431695) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(1431723..1431799) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(1431841..1431916) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 1432389..1433813 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene ccoN CDS 1433837..1434445 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene ccoO CDS 1434448..1434663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1434660..1435589 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ccoP CDS 1435720..1437159 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ccoG CDS 1437161..1437685 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 1437716..1440202 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 1440199..1440429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1440429..1441127 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1441289..1442611 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene hemN CDS 1442673..1443452 product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene anr CDS complement(1443567..1444496) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ttcA CDS complement(1444580..1445206) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1445273..1447090) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1447541..1447804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1447686..1448993) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted CDS 1449347..1449607 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1449614..1451410 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1451506..1452021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1452089..1455190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 note possible pseudo, frameshifted CDS 1455190..1456038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 note possible pseudo, frameshifted CDS complement(1456105..1456767) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1456985..1458919) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene acs CDS complement(1459093..1459653) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1459726..1460367 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1460374..1461495) product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1461767..1462531) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1462528..1463232) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene tsaB CDS complement(1463377..1464033) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene adk CDS complement(1464308..1466299) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene aceF CDS complement(1466357..1469029) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene aceE CDS complement(1469345..1469956) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene ampD CDS 1470208..1470924 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene nadC CDS complement(1470948..1471487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1471589..1472311 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene tsaA CDS complement(1472381..1473094) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1473149..1473835) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1473937..1474917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1474947..1475831) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379025.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene dapA CDS 1476032..1476505 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1476550..1477650) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1477647..1477895) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene tusA CDS 1478011..1479510 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1479527..1480546) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene nadA tRNA complement(1480862..1480937) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(1480967..1481042) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(1481119..1481970) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene rluB CDS complement(1481967..1482842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1482839..1483792) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1483998..1485881) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1485930..1486736) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1486915..1490946) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene purL CDS 1491115..1492596 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene mltF CDS 1492562..1494595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1494551..1495009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1495052..1495915 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene tesB tRNA 1495952..1496027 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(1496105..1496485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1496541..1497404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1497475..1498227) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1498364..1499641) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1499638..1500096) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene umuD CDS complement(1500234..1500530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1500577..1502253 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 note possible pseudo, frameshifted CDS complement(1502260..1505349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1505433..1505624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1505524..1506936 product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1506943..1508349) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1508466..1509665) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1509847..1510569 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1510613..1511464) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1511505..1512380) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1512487..1513380 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1513479..1513931) product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1514066..1514257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1514356..1515108) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1515172..1516074) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1516103..1517506) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene dbpA CDS complement(1517690..1519639) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene ftsH CDS 1519792..1520736 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1520811..1521143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1521156..1521827) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1521820..1522212) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403876.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1522359..1522679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1522936..1523823 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1524024..1524407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1524430..1525074) product alternative oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1525201..1526073) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene yghU tRNA complement(1526235..1526321) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 1526449..1527504 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene queA CDS 1527497..1528633 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene tgt CDS 1528769..1529101 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene yajC CDS 1529255..1531114 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene secD CDS 1531124..1532050 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene secF CDS complement(1532150..1532944) product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene suhB CDS 1533162..1533530 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1533506..1533913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 note possible pseudo, frameshifted CDS 1533983..1534726 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene trmJ CDS 1534842..1535711 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene cysE CDS 1535809..1536279 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene iscR CDS 1536314..1537471 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1537530..1537856 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene iscA CDS 1538055..1538480 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ndk CDS 1538550..1539677 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene rlmN CDS 1539796..1540548 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene pilW CDS 1540579..1541544 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1541553..1542665 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene ispG CDS 1542706..1544031 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene hisS CDS 1544086..1544751 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1544748..1545899 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene bamB CDS 1545896..1547302 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene der CDS 1547560..1548078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1548075..1549604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1549610..1549783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1549831..1550697) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1550824..1550967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1551133..1551627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 note possible pseudo, internal stop codon CDS 1551680..1551937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1552000..1552812) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene aroE CDS complement(1552826..1553755) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene hemF CDS complement(1553794..1554351) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1554404..1555516) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene dprA CDS complement(1555526..1556626) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1556809..1557321 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene def CDS 1557431..1558435 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene fmt CDS 1558432..1559802 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rsmB CDS 1559834..1560040 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1560141..1561514 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene trkA CDS 1561528..1562976 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1563042..1564286 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1564439..1565233) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1565288..1566025) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1566002..1566655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1566612..1567412 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene phnE CDS complement(1567669..1568598) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1568690..1570009 product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1570102..1570302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1570527..1571624 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1571665..1572630 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1572684..1574327 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1574340..1576085) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1576135..1577730) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1577793..1578545) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1578764..1580083 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene ugpB CDS 1580148..1581032 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene ugpA CDS 1581048..1581896 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene ugpE CDS 1581896..1583053 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1583072..1583689) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1583729..1584148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1584306..1585652 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1585681..1586913) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1587011..1587685) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1587857..1589035 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 1589047..1589895 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene truC CDS 1589908..1590753 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene tcdA CDS 1590779..1591003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1591010..1591777) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1591787..1592614) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1592617..1593633) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1593979..1594461) product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene bfrB CDS complement(1594617..1594823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1594935..1595411) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1595425..1596489) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene lptG CDS complement(1596486..1597568) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene lptF CDS 1597719..1599239 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1599405..1600505 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1600509..1600961 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene holC CDS 1601225..1604071 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1604250..1604987 product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602409.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene lpxT CDS complement(1605155..1605601) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092827608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1605637..1606077) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1606284..1606751) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1606859..1607395 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1607457..1608524 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1608621..1609229) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1609404..1610114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1610210..1612507) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene metE CDS 1612612..1613526 product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene metR CDS complement(1613540..1615141) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1615145..1615858) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1616197..1619100 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 1619172..1620452 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1620529..1620708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1620818..1621483) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1621511..1622815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 note possible pseudo, frameshifted CDS complement(1622715..1623866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 note possible pseudo, frameshifted CDS complement(1623902..1625647) product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene fan1 CDS complement(1625652..1626689) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1626686..1627714) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1627722..1628246) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1628365..1629648 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1629688..1630434) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1630447..1631802) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1631890..1632588) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1632592..1632792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1632898..1634532) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1634728..1635723 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 1635720..1636430 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1636427..1636744 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1636844..1637287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1637297..1637734) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene aroQ CDS complement(1637752..1640763) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene glnE CDS complement(1640843..1641214) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1641246..1642685) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene dacB CDS complement(1642749..1643438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 rRNA complement(1643675..1643785) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(1643873..1646763) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(1646996..1647071) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1647282..1647360) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 rRNA complement(1647455..1648996) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(1649740..1650621) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene pssA CDS complement(1650778..1651794) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene ilvC CDS 1651968..1652855 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene ilvY CDS complement(1652921..1653412) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene ilvN CDS complement(1653412..1655136) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1655622..1658216) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene clpB CDS complement(1658410..1659165) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene pgeF CDS complement(1659190..1660149) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266591.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rluD CDS 1660290..1661120 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1661224..1662894) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1662894..1663241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1663271..1664362) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene thiO CDS 1664458..1665051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1665055..1665672) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1665751..1667553) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene recJ CDS complement(1667694..1669082) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene thrC CDS complement(1669086..1670402) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222944447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1670566..1671324) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene dsbC CDS complement(1671328..1672227) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene xerD CDS complement(1672341..1672697) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene rplS CDS complement(1672854..1673645) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene trmD CDS complement(1673645..1674196) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rimM CDS complement(1674234..1674482) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene rpsP CDS complement(1674605..1676014) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene ffh CDS 1676220..1677020 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1677098..1678369 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1678493..1679218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1679221..1679754) product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1679656..1679874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1680060..1680734 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 1680796..1681758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 note possible pseudo, frameshifted CDS 1681677..1683635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 note possible pseudo, frameshifted CDS complement(1683749..1685236) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene sbcB CDS complement(1685313..1685573) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene minE CDS complement(1685570..1686388) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene minD CDS complement(1686449..1687198) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene minC CDS 1687461..1690271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1690385..1691131) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 tRNA 1691350..1691426 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 1691579..1692517 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene trxA CDS complement(1692519..1693715) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1693762..1694208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1694244..1695056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1695130..1695537 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1695534..1696004 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene ybaK CDS 1696087..1696413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1696385..1696930 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1696972..1697094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1697267..1697821 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1697839..1698339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1698416..1698931) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 1699188..1700219 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1700326..1701105 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene yaaA CDS complement(1701139..1701714) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1701831..1702664 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1702755..1702949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1703291..1705207 product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene fabY CDS 1705204..1705683 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene coaD CDS 1705775..1706023 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1706119..1706442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 1706648..1707274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1707378..1708751 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene dinF CDS 1708861..1710171 product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1710229..1710633 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1710635..1711144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1711141..1711461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1711544..1711675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1711748..1712494) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1712612..1713034 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1713031..1714200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1714191..1714859) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1714914..1715276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1715273..1715836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1715962..1717098 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 1717234..1717707 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1717907..1718266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1718260..1719729) product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1719942..1722098) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1722333..1722560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1722442..1723545 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1723610..1724110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1724107..1724670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 note possible pseudo, frameshifted CDS 1724631..1725443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 note possible pseudo, frameshifted CDS 1725699..1726697 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1726759..1728366 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1728366..1729436 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1729549..1732308) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene polA CDS 1732464..1732751 product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1732876..1733835 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 1733832..1735760 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene speA CDS complement(1735860..1736525) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1736630..1737628) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene thpD CDS complement(1737797..1739053) product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1739096..1739398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1739633..1740574) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012105761.