>Feature sequence001 630 121 gene locus_tag LOCUS_00010 630 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1235 651 gene locus_tag LOCUS_00020 1235 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2477 1245 gene locus_tag LOCUS_00030 2477 1245 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551899.1 protein_id gnl|my_center|LOCUS_00030 3232 2612 gene locus_tag LOCUS_00040 3232 2612 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062687261.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 3387 3214 gene locus_tag LOCUS_00050 3387 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 3553 3753 gene locus_tag LOCUS_00060 3553 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4543 4067 gene locus_tag LOCUS_00070 4543 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4924 4601 gene locus_tag LOCUS_00080 4924 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6618 5260 gene locus_tag LOCUS_00090 6618 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7407 6880 gene locus_tag LOCUS_00100 7407 6880 CDS product SecY-interacting protein Syd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208814654.1 protein_id gnl|my_center|LOCUS_00100 9362 7425 gene locus_tag LOCUS_00110 9362 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9727 9930 gene locus_tag LOCUS_00120 9727 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10443 10658 gene locus_tag LOCUS_00130 10443 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11256 10834 gene locus_tag LOCUS_00140 gene mntR 11256 10834 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143085.1 protein_id gnl|my_center|LOCUS_00140 11601 11801 gene locus_tag LOCUS_00150 gene cspD 11601 11801 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 protein_id gnl|my_center|LOCUS_00150 12096 11920 gene locus_tag LOCUS_00160 12096 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12817 12164 gene locus_tag LOCUS_00170 12817 12164 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875548.1 protein_id gnl|my_center|LOCUS_00170 12963 13640 gene locus_tag LOCUS_00180 12963 13640 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 protein_id gnl|my_center|LOCUS_00180 13782 14180 gene locus_tag LOCUS_00190 13782 14180 CDS product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230765.1 protein_id gnl|my_center|LOCUS_00190 14545 14270 gene locus_tag LOCUS_00200 14545 14270 CDS product DUF6123 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195212.1 protein_id gnl|my_center|LOCUS_00200 14655 14792 gene locus_tag LOCUS_00210 14655 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15702 14803 gene locus_tag LOCUS_00220 15702 14803 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732065.1 protein_id gnl|my_center|LOCUS_00220 16136 17257 gene locus_tag LOCUS_00230 gene proB 16136 17257 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744710.1 protein_id gnl|my_center|LOCUS_00230 17257 18501 gene locus_tag LOCUS_00240 gene proA 17257 18501 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006634.1 protein_id gnl|my_center|LOCUS_00240 19458 18625 gene locus_tag LOCUS_00250 19458 18625 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_00250 23305 19664 gene locus_tag LOCUS_00260 23305 19664 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182166.1 protein_id gnl|my_center|LOCUS_00260 24377 23802 gene locus_tag LOCUS_00270 gene bpsB 24377 23802 CDS product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 protein_id gnl|my_center|LOCUS_00270 25447 24377 gene locus_tag LOCUS_00280 gene bpsA 25447 24377 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_00280 27183 25879 gene locus_tag LOCUS_00290 gene pbuX 27183 25879 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809213.1 protein_id gnl|my_center|LOCUS_00290 27763 27173 gene locus_tag LOCUS_00300 27763 27173 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 protein_id gnl|my_center|LOCUS_00300 28341 28493 gene locus_tag LOCUS_00310 28341 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 28509 28991 gene locus_tag LOCUS_00320 28509 28991 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_00320 28994 30643 gene locus_tag LOCUS_00330 28994 30643 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_00330 32456 30948 gene locus_tag LOCUS_00340 gene ypwA 32456 30948 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 protein_id gnl|my_center|LOCUS_00340 32560 32694 gene locus_tag LOCUS_00350 32560 32694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 33895 32744 gene locus_tag LOCUS_00360 33895 32744 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521234.1 protein_id gnl|my_center|LOCUS_00360 35966 33912 gene locus_tag LOCUS_00370 35966 33912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36861 36544 gene locus_tag LOCUS_00380 gene gpsB 36861 36544 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 protein_id gnl|my_center|LOCUS_00380 37551 36991 gene locus_tag LOCUS_00390 37551 36991 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862908.1 protein_id gnl|my_center|LOCUS_00390 39656 38400 gene locus_tag LOCUS_00400 gene mrfB 39656 38400 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_00400 41963 39696 gene locus_tag LOCUS_00410 gene mrfA 41963 39696 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_00410 42117 42575 gene locus_tag LOCUS_00420 42117 42575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43192 42701 gene locus_tag LOCUS_00430 43192 42701 CDS product YppG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487705.1 protein_id gnl|my_center|LOCUS_00430 43374 43553 gene locus_tag LOCUS_00440 43374 43553 CDS product YppF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242652.1 protein_id gnl|my_center|LOCUS_00440 44052 43672 gene locus_tag LOCUS_00450 44052 43672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 44381 44145 gene locus_tag LOCUS_00460 44381 44145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44479 44598 gene locus_tag LOCUS_00470 44479 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 45968 46477 gene locus_tag LOCUS_00480 gene recU 45968 46477 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399067.1 protein_id gnl|my_center|LOCUS_00480 46538 49186 gene locus_tag LOCUS_00490 46538 49186 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723002.1 protein_id gnl|my_center|LOCUS_00490 49718 49203 gene locus_tag LOCUS_00500 49718 49203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50374 49715 gene locus_tag LOCUS_00510 gene nth 50374 49715 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967580.1 protein_id gnl|my_center|LOCUS_00510 51177 50476 gene locus_tag LOCUS_00520 gene dnaD 51177 50476 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 protein_id gnl|my_center|LOCUS_00520 52621 51329 gene locus_tag LOCUS_00530 gene asnS 52621 51329 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_00530 54081 52891 gene locus_tag LOCUS_00540 gene aspB 54081 52891 CDS product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 protein_id gnl|my_center|LOCUS_00540 54575 54099 gene locus_tag LOCUS_00550 54575 54099 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723008.1 protein_id gnl|my_center|LOCUS_00550 54758 54588 gene locus_tag LOCUS_00560 54758 54588 CDS product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225588.1 protein_id gnl|my_center|LOCUS_00560 55730 54930 gene locus_tag LOCUS_00570 55730 54930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58602 55804 gene locus_tag LOCUS_00580 gene dinG 58602 55804 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212965591.1 protein_id gnl|my_center|LOCUS_00580 59236 58853 gene locus_tag LOCUS_00590 gene panD 59236 58853 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_00590 60099 59254 gene locus_tag LOCUS_00600 gene panC 60099 59254 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706997.1 protein_id gnl|my_center|LOCUS_00600 60935 60096 gene locus_tag LOCUS_00610 gene panB 60935 60096 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000851109.1 protein_id gnl|my_center|LOCUS_00610 62183 61206 gene locus_tag LOCUS_00620 62183 61206 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192063.1 protein_id gnl|my_center|LOCUS_00620 63361 62168 gene locus_tag LOCUS_00630 63361 62168 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439304.1 protein_id gnl|my_center|LOCUS_00630 64502 63354 gene locus_tag LOCUS_00640 gene bshA 64502 63354 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768296.1 protein_id gnl|my_center|LOCUS_00640 65215 64499 gene locus_tag LOCUS_00650 gene bshB1 65215 64499 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015673.1 protein_id gnl|my_center|LOCUS_00650 65630 65205 gene locus_tag LOCUS_00660 gene mgsA 65630 65205 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_00660 66630 65830 gene locus_tag LOCUS_00670 gene dapB 66630 65830 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246190.1 protein_id gnl|my_center|LOCUS_00670 66973 66617 gene locus_tag LOCUS_00680 66973 66617 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002108639.1 protein_id gnl|my_center|LOCUS_00680 67260 68132 gene locus_tag LOCUS_00690 67260 68132 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203305.1 protein_id gnl|my_center|LOCUS_00690 69054 68374 gene locus_tag LOCUS_00700 69054 68374 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109966.1 protein_id gnl|my_center|LOCUS_00700 69904 69122 gene locus_tag LOCUS_00710 gene ypjB 69904 69122 CDS product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831584.1 protein_id gnl|my_center|LOCUS_00710 70714 70118 gene locus_tag LOCUS_00720 70714 70118 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262825.1 protein_id gnl|my_center|LOCUS_00720 71696 70920 gene locus_tag LOCUS_00730 gene qcrC 71696 70920 CDS product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554603.1 protein_id gnl|my_center|LOCUS_00730 72434 71760 gene locus_tag LOCUS_00740 gene qcrB 72434 71760 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 protein_id gnl|my_center|LOCUS_00740 72955 72449 gene locus_tag LOCUS_00750 gene qcrA 72955 72449 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 protein_id gnl|my_center|LOCUS_00750 73571 73107 gene locus_tag LOCUS_00760 73571 73107 CDS product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 protein_id gnl|my_center|LOCUS_00760 74327 73788 gene locus_tag LOCUS_00770 74327 73788 CDS product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095925.1 protein_id gnl|my_center|LOCUS_00770 75792 74533 gene locus_tag LOCUS_00780 75792 74533 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723905.1 protein_id gnl|my_center|LOCUS_00780 77400 76114 gene locus_tag LOCUS_00790 gene aroA 77400 76114 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 protein_id gnl|my_center|LOCUS_00790 78517 77414 gene locus_tag LOCUS_00800 78517 77414 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989842.1 protein_id gnl|my_center|LOCUS_00800 79631 78540 gene locus_tag LOCUS_00810 gene hisC 79631 78540 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_00810 80082 79705 gene locus_tag LOCUS_00820 gene aroH 80082 79705 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 protein_id gnl|my_center|LOCUS_00820 81218 80136 gene locus_tag LOCUS_00830 gene aroB 81218 80136 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230592.1 protein_id gnl|my_center|LOCUS_00830 82394 81222 gene locus_tag LOCUS_00840 gene aroC 82394 81222 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269372.1 protein_id gnl|my_center|LOCUS_00840 83376 82600 gene locus_tag LOCUS_00850 gene cheR 83376 82600 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_00850 84211 83765 gene locus_tag LOCUS_00860 gene ndk 84211 83765 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415887.1 protein_id gnl|my_center|LOCUS_00860 85287 84313 gene locus_tag LOCUS_00870 gene hepT 85287 84313 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_00870 86007 85297 gene locus_tag LOCUS_00880 gene menG 86007 85297 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230580.1 protein_id gnl|my_center|LOCUS_00880 86818 86039 gene locus_tag LOCUS_00890 86818 86039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 87252 87031 gene locus_tag LOCUS_00900 gene mtrB 87252 87031 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 protein_id gnl|my_center|LOCUS_00900 87832 87266 gene locus_tag LOCUS_00910 gene folE 87832 87266 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_00910 88658 88386 gene locus_tag LOCUS_00920 88658 88386 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_00920 90505 89027 gene locus_tag LOCUS_00930 gene spoIVA 90505 89027 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_00930 91487 90777 gene locus_tag LOCUS_00940 91487 90777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 protein_id gnl|my_center|LOCUS_00940 91708 91511 gene locus_tag LOCUS_00950 91708 91511 CDS product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288997.1 protein_id gnl|my_center|LOCUS_00950 93053 92004 gene locus_tag LOCUS_00960 gene gpsA 93053 92004 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_00960 94620 93310 gene locus_tag LOCUS_00970 gene engA 94620 93310 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_00970 95189 95004 gene locus_tag LOCUS_00980 95189 95004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979054.1 protein_id gnl|my_center|LOCUS_00980 96082 95186 gene locus_tag LOCUS_00990 96082 95186 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230562.1 protein_id gnl|my_center|LOCUS_00990 96689 96075 gene locus_tag LOCUS_01000 96689 96075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230560.1 protein_id gnl|my_center|LOCUS_01000 96791 96925 gene locus_tag LOCUS_01010 96791 96925 CDS product YpzI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513900.1 protein_id gnl|my_center|LOCUS_01010 98260 97124 gene locus_tag LOCUS_01020 gene rpsA 98260 97124 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 protein_id gnl|my_center|LOCUS_01020 99081 98500 gene locus_tag LOCUS_01030 99081 98500 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_01030 99758 99084 gene locus_tag LOCUS_01040 gene cmk 99758 99084 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_01040 100107 99928 gene locus_tag LOCUS_01050 100107 99928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 100845 100192 gene locus_tag LOCUS_01060 100845 100192 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080664.1 protein_id gnl|my_center|LOCUS_01060 102534 101185 gene locus_tag LOCUS_01070 gene ypeB 102534 101185 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943704.1 protein_id gnl|my_center|LOCUS_01070 103365 102550 gene locus_tag LOCUS_01080 gene sleB 103365 102550 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249053.1 protein_id gnl|my_center|LOCUS_01080 104226 103534 gene locus_tag LOCUS_01090 gene prsW 104226 103534 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_01090 104624 105604 gene locus_tag LOCUS_01100 gene ansA 104624 105604 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822010.1 protein_id gnl|my_center|LOCUS_01100 106591 105626 gene locus_tag LOCUS_01110 106591 105626 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168489.1 protein_id gnl|my_center|LOCUS_01110 107370 106792 gene locus_tag LOCUS_01120 gene mecA 107370 106792 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 protein_id gnl|my_center|LOCUS_01120 108276 107566 gene locus_tag LOCUS_01130 108276 107566 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637817.1 protein_id gnl|my_center|LOCUS_01130 108660 108893 gene locus_tag LOCUS_01140 108660 108893 CDS product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362187.1 protein_id gnl|my_center|LOCUS_01140 108890 109150 gene locus_tag LOCUS_01150 gene cotJB 108890 109150 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_01150 109175 109744 gene locus_tag LOCUS_01160 gene cotJC 109175 109744 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_01160 110232 109777 gene locus_tag LOCUS_01170 110232 109777 CDS product YpbF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230531.1 protein_id gnl|my_center|LOCUS_01170 110881 110288 gene locus_tag LOCUS_01180 110881 110288 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025765.1 protein_id gnl|my_center|LOCUS_01180 112353 110878 gene locus_tag LOCUS_01190 112353 110878 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931427.1 protein_id gnl|my_center|LOCUS_01190 113399 112350 gene locus_tag LOCUS_01200 113399 112350 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176998.1 protein_id gnl|my_center|LOCUS_01200 113662 113910 gene locus_tag LOCUS_01210 113662 113910 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831262.1 protein_id gnl|my_center|LOCUS_01210 114667 114086 gene locus_tag LOCUS_01220 gene fmnP 114667 114086 CDS product riboflavin transporter FmnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399159.1 protein_id gnl|my_center|LOCUS_01220 115780 115082 gene locus_tag LOCUS_01230 115780 115082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 116779 116006 gene locus_tag LOCUS_01240 116779 116006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 117308 116757 gene locus_tag LOCUS_01250 gene sigX 117308 116757 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_01250 119310 117529 gene locus_tag LOCUS_01260 gene resE 119310 117529 CDS product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 protein_id gnl|my_center|LOCUS_01260 120023 119307 gene locus_tag LOCUS_01270 gene resD 120023 119307 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 protein_id gnl|my_center|LOCUS_01270 121350 120163 gene locus_tag LOCUS_01280 gene resC 121350 120163 CDS product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250084.1 protein_id gnl|my_center|LOCUS_01280 122976 121369 gene locus_tag LOCUS_01290 gene resB 122976 121369 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910536.1 protein_id gnl|my_center|LOCUS_01290 123530 122994 gene locus_tag LOCUS_01300 gene resA 123530 122994 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_01300 124418 123690 gene locus_tag LOCUS_01310 gene rluB 124418 123690 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_01310 125208 124678 gene locus_tag LOCUS_01320 gene spmB 125208 124678 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 protein_id gnl|my_center|LOCUS_01320 125803 125210 gene locus_tag LOCUS_01330 gene spmA 125803 125210 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_01330 126941 125796 gene locus_tag LOCUS_01340 gene dacB 126941 125796 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_01340 127744 127145 gene locus_tag LOCUS_01350 gene scpB 127744 127145 