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1740571..1742349) product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088056948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene mobH CDS complement(1742668..1744932) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1745026..1746528) product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1746597..1747190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1747273..1747896) product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1747990..1748529) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene radC CDS complement(1748607..1748972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1749371..1750612) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1750687..1751691) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1751740..1752060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 note possible pseudo, frameshifted CDS complement(1752069..1752830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 note possible pseudo, frameshifted CDS complement(1753135..1754514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1754534..1754761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1754754..1755236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1755463..1756719 product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1757539..1758351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 note possible pseudo, frameshifted CDS complement(1758390..1758692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 note possible pseudo, frameshifted CDS 1758792..1759577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1760041..1760859) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1761401..1762474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 note possible pseudo, frameshifted CDS complement(1762471..1762968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 note possible pseudo, frameshifted CDS 1762971..1763555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1763462..1763857 product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene mvaT CDS complement(1764052..1764396) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1764492..1765613) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1765610..1766128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 note possible pseudo, frameshifted CDS complement(1767011..1767313) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1767673..1769121 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1769100..1769960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1771285..1772046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 note possible pseudo, frameshifted CDS 1772030..1772461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1772862..1773983 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1774050..1774799 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192955.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1775340..1775780 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene umuD CDS 1775795..1777069 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1777230..1778390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1778387..1779199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1779312..1779746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1780304..1781074) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1781071..1784364) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1784373..1784858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010567719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1784855..1786150) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1786144..1787319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1787309..1788118) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1788111..1789199) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1789189..1790721) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1790737..1791414) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128417842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1791879..1793204) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1793274..1793927) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1793962..1795638) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene hutU CDS complement(1795693..1796655) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene hutG CDS complement(1796645..1797859) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene hutI CDS 1798173..1799495 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1799565..1799981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 note possible pseudo, frameshifted CDS complement(1799986..1800288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 note possible pseudo, frameshifted CDS 1800595..1801026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1801144..1802082) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene glsB CDS complement(1802087..1803499) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1803553..1804788) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1804918..1805388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1805339..1805866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 note possible pseudo, frameshifted CDS complement(1806037..1806594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 note possible pseudo, frameshifted CDS 1806705..1807217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1807324..1808868) product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1808868..1809248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1809248..1810732) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1810746..1811696) product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024483820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1811693..1812127) product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821941.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1812366..1812737 product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene mvaT CDS complement(1813123..1813917) product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene mmsR CDS 1814357..1815313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1815288..1815743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1816479..1817336) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1817356..1817523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 note possible pseudo, frameshifted CDS complement(1817743..1818114) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1819218..1819508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1820546..1821640) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1821664..1823163) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1823176..1824072) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene mmsB CDS complement(1824281..1825534) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(1826040..1826375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1826365..1827150) product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1827260..1828462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 note possible pseudo, frameshifted CDS complement(1828489..1830192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 note possible pseudo, frameshifted CDS complement(1830192..1830620) product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1830658..1832109) product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1832106..1833005) product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1833002..1833649) product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1833646..1834029) product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1834029..1834403) product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1834477..1834698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1834698..1835066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1835246..1835938) product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(1835940..1836230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1836199..1838493) product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene traD CDS complement(1838503..1839078) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162526859.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1839093..1839587) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1839687..1840442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1840462..1841223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1841216..1841860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1842001..1842537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1842629..1843162) product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1843268..1843543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1844360..1846252) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1846401..1846604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1846703..1846927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1846948..1847535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1847573..1848007) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1848026..1848214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1848335..1849588 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1849568..1849873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1851045..1851794) product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1851877..1853235) product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161469396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1853235..1853837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1853834..1855738) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1855814..1856050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1856043..1856423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1856420..1857823) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene dnaB CDS complement(1857810..1858676) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 tRNA complement(1858817..1858892) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(1858982..1859056) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(1859063..1859138) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(1859226..1859501) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1859498..1860610) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene mutY CDS complement(1860665..1863016) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1863016..1863462) product acetyl-CoA sensor PanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1863656..1864249 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene hisB CDS 1864281..1864922 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318304.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene hisH CDS 1865048..1865797 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene hisA CDS 1865800..1866573 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene hisF CDS 1866594..1867121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1867138..1867731) product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1867757..1868050) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 1868101..1868796 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084901.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1868812..1869912) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene mnmH CDS complement(1869909..1870946) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene selD CDS complement(1871032..1872411) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene radA CDS complement(1872516..1872965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1873075..1873977) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1874102..1875157 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene hisC rRNA complement(1875485..1875587) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(1875678..1878564) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(1878795..1878870) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1879054..1880433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 tRNA complement(1880679..1880755) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 rRNA complement(1880948..1882484) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(1883241..1884284) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene tyrS CDS 1884555..1885694 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1885735..1886877) product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene pilU CDS complement(1886927..1887961) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene pilT CDS 1888021..1888749 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1888820..1889644 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene proC CDS 1889707..1890288 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 1890335..1891492 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621066.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 1891489..1892091 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene metW CDS 1892118..1892573 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1892611..1894542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 1894779..1895216 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene dksA CDS 1895301..1896197 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene gluQRS CDS 1896207..1896383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 1896482..1899421 product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene cbrA CDS 1899418..1900824 product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene cbrB CDS 1901722..1903128 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 1903125..1903619 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene folK CDS 1903754..1904545 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene panB CDS 1904558..1905406 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene panC CDS 1905435..1905815 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1906042..1907217 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(1907415..1909550) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene pnp CDS complement(1909900..1910169) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rpsO CDS complement(1910249..1911166) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene truB CDS complement(1911166..1911606) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene rbfA CDS complement(1911625..1911849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 note possible pseudo, frameshifted CDS complement(1911821..1914136) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene infB CDS complement(1914238..1915728) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene nusA CDS complement(1915801..1916280) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene rimP tRNA complement(1916527..1916603) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1916723..1916809) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(1916840..1917199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1917204..1917953) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene tpiA CDS complement(1918021..1919382) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene glmM CDS complement(1919376..1920227) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene folP CDS complement(1920315..1922306) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene ftsH CDS complement(1922504..1923193) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene rlmE CDS 1923399..1923725 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene yhbY CDS complement(1923848..1924324) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene greA CDS complement(1924321..1927551) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene carB CDS complement(1927611..1928759) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene carA CDS complement(1929083..1929889) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene dapB CDS complement(1929955..1930863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1930860..1931138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 1931292..1932236 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1932312..1933466) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene dnaJ CDS complement(1933558..1935228) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene dnaK CDS complement(1935273..1935494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 note possible pseudo, frameshifted CDS complement(1935618..1936235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 1936471..1938144 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene recN CDS complement(1938248..1938694) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene fur CDS 1938767..1939228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(1939281..1939577) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1939581..1940015) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815876.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1940144..1940635 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene smpB tmRNA 1940677..1941057 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 1941468..1942784 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1943074..1944273 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1944277..1945455 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene nspC CDS 1945609..1946916 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 1947089..1949398 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene ybiO CDS complement(1949637..1950893) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1950947..1952455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1952424..1953224) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1953224..1954165) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene hemC CDS 1954422..1955855 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene argH CDS 1955855..1956019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1956022..1957302 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene lysA CDS 1957302..1958135 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene dapF CDS 1958166..1958882 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 1958875..1959810 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene xerC CDS 1959807..1960592 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(1960648..1961253) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene yihA CDS 1961492..1962115 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 1962288..1962923 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 1962925..1963749 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 1963832..1964380 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 1964380..1965795 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(1965821..1966252) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 1966277..1967104 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene thiD CDS 1967191..1968036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 1968112..1968717 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 1968784..1969221 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene dtd CDS complement(1969218..1971146) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 1971224..1971739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 1971831..1972850 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 1973050..1973637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 1973668..1974090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 note possible pseudo, frameshifted CDS 1974015..1974953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 note possible pseudo, frameshifted CDS 1974995..1975438 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 1975567..1976253 product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene mip CDS 1976272..1977354 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(1977387..1977980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(1977977..1978489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 1978601..1979515 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1980176..1980919) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene trmB CDS complement(1980987..1981784) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(1981835..1982035) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene thiS CDS 1982153..1982533 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(1982552..1982965) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(1983105..1985279) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 1985515..1986501 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407359.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 1986498..1986995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(1987203..1988705) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1988772..1989098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 1989378..1989716 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene glnK CDS 1989744..1990994 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 1991142..1991480 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene glnK CDS complement(1991574..1992350) product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene fpr CDS 1992511..1993437 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(1993507..1993935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 1994116..1994706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 1994825..1995313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(1995339..1996106) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(1996119..1997219) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(1997229..1998422) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(1998536..1999540) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1999793..2000170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2000163..2001239) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765484.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene hemE CDS 2001436..2002071 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene ribA CDS complement(2002152..2003984) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene dxs CDS complement(2004001..2004885) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2004875..2005165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2005396..2006646 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene serA CDS 2006849..2007634 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2007849..2008673 product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174577.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene iclR CDS complement(2008755..2009204) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2009353..2010666 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene hmgA CDS 2010742..2011758 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2011786..2012436 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene maiA CDS 2012500..2013528 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2013594..2014223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2014233..2014676) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene ruvX CDS complement(2014696..2015226) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2015345..2015716 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2015692..2016099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 note possible pseudo, frameshifted CDS complement(2016113..2016382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2016611..2017042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2017064..2018032) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene gshB CDS complement(2018079..2018783) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(2018828..2019571) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(2019587..2020102) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208976.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene secB CDS complement(2020151..2020573) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2020845..2021930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 note possible pseudo, internal stop codon CDS 2021952..2022431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 note possible pseudo, internal stop codon CDS 2022445..2023605 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014505949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2023680..2024975 product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene cptA CDS complement(2024986..2026287) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(2026314..2027444) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103968835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene ubiH CDS 2027332..2027574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2027661..2028998) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene pepP CDS complement(2029049..2029627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2029803..2030102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2030349..2030993 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2031337..2032851) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene ilvA CDS 2032832..2033050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 2033224..2033913 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rpiA CDS complement(2033939..2034811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 note possible pseudo, frameshifted CDS complement(2035247..2036677) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene hldE CDS complement(2036667..2037770) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2037880..2038527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 2038529..2039257 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2039230..2040276) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(2040273..2041415) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2041454..2042548 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2042499..2043281) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2043412..2044209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 2044148..2045110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 note possible pseudo, frameshifted CDS complement(2045117..2046175) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene waaF CDS complement(2046168..2047124) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene rfaD CDS 2047292..2048200 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379468.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene glyQ CDS 2048203..2050275 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene glyS CDS 2050457..2051032 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene gmhB CDS complement(2051201..2052649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 note possible pseudo, frameshifted CDS complement(2052681..2053628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 note possible pseudo, frameshifted CDS complement(2053640..2054614) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene recF CDS 2054543..2054749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2054801..2055904) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene dnaN CDS complement(2056088..2057554) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102932.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene dnaA CDS complement(2057545..2057844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2058100..2058234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2058248..2058667 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene rnpA CDS 2058873..2060540 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene yidC CDS 2060667..2062034 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene mnmE CDS complement(2062051..2062899) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2062999..2063676) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2063773..2064942) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene hemW CDS complement(2064939..2065550) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2065926..2066603 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2066618..2067874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2067923..2069212) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene hemL CDS complement(2069321..2070175) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2070175..2070606) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene hemJ CDS complement(2070700..2072478) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2072592..2073626 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene argC CDS 2073725..2074078 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene erpA CDS 2074202..2074984 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937418.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene glnH CDS 2075096..2075767 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2075781..2076548 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2077080..2078984 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene mnmG CDS 2078981..2079631 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene rsmG CDS 2079663..2080433 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2080482..2081396 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2081594..2081980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2081992..2082819 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene atpB CDS 2082887..2083114 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene atpE CDS 2083191..2083661 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2083673..2084209 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2084226..2085770 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene atpA CDS 2085839..2086720 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene atpG CDS 2086787..2088163 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene atpD CDS 2088188..2088616 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2088762..2090135 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene mgtE CDS 2090137..2090937 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2090975..2092105 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816932.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2092122..2093483 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene glmU CDS 2093495..2095330 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene glmS CDS 2095327..2096193 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2096575..2097882 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2097978..2098187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 2098472..2099293 product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene hexR CDS 2099386..2101587 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene uvrD CDS 2101722..2102813 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene dctP CDS complement(2102894..2103295) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2103463..2104389 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2104465..2105652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2105649..2107184 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518729.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene pstA CDS 2107213..2108028 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene pstB CDS 2108052..2108780 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene phoU CDS 2109027..2109758 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene cysZ CDS complement(2109744..2111060) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene phoR CDS complement(2111062..2111814) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene phoB CDS complement(2111833..2112726) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene ubiA CDS complement(2112844..2114202) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2114470..2115018) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2115094..2116254 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2116320..2116595 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 2116627..2117037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2117092..2119191) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene recG CDS complement(2119188..2120144) product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2120176..2121048 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(2121089..2121592) product lipid A 3-O-deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene pagL CDS complement(2121624..2122139) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene thpR CDS complement(2122147..2122536) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2122626..2124758) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene spoT CDS complement(2124825..2125085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2125231..2125845) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene gmk CDS 2126552..2129314 product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2129314..2130795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2130792..2132234 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2132313..2133473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2133808..2134638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2135439..2135573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 2135965..2137308 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 2137301..2137930 product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968625.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2137938..2138801) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 2138949..2139527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 note possible pseudo, frameshifted CDS 2139473..2139688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 note possible pseudo, frameshifted CDS complement(2139793..2140560) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 2140653..2141363 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene pyrE CDS 2141382..2141924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2141961..2142515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2142603..2143094 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932347.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene trmL CDS 2143091..2145166 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene rep CDS complement(2145291..2146136) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 note possible pseudo, internal stop codon, frameshifted tRNA 2146373..2146449 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(2146548..2147540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2147566..2148288) product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene rsbQ CDS 2148547..2149755 product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 2149752..2150792 product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804110.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 2151069..2151473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2151612..2152175 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene ahpC CDS 2152342..2153898 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene ahpF CDS complement(2154016..2154384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(2154407..2155009) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2155308..2157299 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 2157296..2157886 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 2157883..2158356 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214855.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 2158375..2159256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 note possible pseudo, frameshifted CDS 2159283..2160050 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2160220..2161839 product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene nirS CDS 2162006..2163673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 2163688..2164239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2164330..2164878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2164970..2165338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 note possible pseudo, internal stop codon CDS complement(2165363..2165938) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2165968..2166798) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2166795..2167727) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2167724..2169034) product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2169089..2170984) product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene nosZ CDS complement(2170988..2173129) product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2173414..2173725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2173899..2174414) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene nsrR CDS complement(2174436..2174849) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2174900..2175547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2175550..2176116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2176184..2177569 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene hemN CDS 2177845..2178339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2178380..2180491 product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2180567..2181319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2181436..2182182) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2182179..2183099) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2183111..2184106) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(2184303..2184959) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene ytfE CDS complement(2185034..2186203) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene hmpA CDS complement(2186316..2187524) product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene nirF CDS complement(2187543..2187893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 2188129..2188602 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2188599..2189117 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2189114..2189659 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 2189634..2190182 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2190186..2191385 product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene nirJ CDS 2191431..2192297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2192294..2193808 product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene nirN CDS 2193925..2195121 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2195141..2195536 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2195631..2195948 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2196173..2196619 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 2197063..2198016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 note possible pseudo, frameshifted CDS 2198078..2198887 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2199053..2200093 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 2200493..2202433 product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2202446..2202658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2202812..2203123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2203128..2203730) product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2203790..2204356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2204369..2204791) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2204970..2206469) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2206528..2206986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2207072..2208664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(2208940..2209071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2209265..2209474 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2209471..2210085 product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2210103..2210693 product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014819602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2210737..2214318 product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene brxC CDS 2214359..2216029 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144178156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 2216171..2218267 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2218271..2219650 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 2219656..2220771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2220878..2221441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2221534..2222151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2222535..2223194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 2223191..2226229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 2226226..2226510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 2227151..2228254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2228275..2230155 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036859483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 2230152..2232665 product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene pglZ CDS 2232678..2234729 product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene brxL CDS complement(2234804..2235469) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene narL CDS complement(2235477..2237414) product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene narX CDS 2237554..2238825 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2239039..2242794 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2242791..2244371 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene narH CDS 2244364..2245143 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene narJ CDS 2245157..2245846 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene narI CDS 2245960..2246682 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2246764..2247360 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene moaB CDS 2247357..2248610 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 2248570..2249313 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 2249358..2249768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2249765..2250634 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene moaA note possible pseudo, frameshifted CDS 2250597..2250752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 note possible pseudo, frameshifted CDS 2250768..2251742 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530805.