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223904.1 protein_id gnl|my_center|LOCUS_01350 128484 127741 gene locus_tag LOCUS_01360 gene scpA 128484 127741 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_01360 128934 129464 gene locus_tag LOCUS_01370 128934 129464 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281547.1 protein_id gnl|my_center|LOCUS_01370 129920 129564 gene locus_tag LOCUS_01380 gene ribT 129920 129564 CDS product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 protein_id gnl|my_center|LOCUS_01380 131526 130207 gene locus_tag LOCUS_01390 gene lysA 131526 130207 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_01390 133305 131821 gene locus_tag LOCUS_01400 gene spoVAF 133305 131821 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_01400 133867 133268 gene locus_tag LOCUS_01410 133867 133268 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254415.1 protein_id gnl|my_center|LOCUS_01410 134328 133900 gene locus_tag LOCUS_01420 gene spoVAB 134328 133900 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 protein_id gnl|my_center|LOCUS_01420 134938 134318 gene locus_tag LOCUS_01430 gene spoVAA 134938 134318 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_01430 135868 135104 gene locus_tag LOCUS_01440 gene sigF 135868 135104 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_01440 136321 135881 gene locus_tag LOCUS_01450 gene spoIIAB 136321 135881 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243400.1 protein_id gnl|my_center|LOCUS_01450 136672 136322 gene locus_tag LOCUS_01460 gene spoIIAA 136672 136322 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_01460 137974 136793 gene locus_tag LOCUS_01470 gene dacF 137974 136793 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_01470 139464 138160 gene locus_tag LOCUS_01480 139464 138160 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_01480 140312 139494 gene locus_tag LOCUS_01490 140312 139494 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_01490 141509 140325 gene locus_tag LOCUS_01500 gene deoB 141509 140325 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_01500 142631 141738 gene locus_tag LOCUS_01510 gene xerD 142631 141738 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_01510 142868 142638 gene locus_tag LOCUS_01520 142868 142638 CDS product YqzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230440.1 protein_id gnl|my_center|LOCUS_01520 143687 143202 gene locus_tag LOCUS_01530 gene fur 143687 143202 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 protein_id gnl|my_center|LOCUS_01530 144432 143797 gene locus_tag LOCUS_01540 gene spoIIM 144432 143797 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269101.1 protein_id gnl|my_center|LOCUS_01540 144577 145155 gene locus_tag LOCUS_01550 144577 145155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068736.1 protein_id gnl|my_center|LOCUS_01550 146451 145291 gene locus_tag LOCUS_01560 146451 145291 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_01560 147003 146452 gene locus_tag LOCUS_01570 gene nudF 147003 146452 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_01570 147132 147266 gene locus_tag LOCUS_01580 147132 147266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 147280 148248 gene locus_tag LOCUS_01590 gene lolS 147280 148248 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 protein_id gnl|my_center|LOCUS_01590 148551 148303 gene locus_tag LOCUS_01600 148551 148303 CDS product YqkE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727557.1 protein_id gnl|my_center|LOCUS_01600 149863 148679 gene locus_tag LOCUS_01610 149863 148679 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_01610 150042 150173 gene locus_tag LOCUS_01620 150042 150173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 150257 151177 gene locus_tag LOCUS_01630 150257 151177 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819224.1 protein_id gnl|my_center|LOCUS_01630 151512 151192 gene locus_tag LOCUS_01640 151512 151192 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 protein_id gnl|my_center|LOCUS_01640 151613 151813 gene locus_tag LOCUS_01650 151613 151813 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070876731.1 protein_id gnl|my_center|LOCUS_01650 152207 151860 gene locus_tag LOCUS_01660 152207 151860 CDS product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 protein_id gnl|my_center|LOCUS_01660 153519 152257 gene locus_tag LOCUS_01670 153519 152257 CDS product UV damage repair protein UvrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168747920.1 protein_id gnl|my_center|LOCUS_01670 153691 153879 gene locus_tag LOCUS_01680 153691 153879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 154704 153910 gene locus_tag LOCUS_01690 154704 153910 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_01690 155684 154707 gene locus_tag LOCUS_01700 155684 154707 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125119.1 protein_id gnl|my_center|LOCUS_01700 156494 157324 gene locus_tag LOCUS_01710 gene proI 156494 157324 CDS product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027249.1 protein_id gnl|my_center|LOCUS_01710 157511 158533 gene locus_tag LOCUS_01720 gene namA 157511 158533 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083631.1 protein_id gnl|my_center|LOCUS_01720 159498 158575 gene locus_tag LOCUS_01730 gene rnz 159498 158575 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397455.1 protein_id gnl|my_center|LOCUS_01730 159741 161240 gene locus_tag LOCUS_01740 gene zwf 159741 161240 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 protein_id gnl|my_center|LOCUS_01740 161396 162013 gene locus_tag LOCUS_01750 161396 162013 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393784.1 protein_id gnl|my_center|LOCUS_01750 162159 162599 gene locus_tag LOCUS_01760 162159 162599 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247558.1 protein_id gnl|my_center|LOCUS_01760 164080 162671 gene locus_tag LOCUS_01770 gene gndA 164080 162671 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_01770 165409 164147 gene locus_tag LOCUS_01780 165409 164147 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208841.1 protein_id gnl|my_center|LOCUS_01780 165791 166978 gene locus_tag LOCUS_01790 165791 166978 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_01790 166992 168203 gene locus_tag LOCUS_01800 166992 168203 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_01800 168349 169755 gene locus_tag LOCUS_01810 168349 169755 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_01810 169730 171055 gene locus_tag LOCUS_01820 169730 171055 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_01820 171801 171487 gene locus_tag LOCUS_01830 171801 171487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 172461 171979 gene locus_tag LOCUS_01840 172461 171979 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265620.1 protein_id gnl|my_center|LOCUS_01840 173763 172639 gene locus_tag LOCUS_01850 173763 172639 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 protein_id gnl|my_center|LOCUS_01850 175470 173923 gene locus_tag LOCUS_01860 175470 173923 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_01860 175894 175478 gene locus_tag LOCUS_01870 gene mce 175894 175478 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence002 755 246 gene locus_tag LOCUS_01880 755 246 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146547.1 protein_id gnl|my_center|LOCUS_01880 1781 813 gene locus_tag LOCUS_01890 1781 813 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 protein_id gnl|my_center|LOCUS_01890 2359 1922 gene locus_tag LOCUS_01900 gene brxB 2359 1922 CDS product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 protein_id gnl|my_center|LOCUS_01900 3737 2622 gene locus_tag LOCUS_01910 gene meaB 3737 2622 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_01910 5930 3738 gene locus_tag LOCUS_01920 gene scpA 5930 3738 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_01920 7840 5927 gene locus_tag LOCUS_01930 gene mutA 7840 5927 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_01930 8134 8994 gene locus_tag LOCUS_01940 8134 8994 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 protein_id gnl|my_center|LOCUS_01940 10416 9127 gene locus_tag LOCUS_01950 10416 9127 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257658.1 protein_id gnl|my_center|LOCUS_01950 11610 10627 gene locus_tag LOCUS_01960 gene bfmBAB 11610 10627 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398638.1 protein_id gnl|my_center|LOCUS_01960 12622 11630 gene locus_tag LOCUS_01970 gene bfmBAA 12622 11630 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_01970 14077 12650 gene locus_tag LOCUS_01980 gene lpdA 14077 12650 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_01980 15200 14103 gene locus_tag LOCUS_01990 gene buk 15200 14103 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 protein_id gnl|my_center|LOCUS_01990 16437 15340 gene locus_tag LOCUS_02000 gene bcd 16437 15340 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_02000 18944 16890 gene locus_tag LOCUS_02010 18944 16890 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810985.1 protein_id gnl|my_center|LOCUS_02010 19137 19373 gene locus_tag LOCUS_02020 19137 19373 CDS product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230304.1 protein_id gnl|my_center|LOCUS_02020 20157 19423 gene locus_tag LOCUS_02030 20157 19423 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172591.1 protein_id gnl|my_center|LOCUS_02030 20997 20197 gene locus_tag LOCUS_02040 gene spo0A 20997 20197 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_02040 21316 21128 gene locus_tag LOCUS_02050 21316 21128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 22553 21261 gene locus_tag LOCUS_02060 gene spoIVB 22553 21261 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054681.1 protein_id gnl|my_center|LOCUS_02060 24522 22810 gene locus_tag LOCUS_02070 gene recN 24522 22810 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_02070 25168 24719 gene locus_tag LOCUS_02080 gene argR 25168 24719 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 protein_id gnl|my_center|LOCUS_02080 26166 25327 gene locus_tag LOCUS_02090 26166 25327 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 protein_id gnl|my_center|LOCUS_02090 28028 26169 gene locus_tag LOCUS_02100 gene dxs 28028 26169 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_02100 29162 28275 gene locus_tag LOCUS_02110 29162 28275 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 protein_id gnl|my_center|LOCUS_02110 29391 29167 gene locus_tag LOCUS_02120 29391 29167 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_02120 30739 29381 gene locus_tag LOCUS_02130 gene xseA 30739 29381 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_02130 31705 30851 gene locus_tag LOCUS_02140 gene folD 31705 30851 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_02140 32113 31724 gene locus_tag LOCUS_02150 gene nusB 32113 31724 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_02150 33257 32847 gene locus_tag LOCUS_02160 gene yqhY 33257 32847 CDS product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 protein_id gnl|my_center|LOCUS_02160 34633 33284 gene locus_tag LOCUS_02170 gene accC 34633 33284 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_02170 35147 34647 gene locus_tag LOCUS_02180 gene accB 35147 34647 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 protein_id gnl|my_center|LOCUS_02180 36022 35474 gene locus_tag LOCUS_02190 36022 35474 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914708.1 protein_id gnl|my_center|LOCUS_02190 36688 36026 gene locus_tag LOCUS_02200 gene spoIIIAG 36688 36026 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_02200 37298 36651 gene locus_tag LOCUS_02210 gene spoIIIAF 37298 36651 CDS product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230233.1 protein_id gnl|my_center|LOCUS_02210 38496 37309 gene locus_tag LOCUS_02220 gene spoIIIAE 38496 37309 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_02220 38762 38526 gene locus_tag LOCUS_02230 38762 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 39138 38935 gene locus_tag LOCUS_02240 gene spoIIIAC 39138 38935 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_02240 39672 39157 gene locus_tag LOCUS_02250 gene spoIIIAB 39672 39157 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 protein_id gnl|my_center|LOCUS_02250 40595 39669 gene locus_tag LOCUS_02260 gene spoIIIAA 40595 39669 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665889.1 protein_id gnl|my_center|LOCUS_02260 41396 40839 gene locus_tag LOCUS_02270 gene efp 41396 40839 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 protein_id gnl|my_center|LOCUS_02270 42480 41416 gene locus_tag LOCUS_02280 gene pepQ 42480 41416 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_02280 42949 42467 gene locus_tag LOCUS_02290 gene aroQ 42949 42467 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_02290 43569 43057 gene locus_tag LOCUS_02300 43569 43057 CDS product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 protein_id gnl|my_center|LOCUS_02300 43803 44747 gene locus_tag LOCUS_02310 43803 44747 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967716.1 protein_id gnl|my_center|LOCUS_02310 44796 45149 gene locus_tag LOCUS_02320 44796 45149 CDS product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226367.1 protein_id gnl|my_center|LOCUS_02320 46033 45158 gene locus_tag LOCUS_02330 46033 45158 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 protein_id gnl|my_center|LOCUS_02330 48768 46207 gene locus_tag LOCUS_02340 48768 46207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 49949 49110 gene locus_tag LOCUS_02350 gene lipM 49949 49110 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_02350 50186 50563 gene locus_tag LOCUS_02360 50186 50563 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398485.1 protein_id gnl|my_center|LOCUS_02360 52199 50736 gene locus_tag LOCUS_02370 gene gcvPB 52199 50736 CDS product aminomethyl-transferring glycine dehydrogenase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795703.1 protein_id gnl|my_center|LOCUS_02370 53538 52192 gene locus_tag LOCUS_02380 gene gcvPA 53538 52192 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 protein_id gnl|my_center|LOCUS_02380 54665 53562 gene locus_tag LOCUS_02390 gene gcvT 54665 53562 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_02390 55676 55470 gene locus_tag LOCUS_02400 55676 55470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 55734 57428 gene locus_tag LOCUS_02410 55734 57428 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 protein_id gnl|my_center|LOCUS_02410 57397 58194 gene locus_tag LOCUS_02420 57397 58194 CDS product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183959.1 protein_id gnl|my_center|LOCUS_02420 58565 58386 gene locus_tag LOCUS_02430 58565 58386 CDS product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230176.1 protein_id gnl|my_center|LOCUS_02430 59110 58607 gene locus_tag LOCUS_02440 59110 58607 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289138.1 protein_id gnl|my_center|LOCUS_02440 59509 59126 gene locus_tag LOCUS_02450 59509 59126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 59997 59509 gene locus_tag LOCUS_02460 gene comGF 59997 59509 CDS product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931731.1 protein_id gnl|my_center|LOCUS_02460 60238 59921 gene locus_tag LOCUS_02470 60238 59921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 60647 60222 gene locus_tag LOCUS_02480 60647 60222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 60962 60654 gene locus_tag LOCUS_02490 gene comGC 60962 60654 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732258.1 protein_id gnl|my_center|LOCUS_02490 62113 61142 gene locus_tag LOCUS_02500 gene comGB 62113 61142 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776422.1 protein_id gnl|my_center|LOCUS_02500 63224 62136 gene locus_tag LOCUS_02510 gene comGA 63224 62136 CDS product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 protein_id gnl|my_center|LOCUS_02510 63358 63431 gene locus_tag LOCUS_t00010 63358 63431 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 63588 64283 gene locus_tag LOCUS_02520 63588 64283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434132.1 protein_id gnl|my_center|LOCUS_02520 64367 64609 gene locus_tag LOCUS_02530 64367 64609 CDS product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440720.1 protein_id gnl|my_center|LOCUS_02530 65463 64828 gene locus_tag LOCUS_02540 65463 64828 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_02540 65708 65881 gene locus_tag LOCUS_02550 65708 65881 CDS product DUF2759 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524853.1 protein_id gnl|my_center|LOCUS_02550 67231 66044 gene locus_tag LOCUS_02560 67231 66044 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 protein_id gnl|my_center|LOCUS_02560 69233 67368 gene locus_tag LOCUS_02570 69233 67368 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 protein_id gnl|my_center|LOCUS_02570 70431 69451 gene locus_tag LOCUS_02580 gene glcK 70431 69451 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_02580 70636 70433 gene locus_tag LOCUS_02590 70636 70433 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253699.1 protein_id gnl|my_center|LOCUS_02590 72222 70762 gene locus_tag LOCUS_02600 72222 70762 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_02600 72372 73244 gene locus_tag LOCUS_02610 72372 73244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 74787 73234 gene locus_tag LOCUS_02620 gene yqgP 74787 73234 CDS product rhomboid protease YqgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230128.1 protein_id gnl|my_center|LOCUS_02620 75210 75028 gene locus_tag LOCUS_02630 75210 75028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 76060 75275 gene locus_tag LOCUS_02640 76060 75275 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_02640 76619 76053 gene locus_tag LOCUS_02650 76619 76053 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206416.1 protein_id gnl|my_center|LOCUS_02650 77046 76897 gene locus_tag LOCUS_02660 gene rpmG 77046 76897 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265617.1 protein_id gnl|my_center|LOCUS_02660 77710 77105 gene locus_tag LOCUS_02670 77710 77105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 77953 78294 gene locus_tag LOCUS_02680 77953 78294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 78310 78798 gene locus_tag LOCUS_02690 78310 78798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 79640 78828 gene locus_tag LOCUS_02700 gene pstB 79640 