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2251766..2253379) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2253545..2254000) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2254000..2254956) product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096713.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2254953..2255873) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268083.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 2256026..2256175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2256461..2256913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2256843..2257130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 2257362..2258570 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(2258584..2259468) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 2259742..2261193 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene putP CDS 2261573..2262829 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene codB CDS 2262829..2264046 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528031.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2264066..2265343 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene codA CDS complement(2265435..2266343) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2266567..2268660 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 2268679..2270439 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 2270664..2272043 product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2272214..2272915 product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 2273043..2274098 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 2274406..2275710 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2275760..2277010 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2277023..2277391 product sarcosine oxidase subunit delta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 2277388..2280450 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 2280443..2281111 product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 2281126..2281470 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 2281522..2282391 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 2282429..2283808 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 2283923..2284132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2284337..2284801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2284894..2285493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(2285450..2285722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 2285836..2287233 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 2287302..2288282 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2288279..2289256 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2289318..2290346 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 2290343..2291383 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 2291528..2292892 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 2293019..2293894 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2293889..2294767) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(2294811..2295611) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056662.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2295592..2296515) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385382.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 2296617..2297153 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091007.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene mntR CDS complement(2297288..2297905) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene thiE CDS complement(2297895..2298716) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene thiM CDS complement(2298917..2299411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2299476..2299820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 2300027..2300560 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene gloA CDS complement(2300636..2301373) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2301472..2302653) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2302653..2305178) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103640.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(2305178..2305858) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2306006..2307013 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(2307031..2307570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 note possible pseudo, frameshifted CDS complement(2307539..2308687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 note possible pseudo, frameshifted CDS complement(2308710..2309897) product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(2309913..2311067) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2311064..2312608) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2312621..2313844) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2314119..2315168) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2315211..2316101) product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene aztB CDS complement(2316085..2316819) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807167.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene aztA CDS complement(2316819..2316971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2317058..2317810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 2317882..2318949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2319067..2320266 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 2320291..2320977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2321051..2322055) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(2322073..2322666) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2322877..2324127 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 2324249..2324632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 2325066..2327297 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2327638..2328306 product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene cas5c CDS 2328303..2330087 product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene cas8c CDS 2330099..2330968 product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene cas7c CDS 2330969..2331616 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene cas4 CDS 2331622..2332662 product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene cas1c CDS 2332687..2332977 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene cas2 repeat_region 2333167..2341823 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcggcccgcccgggccgcgcggatagaaac CDS 2341834..2342139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2342169..2342957) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene istB CDS complement(2342875..2343273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 note possible pseudo, frameshifted CDS complement(2343224..2344276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 note possible pseudo, frameshifted CDS 2344366..2344671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 2344673..2345419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2345702..2346016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2346229..2346726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2346723..2347916) product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2347918..2349342) product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338823.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2349483..2350544) product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2350547..2351302) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 2351517..2352701 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2352920..2354230) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(2354230..2355237) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(2355262..2355966) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2355953..2356732) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(2356840..2358285) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2358411..2358755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(2358884..2360731) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene typA CDS complement(2360945..2361913) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(2361968..2363491) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(2363493..2363960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(2364100..2364645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(2364884..2365093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 2365185..2366591 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene glnA CDS 2366760..2367326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 2367768..2368799 product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene ntrB CDS 2368792..2370204 product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene ntrC CDS complement(2370234..2370554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2370557..2370826) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(2370868..2372079) product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(2372081..2375464) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(2375466..2376071) product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 note possible pseudo, frameshifted CDS complement(2376068..2377543) product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 2377641..2378990 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2379004..2379906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2380030..2380893 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2380900..2381274) product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2381379..2382071) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene yieH CDS 2382473..2382781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2382941..2384005) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene fba CDS complement(2384091..2385260) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084960.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2385295..2386338) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene epd CDS complement(2386405..2387121) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2387114..2387473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2387705..2388247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2388244..2388378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(2388457..2390451) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244559.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene tkt CDS 2390680..2391900 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene metK CDS 2392003..2393412 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene ahcY CDS complement(2393413..2394348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 2394530..2395372 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene metF CDS complement(2395478..2397673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2397770..2398753) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(2399030..2400736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2400738..2400983) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2401075..2403123) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene prlC CDS 2403263..2404603 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 2404624..2405175 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2405314..2405985 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2405961..2407343) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2407336..2409240) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2409237..2410028) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 2410323..2411078 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2411075..2412529 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 2412526..2413203 product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 2413203..2416055 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 rRNA 2416644..2418177 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 2418272..2418348 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 2418541..2418616 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 rRNA 2418846..2421734 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 2421828..2421938 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS 2422094..2423077 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene birA CDS 2423074..2423913 product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 tRNA 2424035..2424118 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 2424168..2424241 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 2424265..2424339 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 2424482..2424557 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 2424629..2424997 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene secE CDS 2425006..2425539 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene nusG CDS 2425629..2426060 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene rplK CDS 2426063..2426755 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene rplA CDS 2427033..2427536 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707703.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene rplJ CDS 2427656..2428027 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene rplL CDS 2428264..2432343 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene rpoB CDS 2432427..2436647 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene rpoC CDS 2436806..2437180 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene rpsL CDS 2437312..2437782 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene rpsG CDS 2437881..2440001 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene fusA CDS 2440031..2441224 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene tuf CDS 2441386..2441697 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene rpsJ CDS 2441860..2442498 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene rplC CDS 2442513..2443118 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene rplD CDS 2443115..2443411 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene rplW CDS 2443429..2444256 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene rplB CDS 2444279..2444554 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene rpsS CDS 2444573..2444905 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene rplV CDS 2444917..2445615 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene rpsC CDS 2445631..2446044 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene rplP CDS 2446044..2446235 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene rpmC CDS 2446228..2446497 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene rpsQ CDS 2446550..2446921 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene rplN CDS 2446936..2447253 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene rplX CDS 2447281..2447811 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096208.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene rplE CDS 2447823..2448128 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene rpsN CDS 2448161..2448553 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene rpsH CDS 2448563..2449093 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene rplF CDS 2449103..2449453 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene rplR CDS 2449465..2449965 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene rpsE CDS 2449971..2450153 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene rpmD CDS 2450157..2450591 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene rplO CDS 2450592..2451923 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene secY CDS 2452238..2452594 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene rpsM CDS 2452634..2453020 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene rpsK CDS 2453033..2453653 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene rpsD CDS 2453733..2454731 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene rpoA CDS 2454771..2455163 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene rplQ CDS complement(2455394..2458255) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene uvrA CDS 2458417..2459805 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 2459891..2460544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2460581..2461474 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113045.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 2461471..2462241 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(2462379..2462741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 note possible pseudo, frameshifted CDS complement(2462630..2463601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 note possible pseudo, frameshifted CDS complement(2463616..2464131) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379759.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene fabA CDS 2464355..2464750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 note possible pseudo, internal stop codon CDS 2464793..2466211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 note possible pseudo, internal stop codon, frameshifted CDS complement(2466170..2466694) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(2466704..2467975) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2467972..2468799) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(2468796..2470157) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2470154..2470945) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2470997..2471437) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(2471470..2472288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 note possible pseudo, frameshifted CDS complement(2472404..2472892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 note possible pseudo, frameshifted CDS complement(2472900..2473820) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2473897..2474934) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 2475051..2475956 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2475982..2478930) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene rapA CDS complement(2479230..2480030) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 2480211..2480450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 2480443..2482017 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 2482057..2483571 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2483665..2484117 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 tRNA complement(2484263..2484339) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(2484419..2485414) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175409.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene ispB CDS 2485809..2486009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2486041..2486298 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094760.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rpmA CDS 2486399..2487586 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene cgtA CDS 2487631..2487855 product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 2487923..2489047 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene proB CDS 2489256..2489522 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene rpsT CDS 2489642..2491243 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene murJ CDS 2491341..2491811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 note possible pseudo, frameshifted CDS 2491730..2492230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 note possible pseudo, frameshifted CDS complement(2492807..2493085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 2493180..2494217 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene ribF CDS 2494228..2497071 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene ileS CDS 2497064..2497618 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene lspA CDS 2497632..2498078 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene fkpB CDS 2498088..2499035 product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 2499083..2499343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 2499361..2500329 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene ispH CDS 2500355..2500624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 2501102..2501518 product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene pilE CDS 2501683..2502291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 2502185..2503033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 2503345..2503707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2503691..2504149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2504146..2504706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 2504816..2505880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2506012..2506275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(2506319..2506897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(2506949..2507302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(2507457..2508251) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene istB CDS complement(2508251..2508559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 note possible pseudo, frameshifted CDS complement(2508510..2509559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 note possible pseudo, frameshifted CDS 2509683..2510237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 2510266..2510529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 2510980..2511237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 note possible pseudo, frameshifted CDS 2511119..2512234 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 note possible pseudo, frameshifted CDS 2512252..2512491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2512437..2512838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 2512752..2513744 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 2513992..2514582 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2514579..2514773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(2514959..2517559) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(2517556..2518047) product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2518371..2519723 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 2520125..2521030 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene prfB note possible pseudo, frameshifted CDS 2521035..2522576 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene lysS CDS 2522798..2523184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 2523259..2524665 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2524997..2525308 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2525305..2526111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 2526101..2526667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2526674..2526874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2527180..2527827) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene rsmD CDS 2527918..2529429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 2529426..2530094 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene ftsE CDS 2530091..2531068 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene ftsX note possible pseudo, frameshifted CDS 2531209..2532075 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rpoH CDS complement(2532175..2532786) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene slmA CDS complement(2532875..2533783) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene argB CDS complement(2533863..2535257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(2535295..2535771) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene dut CDS complement(2535800..2537074) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene coaBC CDS 2537211..2537885 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene radC CDS 2538214..2538450 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene rpmB CDS 2538492..2538647 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene rpmG CDS 2538784..2539629 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene mutM CDS 2539646..2540839 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 2540915..2541349 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 2541420..2542445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 2542660..2543868 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 2544010..2545689 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(2545942..2548698) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268414.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene acnA CDS 2549017..2549967 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene trxB CDS complement(2550132..2550377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 2550487..2550936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2551030..2551431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(2551439..2552611) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene dapE CDS complement(2552598..2553623) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene dapD CDS complement(2553702..2554046) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(2554046..2555299) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene dapC CDS complement(2555400..2558084) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2558089..2558880) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene map CDS 2559179..2559925 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene rpsB CDS 2560102..2560971 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene tsf CDS 2561082..2561843 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene pyrH CDS 2561848..2562405 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene frr CDS 2562562..2563260 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene uppS CDS 2563253..2564053 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 2564055..2565260 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene ispC CDS 2565758..2566660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 note possible pseudo, frameshifted CDS 2566912..2569251 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene bamA CDS 2569315..2569797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 2569821..2570858 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene lpxD CDS 2570970..2571407 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene fabZ CDS 2571404..2572171 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene lpxA CDS 2572174..2573388 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene lpxB CDS 2573385..2574011 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene rnhB CDS 2574215..2577721 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene dnaE CDS 2577918..2578871 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene accA CDS 2578893..2580185 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene tilS CDS complement(2580216..2581724) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene ppx CDS 2582147..2583406 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene rho CDS 2583630..2585156 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene ubiD CDS 2585175..2585954 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene fre CDS 2585951..2586664 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene folM CDS 2586723..2586851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 2586917..2587063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 2587377..2588480 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104335.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 2588704..2589105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2589065..2589223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2589275..2591485) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene ppk1 CDS complement(2591529..2592536) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene hemB CDS 2592748..2593410 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene elbB CDS complement(2593526..2594296) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene tatC CDS complement(2594293..2594733) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene tatB CDS complement(2594740..2595000) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene tatA CDS complement(2595051..2595386) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(2595420..2597045) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene ubiB CDS complement(2597042..2597692) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115043.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2597700..2598524) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene ubiE CDS complement(2598561..2598944) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(2599172..2600494) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene hslU CDS complement(2600506..2601024) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene hslV CDS complement(2601230..2601964) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(2601968..2603653) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene argS CDS complement(2603809..2606052) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266372.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 2606242..2606454 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene rpmE CDS 2606692..2607960 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(2608048..2608803) product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(2608899..2611427) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2611661..2612746 product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene pilM CDS 2612743..2613324 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 2613321..2613944 product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene pilO CDS 2613941..2614471 product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene pilP CDS 2614559..2616625 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093473135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 2616625..2617167 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene aroK CDS 2617173..2618279 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene aroB CDS 2618737..2623188 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene gltB CDS 2623314..2624732 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2624853..2625167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2625112..2626767 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2626772..2627623 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073591.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene kdsA CDS 2627657..2628949 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene eno CDS complement(2629456..2629779) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 2629873..2630091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2630103..2632691) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene mutS CDS 2632798..2633310 product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766018.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2633418..2634479 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene recA CDS 2634483..2634971 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene recX CDS 2635106..2637718 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene alaS CDS 2637825..2639075 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 2639272..2639469 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene csrA tRNA 2639550..2639642 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 2639696..2639772 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 2639821..2639897 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(2640068..2641027) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 2641208..2641459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 2641514..2642827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 note possible pseudo, frameshifted CDS 2642745..2643347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 2643359..2644690 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2644766..2645383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(2645383..2645868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 2646085..2646732 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene ccmA CDS 2646719..2647462 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene ccmB CDS 2647477..2648217 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 2648217..2648456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2648446..2648979 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene ccmE CDS 2648992..2651010 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 2651007..2651540 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene dsbE CDS 2651531..2652004 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 2652001..2653251 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene ccmI CDS 2653271..2656756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 2656983..2658731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 2658874..2660955 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene ligA CDS 2660952..2661221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2661257..2663275) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene mnmC CDS complement(2663451..2663750) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 2663872..2664768 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 2664811..2665434 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011215625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(2665693..2666571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 2666675..2667355 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2667442..2668707 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2668848..2670173 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene argA CDS 2671090..2672580 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 2672586..2673176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 2673173..2674600 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene glrR CDS complement(2674610..2675959) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene xseA CDS complement(2676104..2676661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 2676950..2678377 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092702.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene guaB CDS 2678387..2679964 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene guaA CDS 2680003..2680479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2680706..2681299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(2681182..2682069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 2681998..2683089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 2683089..2683715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 2683904..2684665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 2684658..2685662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 2685909..2687150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 2687410..2688591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 2688917..2689552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(2689721..2690773) product IS481-like element ISDvu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937781.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 2691128..2691604 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(2691628..2691843) product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478080.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(2691879..2692877) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2693303..2693560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 2693784..2693948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 2694075..2694488 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene rnk CDS 2694505..2695122 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2695211..2696431 product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2696371..2697777) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 2697981..2698607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 2698604..2699530 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 2699533..2700459 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 2700468..2702597 product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene tgpA CDS 2702624..2703109 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(2703208..2703597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 2703766..2704971 product enoyl-[acyl-carrier-protein] reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035373.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene fabV CDS 2705039..2705254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 2705404..2706444 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085944.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene argR CDS complement(2706448..2707074) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405053.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2707254..2708468 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 2708510..2709598 product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085950.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene aruF CDS 2709598..2710464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 note possible pseudo, frameshifted CDS 2710419..2710649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 2710649..2712118 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079221.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene astD CDS 2712115..2713488 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene astB CDS complement(2713570..2714619) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(2714626..2715123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 2715339..2715842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 2716006..2716743 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(2716778..2717587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(2717669..2720494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(2720757..2721083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(2721052..2721483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(2721822..2723306) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene nhaD CDS 2723504..2723875 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 2723851..2724258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 note possible pseudo, frameshifted CDS complement(2724334..2727795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 2727913..2728620 product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 2728666..2730372 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219893520.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(2730397..2731293) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(2731390..2732409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 2732537..2733415 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202665.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 2733486..2734454 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene corA CDS 2734552..2735784 product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(2735791..2736975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(2736988..2737221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(2737218..2737631) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene arfB CDS complement(2737674..2737889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(2738066..2738272) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 2738642..2739406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(2739523..2739930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 note possible pseudo, frameshifted CDS complement(2739830..2740231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 2740361..2741092 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene nfsA CDS complement(2741184..2741408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 2741892..2742476 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 2742715..2743863 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269159.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 2743863..2744210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(2744234..2745247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(2745387..2746241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(2746438..2746725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(2746873..2747550) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530372.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 2747549..2748064 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 2748213..2749502 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 2749628..2749951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 2750044..2750184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(2750141..2751595) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 2751844..2753634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 2753631..2754122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(2754232..2754513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(2754578..2756827) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene recD CDS complement(2756887..2760906) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene recB CDS complement(2760903..2764526) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene recC CDS 2764639..2765298 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(2765300..2766238) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 2766472..2767455 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 2767471..2768031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 2768028..2769293 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 2769421..2769834 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 2769819..2770238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 2770330..2771820 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337441.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(2771921..2774089) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene katG CDS 2774520..2776427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(2776437..2777381) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040213.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 2777601..2779100 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813760.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(2779208..2779960) product IS5-like element ISRel13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092755085.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 2780066..2781913 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150913023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 2782024..2782611 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 2782682..2783437 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 2783633..2785039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 2785138..2785731 product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(2785811..2786215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(2786218..2786505) product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene higB CDS 2786699..2788720 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940327.