78828 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226686.1 protein_id gnl|my_center|LOCUS_02700 80610 79735 gene locus_tag LOCUS_02710 gene pstA 80610 79735 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450297.1 protein_id gnl|my_center|LOCUS_02710 81551 80610 gene locus_tag LOCUS_02720 gene pstC 81551 80610 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830936.1 protein_id gnl|my_center|LOCUS_02720 82605 81625 gene locus_tag LOCUS_02730 gene phoX 82605 81625 CDS product phosphate ABC transporter substrate-binding protein PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871265.1 protein_id gnl|my_center|LOCUS_02730 85066 82895 gene locus_tag LOCUS_02740 85066 82895 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039006.1 protein_id gnl|my_center|LOCUS_02740 86429 85212 gene locus_tag LOCUS_02750 86429 85212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_02750 87149 86541 gene locus_tag LOCUS_02760 gene sodA 87149 86541 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_02760 89181 87544 gene locus_tag LOCUS_02770 89181 87544 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456278.1 protein_id gnl|my_center|LOCUS_02770 89521 90309 gene locus_tag LOCUS_02780 89521 90309 CDS product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021897.1 protein_id gnl|my_center|LOCUS_02780 91567 90374 gene locus_tag LOCUS_02790 91567 90374 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_02790 91702 92025 gene locus_tag LOCUS_02800 91702 92025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825409.1 protein_id gnl|my_center|LOCUS_02800 92196 93302 gene locus_tag LOCUS_02810 gene ispG 92196 93302 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 protein_id gnl|my_center|LOCUS_02810 93676 93329 gene locus_tag LOCUS_02820 93676 93329 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 protein_id gnl|my_center|LOCUS_02820 93889 94467 gene locus_tag LOCUS_02830 93889 94467 CDS product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 protein_id gnl|my_center|LOCUS_02830 94968 94543 gene locus_tag LOCUS_02840 94968 94543 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054516.1 protein_id gnl|my_center|LOCUS_02840 95834 94998 gene locus_tag LOCUS_02850 95834 94998 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613815.1 protein_id gnl|my_center|LOCUS_02850 96609 95827 gene locus_tag LOCUS_02860 96609 95827 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_02860 97667 96795 gene locus_tag LOCUS_02870 97667 96795 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435963.1 protein_id gnl|my_center|LOCUS_02870 97780 98034 gene locus_tag LOCUS_02880 97780 98034 CDS product DUF2624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048962.1 protein_id gnl|my_center|LOCUS_02880 99272 98379 gene locus_tag LOCUS_02890 99272 98379 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_02890 100747 99434 gene locus_tag LOCUS_02900 100747 99434 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121678890.1 protein_id gnl|my_center|LOCUS_02900 100971 101597 gene locus_tag LOCUS_02910 100971 101597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 101677 102633 gene locus_tag LOCUS_02920 101677 102633 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 protein_id gnl|my_center|LOCUS_02920 104191 103073 gene locus_tag LOCUS_02930 104191 103073 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_02930 104895 104194 gene locus_tag LOCUS_02940 104895 104194 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_02940 105423 105067 gene locus_tag LOCUS_02950 gene cccA 105423 105067 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 protein_id gnl|my_center|LOCUS_02950 106145 105813 gene locus_tag LOCUS_02960 106145 105813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 107430 106297 gene locus_tag LOCUS_02970 gene rpoD 107430 106297 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_02970 109276 107474 gene locus_tag LOCUS_02980 gene dnaG 109276 107474 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_02980 109725 109273 gene locus_tag LOCUS_02990 109725 109273 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 protein_id gnl|my_center|LOCUS_02990 110857 110045 gene locus_tag LOCUS_03000 110857 110045 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 protein_id gnl|my_center|LOCUS_03000 111523 110891 gene locus_tag LOCUS_03010 gene ccpN 111523 110891 CDS product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 protein_id gnl|my_center|LOCUS_03010 113876 111807 gene locus_tag LOCUS_03020 gene glyS 113876 111807 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_03020 114759 113869 gene locus_tag LOCUS_03030 gene glyQ 114759 113869 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_03030 115818 115048 gene locus_tag LOCUS_03040 gene recO 115818 115048 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_03040 116003 115860 gene locus_tag LOCUS_03050 116003 115860 CDS product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230053.1 protein_id gnl|my_center|LOCUS_03050 117031 116111 gene locus_tag LOCUS_03060 gene era 117031 116111 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_03060 117422 117024 gene locus_tag LOCUS_03070 117422 117024 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_03070 118190 117807 gene locus_tag LOCUS_03080 118190 117807 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721970.1 protein_id gnl|my_center|LOCUS_03080 118644 118174 gene locus_tag LOCUS_03090 gene ybeY 118644 118174 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_03090 120795 118663 gene locus_tag LOCUS_03100 gene pgpH 120795 118663 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_03100 122003 121041 gene locus_tag LOCUS_03110 122003 121041 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_03110 123195 121978 gene locus_tag LOCUS_03120 gene yqfD 123195 121978 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792498.1 protein_id gnl|my_center|LOCUS_03120 123492 123208 gene locus_tag LOCUS_03130 gene yqfC 123492 123208 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732269.1 protein_id gnl|my_center|LOCUS_03130 123986 123564 gene locus_tag LOCUS_03140 123986 123564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230029.1 protein_id gnl|my_center|LOCUS_03140 125049 124039 gene locus_tag LOCUS_03150 gene floA 125049 124039 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_03150 126330 125062 gene locus_tag LOCUS_03160 126330 125062 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_03160 126971 126525 gene locus_tag LOCUS_03170 126971 126525 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 protein_id gnl|my_center|LOCUS_03170 127165 126992 gene locus_tag LOCUS_03180 127165 126992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 127409 128356 gene locus_tag LOCUS_03190 127409 128356 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230019.1 protein_id gnl|my_center|LOCUS_03190 129095 128424 gene locus_tag LOCUS_03200 gene deoC 129095 128424 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_03200 130720 129365 gene locus_tag LOCUS_03210 gene mtaB 130720 129365 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_03210 131478 130726 gene locus_tag LOCUS_03220 131478 130726 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 protein_id gnl|my_center|LOCUS_03220 132549 131611 gene locus_tag LOCUS_03230 gene prmA 132549 131611 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 protein_id gnl|my_center|LOCUS_03230 133688 132573 gene locus_tag LOCUS_03240 gene dnaJ 133688 132573 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_03240 135715 133880 gene locus_tag LOCUS_03250 gene dnaK 135715 133880 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_03250 136323 135748 gene locus_tag LOCUS_03260 136323 135748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 137494 136463 gene locus_tag LOCUS_03270 gene hrcA 137494 136463 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_03270 138768 137632 gene locus_tag LOCUS_03280 gene hemW 138768 137632 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732347.1 protein_id gnl|my_center|LOCUS_03280 140774 138942 gene locus_tag LOCUS_03290 gene lepA 140774 138942 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_03290 141301 140969 gene locus_tag LOCUS_03300 141301 140969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 142566 141376 gene locus_tag LOCUS_03310 gene spoIIP 142566 141376 CDS product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 protein_id gnl|my_center|LOCUS_03310 143879 142770 gene locus_tag LOCUS_03320 gene gpr 143879 142770 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_03320 144088 144348 gene locus_tag LOCUS_03330 gene rpsT 144088 144348 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726526.1 protein_id gnl|my_center|LOCUS_03330 144650 144465 gene locus_tag LOCUS_03340 144650 144465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 145024 144782 gene locus_tag LOCUS_03350 145024 144782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 145521 145084 gene locus_tag LOCUS_03360 145521 145084 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097663.1 protein_id gnl|my_center|LOCUS_03360 147447 145540 gene locus_tag LOCUS_03370 147447 145540 CDS product ribonuclease YeeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398855.1 protein_id gnl|my_center|LOCUS_03370 147789 147992 gene locus_tag LOCUS_03380 147789 147992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 148773 148564 gene locus_tag LOCUS_03390 148773 148564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 150791 148911 gene locus_tag LOCUS_03400 gene ltrA 150791 148911 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_03400 152431 151517 gene locus_tag LOCUS_03410 152431 151517 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289051.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence003 379 116 gene locus_tag LOCUS_03420 gene csgA 379 116 CDS product sigma-G-dependent sporulation-specific acid-soluble spore protein CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234887.1 protein_id gnl|my_center|LOCUS_03420 571 380 gene locus_tag LOCUS_03430 571 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 693 842 gene locus_tag LOCUS_03440 693 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 940 1074 gene locus_tag LOCUS_03450 940 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1208 1399 gene locus_tag LOCUS_03460 1208 1399 CDS product DUF5370 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234886.1 protein_id gnl|my_center|LOCUS_03460 2360 1557 gene locus_tag LOCUS_03470 2360 1557 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690200.1 protein_id gnl|my_center|LOCUS_03470 2723 4057 gene locus_tag LOCUS_03480 gene dsdA 2723 4057 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_03480 4084 4698 gene locus_tag LOCUS_03490 4084 4698 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_03490 5411 4854 gene locus_tag LOCUS_03500 5411 4854 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245125.1 protein_id gnl|my_center|LOCUS_03500 5604 5879 gene locus_tag LOCUS_03510 5604 5879 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_03510 6028 7296 gene locus_tag LOCUS_03520 6028 7296 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_03520 7551 7832 gene locus_tag LOCUS_03530 7551 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 7854 8990 gene locus_tag LOCUS_03540 7854 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 9005 9199 gene locus_tag LOCUS_03550 9005 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 9290 9619 gene locus_tag LOCUS_03560 9290 9619 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531355.1 protein_id gnl|my_center|LOCUS_03560 10250 9921 gene locus_tag LOCUS_03570 10250 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 10552 11625 gene locus_tag LOCUS_03580 10552 11625 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_03580 12012 13832 gene locus_tag LOCUS_03590 12012 13832 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814302.1 protein_id gnl|my_center|LOCUS_03590 13943 14167 gene locus_tag LOCUS_03600 13943 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 14926 14660 gene locus_tag LOCUS_03610 14926 14660 CDS product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230757.1 protein_id gnl|my_center|LOCUS_03610 16044 15100 gene locus_tag LOCUS_03620 16044 15100 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888238.1 protein_id gnl|my_center|LOCUS_03620 16206 16961 gene locus_tag LOCUS_03630 16206 16961 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_03630 17203 17403 gene locus_tag LOCUS_03640 17203 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 17479 17772 gene locus_tag LOCUS_03650 17479 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 18138 17941 gene locus_tag LOCUS_03660 18138 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 18601 19953 gene locus_tag LOCUS_03670 18601 19953 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898539.1 protein_id gnl|my_center|LOCUS_03670 20388 21392 gene locus_tag LOCUS_03680 20388 21392 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 protein_id gnl|my_center|LOCUS_03680 21407 22180 gene locus_tag LOCUS_03690 21407 22180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_03690 22240 23217 gene locus_tag LOCUS_03700 22240 23217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731011.1 protein_id gnl|my_center|LOCUS_03700 24371 23283 gene locus_tag LOCUS_03710 gene phaC 24371 23283 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 protein_id gnl|my_center|LOCUS_03710 25239 24457 gene locus_tag LOCUS_03720 gene phbB 25239 24457 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_03720 25772 25293 gene locus_tag LOCUS_03730 25772 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 26040 26459 gene locus_tag LOCUS_03740 gene phaQ 26040 26459 CDS product poly-beta-hydroxybutyrate-responsive repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903020.1 protein_id gnl|my_center|LOCUS_03740 26603 27130 gene locus_tag LOCUS_03750 26603 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 27164 27580 gene locus_tag LOCUS_03760 27164 27580 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067916.1 protein_id gnl|my_center|LOCUS_03760 27853 29211 gene locus_tag LOCUS_03770 27853 29211 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_03770 29682 31559 gene locus_tag LOCUS_03780 gene htpG 29682 31559 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_03780 31699 32577 gene locus_tag LOCUS_03790 31699 32577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 32969 34192 gene locus_tag LOCUS_03800 32969 34192 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243239.1 protein_id gnl|my_center|LOCUS_03800 34331 36313 gene locus_tag LOCUS_03810 34331 36313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 36420 37166 gene locus_tag LOCUS_03820 36420 37166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294982.1 protein_id gnl|my_center|LOCUS_03820 37446 38255 gene locus_tag LOCUS_03830 37446 38255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294982.1 protein_id gnl|my_center|LOCUS_03830 39066 38341 gene locus_tag LOCUS_03840 39066 38341 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550961.1 protein_id gnl|my_center|LOCUS_03840 39217 39591 gene locus_tag LOCUS_03850 39217 39591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 39664 39900 gene locus_tag LOCUS_03860 39664 39900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 40028 40327 gene locus_tag LOCUS_03870 40028 40327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 40513 41553 gene locus_tag LOCUS_03880 gene mnmH 40513 41553 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812887.1 protein_id gnl|my_center|LOCUS_03880 42097 41801 gene locus_tag LOCUS_03890 42097 41801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 protein_id gnl|my_center|LOCUS_03890 42165 42443 gene locus_tag LOCUS_03900 42165 42443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 43687 42569 gene locus_tag LOCUS_03910 gene xerD 43687 42569 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098612.1 protein_id gnl|my_center|LOCUS_03910 44239 44751 gene locus_tag LOCUS_03920 44239 44751 CDS product DUF3231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243249.1 protein_id gnl|my_center|LOCUS_03920 45503 44970 gene locus_tag LOCUS_03930 45503 44970 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003157550.1 protein_id gnl|my_center|LOCUS_03930 47122 46571 gene locus_tag LOCUS_03940 47122 46571 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020694.1 protein_id gnl|my_center|LOCUS_03940 47318 48103 gene locus_tag LOCUS_03950 47318 48103 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982927.1 protein_id gnl|my_center|LOCUS_03950 48154 48582 gene locus_tag LOCUS_03960 48154 48582 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071557.1 protein_id gnl|my_center|LOCUS_03960 48768 49409 gene locus_tag LOCUS_03970 48768 49409 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536320.1 protein_id gnl|my_center|LOCUS_03970 49855 49484 gene locus_tag LOCUS_03980 gene crcB 49855 49484 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944501.1 protein_id gnl|my_center|LOCUS_03980 50226 49861 gene locus_tag LOCUS_03990 gene crcB 50226 49861 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639315.1 protein_id gnl|my_center|LOCUS_03990 50434 50267 gene locus_tag LOCUS_04000 50434 50267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 50909 51586 gene locus_tag LOCUS_04010 50909 51586 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_04010 51657 52685 gene locus_tag LOCUS_04020 51657 52685 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_04020 52712 53467 gene locus_tag LOCUS_04030 52712 53467 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242723.1 protein_id gnl|my_center|LOCUS_04030 53501 54481 gene locus_tag LOCUS_04040 53501 54481 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 protein_id gnl|my_center|LOCUS_04040 55483 54647 gene locus_tag LOCUS_04050 55483 54647 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878847.1 protein_id gnl|my_center|LOCUS_04050 55825 56580 gene locus_tag LOCUS_04060 55825 56580 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811624.1 protein_id gnl|my_center|LOCUS_04060 57736 56831 gene locus_tag LOCUS_04070 57736 56831 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409953.1 protein_id gnl|my_center|LOCUS_04070 58748 57750 gene locus_tag LOCUS_04080 58748 57750 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418724.1 protein_id gnl|my_center|LOCUS_04080 59468 59842 gene locus_tag LOCUS_04090 59468 59842 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_04090 