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(2788852..2789214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 2789579..2790154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 2790198..2791367 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 2791364..2792698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 2792729..2794117 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 2794150..2794998 product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene ntrB CDS 2794988..2795926 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 2795995..2796444 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103774.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene cynS CDS 2796533..2798212 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 2798292..2799986 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene ilvD CDS complement(2800098..2803208) product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(2803201..2804427) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene nrfD CDS complement(2804408..2805187) product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene ttrB CDS complement(2805419..2805598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(2805810..2807237) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189443605.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 2807378..2808832 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 2808870..2810156 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813168.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene gabT CDS 2810365..2811345 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene glaH CDS 2811468..2812664 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704497.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene lhgO CDS 2812821..2813780 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 2813804..2814316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 2814327..2816360 product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 2816443..2816949 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215768.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene purE CDS 2816989..2818125 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2818204..2820231) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(2820392..2820943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(2820940..2822382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 2822687..2823979 product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930659.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 2823976..2824821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(2824829..2825641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(2825692..2826102) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252490.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 2826373..2827332 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 2827488..2828015 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 2828012..2829331 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 2829423..2830484 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 2830560..2831939 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 2832068..2833453 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 2833463..2834644 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 2834682..2835389 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 2835399..2836598 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(2836595..2838796) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 2838876..2839334 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene cadR CDS complement(2839351..2840499) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene iadA CDS complement(2840569..2841354) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(2841870..2842670) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(2842754..2843524) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(2843669..2844391) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(2844393..2845094) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262156.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(2845108..2845878) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(2846111..2847130) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene astE CDS complement(2847132..2847689) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 2847801..2848673 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(2848690..2849763) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 2849879..2850793 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(2850803..2851642) product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103253.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(2851662..2853233) product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(2853274..2854191) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(2854263..2854664) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(2854675..2855910) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene glcF CDS complement(2855932..2857047) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene glcE CDS complement(2857062..2858567) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene glcD CDS complement(2858756..2860456) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 2860815..2861522 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532474.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 2861654..2862010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2862119..2862742) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(2862896..2864299) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(2864613..2865140) product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene uraD CDS 2865309..2865668 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene uraH CDS 2865755..2866954 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 2867094..2867828 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463915.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 2867911..2868840 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193045.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene puuE CDS 2868850..2869683 product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 2869961..2870446 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(2870600..2871025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(2871464..2872051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 2872183..2873958 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114301.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene gcl CDS 2874115..2874894 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene hyi CDS 2874984..2875886 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 2876113..2876988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(2877118..2877456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 2878129..2878482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 note possible pseudo, frameshifted CDS 2878472..2879725 product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762472.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 2879813..2880544 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 2880641..2881468 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene modA CDS 2881468..2882136 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene modB CDS 2882129..2883271 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 2883268..2883849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 2884003..2885013 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene dctP CDS 2885078..2885557 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 2885547..2886869 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389892.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 2887225..2888613 product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 2888897..2889877 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 2890072..2892624 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 2892638..2893066 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261090.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(2893165..2893974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(2893997..2895028) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(2895106..2896422) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(2896432..2896764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 2897061..2897888 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 2897986..2898465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(2898507..2898962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(2898857..2899960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 note possible pseudo, frameshifted CDS 2900121..2900636 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 2900660..2902837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 2902905..2904098 product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 2904067..2905443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(2905416..2906096) product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene agmR CDS 2906228..2907748 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115507.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 2907878..2908906 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene adhP CDS complement(2908909..2909040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(2909033..2910787) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene dauA CDS complement(2911082..2911783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(2911876..2912595) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(2912592..2914031) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene baeS CDS complement(2914064..2917129) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(2917126..2918379) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(2918486..2919406) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(2919486..2920199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(2920317..2921660) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(2921657..2922238) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(2922308..2923252) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930857.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 2923509..2924708 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene doeA CDS 2924908..2925921 product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene doeB CDS 2925938..2926414 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(2926348..2926617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 2926616..2927485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 2927518..2929104 product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 2929146..2930147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 2930188..2932965 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 2933189..2934688 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527051.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 2934951..2936369 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 2936592..2938157 product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 2938222..2939028 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063818.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 2939479..2940975 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 2940984..2941661 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836249.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 note possible pseudo, frameshifted CDS 2941573..2941845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 note possible pseudo, frameshifted CDS complement(2941931..2942980) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208596183.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(2943097..2944203) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103331.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene ugpC CDS complement(2944300..2945919) product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027987980.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(2945953..2946795) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(2946792..2947772) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403357.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(2947788..2949059) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266612.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 2949436..2950932 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706779.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 2951111..2951485 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(2951495..2953024) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene phnE CDS complement(2953021..2953803) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(2953815..2954672) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(2954794..2955654) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 2955883..2957391 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene zwf CDS 2957403..2958071 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene pgl CDS 2958090..2958764 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(2958941..2960605) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene pgi CDS complement(2960553..2961140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(2961137..2962615) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene pyk CDS 2962916..2963938 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene gap CDS complement(2964153..2965895) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684711.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene fruA CDS complement(2965892..2966872) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112874.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene pfkB CDS complement(2966872..2968824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 note possible pseudo, frameshifted CDS 2968778..2969845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 2969993..2970994 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene cra CDS 2971068..2972786 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 2973154..2974206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 2974286..2975218 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene rhuM CDS 2975223..2978393 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(2978474..2979445) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(2979442..2980329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(2980348..2981313) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(2981362..2983254) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene edd CDS complement(2983377..2984774) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 2984870..2986021 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 2986081..2986416 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene ftsB CDS 2986413..2987159 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766007.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene ispD CDS 2987159..2987665 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene ispF CDS 2987658..2988734 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene truD CDS 2988746..2989492 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092341.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene surE CDS 2989479..2990159 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 2990173..2991147 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 2991140..2992105 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 2992222..2993235 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene rpoS CDS 2993343..2994797 product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene opmH CDS 2994945..2996063 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene alr CDS 2996104..2997021 product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(2997155..2998816) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene ettA CDS complement(2998891..2999091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(2999304..2999735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(2999878..3001191) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(3001223..3002422) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 3002624..3002923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 3002920..3003420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 3003417..3004307 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(3004332..3004970) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 3005005..3005721 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 3005718..3008300 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 3008311..3009738 product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene pap CDS 3009793..3010938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 3011095..3012360 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243779.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 3012552..3013967 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 3014087..3014557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 3014637..3014834 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 3015034..3015930 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 3015941..3017749 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 3017762..3018235 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3018232..3018675 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 3018852..3019547 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 3019544..3020863 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 3020920..3021573 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 3021586..3022629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(3022756..3023523) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene dsbG CDS complement(3023575..3024396) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 3024599..3025105 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458360.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 3025182..3025664 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene nrdR CDS 3025693..3026838 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene ribD CDS 3026985..3028172 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene ribBA CDS 3028245..3028739 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene ribE CDS 3028736..3029239 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene nusB CDS 3029253..3030272 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113052.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene thiL CDS 3030269..3030742 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 3030798..3032033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 3032136..3034595 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene lon CDS complement(3034610..3035038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 note possible pseudo, frameshifted CDS complement(3035031..3035474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 note possible pseudo, frameshifted CDS 3035642..3037486 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene ilvD CDS complement(3037573..3038202) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene nudE CDS 3038277..3038996 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene yrfG CDS 3038993..3039382 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene hslR CDS 3039414..3040289 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene hslO CDS 3040542..3042095 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 3042251..3044614 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 3044652..3046262 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene gshA CDS 3046259..3046777 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 3046918..3047427 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene rsd CDS complement(3047458..3049524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(3049526..3050617) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 3050954..3051931 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(3052085..3052741) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 3052861..3053412 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 3053531..3055789 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene ptsP CDS complement(3055916..3056692) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 3056875..3057831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 3057858..3058646 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene lgt CDS 3058708..3059007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 3059083..3059904 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 3059919..3060437 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402228.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 3060518..3061702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 3062000..3063133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(3063643..3063873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(3063870..3064715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 note possible pseudo, frameshifted CDS complement(3064845..3066047) product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(3066308..3066622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 3067081..3068199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 3068267..3069670 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene fliD CDS 3069766..3071169 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211150.