59845 60723 gene locus_tag LOCUS_04100 59845 60723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 protein_id gnl|my_center|LOCUS_04100 60707 61363 gene locus_tag LOCUS_04110 60707 61363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 61824 61411 gene locus_tag LOCUS_04120 61824 61411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 61882 62430 gene locus_tag LOCUS_04130 61882 62430 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543140.1 protein_id gnl|my_center|LOCUS_04130 63470 63195 gene locus_tag LOCUS_04140 63470 63195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 65320 63533 gene locus_tag LOCUS_04150 gene arsA 65320 63533 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948468.1 protein_id gnl|my_center|LOCUS_04150 65706 65344 gene locus_tag LOCUS_04160 gene arsD 65706 65344 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948467.1 protein_id gnl|my_center|LOCUS_04160 66175 65756 gene locus_tag LOCUS_04170 66175 65756 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_04170 67485 66190 gene locus_tag LOCUS_04180 67485 66190 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_04180 67842 67501 gene locus_tag LOCUS_04190 gene aseR 67842 67501 CDS product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 protein_id gnl|my_center|LOCUS_04190 68990 68076 gene locus_tag LOCUS_04200 gene murB 68990 68076 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 protein_id gnl|my_center|LOCUS_04200 70471 69500 gene locus_tag LOCUS_04210 70471 69500 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170749.1 protein_id gnl|my_center|LOCUS_04210 71232 70471 gene locus_tag LOCUS_04220 71232 70471 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648880.1 protein_id gnl|my_center|LOCUS_04220 72002 71229 gene locus_tag LOCUS_04230 gene cobA 72002 71229 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521262.1 protein_id gnl|my_center|LOCUS_04230 72284 72063 gene locus_tag LOCUS_04240 72284 72063 CDS product DUF3906 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366914.1 protein_id gnl|my_center|LOCUS_04240 73990 72365 gene locus_tag LOCUS_04250 73990 72365 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_04250 74596 74003 gene locus_tag LOCUS_04260 gene cysC 74596 74003 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 protein_id gnl|my_center|LOCUS_04260 75818 74667 gene locus_tag LOCUS_04270 gene sat 75818 74667 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_04270 76596 75880 gene locus_tag LOCUS_04280 76596 75880 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 protein_id gnl|my_center|LOCUS_04280 77778 77026 gene locus_tag LOCUS_04290 77778 77026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948399.1 protein_id gnl|my_center|LOCUS_04290 79623 78190 gene locus_tag LOCUS_04300 79623 78190 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_04300 82396 79967 gene locus_tag LOCUS_04310 gene parC 82396 79967 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_04310 84374 82383 gene locus_tag LOCUS_04320 gene parE 84374 82383 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062193.1 protein_id gnl|my_center|LOCUS_04320 85050 84640 gene locus_tag LOCUS_04330 85050 84640 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 protein_id gnl|my_center|LOCUS_04330 86414 85131 gene locus_tag LOCUS_04340 86414 85131 CDS product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847027.1 protein_id gnl|my_center|LOCUS_04340 86823 87404 gene locus_tag LOCUS_04350 gene plsY 86823 87404 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 protein_id gnl|my_center|LOCUS_04350 89464 87470 gene locus_tag LOCUS_04360 89464 87470 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392342.1 protein_id gnl|my_center|LOCUS_04360 90015 90308 gene locus_tag LOCUS_04370 90015 90308 CDS product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 protein_id gnl|my_center|LOCUS_04370 90659 90333 gene locus_tag LOCUS_04380 90659 90333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 protein_id gnl|my_center|LOCUS_04380 91082 90666 gene locus_tag LOCUS_04390 91082 90666 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 protein_id gnl|my_center|LOCUS_04390 91431 91201 gene locus_tag LOCUS_04400 gene tlp 91431 91201 CDS product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 protein_id gnl|my_center|LOCUS_04400 91620 91477 gene locus_tag LOCUS_04410 gene sspN 91620 91477 CDS product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527987.1 protein_id gnl|my_center|LOCUS_04410 91819 91679 gene locus_tag LOCUS_04420 91819 91679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 92371 91940 gene locus_tag LOCUS_04430 92371 91940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 95397 92677 gene locus_tag LOCUS_04440 gene acnA 95397 92677 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 protein_id gnl|my_center|LOCUS_04440 95899 95735 gene locus_tag LOCUS_04450 95899 95735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 96025 96177 gene locus_tag LOCUS_04460 96025 96177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 96522 96265 gene locus_tag LOCUS_04470 96522 96265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146294.1 protein_id gnl|my_center|LOCUS_04470 96638 96784 gene locus_tag LOCUS_04480 96638 96784 CDS product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221237.1 protein_id gnl|my_center|LOCUS_04480 98253 96859 gene locus_tag LOCUS_04490 gene selA 98253 96859 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_04490 98400 98780 gene locus_tag LOCUS_04500 98400 98780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 99244 100083 gene locus_tag LOCUS_04510 99244 100083 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_04510 100100 100279 gene locus_tag LOCUS_04520 100100 100279 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085171.1 protein_id gnl|my_center|LOCUS_04520 100531 101508 gene locus_tag LOCUS_04530 gene selD 100531 101508 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_04530 104280 101701 gene locus_tag LOCUS_04540 104280 101701 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163262492.1 protein_id gnl|my_center|LOCUS_04540 104475 104750 gene locus_tag LOCUS_04550 104475 104750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 105090 105278 gene locus_tag LOCUS_04560 105090 105278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231000.1 protein_id gnl|my_center|LOCUS_04560 106034 105411 gene locus_tag LOCUS_04570 106034 105411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 106352 107701 gene locus_tag LOCUS_04580 106352 107701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087647.1 protein_id gnl|my_center|LOCUS_04580 107682 110432 gene locus_tag LOCUS_04590 107682 110432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710987.1 protein_id gnl|my_center|LOCUS_04590 110437 112188 gene locus_tag LOCUS_04600 110437 112188 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021385.1 protein_id gnl|my_center|LOCUS_04600 112178 112897 gene locus_tag LOCUS_04610 112178 112897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 114557 113229 gene locus_tag LOCUS_04620 114557 113229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 114984 114490 gene locus_tag LOCUS_04630 114984 114490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 116195 115410 gene locus_tag LOCUS_04640 116195 115410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04640 116343 116918 gene locus_tag LOCUS_04650 116343 116918 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033728358.1 protein_id gnl|my_center|LOCUS_04650 117625 117173 gene locus_tag LOCUS_04660 117625 117173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 117990 118130 gene locus_tag LOCUS_04670 117990 118130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04670 118137 118631 gene locus_tag LOCUS_04680 118137 118631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04680 119725 119558 gene locus_tag LOCUS_04690 119725 119558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 120045 120323 gene locus_tag LOCUS_04700 120045 120323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 121702 120884 gene locus_tag LOCUS_04710 121702 120884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 122040 121762 gene locus_tag LOCUS_04720 122040 121762 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816285.1 protein_id gnl|my_center|LOCUS_04720 122336 122109 gene locus_tag LOCUS_04730 122336 122109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 122671 122465 gene locus_tag LOCUS_04740 122671 122465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 123789 122929 gene locus_tag LOCUS_04750 123789 122929 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018922.1 protein_id gnl|my_center|LOCUS_04750 124027 123821 gene locus_tag LOCUS_04760 124027 123821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 124390 124040 gene locus_tag LOCUS_04770 gene spoVAE 124390 124040 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_04770 125406 124387 gene locus_tag LOCUS_04780 gene spoVAD 125406 124387 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938970.1 protein_id gnl|my_center|LOCUS_04780 125885 125406 gene locus_tag LOCUS_04790 gene spoVAC 125885 125406 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 protein_id gnl|my_center|LOCUS_04790 126379 125903 gene locus_tag LOCUS_04800 126379 125903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 126665 126462 gene locus_tag LOCUS_04810 126665 126462 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216166.1 protein_id gnl|my_center|LOCUS_04810 127062 127238 gene locus_tag LOCUS_04820 127062 127238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 127549 127800 gene locus_tag LOCUS_04830 127549 127800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 128209 128613 gene locus_tag LOCUS_04840 128209 128613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 129130 129363 gene locus_tag LOCUS_04850 129130 129363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04850 130063 129731 gene locus_tag LOCUS_04860 130063 129731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 131643 130720 gene locus_tag LOCUS_04870 131643 130720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence004 1500 235 gene locus_tag LOCUS_04880 gene lytF 1500 235 CDS product peptidoglycan endopeptidase LytF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244874.1 protein_id gnl|my_center|LOCUS_04880 3404 1983 gene locus_tag LOCUS_04890 3404 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3834 3619 gene locus_tag LOCUS_04900 3834 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5813 3810 gene locus_tag LOCUS_04910 gene pbpC 5813 3810 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227238.1 protein_id gnl|my_center|LOCUS_04910 7343 6198 gene locus_tag LOCUS_04920 7343 6198 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 protein_id gnl|my_center|LOCUS_04920 7716 8348 gene locus_tag LOCUS_04930 7716 8348 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244397.1 protein_id gnl|my_center|LOCUS_04930 8887 8414 gene locus_tag LOCUS_04940 8887 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9091 9495 gene locus_tag LOCUS_04950 9091 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 9848 9552 gene locus_tag LOCUS_04960 9848 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 10217 10017 gene locus_tag LOCUS_04970 10217 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 10385 10248 gene locus_tag LOCUS_04980 10385 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10552 11670 gene locus_tag LOCUS_04990 10552 11670 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853516.1 protein_id gnl|my_center|LOCUS_04990 12284 11715 gene locus_tag LOCUS_05000 12284 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 12557 13501 gene locus_tag LOCUS_05010 gene lytR 12557 13501 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_05010 13781 15424 gene locus_tag LOCUS_05020 13781 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939127.1 protein_id gnl|my_center|LOCUS_05020 15417 18221 gene locus_tag LOCUS_05030 15417 18221 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227803.1 protein_id gnl|my_center|LOCUS_05030 19237 19049 gene locus_tag LOCUS_05040 19237 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 19617 19252 gene locus_tag LOCUS_05050 gene ssbB 19617 19252 CDS product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 protein_id gnl|my_center|LOCUS_05050 19885 20313 gene locus_tag LOCUS_05060 19885 20313 CDS product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789631.1 protein_id gnl|my_center|LOCUS_05060 20673 20497 gene locus_tag LOCUS_05070 20673 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 21068 20670 gene locus_tag LOCUS_05080 21068 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 21574 21260 gene locus_tag LOCUS_05090 21574 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 22430 22005 gene locus_tag LOCUS_05100 gene fabZ 22430 22005 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_05100 23848 23027 gene locus_tag LOCUS_05110 gene flhP 23848 23027 CDS product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 protein_id gnl|my_center|LOCUS_05110 24703 23870 gene locus_tag LOCUS_05120 gene flhO 24703 23870 CDS product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 protein_id gnl|my_center|LOCUS_05120 25778 24777 gene locus_tag LOCUS_05130 gene mbl 25778 24777 CDS product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 protein_id gnl|my_center|LOCUS_05130 26310 26053 gene locus_tag LOCUS_05140 gene spoIIID 26310 26053 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544012.1 protein_id gnl|my_center|LOCUS_05140 27889 26987 gene locus_tag LOCUS_05150 gene spoIIQ 27889 26987 CDS product stage II sporulation protein spoIIQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227751.1 protein_id gnl|my_center|LOCUS_05150 28402 28839 gene locus_tag LOCUS_05160 28402 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 29931 28903 gene locus_tag LOCUS_05170 gene spoIID 29931 28903 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_05170 31620 30310 gene locus_tag LOCUS_05180 gene murA 31620 30310 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_05180 32372 31653 gene locus_tag LOCUS_05190 32372 31653 CDS product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033689837.1 protein_id gnl|my_center|LOCUS_05190 32896 32660 gene locus_tag LOCUS_05200 32896 32660 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 protein_id gnl|my_center|LOCUS_05200 35118 33451 gene locus_tag LOCUS_05210 35118 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 35998 35594 gene locus_tag LOCUS_05220 gene atpC 35998 35594 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_05220 37442 36021 gene locus_tag LOCUS_05230 gene atpD 37442 36021 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227686.1 protein_id gnl|my_center|LOCUS_05230 38485 37628 gene locus_tag LOCUS_05240 gene atpG 38485 37628 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 protein_id gnl|my_center|LOCUS_05240 40120 38621 gene locus_tag LOCUS_05250 gene atpA 40120 38621 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 protein_id gnl|my_center|LOCUS_05250 40720 40184 gene locus_tag LOCUS_05260 gene atpH 40720 40184 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064678.1 protein_id gnl|my_center|LOCUS_05260 41235 40717 gene locus_tag LOCUS_05270 gene atpF 41235 40717 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_05270 41601 41389 gene locus_tag LOCUS_05280 gene atpE 41601 41389 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732517.1 protein_id gnl|my_center|LOCUS_05280 42159 41677 gene locus_tag LOCUS_05290 42159 41677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 42260 42394 gene locus_tag LOCUS_05300 42260 42394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 42795 42406 gene locus_tag LOCUS_05310 42795 42406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 43026 42802 gene locus_tag LOCUS_05320 43026 42802 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267372.1 protein_id gnl|my_center|LOCUS_05320 45550 43343 gene locus_tag LOCUS_05330 gene vpr 45550 43343 CDS product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 protein_id gnl|my_center|LOCUS_05330 46817 45675 gene locus_tag LOCUS_05340 gene wecB 46817 45675 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_05340 47468 46839 gene locus_tag LOCUS_05350 gene upp 47468 46839 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 protein_id gnl|my_center|LOCUS_05350 49567 48332 gene locus_tag LOCUS_05360 gene glyA 49567 48332 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 protein_id gnl|my_center|LOCUS_05360 50313 49738 gene locus_tag LOCUS_05370 50313 49738 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136374.1 protein_id gnl|my_center|LOCUS_05370 50982 50536 gene locus_tag LOCUS_05380 gene rpiB 50982 50536 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_05380 52628 51159 gene locus_tag LOCUS_05390 52628 51159 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250519.1 protein_id gnl|my_center|LOCUS_05390 53640 52675 gene locus_tag LOCUS_05400 53640 52675 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_05400 54923 53760 gene locus_tag LOCUS_05410 54923 53760 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528785.1 protein_id gnl|my_center|LOCUS_05410 55074 56270 gene locus_tag LOCUS_05420 gene cdaR 55074 56270 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095649.1 protein_id gnl|my_center|LOCUS_05420 56376 57566 gene locus_tag LOCUS_05430 56376 57566 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583442.1 protein_id gnl|my_center|LOCUS_05430 57550 59226 gene locus_tag LOCUS_05440 57550 59226 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925994.1 protein_id gnl|my_center|LOCUS_05440 59255 60754 gene locus_tag LOCUS_05450 59255 60754 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_05450 62635 61349 gene locus_tag LOCUS_05460 62635 61349 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410233.1 protein_id gnl|my_center|LOCUS_05460 63091 62657 gene locus_tag LOCUS_05470 gene prpB 63091 62657 CDS product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 protein_id gnl|my_center|LOCUS_05470 64162 63608 gene locus_tag LOCUS_05480 64162 63608 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_05480 65337 64288 gene locus_tag LOCUS_05490 65337 64288 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_05490 65965 65537 gene locus_tag LOCUS_05500 65965 65537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244265.1 protein_id gnl|my_center|LOCUS_05500 66932 66072 gene locus_tag LOCUS_05510 66932 66072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 67957 67085 gene locus_tag LOCUS_05520 gene prmC 67957 67085 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 protein_id gnl|my_center|LOCUS_05520 69027 67957 gene locus_tag LOCUS_05530 gene prfA 69027 67957 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_05530 69623 69189 gene locus_tag LOCUS_05540 69623 69189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 70294 69713 gene locus_tag LOCUS_05550 70294 69713 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280859.1 protein_id gnl|my_center|LOCUS_05550 70789 70589 gene locus_tag LOCUS_05560 gene rpmE 70789 70589 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_05560 72224 70938 gene locus_tag LOCUS_05570 gene rho 72224 70938 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 protein_id gnl|my_center|LOCUS_05570 73582 72617 gene locus_tag LOCUS_05580 gene glpX 73582 72617 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 protein_id gnl|my_center|LOCUS_05580 74963 73677 gene locus_tag LOCUS_05590 74963 73677 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_05590 76265 75615 gene locus_tag LOCUS_05600 gene fsa 76265 75615 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 protein_id gnl|my_center|LOCUS_05600 77550 76693 gene locus_tag LOCUS_05610 77550 76693 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 protein_id gnl|my_center|LOCUS_05610 78085 77711 gene locus_tag LOCUS_05620 gene spo0F 78085 77711 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 protein_id gnl|my_center|LOCUS_05620 78515 79039 gene locus_tag LOCUS_05630 78515 79039 CDS product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912418.1 protein_id gnl|my_center|LOCUS_05630 80881 79277 gene locus_tag LOCUS_05640 gene pyrG 80881 79277 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_05640 81608 81072 gene locus_tag LOCUS_05650 81608 81072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 82072 81905 gene locus_tag LOCUS_05660 82072 81905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 85526 82257 gene locus_tag LOCUS_05670 85526 82257 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 protein_id gnl|my_center|LOCUS_05670 86172 85519 gene locus_tag LOCUS_05680 86172 85519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238599.1 protein_id gnl|my_center|LOCUS_05680 87590 86451 gene locus_tag LOCUS_05690 gene acdA 87590 86451 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_05690 88739 87603 gene locus_tag LOCUS_05700 88739 87603 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011186.1 protein_id gnl|my_center|LOCUS_05700 89645 88794 gene locus_tag LOCUS_05710 89645 88794 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_05710 90891 89704 gene locus_tag LOCUS_05720 90891 89704 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_05720 93274 91151 gene locus_tag LOCUS_05730 93274 91151 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086758.1 protein_id gnl|my_center|LOCUS_05730 93566 94768 gene locus_tag LOCUS_05740 gene cls 93566 94768 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465731.1 protein_id gnl|my_center|LOCUS_05740 95322 95143 gene locus_tag LOCUS_05750 95322 95143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 97132 95459 gene locus_tag LOCUS_05760 gene argS 97132 95459 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_05760 97575 97126 gene locus_tag LOCUS_05770 97575 97126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 99169 98297 gene locus_tag LOCUS_05780 gene speB 99169 98297 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227545.1 protein_id gnl|my_center|LOCUS_05780 100013 99183 gene locus_tag LOCUS_05790 gene speE 100013 99183 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 protein_id gnl|my_center|LOCUS_05790 100239 102308 gene locus_tag LOCUS_05800 100239 102308 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_05800 103305 102805 gene locus_tag LOCUS_05810 103305 102805 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_05810 104045 103383 gene locus_tag LOCUS_05820 104045 103383 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 protein_id gnl|my_center|LOCUS_05820 104211 104399 gene locus_tag LOCUS_05830 104211 104399 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222038.1 protein_id gnl|my_center|LOCUS_05830 105157 104648 gene locus_tag LOCUS_05840 105157 104648 CDS product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 protein_id gnl|my_center|LOCUS_05840 106497 105199 gene locus_tag LOCUS_05850 106497 105199 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_05850 108190 106796 gene locus_tag LOCUS_05860 108190 106796 CDS product DUF4179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947918.1 protein_id gnl|my_center|LOCUS_05860 108750 108193 gene locus_tag LOCUS_05870 108750 108193 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_05870 109259 109035 gene locus_tag LOCUS_05880 109259 109035 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 protein_id gnl|my_center|LOCUS_05880 109689 110405 gene locus_tag LOCUS_05890 gene rsfA 109689 110405 CDS product prespore-specific transcription regulator RsfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243464.1 protein_id gnl|my_center|LOCUS_05890 111303 110461 gene locus_tag LOCUS_05900 111303 110461 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071929.1 protein_id gnl|my_center|LOCUS_05900 111546 112292 gene locus_tag LOCUS_05910 111546 112292 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287595.1 protein_id gnl|my_center|LOCUS_05910 112632 113054 gene locus_tag LOCUS_05920 gene cwlJ 112632 113054 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538169.1 protein_id gnl|my_center|LOCUS_05920 113159 113620 gene locus_tag LOCUS_05930 113159 113620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 114213 113845 gene locus_tag LOCUS_05940 114213 113845 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_05940 114514 114227 gene locus_tag LOCUS_05950 114514 114227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 114980 115846 gene locus_tag LOCUS_05960 gene speE 114980 115846 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943180.1 protein_id gnl|my_center|LOCUS_05960 116768 116088 gene locus_tag LOCUS_05970 116768 116088 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence005 180 644 gene locus_tag LOCUS_05980 180 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05980 717 1319 gene locus_tag LOCUS_05990 717 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05990 1327 1647 gene locus_tag LOCUS_06000 1327 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 1651 2139 gene locus_tag LOCUS_06010 1651 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2278 2748 gene locus_tag LOCUS_06020 2278 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06020 2913 3260 gene locus_tag LOCUS_06030 2913 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06030 3270 4052 gene locus_tag LOCUS_06040 3270 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5593 4286 gene locus_tag LOCUS_06050 5593 4286 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_06050 7199 5967 gene locus_tag LOCUS_06060 7199 5967 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231847.1 protein_id gnl|my_center|LOCUS_06060 7930 7352 gene locus_tag LOCUS_06070 gene pgsA 7930 7352 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_06070 8971 8063 gene locus_tag LOCUS_06080 8971 8063 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732284.1 protein_id gnl|my_center|LOCUS_06080 9778 8990 gene locus_tag LOCUS_06090 9778 8990 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_06090 10154 9897 gene locus_tag LOCUS_06100 10154 9897 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245199.1 protein_id gnl|my_center|LOCUS_06100 10967 10245 gene locus_tag LOCUS_06110 gene efpI 10967 10245 CDS product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 protein_id gnl|my_center|LOCUS_06110 12376 11087 gene locus_tag LOCUS_06120 12376 11087 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_06120 13653 12379 gene locus_tag LOCUS_06130 13653 12379 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_06130 14505 13933 gene locus_tag LOCUS_06140 14505 13933 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214821.1 protein_id gnl|my_center|LOCUS_06140 15301 14525 gene locus_tag LOCUS_06150 gene cobA 15301 14525 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521262.1 protein_id gnl|my_center|LOCUS_06150 16734 15349 gene locus_tag LOCUS_06160 16734 15349 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_06160 17893 16763 gene locus_tag LOCUS_06170 17893 16763 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 protein_id gnl|my_center|LOCUS_06170 18669 17890 gene locus_tag LOCUS_06180 gene cobM 18669 17890 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_06180 19367 18666 gene locus_tag LOCUS_06190 gene cobI 19367 18666 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_06190 20578 19367 gene locus_tag LOCUS_06200 20578 19367 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649057.1 protein_id gnl|my_center|LOCUS_06200 21674 20571 gene locus_tag LOCUS_06210 21674 20571 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631402.1 protein_id gnl|my_center|LOCUS_06210 22327 21680 gene locus_tag LOCUS_06220 22327 21680 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_06220 23184 22417 gene locus_tag LOCUS_06230 gene cobK 23184 22417 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_06230 24068 23181 gene locus_tag LOCUS_06240 24068 23181 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_06240 25742 24159 gene locus_tag LOCUS_06250 25742 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 26236 25739 gene locus_tag LOCUS_06260 26236 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 26968 27723 gene locus_tag LOCUS_06270 26968 27723 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108306299.1 protein_id gnl|my_center|LOCUS_06270 27727 28017 gene locus_tag LOCUS_06280 27727 28017 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895390.1 protein_id gnl|my_center|LOCUS_06280 28014 28790 gene locus_tag LOCUS_06290 gene cbiQ 28014 28790 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_06290 28898 29626 gene locus_tag LOCUS_06300 28898 29626 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_06300 30474 29734 gene locus_tag LOCUS_06310 30474 29734 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114176.1 protein_id gnl|my_center|LOCUS_06310 33167 30855 gene locus_tag LOCUS_06320 gene spoIIIE 33167 30855 CDS product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 protein_id gnl|my_center|LOCUS_06320 33617 33405 gene locus_tag LOCUS_06330 gene tepJ 33617 33405 CDS product TepA modulator TepJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231871.1 protein_id gnl|my_center|LOCUS_06330 34360 33614 gene locus_tag LOCUS_06340 gene tepA 34360 33614 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_06340 36331 34664 gene locus_tag LOCUS_06350 36331 34664 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721939.1 protein_id gnl|my_center|LOCUS_06350 37595 36723 gene locus_tag LOCUS_06360 gene dapA 37595 36723 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_06360 38856 37615 gene locus_tag LOCUS_06370 gene dapG 38856 37615 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 protein_id gnl|my_center|LOCUS_06370 40015 38963 gene locus_tag LOCUS_06380 gene asd 40015 38963 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 protein_id gnl|my_center|LOCUS_06380 41066 40467 gene locus_tag LOCUS_06390 gene dpaB 41066 40467 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053596.1 protein_id gnl|my_center|LOCUS_06390 41968 41063 gene locus_tag LOCUS_06400 gene dpaA 41968 41063 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954724.1 protein_id gnl|my_center|LOCUS_06400 42514 42278 gene locus_tag LOCUS_06410 42514 42278 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231890.1 protein_id gnl|my_center|LOCUS_06410 43899 42664 gene locus_tag LOCUS_06420 43899 42664 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_06420 44916 43933 gene locus_tag LOCUS_06430 44916 43933 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868217.1 protein_id gnl|my_center|LOCUS_06430 47373 45244 gene locus_tag LOCUS_06440 gene pnp 47373 45244 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_06440 47870 47601 gene locus_tag LOCUS_06450 gene rpsO 47870 47601 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 protein_id gnl|my_center|LOCUS_06450 48950 48000 gene locus_tag LOCUS_06460 gene ribF 48950 48000 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 protein_id gnl|my_center|LOCUS_06460 49875 48973 gene locus_tag LOCUS_06470 gene truB 49875 48973 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_06470 50474 50127 gene locus_tag LOCUS_06480 gene rbfA 50474 50127 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_06480 50768 50490 gene locus_tag LOCUS_06490 50768 50490 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 protein_id gnl|my_center|LOCUS_06490 52864 50765 gene locus_tag LOCUS_06500 gene infB 52864 50765 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036343.1 protein_id gnl|my_center|LOCUS_06500 53186 52878 gene locus_tag LOCUS_06510 53186 52878 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 protein_id gnl|my_center|LOCUS_06510 53466 53191 gene locus_tag LOCUS_06520 gene rulR 53466 53191 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_06520 54619 53480 gene locus_tag LOCUS_06530 gene nusA 54619 53480 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_06530 55344 54874 gene locus_tag LOCUS_06540 gene rimP 55344 54874 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359097.1 protein_id gnl|my_center|LOCUS_06540 59804 55524 gene locus_tag LOCUS_06550 59804 55524 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_06550 61731 60025 gene locus_tag LOCUS_06560 gene proS 61731 60025 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 protein_id gnl|my_center|LOCUS_06560 63086 61824 gene locus_tag LOCUS_06570 gene rseP 63086 61824 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 protein_id gnl|my_center|LOCUS_06570 64353 63211 gene locus_tag LOCUS_06580 gene dxr 64353 63211 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 protein_id gnl|my_center|LOCUS_06580 65167 64385 gene locus_tag LOCUS_06590 gene cdsA 65167 64385 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 protein_id gnl|my_center|LOCUS_06590 65960 65187 gene locus_tag LOCUS_06600 gene uppS 65960 65187 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971296.1 protein_id gnl|my_center|LOCUS_06600 66729 66172 gene locus_tag LOCUS_06610 gene frr 66729 66172 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_06610 67454 66729 gene locus_tag LOCUS_06620 gene pyrH 67454 66729 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 protein_id gnl|my_center|LOCUS_06620 68584 67703 gene locus_tag LOCUS_06630 gene tsf 68584 67703 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018578.1 protein_id gnl|my_center|LOCUS_06630 69404 68694 gene locus_tag LOCUS_06640 gene rpsB 69404 68694 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_06640 70124 69558 gene locus_tag LOCUS_06650 gene swrB 70124 69558 CDS product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 protein_id gnl|my_center|LOCUS_06650 70445 70134 gene locus_tag LOCUS_06660 70445 70134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 71230 70460 gene locus_tag LOCUS_06670 gene sigD 71230 70460 CDS product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 protein_id gnl|my_center|LOCUS_06670 71750 71397 gene locus_tag LOCUS_06680 71750 71397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 72247 71750 gene locus_tag LOCUS_06690 gene cheD 72247 71750 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_06690 72881 72240 gene locus_tag LOCUS_06700 gene cheC 72881 72240 CDS product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 protein_id gnl|my_center|LOCUS_06700 73335 72898 gene locus_tag LOCUS_06710 73335 72898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 75429 73360 gene locus_tag LOCUS_06720 gene cheA 75429 73360 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_06720 76532 75447 gene locus_tag LOCUS_06730 gene cheB 76532 75447 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_06730 77402 76539 gene locus_tag LOCUS_06740 gene flhG 77402 76539 CDS product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 protein_id gnl|my_center|LOCUS_06740 78550 77399 gene locus_tag LOCUS_06750 gene flhF 78550 77399 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 protein_id gnl|my_center|LOCUS_06750 80583 78547 gene locus_tag LOCUS_06760 gene flhA 80583 78547 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_06760 81695 80613 gene locus_tag LOCUS_06770 gene flhB 81695 80613 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_06770 82473 81697 gene locus_tag LOCUS_06780 gene fliR 82473 81697 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_06780 82744 82475 gene locus_tag LOCUS_06790 gene fliQ 82744 82475 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_06790 83422 82754 gene locus_tag LOCUS_06800 gene fliP 83422 82754 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_06800 84101 83415 gene locus_tag LOCUS_06810 84101 83415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 84483 84118 gene locus_tag LOCUS_06820 gene cheY 84483 84118 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_06820 85781 84507 gene locus_tag LOCUS_06830 gene fliY 85781 84507 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_06830 86772 85771 gene locus_tag LOCUS_06840 gene fliM 86772 85771 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_06840 87246 86806 gene locus_tag LOCUS_06850 gene fliL 87246 86806 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 protein_id gnl|my_center|LOCUS_06850 87457 87236 gene locus_tag LOCUS_06860 gene swrD 87457 87236 CDS product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 protein_id gnl|my_center|LOCUS_06860 88826 87585 gene locus_tag LOCUS_06870 gene flgE 88826 87585 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657723.1 protein_id gnl|my_center|LOCUS_06870 89580 88939 gene locus_tag LOCUS_06880 89580 88939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 90869 89589 gene locus_tag LOCUS_06890 90869 89589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 91526 90909 gene locus_tag LOCUS_06900 91526 90909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 91979 91536 gene locus_tag LOCUS_06910 gene fliJ 91979 91536 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231977.1 protein_id gnl|my_center|LOCUS_06910 93307 91976 gene