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene fliD CDS complement(3071231..3072529) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(3072522..3072812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 3073192..3074511 product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(3074696..3075103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 note possible pseudo, frameshifted CDS complement(3075079..3075447) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 3075646..3076662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 3076750..3078111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 3078230..3079162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(3079190..3079579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3079609..3080865) product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 3081253..3081477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 3081992..3082276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 3082331..3082522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(3082551..3082958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 note possible pseudo, internal stop codon, frameshifted CDS complement(3082978..3083427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 note possible pseudo, internal stop codon, frameshifted CDS 3083576..3085153 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 3085419..3085679 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 3086116..3087693 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 3087760..3091299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3091332..3093161) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204227.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 3093439..3094050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 3094166..3095113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 3095101..3095526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 tRNA complement(3095750..3095822) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 3095959..3097332 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 3097353..3097847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 3097937..3098185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 3098196..3099392 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 note possible pseudo, frameshifted CDS 3099591..3099905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 3099987..3100328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 3100325..3102781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 3102847..3103281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(3103332..3104120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 tRNA complement(3104522..3104598) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 3104757..3106004 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392332.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 3106001..3109129 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 3109345..3110850 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 3110891..3111736 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111303.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 3111733..3112839 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(3112805..3113344) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene greB CDS 3113517..3114164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 3114161..3114886 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 3114916..3115362 product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 3115416..3116153 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene cpdA CDS 3116339..3117232 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene cysD CDS 3117232..3118680 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454657.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene cysN CDS 3118976..3119650 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(3119647..3120639) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365980.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene cmoB CDS complement(3120642..3121409) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261594.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene cmoA CDS 3121495..3123177 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene pgi CDS 3123206..3123853 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 3123850..3125730 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817213.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene parE CDS 3125822..3128083 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene parC CDS 3128141..3129361 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene serB CDS 3129361..3130200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3130559..3132274 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene leuA CDS complement(3132432..3133442) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene epmB CDS 3133582..3134148 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene efp CDS 3134249..3135235 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene epmA CDS complement(3135291..3136316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(3136344..3137174) product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene rhdA CDS complement(3137213..3138250) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene rsgA CDS 3138354..3138947 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene orn CDS complement(3138950..3140044) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene queG CDS 3140143..3141666 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 3141647..3142165 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene tsaE CDS 3142162..3143613 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene amiB CDS 3143634..3145604 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene mutL CDS 3145792..3146730 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266496.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene miaA CDS 3146854..3147102 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene hfq CDS 3147111..3148439 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene hflX CDS 3148574..3149815 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene hflK CDS 3149816..3150700 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene hflC CDS 3150897..3152072 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 3152134..3153429 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 3153547..3154827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(3154867..3155466) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278887.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene cobO CDS complement(3155531..3157027) product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 3157193..3157693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 3157734..3158219 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 3158298..3158675 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 3158814..3161459 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene pepN CDS complement(3161604..3161891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(3161910..3162296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(3162323..3162673) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(3162670..3164166) product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461230.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 3164368..3164964 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 3164977..3166641 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 3166682..3166897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 3166997..3167707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(3167807..3168013) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 3168292..3168936 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(3169014..3170999) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 3171212..3171721 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 3171714..3172184 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 3172289..3174193 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene htpG CDS 3174412..3175938 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 3175954..3177396 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 3177508..3178575 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267382.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 3178568..3179050 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene sixA CDS complement(3179169..3180116) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418432.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 3180345..3181151 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 3181148..3182035 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 3182032..3183126 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(3183128..3183700) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 3183827..3184774 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene prmB CDS 3184803..3185888 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene aroC CDS 3185956..3186411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 3186533..3186961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 3187101..3188945 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene phaC CDS complement(3189330..3190532) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(3190622..3192094) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene lnt CDS complement(3192147..3193016) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(3193013..3193525) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene ybeY CDS complement(3193522..3194607) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(3194687..3196030) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368786.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene miaB CDS 3196299..3196580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 3196811..3197437 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 3197448..3198086 product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(3198154..3198759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 3198937..3199365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(3199388..3200008) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene msrQ CDS complement(3200008..3201024) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene msrP CDS complement(3201122..3202612) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(3202616..3203317) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(3203373..3203636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(3203811..3204899) product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(3204896..3205723) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene cysW CDS complement(3205723..3206586) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073418.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene cysT CDS complement(3206619..3207629) product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073417.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene cysP CDS 3207780..3208514 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304938.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene rpe CDS 3208519..3209640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 3209922..3211421 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene trpE CDS 3211451..3212047 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 3212064..3213089 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene trpD CDS 3213151..3213960 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene trpC CDS 3214139..3216919 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 3216910..3218226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 3218223..3219272 product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 3219294..3222410 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 3222407..3223117 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(3223298..3223870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043125671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(3224008..3224730) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(3224711..3226327) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(3226554..3226754) product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(3226852..3230130) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 3230315..3231598 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene serS CDS complement(3231689..3232459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 3232605..3233711 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(3233770..3234093) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene trxA CDS 3234326..3235297 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene cysB CDS complement(3235415..3236251) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895583.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3236264..3237670) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene pabB CDS 3237867..3238577 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 3238637..3239527 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene prpB CDS 3239574..3240701 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene prpC CDS 3240704..3243334 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477783.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene acnD CDS 3243450..3244640 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene prpF rRNA 3245340..3246873 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA 3246968..3247044 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 3247255..3247330 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 rRNA 3247561..3250458 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA 3250546..3250656 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 3250830..3250991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3251103..3252455) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene gdhA CDS 3252753..3253184 product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 3253181..3254251 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene rlmM CDS complement(3254302..3254592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 3254637..3254900 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene tusA CDS complement(3254915..3255628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(3255773..3256822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(3256803..3258254) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 3258384..3258950 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 3259034..3261211 product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(3261219..3261761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(3261787..3262659) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 3262806..3264758 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(3264925..3265380) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 3265498..3266028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(3266049..3266504) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene slyA CDS complement(3266590..3267045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 3267251..3269428 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene fadB CDS 3269460..3270638 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065826.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene fadA CDS complement(3270718..3271182) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 3271252..3271731 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 3271739..3272110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(3272123..3273058) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 3273239..3274816 product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 3274818..3275723 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(3275839..3276183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(3276296..3277561) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 3277722..3278252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 3278300..3279058 product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 3279232..3279720 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(3279742..3280380) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268645.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(3280394..3281449) product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(3281538..3282446) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 3282588..3282929 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 3283077..3283598 product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 3283667..3285109 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene sufB CDS 3285136..3285894 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene sufC CDS 3285891..3287237 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene sufD CDS 3287263..3288519 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 3288528..3289100 product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene sufT CDS 3289132..3289884 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene sanA CDS complement(3289974..3290417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(3290530..3291438) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene rimK CDS complement(3291479..3291922) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186005924.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(3291942..3292967) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 3293254..3293586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(3293670..3294332) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(3294546..3295139) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 3295419..3295715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(3295817..3297295) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene putP CDS complement(3297339..3300530) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene putA CDS complement(3300733..3301524) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(3301582..3301965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 tRNA complement(3302048..3302121) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(3302497..3302913) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 3303090..3303593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 3303687..3304556 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 3304632..3305552 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 3305554..3306558 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 3306741..3307598 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 3307642..3307926 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 3307919..3308770 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 3308831..3309382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 3309333..3309668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 3309733..3310800 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene cobT CDS 3310793..3311788 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142443.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene cbiB CDS 3311785..3312942 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene cobD CDS 3312939..3313496 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552342.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene cobU CDS 3313493..3314248 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 3314200..3314832 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886923.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 3314787..3315215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 3315662..3317518 product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene btuB CDS 3317508..3318434 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 3318444..3319412 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 3319412..3320179 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(3320192..3320956) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(3320953..3322020) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710978.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(3322017..3323033) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339271.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 3323593..3325362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 3325355..3326731 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 3326728..3327858 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene cobW CDS 3327858..3331724 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113999.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene cobN CDS 3331724..3332701 product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene cobG note possible pseudo, internal stop codon, frameshifted CDS 3332714..3332959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 3332943..3333572 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337771.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 3333569..3334309 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174893316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 3334306..3335088 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene cobJ CDS complement(3335052..3335810) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 3335811..3337034 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086053.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 3337031..3337390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 3337393..3338199 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene cobM CDS 3338196..3338972 product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene cobF CDS 3338987..3339592 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene cobO CDS 3339811..3340542 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene bluB CDS 3340530..3341996 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038176.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3342038..3342961) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 3343216..3344007 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 3344127..3346325 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 3346325..3347146 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 3347319..3349259 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(3349340..3351787) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene fadE CDS complement(3352023..3353729) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763658.