locus_tag LOCUS_06920 gene fliI 93307 91976 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 protein_id gnl|my_center|LOCUS_06920 94077 93304 gene locus_tag LOCUS_06930 94077 93304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 95083 94070 gene locus_tag LOCUS_06940 gene fliG 95083 94070 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_06940 96691 95096 gene locus_tag LOCUS_06950 gene fliF 96691 95096 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 protein_id gnl|my_center|LOCUS_06950 97049 96738 gene locus_tag LOCUS_06960 gene fliE 97049 96738 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 protein_id gnl|my_center|LOCUS_06960 97525 97064 gene locus_tag LOCUS_06970 gene flgC 97525 97064 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_06970 97926 97528 gene locus_tag LOCUS_06980 gene flgB 97926 97528 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 protein_id gnl|my_center|LOCUS_06980 99086 98307 gene locus_tag LOCUS_06990 gene codY 99086 98307 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 protein_id gnl|my_center|LOCUS_06990 100527 99118 gene locus_tag LOCUS_07000 gene hslU 100527 99118 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_07000 101084 100545 gene locus_tag LOCUS_07010 gene clpQ 101084 100545 CDS product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 protein_id gnl|my_center|LOCUS_07010 102007 101105 gene locus_tag LOCUS_07020 gene xerC 102007 101105 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 protein_id gnl|my_center|LOCUS_07020 103375 102071 gene locus_tag LOCUS_07030 gene trmFO 103375 102071 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_07030 105773 103698 gene locus_tag LOCUS_07040 gene topA 105773 103698 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_07040 107004 106132 gene locus_tag LOCUS_07050 gene dprA 107004 106132 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818060.1 protein_id gnl|my_center|LOCUS_07050 108057 107155 gene locus_tag LOCUS_07060 gene sucD 108057 107155 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_07060 109236 108076 gene locus_tag LOCUS_07070 gene sucC 109236 108076 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_07070 109681 109406 gene locus_tag LOCUS_07080 109681 109406 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919773.1 protein_id gnl|my_center|LOCUS_07080 111531 109678 gene locus_tag LOCUS_07090 111531 109678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 113232 113077 gene locus_tag LOCUS_07100 113232 113077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 113896 113234 gene locus_tag LOCUS_07110 113896 113234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963642.1 protein_id gnl|my_center|LOCUS_07110 115113 113893 gene locus_tag LOCUS_07120 115113 113893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 115546 115100 gene locus_tag LOCUS_07130 115546 115100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence006 1154 159 gene locus_tag LOCUS_07140 gene bioB 1154 159 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 protein_id gnl|my_center|LOCUS_07140 1779 1174 gene locus_tag LOCUS_07150 1779 1174 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252167.1 protein_id gnl|my_center|LOCUS_07150 2246 2094 gene locus_tag LOCUS_07160 2246 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4262 2262 gene locus_tag LOCUS_07170 gene feoB 4262 2262 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_07170 4486 4259 gene locus_tag LOCUS_07180 4486 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4728 5015 gene locus_tag LOCUS_07190 4728 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5049 5816 gene locus_tag LOCUS_07200 5049 5816 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722505.1 protein_id gnl|my_center|LOCUS_07200 6027 6677 gene locus_tag LOCUS_07210 6027 6677 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242630.1 protein_id gnl|my_center|LOCUS_07210 6670 7842 gene locus_tag LOCUS_07220 6670 7842 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723133.1 protein_id gnl|my_center|LOCUS_07220 9200 7881 gene locus_tag LOCUS_07230 gene brnQ 9200 7881 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099166.1 protein_id gnl|my_center|LOCUS_07230 10315 9884 gene locus_tag LOCUS_07240 gene rok 10315 9884 CDS product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 protein_id gnl|my_center|LOCUS_07240 10828 10619 gene locus_tag LOCUS_07250 10828 10619 CDS product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231245.1 protein_id gnl|my_center|LOCUS_07250 12295 10844 gene locus_tag LOCUS_07260 12295 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 13216 12491 gene locus_tag LOCUS_07270 13216 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 14351 13236 gene locus_tag LOCUS_07280 14351 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 14671 14802 gene locus_tag LOCUS_07290 14671 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 14999 14862 gene locus_tag LOCUS_07300 14999 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 15877 15245 gene locus_tag LOCUS_07310 15877 15245 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598707.1 protein_id gnl|my_center|LOCUS_07310 16887 15895 gene locus_tag LOCUS_07320 16887 15895 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744337.1 protein_id gnl|my_center|LOCUS_07320 17609 16902 gene locus_tag LOCUS_07330 gene liaF 17609 16902 CDS product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716089.1 protein_id gnl|my_center|LOCUS_07330 18386 17733 gene locus_tag LOCUS_07340 18386 17733 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814124.1 protein_id gnl|my_center|LOCUS_07340 18747 18400 gene locus_tag LOCUS_07350 18747 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 19223 18900 gene locus_tag LOCUS_07360 19223 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 19436 19254 gene locus_tag LOCUS_07370 19436 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180555.1 protein_id gnl|my_center|LOCUS_07370 20834 19599 gene locus_tag LOCUS_07380 gene odhB 20834 19599 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399364.1 protein_id gnl|my_center|LOCUS_07380 23726 20883 gene locus_tag LOCUS_07390 gene sucA 23726 20883 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 protein_id gnl|my_center|LOCUS_07390 24279 24749 gene locus_tag LOCUS_07400 24279 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 25649 24834 gene locus_tag LOCUS_07410 25649 24834 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_07410 26730 25945 gene locus_tag LOCUS_07420 gene trpA 26730 25945 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537932.1 protein_id gnl|my_center|LOCUS_07420 27929 26727 gene locus_tag LOCUS_07430 gene trpB 27929 26727 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 protein_id gnl|my_center|LOCUS_07430 28540 27926 gene locus_tag LOCUS_07440 28540 27926 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865141.1 protein_id gnl|my_center|LOCUS_07440 29326 28550 gene locus_tag LOCUS_07450 gene trpC 29326 28550 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536690.1 protein_id gnl|my_center|LOCUS_07450 30934 29327 gene locus_tag LOCUS_07460 30934 29327 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_07460 32328 30931 gene locus_tag LOCUS_07470 gene trpE 32328 30931 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269846.1 protein_id gnl|my_center|LOCUS_07470 33296 34510 gene locus_tag LOCUS_07480 gene pdeH 33296 34510 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 protein_id gnl|my_center|LOCUS_07480 36010 34571 gene locus_tag LOCUS_07490 gene panF 36010 34571 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104834.1 protein_id gnl|my_center|LOCUS_07490 36282 36007 gene locus_tag LOCUS_07500 36282 36007 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800721.1 protein_id gnl|my_center|LOCUS_07500 37165 36407 gene locus_tag LOCUS_07510 37165 36407 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228381.1 protein_id gnl|my_center|LOCUS_07510 38199 37342 gene locus_tag LOCUS_07520 38199 37342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 39654 38725 gene locus_tag LOCUS_07530 gene thrB 39654 38725 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 protein_id gnl|my_center|LOCUS_07530 40712 39651 gene locus_tag LOCUS_07540 gene thrC 40712 39651 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 protein_id gnl|my_center|LOCUS_07540 42010 40709 gene locus_tag LOCUS_07550 42010 40709 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659109.1 protein_id gnl|my_center|LOCUS_07550 42747 42457 gene locus_tag LOCUS_07560 42747 42457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 44305 42698 gene locus_tag LOCUS_07570 gene asnB 44305 42698 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_07570 45976 44921 gene locus_tag LOCUS_07580 45976 44921 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134908.1 protein_id gnl|my_center|LOCUS_07580 46825 46214 gene locus_tag LOCUS_07590 46825 46214 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 protein_id gnl|my_center|LOCUS_07590 47105 47824 gene locus_tag LOCUS_07600 47105 47824 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461356.1 protein_id gnl|my_center|LOCUS_07600 47800 49011 gene locus_tag LOCUS_07610 47800 49011 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 protein_id gnl|my_center|LOCUS_07610 49613 49419 gene locus_tag LOCUS_07620 49613 49419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006464.1 protein_id gnl|my_center|LOCUS_07620 50098 51492 gene locus_tag LOCUS_07630 50098 51492 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860348.1 protein_id gnl|my_center|LOCUS_07630 51804 52817 gene locus_tag LOCUS_07640 gene adhP 51804 52817 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_07640 52979 54496 gene locus_tag LOCUS_07650 52979 54496 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_07650 54514 54861 gene locus_tag LOCUS_07660 54514 54861 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_07660 56357 54903 gene locus_tag LOCUS_07670 56357 54903 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_07670 58036 56375 gene locus_tag LOCUS_07680 58036 56375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07680 59187 58039 gene locus_tag LOCUS_07690 59187 58039 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_07690 61607 59424 gene locus_tag LOCUS_07700 61607 59424 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763731.1 protein_id gnl|my_center|LOCUS_07700 62658 62326 gene locus_tag LOCUS_07710 62658 62326 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 protein_id gnl|my_center|LOCUS_07710 64236 63052 gene locus_tag LOCUS_07720 64236 63052 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_07720 66173 64800 gene locus_tag LOCUS_07730 66173 64800 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 protein_id gnl|my_center|LOCUS_07730 66714 66514 gene locus_tag LOCUS_07740 gene cspD 66714 66514 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_07740 67616 67122 gene locus_tag LOCUS_07750 67616 67122 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617568.1 protein_id gnl|my_center|LOCUS_07750 68667 68032 gene locus_tag LOCUS_07760 gene thiE 68667 68032 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_07760 69463 68648 gene locus_tag LOCUS_07770 gene thiM 69463 68648 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393513.1 protein_id gnl|my_center|LOCUS_07770 70290 69487 gene locus_tag LOCUS_07780 gene thiD 70290 69487 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_07780 70780 70259 gene locus_tag LOCUS_07790 gene thiW 70780 70259 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842277.1 protein_id gnl|my_center|LOCUS_07790 71704 71030 gene locus_tag LOCUS_07800 71704 71030 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 protein_id gnl|my_center|LOCUS_07800 72592 71756 gene locus_tag LOCUS_07810 72592 71756 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_07810 72744 74570 gene locus_tag LOCUS_07820 72744 74570 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886495.1 protein_id gnl|my_center|LOCUS_07820 75072 74605 gene locus_tag LOCUS_07830 gene ribH 75072 74605 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 protein_id gnl|my_center|LOCUS_07830 76281 75085 gene locus_tag LOCUS_07840 gene ribBA 76281 75085 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469013.1 protein_id gnl|my_center|LOCUS_07840 77003 76356 gene locus_tag LOCUS_07850 gene ribE 77003 76356 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493929.1 protein_id gnl|my_center|LOCUS_07850 78104 77010 gene locus_tag LOCUS_07860 gene ribD 78104 77010 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131960.1 protein_id gnl|my_center|LOCUS_07860 79047 79229 gene locus_tag LOCUS_07870 79047 79229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 80014 79727 gene locus_tag LOCUS_07880 80014 79727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 80554 80967 gene locus_tag LOCUS_07890 80554 80967 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_07890 81117 81497 gene locus_tag LOCUS_07900 81117 81497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 82073 82855 gene locus_tag LOCUS_07910 82073 82855 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_07910 82874 83470 gene locus_tag LOCUS_07920 82874 83470 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231529.1 protein_id gnl|my_center|LOCUS_07920 83834 84391 gene locus_tag LOCUS_07930 83834 84391 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914737.1 protein_id gnl|my_center|LOCUS_07930 84651 86009 gene locus_tag LOCUS_07940 84651 86009 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 protein_id gnl|my_center|LOCUS_07940 87387 86074 gene locus_tag LOCUS_07950 87387 86074 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454128.1 protein_id gnl|my_center|LOCUS_07950 88380 87601 gene locus_tag LOCUS_07960 88380 87601 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054921.1 protein_id gnl|my_center|LOCUS_07960 89497 88733 gene locus_tag LOCUS_07970 89497 88733 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747596.1 protein_id gnl|my_center|LOCUS_07970 90158 89889 gene locus_tag LOCUS_07980 90158 89889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 91852 90242 gene locus_tag LOCUS_07990 91852 90242 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_07990 92354 91938 gene locus_tag LOCUS_08000 92354 91938 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398634.1 protein_id gnl|my_center|LOCUS_08000 93391 92471 gene locus_tag LOCUS_08010 93391 92471 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044939.1 protein_id gnl|my_center|LOCUS_08010 94938 93472 gene locus_tag LOCUS_08020 94938 93472 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733072.1 protein_id gnl|my_center|LOCUS_08020 95325 95122 gene locus_tag LOCUS_08030 gene copZ 95325 95122 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_08030 97752 95356 gene locus_tag LOCUS_08040 97752 95356 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 protein_id gnl|my_center|LOCUS_08040 98097 97795 gene locus_tag LOCUS_08050 98097 97795 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 protein_id gnl|my_center|LOCUS_08050 98977 98207 gene locus_tag LOCUS_08060 gene ldcB 98977 98207 CDS product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 protein_id gnl|my_center|LOCUS_08060 99825 99121 gene locus_tag LOCUS_08070 gene deoD 99825 99121 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_08070 99950 100072 gene locus_tag LOCUS_08080 99950 100072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 100085 100231 gene locus_tag LOCUS_08090 100085 100231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231174.1 protein_id gnl|my_center|LOCUS_08090 100913 100599 gene locus_tag LOCUS_08100 100913 100599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 101125 100877 gene locus_tag LOCUS_08110 101125 100877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 101816 101046 gene locus_tag LOCUS_08120 101816 101046 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486596.1 protein_id gnl|my_center|LOCUS_08120 102194 102018 gene locus_tag LOCUS_08130 102194 102018 CDS product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231166.1 protein_id gnl|my_center|LOCUS_08130 102914 102255 gene locus_tag LOCUS_08140 102914 102255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101489.1 protein_id gnl|my_center|LOCUS_08140 103417 103193 gene locus_tag LOCUS_08150 103417 103193 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 protein_id gnl|my_center|LOCUS_08150 103650 104387 gene locus_tag LOCUS_08160 103650 104387 CDS product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986895.1 protein_id gnl|my_center|LOCUS_08160 105110 104526 gene locus_tag LOCUS_08170 105110 104526 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732075.1 protein_id gnl|my_center|LOCUS_08170 105869 105132 gene locus_tag LOCUS_08180 105869 105132 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245956.1 protein_id gnl|my_center|LOCUS_08180 106229 106762 gene locus_tag LOCUS_08190 106229 106762 CDS product PCYCGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761013.1 protein_id gnl|my_center|LOCUS_08190 107659 106817 gene locus_tag LOCUS_08200 107659 106817 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_08200 108093 107842 gene locus_tag LOCUS_08210 108093 107842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 109010 108216 gene locus_tag LOCUS_08220 109010 108216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_08220 110004 108985 gene locus_tag LOCUS_08230 110004 108985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_08230 111074 110073 gene locus_tag LOCUS_08240 111074 110073 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_08240 111563 111375 gene locus_tag LOCUS_08250 111563 111375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 112068 111916 gene locus_tag LOCUS_08260 112068 111916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence007 658 3687 gene locus_tag LOCUS_08270 658 3687 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_08270 5468 3783 gene locus_tag LOCUS_08280 5468 3783 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231425.1 protein_id gnl|my_center|LOCUS_08280 5736 6992 gene locus_tag LOCUS_08290 5736 6992 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 protein_id gnl|my_center|LOCUS_08290 7776 7069 gene locus_tag LOCUS_08300 7776 7069 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_08300 9707 7842 gene locus_tag LOCUS_08310 9707 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11365 10088 gene locus_tag LOCUS_08320 11365 