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene betA CDS complement(3353739..3355223) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097648.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene betB CDS complement(3355235..3355837) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene betI tRNA 3356003..3356079 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 3356214..3356289 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 3356325..3356400 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 3356420..3356495 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(3356687..3358630) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 3358523..3358750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 3358897..3360195 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 tRNA complement(3360271..3360347) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 3360496..3360571 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 3360605..3360679 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 3360822..3360897 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 3360929..3361003 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 3361047..3361122 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 3361151..3361225 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS 3361412..3362377 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 3362374..3363147 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 3363144..3363980 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114774.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene queF CDS 3364037..3364597 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 3364610..3365143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 tRNA 3365207..3365294 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 3365604..3369209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 3369280..3370062 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390684.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3370087..3371049) product N-acetylmuramidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 3371433..3371858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3371933..3375046) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(3375046..3376143) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 3376417..3377613 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919352.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(3377650..3378384) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 3378593..3379243 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(3379234..3379689) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(3379715..3380050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(3380040..3380447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(3380447..3380779) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164648.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(3380886..3381965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 3382118..3385492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(3385558..3386334) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228016.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3386477..3387487 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 3387573..3389567 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 3390020..3391051 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(3391048..3392016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 3392247..3393542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 note possible pseudo, frameshifted CDS 3393778..3394191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 3394254..3394580 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 3394761..3395336 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene recR CDS 3395408..3396535 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene rnd CDS 3396532..3396843 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 3397030..3397476 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968986.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(3397499..3399589) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104778.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 3399635..3400069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 3400166..3401740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 3401733..3402530 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 3402713..3404395 product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene fadD1 CDS complement(3404350..3404562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 3404546..3408595 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene hrpA CDS 3408661..3409773 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 3409817..3410617 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 3410629..3411816 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 3411803..3412312 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(3412337..3413308) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090868.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene tal CDS 3413413..3414597 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 3414590..3415324 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 3415461..3416474 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 3416532..3417905 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene pstC CDS 3417912..3419276 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene pstA CDS 3419277..3420101 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene pstB CDS 3420286..3420639 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 3420797..3421420 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 3421411..3422214 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene fetB CDS complement(3422215..3422988) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(3422988..3424175) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 3424333..3424902 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 3425178..3426851 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 3426867..3427634 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 3427775..3429586 product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 3429758..3431767 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 3431890..3432753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(3432796..3433422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(3433419..3434054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 note possible pseudo, frameshifted CDS complement(3434009..3434893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(3434925..3435389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 3435517..3436092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 note possible pseudo, frameshifted CDS 3436035..3436772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 note possible pseudo, frameshifted CDS 3436846..3437178 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene cadR CDS 3437275..3437745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 3437812..3438675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 3438687..3439496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 3439493..3440140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 3440067..3440729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 3440733..3441125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 3441103..3441594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 note possible pseudo, frameshifted CDS complement(3441611..3442087) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 3442552..3443934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 3444873..3445727 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(3445973..3446938) product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196566.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 3447021..3448397 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene chrA CDS 3448732..3449091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(3449120..3449722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(3449967..3450374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(3450431..3450748) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705368.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(3450780..3451853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(3451924..3453000) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 3453151..3453666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 note possible pseudo, frameshifted CDS 3453615..3454142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 3454225..3454515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 3454723..3455766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 note possible pseudo, internal stop codon CDS 3455824..3456039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(3456162..3457442) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene bioA tRNA complement(3457558..3457642) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS complement(3457687..3458400) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene bioD CDS complement(3458410..3459261) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene bioC CDS complement(3459258..3459998) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240449.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene bioH CDS complement(3459995..3461173) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene bioF CDS complement(3461177..3462295) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene bioB CDS 3462310..3463077 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 3463148..3464134 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(3464264..3464836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 3465039..3465596 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene folE CDS 3465622..3466032 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene folX CDS 3466138..3466497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 3466633..3468090 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene gabD CDS complement(3468154..3469734) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene purH CDS complement(3469828..3470160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(3470157..3471239) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene dusB CDS complement(3471297..3472211) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene prmA CDS complement(3472295..3473638) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene accC CDS complement(3473682..3474143) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene accB CDS complement(3474390..3476225) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene dsbD CDS 3476444..3477616 product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(3477697..3477957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 note possible pseudo, frameshifted CDS complement(3477869..3478228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 note possible pseudo, frameshifted CDS 3478494..3480245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(3480289..3481545) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 3481926..3483317 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene mpl CDS 3483310..3483951 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene ubiX CDS 3483948..3484571 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106442.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(3484587..3485996) product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(3486069..3487856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 3487962..3489254 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 3489263..3489946 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene nadD CDS 3489956..3490417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 3490414..3490881 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298242.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene rlmH CDS 3490909..3492816 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene mrdA CDS 3492819..3493979 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene rodA CDS 3494023..3495081 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene mltB CDS 3495078..3496076 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 3496124..3497338 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 3497408..3497719 product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 3497719..3498435 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene lipB CDS complement(3498422..3499477) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene lipA CDS complement(3499677..3500660) product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene pycR CDS 3500761..3501708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 3501835..3504297 product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064308.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 3504522..3507182 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene topA CDS 3507179..3507643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 3507785..3510031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 3510028..3511185 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625967.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 3511182..3514370 product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene vmeI CDS 3514400..3514873 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 3515011..3515151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 3515162..3515593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 3515884..3517476 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 3517574..3517996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(3518023..3518646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 3518617..3519588 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene coxB CDS 3519585..3522113 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene ctaD CDS 3522110..3522466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 3522476..3524743 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 3524789..3525655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 note possible pseudo, frameshifted CDS 3525564..3526049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 note possible pseudo, frameshifted CDS complement(3526092..3528494) product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 3528700..3529314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 3529494..3529757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(3529863..3530888) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(3531097..3534504) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene mfd CDS 3534739..3536202 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(3536343..3536579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 3536496..3537845 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 3537848..3539071 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 3539071..3539886 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 3539889..3540557 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208714.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 3540559..3541176 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene nqrE CDS 3541249..3542481 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene nqrF CDS complement(3542754..3542912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 3542915..3543238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 3543266..3543520 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene nqrM CDS 3543745..3545136 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene sthA CDS complement(3545214..3545639) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895538.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(3545642..3546616) product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(3546627..3547025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(3547188..3548246) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene holA CDS complement(3548243..3548725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(3548750..3551368) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene leuS CDS 3551577..3552092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(3552096..3553418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(3553478..3554383) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 3554758..3555933 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene leuC note possible pseudo, frameshifted CDS 3555906..3556193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 note possible pseudo, frameshifted CDS 3556197..3556850 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene leuD CDS 3557007..3558086 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene leuB CDS 3558203..3559315 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene asd CDS 3559592..3561184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 note possible pseudo, internal stop codon, frameshifted CDS 3561185..3562228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 note possible pseudo, internal stop codon, frameshifted CDS 3562235..3563152 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283590.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene truA CDS 3563152..3563808 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408280.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 3563852..3564880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 note possible pseudo, frameshifted CDS 3564843..3565073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 note possible pseudo, frameshifted CDS 3565079..3565897 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947036.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene trpA CDS 3565976..3566992 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene accD CDS 3566997..3568268 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267159.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene folC CDS 3568265..3568975 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 3568977..3569534 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 3569607..3571127 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene purF CDS 3571120..3572331 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 3572536..3573090 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 3573141..3573725 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378759.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 3573837..3575204 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 3575328..3575924 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene mobA CDS 3575921..3576544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 note possible pseudo, frameshifted CDS 3576541..3577845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 note possible pseudo, frameshifted CDS 3577856..3578701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 3578705..3579169 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene moaE CDS 3579197..3580198 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene moaA CDS 3580387..3580677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(3580763..3582472) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 3582809..3583663 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene purU CDS 3583697..3584374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(3584436..3585482) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086018.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene dinB CDS complement(3585503..3586153) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091196.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene lexA CDS 3586403..3587086 product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene psrA CDS 3587231..3588238 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene nagZ CDS 3588284..3588862 product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099341.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(3588866..3589717) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(3589736..3590971) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(3591024..3592814) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene pilB CDS complement(3593035..3593445) product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(3593435..3593860) product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(3593982..3594125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 3594382..3595824 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268561.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 3595836..3596267 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 3596485..3597672 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 3597790..3598044 product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene yefM CDS 3598041..3598295 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 3598457..3600889 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 3600882..3601637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(3601634..3602026) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681772.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(3602026..3602277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 3603107..3603580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 3603571..3604215 product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 3604246..3608175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 3608204..3608386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 3608633..3609739 product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(3609736..3610746) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410