10088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_08320 12549 11860 gene locus_tag LOCUS_08330 12549 11860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286060.1 protein_id gnl|my_center|LOCUS_08330 13619 12552 gene locus_tag LOCUS_08340 13619 12552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477931.1 protein_id gnl|my_center|LOCUS_08340 14265 13759 gene locus_tag LOCUS_08350 14265 13759 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464974.1 protein_id gnl|my_center|LOCUS_08350 15026 16546 gene locus_tag LOCUS_08360 15026 16546 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_08360 16566 16928 gene locus_tag LOCUS_08370 16566 16928 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_08370 18382 17150 gene locus_tag LOCUS_08380 18382 17150 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269258.1 protein_id gnl|my_center|LOCUS_08380 19134 18664 gene locus_tag LOCUS_08390 19134 18664 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842896.1 protein_id gnl|my_center|LOCUS_08390 19276 19079 gene locus_tag LOCUS_08400 19276 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 20840 19365 gene locus_tag LOCUS_08410 20840 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 21185 22063 gene locus_tag LOCUS_08420 21185 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 22159 22983 gene locus_tag LOCUS_08430 22159 22983 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965644.1 protein_id gnl|my_center|LOCUS_08430 24397 23114 gene locus_tag LOCUS_08440 gene cgeD 24397 23114 CDS product spore maturation glycosyltransferase CgeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230828.1 protein_id gnl|my_center|LOCUS_08440 24953 24495 gene locus_tag LOCUS_08450 24953 24495 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_08450 25792 24950 gene locus_tag LOCUS_08460 gene rfbD 25792 24950 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_08460 26756 25806 gene locus_tag LOCUS_08470 gene rfbB 26756 25806 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062109482.1 protein_id gnl|my_center|LOCUS_08470 27493 26738 gene locus_tag LOCUS_08480 27493 26738 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243368.1 protein_id gnl|my_center|LOCUS_08480 28974 27703 gene locus_tag LOCUS_08490 28974 27703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 30228 29011 gene locus_tag LOCUS_08500 30228 29011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 30469 31707 gene locus_tag LOCUS_08510 30469 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 31917 32855 gene locus_tag LOCUS_08520 31917 32855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102569.1 protein_id gnl|my_center|LOCUS_08520 34291 33002 gene locus_tag LOCUS_08530 34291 33002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 38399 34281 gene locus_tag LOCUS_08540 38399 34281 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_08540 39562 38399 gene locus_tag LOCUS_08550 39562 38399 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_08550 41059 39563 gene locus_tag LOCUS_08560 41059 39563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 42369 41422 gene locus_tag LOCUS_08570 42369 41422 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802592.1 protein_id gnl|my_center|LOCUS_08570 42490 43362 gene locus_tag LOCUS_08580 42490 43362 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_08580 43696 43448 gene locus_tag LOCUS_08590 43696 43448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 44570 43884 gene locus_tag LOCUS_08600 44570 43884 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875893.1 protein_id gnl|my_center|LOCUS_08600 45439 44567 gene locus_tag LOCUS_08610 45439 44567 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242677.1 protein_id gnl|my_center|LOCUS_08610 45650 46483 gene locus_tag LOCUS_08620 45650 46483 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248042.1 protein_id gnl|my_center|LOCUS_08620 46823 47437 gene locus_tag LOCUS_08630 46823 47437 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243118.1 protein_id gnl|my_center|LOCUS_08630 48054 47494 gene locus_tag LOCUS_08640 48054 47494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 49341 48580 gene locus_tag LOCUS_08650 49341 48580 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_08650 49898 52228 gene locus_tag LOCUS_08660 49898 52228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 53383 52439 gene locus_tag LOCUS_08670 53383 52439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 54067 53690 gene locus_tag LOCUS_08680 54067 53690 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892190.1 protein_id gnl|my_center|LOCUS_08680 55119 56351 gene locus_tag LOCUS_08690 gene sstT 55119 56351 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_08690 58368 56851 gene locus_tag LOCUS_08700 58368 56851 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 protein_id gnl|my_center|LOCUS_08700 59136 60743 gene locus_tag LOCUS_08710 gene phoD 59136 60743 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_08710 61719 61303 gene locus_tag LOCUS_08720 61719 61303 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_08720 62402 61722 gene locus_tag LOCUS_08730 gene bdbD 62402 61722 CDS product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 protein_id gnl|my_center|LOCUS_08730 63438 62584 gene locus_tag LOCUS_08740 63438 62584 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_08740 64788 64087 gene locus_tag LOCUS_08750 64788 64087 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439430.1 protein_id gnl|my_center|LOCUS_08750 67489 64781 gene locus_tag LOCUS_08760 67489 64781 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990039.1 protein_id gnl|my_center|LOCUS_08760 67861 69558 gene locus_tag LOCUS_08770 gene kdpA 67861 69558 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_08770 69574 71640 gene locus_tag LOCUS_08780 gene kdpB 69574 71640 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966942.1 protein_id gnl|my_center|LOCUS_08780 71654 72292 gene locus_tag LOCUS_08790 71654 72292 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896752.1 protein_id gnl|my_center|LOCUS_08790 72308 72556 gene locus_tag LOCUS_08800 72308 72556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 72866 72615 gene locus_tag LOCUS_08810 gene copZ 72866 72615 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436973.1 protein_id gnl|my_center|LOCUS_08810 73624 73346 gene locus_tag LOCUS_08820 73624 73346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 76100 73641 gene locus_tag LOCUS_08830 76100 73641 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_08830 76802 76347 gene locus_tag LOCUS_08840 76802 76347 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103844.1 protein_id gnl|my_center|LOCUS_08840 78621 77107 gene locus_tag LOCUS_08850 78621 77107 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437604.1 protein_id gnl|my_center|LOCUS_08850 79715 78672 gene locus_tag LOCUS_08860 79715 78672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 80374 79712 gene locus_tag LOCUS_08870 80374 79712 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404711.1 protein_id gnl|my_center|LOCUS_08870 80650 81417 gene locus_tag LOCUS_08880 80650 81417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 82809 81601 gene locus_tag LOCUS_08890 82809 81601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591668.1 protein_id gnl|my_center|LOCUS_08890 83920 83393 gene locus_tag LOCUS_08900 83920 83393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 85060 84281 gene locus_tag LOCUS_08910 85060 84281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 86960 85830 gene locus_tag LOCUS_08920 86960 85830 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_08920 87651 86950 gene locus_tag LOCUS_08930 gene vanR 87651 86950 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_08930 87989 87777 gene locus_tag LOCUS_08940 87989 87777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 88149 88844 gene locus_tag LOCUS_08950 88149 88844 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822492.1 protein_id gnl|my_center|LOCUS_08950 88894 89943 gene locus_tag LOCUS_08960 88894 89943 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_08960 90057 90935 gene locus_tag LOCUS_08970 90057 90935 CDS product D-Ala-D-Ala carboxypeptidase VanY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759406.1 protein_id gnl|my_center|LOCUS_08970 91899 91099 gene locus_tag LOCUS_08980 91899 91099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 92480 91878 gene locus_tag LOCUS_08990 92480 91878 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036618527.1 protein_id gnl|my_center|LOCUS_08990 94706 93654 gene locus_tag LOCUS_09000 94706 93654 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972097.1 protein_id gnl|my_center|LOCUS_09000 95652 94933 gene locus_tag LOCUS_09010 95652 94933 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_09010 96322 95945 gene locus_tag LOCUS_09020 96322 95945 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067590925.1 protein_id gnl|my_center|LOCUS_09020 96822 96577 gene locus_tag LOCUS_09030 96822 96577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 97178 97786 gene locus_tag LOCUS_09040 97178 97786 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 protein_id gnl|my_center|LOCUS_09040 97786 98457 gene locus_tag LOCUS_09050 97786 98457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 99435 98725 gene locus_tag LOCUS_09060 99435 98725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144450.1 protein_id gnl|my_center|LOCUS_09060 100280 99432 gene locus_tag LOCUS_09070 100280 99432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170865.1 protein_id gnl|my_center|LOCUS_09070 101504 100446 gene locus_tag LOCUS_09080 101504 100446 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185912.1 protein_id gnl|my_center|LOCUS_09080 102214 102035 gene locus_tag LOCUS_09090 102214 102035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09090 102509 102282 gene locus_tag LOCUS_09100 102509 102282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 102867 103622 gene locus_tag LOCUS_09110 102867 103622 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979024.1 protein_id gnl|my_center|LOCUS_09110 104148 103999 gene locus_tag LOCUS_09120 104148 103999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 104506 104333 gene locus_tag LOCUS_09130 104506 104333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09130 105185 105484 gene locus_tag LOCUS_09140 105185 105484 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_09140 105489 105824 gene locus_tag LOCUS_09150 105489 105824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence008 261 1397 gene locus_tag LOCUS_09160 261 1397 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105815.1 protein_id gnl|my_center|LOCUS_09160 3617 1506 gene locus_tag LOCUS_09170 3617 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4219 3617 gene locus_tag LOCUS_09180 4219 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4676 4161 gene locus_tag LOCUS_09190 4676 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4898 6388 gene locus_tag LOCUS_09200 4898 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6481 7185 gene locus_tag LOCUS_09210 6481 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 7206 8492 gene locus_tag LOCUS_09220 7206 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 8621 10279 gene locus_tag LOCUS_09230 8621 10279 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_09230 10286 11341 gene locus_tag LOCUS_09240 10286 11341 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_09240 11328 12539 gene locus_tag LOCUS_09250 11328 12539 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_09250 12644 13090 gene locus_tag LOCUS_09260 12644 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 13240 13845 gene locus_tag LOCUS_09270 13240 13845 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886586.1 protein_id gnl|my_center|LOCUS_09270 13885 14829 gene locus_tag LOCUS_09280 13885 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 14834 15475 gene locus_tag LOCUS_09290 14834 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 15472 16155 gene locus_tag LOCUS_09300 15472 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 16182 16370 gene locus_tag LOCUS_09310 16182 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 16542 17540 gene locus_tag LOCUS_09320 16542 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 17830 18423 gene locus_tag LOCUS_09330 17830 18423 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_09330 18443 18940 gene locus_tag LOCUS_09340 18443 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 19906 20118 gene locus_tag LOCUS_09350 19906 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09350 20853 22595 gene locus_tag LOCUS_09360 20853 22595 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272172.1 protein_id gnl|my_center|LOCUS_09360 23112 24125 gene locus_tag LOCUS_09370 gene mreB 23112 24125 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 protein_id gnl|my_center|LOCUS_09370 24240 25139 gene locus_tag LOCUS_09380 gene mreC 24240 25139 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_09380 25136 25654 gene locus_tag LOCUS_09390 gene mreD 25136 25654 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398811.1 protein_id gnl|my_center|LOCUS_09390 25703 26431 gene locus_tag LOCUS_09400 gene minC 25703 26431 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391517.1 protein_id gnl|my_center|LOCUS_09400 26424 27233 gene locus_tag LOCUS_09410 gene minD 26424 27233 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 protein_id gnl|my_center|LOCUS_09410 27401 28174 gene locus_tag LOCUS_09420 gene spoIVFA 27401 28174 CDS product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797463.1 protein_id gnl|my_center|LOCUS_09420 28227 29033 gene locus_tag LOCUS_09430 gene spoIVFB 28227 29033 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599058.1 protein_id gnl|my_center|LOCUS_09430 29206 30663 gene locus_tag LOCUS_09440 29206 30663 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173058485.1 protein_id gnl|my_center|LOCUS_09440 30819 31127 gene locus_tag LOCUS_09450 gene rplU 30819 31127 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_09450 31140 31472 gene locus_tag LOCUS_09460 31140 31472 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 protein_id gnl|my_center|LOCUS_09460 31485 31775 gene locus_tag LOCUS_09470 gene rpmA 31485 31775 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_09470 32286 32840 gene locus_tag LOCUS_09480 32286 32840 CDS product sporulation initiation phosphotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003584.1 protein_id gnl|my_center|LOCUS_09480 32931 34220 gene locus_tag LOCUS_09490 gene obgE 32931 34220 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_09490 34289 34744 gene locus_tag LOCUS_09500 gene thrR 34289 34744 CDS product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 protein_id gnl|my_center|LOCUS_09500 34806 35654 gene locus_tag LOCUS_09510 gene pheA 34806 35654 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398512.1 protein_id gnl|my_center|LOCUS_09510 36269 35724 gene locus_tag LOCUS_09520 36269 35724 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812275.1 protein_id gnl|my_center|LOCUS_09520 37442 36327 gene locus_tag LOCUS_09530 37442 36327 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973777.1 protein_id gnl|my_center|LOCUS_09530 37641 39239 gene locus_tag LOCUS_09540 gene nadB 37641 39239 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229687.1 protein_id gnl|my_center|LOCUS_09540 39208 40059 gene locus_tag LOCUS_09550 gene nadC 39208 40059 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092231.1 protein_id gnl|my_center|LOCUS_09550 40062 41168 gene locus_tag LOCUS_09560 gene nadA 40062 41168 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025295.1 protein_id gnl|my_center|LOCUS_09560 41821 43350 gene locus_tag LOCUS_09570 41821 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 43373 44311 gene locus_tag LOCUS_09580 43373 44311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 44437 44985 gene locus_tag LOCUS_09590 44437 44985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 45227 45784 gene locus_tag LOCUS_09600 45227 45784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 45977 47896 gene locus_tag LOCUS_09610 45977 47896 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 protein_id gnl|my_center|LOCUS_09610 48025 48636 gene locus_tag LOCUS_09620 gene ruvA 48025 48636 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 protein_id gnl|my_center|LOCUS_09620 48695 49696 gene locus_tag LOCUS_09630 gene ruvB 48695 49696 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 protein_id gnl|my_center|LOCUS_09630 49693 49899 gene locus_tag LOCUS_09640 49693 49899 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 protein_id gnl|my_center|LOCUS_09640 49916 50944 gene locus_tag LOCUS_09650 gene queA 49916 50944 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_09650 50996 52135 gene locus_tag LOCUS_09660 gene tgt 50996 52135 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125362.1 protein_id gnl|my_center|LOCUS_09660 52252 52515 gene locus_tag LOCUS_09670 gene yajC 52252 52515 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 protein_id gnl|my_center|LOCUS_09670 53001 52618 gene locus_tag LOCUS_09680 53001 52618 CDS product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 protein_id gnl|my_center|LOCUS_09680 53201 53851 gene locus_tag LOCUS_09690 53201 53851 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 protein_id gnl|my_center|LOCUS_09690 55440 53896 gene locus_tag LOCUS_09700 gene spoVB 55440 53896 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_09700 55545 55862 gene locus_tag LOCUS_09710 gene comN 55545 55862 CDS product post-transcriptional regulator ComN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398498.1 protein_id gnl|my_center|LOCUS_09710 56056 58320 gene locus_tag LOCUS_09720 gene secDF 56056 58320 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_09720 58630 60966 gene locus_tag LOCUS_09730 gene recJ 58630 60966 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941257.1 protein_id gnl|my_center|LOCUS_09730 60989 61501 gene locus_tag LOCUS_09740 60989 61501 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 protein_id gnl|my_center|LOCUS_09740 62785 62303 gene locus_tag LOCUS_09750 62785 62303 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050142.1 protein_id gnl|my_center|LOCUS_09750 63508 65700 gene locus_tag LOCUS_09760 gene relA 63508 65700 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_09760 65712 66152 gene locus_tag LOCUS_09770 65712 66152 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266954.1 protein_id gnl|my_center|LOCUS_09770 67673 66279 gene locus_tag LOCUS_09780 67673 66279 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399040.1 protein_id gnl|my_center|LOCUS_09780 67893 68069 gene locus_tag LOCUS_09790 67893 68069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242605.1 protein_id gnl|my_center|LOCUS_09790 68421 69698 gene locus_tag LOCUS_09800 gene hisS 68421 69698 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_09800 69698 71473 gene locus_tag LOCUS_09810 gene aspS 69698 71473 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_09810 71928 72689 gene locus_tag LOCUS_09820 71928 72689 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_09820 72927 73703 gene locus_tag LOCUS_09830 72927 73703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245465.1 protein_id gnl|my_center|LOCUS_09830 73704 74084 gene locus_tag LOCUS_09840 73704 74084 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233424.1 protein_id gnl|my_center|LOCUS_09840 74081 74773 gene locus_tag LOCUS_09850 74081 74773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233423.1 protein_id gnl|my_center|LOCUS_09850 74786 75712 gene locus_tag LOCUS_09860 74786 75712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_09860 75705 76655 gene locus_tag LOCUS_09870 75705 76655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 protein_id gnl|my_center|LOCUS_09870 78191 76917 gene locus_tag LOCUS_09880 78191 76917 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 protein_id gnl|my_center|LOCUS_09880 78475 79143 gene locus_tag LOCUS_09890 78475 79143 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 protein_id gnl|my_center|LOCUS_09890 79140 79559 gene locus_tag LOCUS_09900 gene cymR 79140 79559 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_09900 79658 80800 gene locus_tag LOCUS_09910 79658 80800 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439881.1 protein_id gnl|my_center|LOCUS_09910 80816 81934 gene locus_tag LOCUS_09920 gene mnmA 80816 81934 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038010.1 protein_id gnl|my_center|LOCUS_09920 82238 82909 gene locus_tag LOCUS_09930 82238 82909 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066395.1 protein_id gnl|my_center|LOCUS_09930 82935 85328 gene locus_tag LOCUS_09940 82935 85328 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732598.1 protein_id gnl|my_center|LOCUS_09940 85368 85880 gene locus_tag LOCUS_09950 85368 85880 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886583.1 protein_id gnl|my_center|LOCUS_09950 85855 86043 gene locus_tag LOCUS_09960 85855 86043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 protein_id gnl|my_center|LOCUS_09960 86346 87422 gene locus_tag LOCUS_09970 86346 87422 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_09970 87794 90427 gene locus_tag LOCUS_09980 gene alaS 87794 90427 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 protein_id gnl|my_center|LOCUS_09980 90513 90788 gene locus_tag LOCUS_09990 90513 90788 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_09990 90785 91201 gene locus_tag LOCUS_10000 gene ruvX 90785 91201 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_10000 91216 91506 gene locus_tag LOCUS_10010 91216 91506 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_10010 91646 92755 gene locus_tag LOCUS_10020 gene mltG 91646 92755 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 protein_id gnl|my_center|LOCUS_10020 92927 93568 gene locus_tag LOCUS_10030 92927 93568 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 protein_id gnl|my_center|LOCUS_10030 93570 94499 gene locus_tag LOCUS_10040 93570 94499 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 protein_id gnl|my_center|LOCUS_10040 94521 95795 gene locus_tag LOCUS_10050 94521 95795 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217969.1 protein_id gnl|my_center|LOCUS_10050 96422 96898 gene locus_tag LOCUS_10060 gene greA 96422 96898 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 protein_id gnl|my_center|LOCUS_10060 97074 98837 gene locus_tag LOCUS_10070 97074 98837 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695148.1 protein_id gnl|my_center|LOCUS_10070 98944 99555 gene locus_tag LOCUS_10080 98944 99555 CDS product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722003.1 protein_id gnl|my_center|LOCUS_10080 99908 99702 gene locus_tag LOCUS_10090 99908 99702 CDS product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010984.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence009 408 274 gene locus_tag LOCUS_10100 408 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 577 425 gene locus_tag LOCUS_10110 577 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10110 1281 814 gene locus_tag LOCUS_10120 1281 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 1692 1510 gene locus_tag LOCUS_10130 1692 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2435 2082 gene locus_tag LOCUS_10140 2435 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2683 2447 gene locus_tag LOCUS_10150 2683 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3659 2883 gene locus_tag LOCUS_10160 3659 2883 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062687261.1 protein_id gnl|my_center|LOCUS_10160 3827 4027 gene locus_tag LOCUS_10170 3827 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4662 4381 gene locus_tag LOCUS_10180 4662 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 6353 4668 gene locus_tag LOCUS_10190 6353 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8584 7751 gene locus_tag LOCUS_10200 8584 7751 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_10200 8717 8568 gene locus_tag LOCUS_10210 8717 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9880 8942 gene locus_tag LOCUS_10220 9880 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11726 10134 gene locus_tag LOCUS_10230 11726 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 12524 13804 gene locus_tag LOCUS_10240 gene dacA 12524 13804 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 protein_id gnl|my_center|LOCUS_10240 14400 14194 gene locus_tag LOCUS_10250 14400 14194 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393288.1 protein_id gnl|my_center|LOCUS_10250 15829 14717 gene locus_tag LOCUS_10260 gene ald 15829 14717 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_10260 17177 15933 gene locus_tag LOCUS_10270 gene adeR 17177 15933 CDS product sporulation transcriptional activator AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886604.1 protein_id gnl|my_center|LOCUS_10270 17358 18449 gene locus_tag LOCUS_10280 17358 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 18446 19948 gene locus_tag LOCUS_10290 gene gerSA 18446 19948 CDS product spore germination protein GerSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528995.1 protein_id gnl|my_center|LOCUS_10290 19948 21210 gene locus_tag LOCUS_10300 19948 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 21678 21271 gene locus_tag LOCUS_10310 21678 21271 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_10310 22236 21817 gene locus_tag LOCUS_10320 22236 21817 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879309.1 protein_id gnl|my_center|LOCUS_10320 22837 22658 gene locus_tag LOCUS_10330 22837 22658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 24964 23081 gene locus_tag LOCUS_10340 gene selB 24964 23081 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_10340 25682 25089 gene locus_tag LOCUS_10350 gene scuA 25682 25089 CDS product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 protein_id gnl|my_center|LOCUS_10350 27941 25830 gene locus_tag LOCUS_10360 27941 25830 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_10360 31593 28462 gene locus_tag LOCUS_10370 31593 28462 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989769.1 protein_id gnl|my_center|LOCUS_10370 32735 31590 gene locus_tag LOCUS_10380 32735 31590 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_10380 33024 32928 gene locus_tag LOCUS_t00020 33024 32928 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 33203 33628 gene locus_tag LOCUS_10390 33203 33628 CDS product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889384.1 protein_id gnl|my_center|LOCUS_10390 34172 33681 gene locus_tag LOCUS_10400 34172 33681 CDS product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 protein_id gnl|my_center|LOCUS_10400 34862 34503 gene locus_tag LOCUS_10410 gene cheY 34862 34503 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_10410 35682 34975 gene locus_tag LOCUS_10420 gene ccdA 35682 34975 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 protein_id gnl|my_center|LOCUS_10420 35999 36205 gene locus_tag LOCUS_10430 35999 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 36658 36446 gene locus_tag LOCUS_10440 36658 36446 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123317.1 protein_id gnl|my_center|LOCUS_10440 37172 36732 gene locus_tag LOCUS_10450 gene sirA 37172 36732 CDS product sporulation inhibitor of replication protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231591.1 protein_id gnl|my_center|LOCUS_10450 39504 37498 gene locus_tag LOCUS_10460 gene tkt 39504 37498 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 protein_id gnl|my_center|LOCUS_10460 39944 39711 gene locus_tag LOCUS_10470 39944 39711 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295816.1 protein_id gnl|my_center|LOCUS_10470 40674 40015 gene locus_tag LOCUS_10480 40674 40015 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231596.1 protein_id gnl|my_center|LOCUS_10480 41001 40681 gene locus_tag LOCUS_10490 gene yneA 41001 40681 CDS product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231598.1 protein_id gnl|my_center|LOCUS_10490 41159 41779 gene locus_tag LOCUS_10500 gene lexA 41159 41779 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_10500 42900 41815 gene locus_tag LOCUS_10510 gene spoIIP 42900 41815 CDS product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 protein_id gnl|my_center|LOCUS_10510 43275 43679 gene locus_tag LOCUS_10520 43275 43679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 45370 44036 gene locus_tag LOCUS_10530 gene glnA 45370 44036 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 protein_id gnl|my_center|LOCUS_10530 45939 45538 gene locus_tag LOCUS_10540 gene glnR 45939 45538 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656783.1 protein_id gnl|my_center|LOCUS_10540 47411 46149 gene locus_tag LOCUS_10550 47411 46149 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 protein_id gnl|my_center|LOCUS_10550 48676 47423 gene locus_tag LOCUS_10560 gene hflX 48676 47423 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048525537.1 protein_id gnl|my_center|LOCUS_10560 48919 49554 gene locus_tag LOCUS_10570 48919 49554 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 protein_id gnl|my_center|LOCUS_10570 50319 49666 gene locus_tag LOCUS_10580 50319 49666 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243049.1 protein_id gnl|my_center|LOCUS_10580 51096 50410 gene locus_tag LOCUS_10590 51096 50410 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_10590 52665 51112 gene locus_tag LOCUS_10600 52665 51112 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 protein_id gnl|my_center|LOCUS_10600 53460 52678 gene locus_tag LOCUS_10610 53460 52678 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939818.1 protein_id gnl|my_center|LOCUS_10610 54373 53477 gene locus_tag LOCUS_10620 gene ldeG 54373 53477 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_10620 54598 54386 gene locus_tag LOCUS_10630 54598 54386 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_10630 56149 54794 gene locus_tag LOCUS_10640 56149 54794 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 protein_id gnl|my_center|LOCUS_10640 57812 56178 gene locus_tag LOCUS_10650 57812 56178 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244755.1 protein_id gnl|my_center|LOCUS_10650 58973 57831 gene locus_tag LOCUS_10660 58973 57831 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_10660 59680 59048 gene locus_tag LOCUS_10670 59680 59048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224998.1 protein_id gnl|my_center|LOCUS_10670 61100 59970 gene locus_tag LOCUS_10680 61100 59970 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453275.1 protein_id gnl|my_center|LOCUS_10680 62526 61558 gene locus_tag LOCUS_10690 gene spoVK 62526 61558 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_10690 63051 62818 gene locus_tag LOCUS_10700 gene hfq 63051 62818 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_10700 64033 63089 gene locus_tag LOCUS_10710 gene miaA 64033 63089 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_10710 66575 64194 gene locus_tag LOCUS_10720 66575 64194 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078404016.1 protein_id gnl|my_center|LOCUS_10720 68426 66762 gene locus_tag LOCUS_10730 gene glpD 68426 66762 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672833.1 protein_id gnl|my_center|LOCUS_10730 70077 68584 gene locus_tag LOCUS_10740 gene glpK 70077 68584 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_10740 70976 70155 gene locus_tag LOCUS_10750 gene glpF 70976 70155 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 protein_id gnl|my_center|LOCUS_10750 71303 72058 gene locus_tag LOCUS_10760 71303 72058 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_10760 72810 72256 gene locus_tag LOCUS_10770 gene glpP 72810 72256 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394285.1 protein_id gnl|my_center|LOCUS_10770 74875 72962 gene locus_tag LOCUS_10780 gene mutL 74875 72962 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 protein_id gnl|my_center|LOCUS_10780 77337 74911 gene locus_tag LOCUS_10790 gene mutS 77337 74911 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 protein_id gnl|my_center|LOCUS_10790 79339 77738 gene locus_tag LOCUS_10800 79339 77738 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272172.1 protein_id gnl|my_center|LOCUS_10800 80062 79919 gene locus_tag LOCUS_10810 80062 79919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 80263 81210 gene locus_tag LOCUS_10820 80263 81210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754999.1 protein_id gnl|my_center|LOCUS_10820 81813 81268 gene locus_tag LOCUS_10830 gene cotE 81813 81268 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_10830 82486 82058 gene locus_tag LOCUS_10840 gene ricA 82486 82058 CDS product regulatory iron-sulfur-containing complex subunit RicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231834.1 protein_id gnl|my_center|LOCUS_10840 84032 82488 gene locus_tag LOCUS_10850 gene miaB 84032 82488 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_10850 85056 84190 gene locus_tag LOCUS_10860 85056 84190 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_10860 86799 85057 gene locus_tag LOCUS_10870 86799 85057 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 protein_id gnl|my_center|LOCUS_10870 87948 87028 gene locus_tag LOCUS_10880 87948 87028 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688045.1 protein_id gnl|my_center|LOCUS_10880 88585 88325 gene locus_tag LOCUS_10890 gene spoVS 88585 88325 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_10890 89552 88752 gene locus_tag LOCUS_10900 89552 88752 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297139.1 protein_id gnl|my_center|LOCUS_10900 91240 89681 gene locus_tag LOCUS_10910 gene rny 91240 89681 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence010 400 1230 gene locus_tag LOCUS_10920 400 1230 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604155.1 protein_id gnl|my_center|LOCUS_10920 1486 2100 gene locus_tag LOCUS_10930 gene wrbA 1486 2100 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 protein_id gnl|my_center|LOCUS_10930 3082 2162 gene locus_tag LOCUS_10940 3082 2162 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448370.1 protein_id gnl|my_center|LOCUS_10940 3185 3589 gene locus_tag LOCUS_10950 3185 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3897 5633 gene locus_tag LOCUS_10960 gene pgcA 3897 5633 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_10960 6189 5935 gene locus_tag LOCUS_10970 6189 5935 CDS product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 protein_id gnl|my_center|LOCUS_10970 6313 7299 gene locus_tag LOCUS_10980 6313 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 7395 8813 gene locus_tag LOCUS_10990 gene spoVR 7395 8813 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 protein_id gnl|my_center|LOCUS_10990 9750 8941 gene locus_tag LOCUS_11000 9750 8941 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 protein_id gnl|my_center|LOCUS_11000 10435 10115 gene locus_tag LOCUS_11010 10435 10115 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578878.1 protein_id gnl|my_center|LOCUS_11010 11555 11247 gene locus_tag LOCUS_11020 gene czrA 11555 11247 CDS product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 protein_id gnl|my_center|LOCUS_11020 11756 12994 gene locus_tag LOCUS_11030 11756 12994 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814809.1 protein_id gnl|my_center|LOCUS_11030 13415 13597 gene locus_tag LOCUS_11040 gene tatAY 13415 13597 CDS product sec-independent protein translocase protein TatAY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234072.1 protein_id gnl|my_center|LOCUS_11040 13852 15684 gene locus_tag LOCUS_11050 13852 15684 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723360.1 protein_id gnl|my_center|LOCUS_11050 14256 14346 gene locus_tag LOCUS_t00030 14256 14346 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16131 17798 gene locus_tag LOCUS_11060 gene ilvD 16131 17798 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728794.1 protein_id gnl|my_center|LOCUS_11060 18271 19986 gene locus_tag LOCUS_11070 gene ilvB 18271 19986 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_11070 19983 20501 gene locus_tag LOCUS_11080 gene ilvN 19983 20501 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 protein_id gnl|my_center|LOCUS_11080 20526 21551 gene locus_tag LOCUS_11090 gene ilvC 20526 21551 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 protein_id gnl|my_center|LOCUS_11090 21538 23070 gene locus_tag LOCUS_11100 21538 23070 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 protein_id gnl|my_center|LOCUS_11100 23092 24201 gene locus_tag LOCUS_11110 gene leuB 23092 24201 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 protein_id gnl|my_center|LOCUS_11110 24299 25711 gene locus_tag LOCUS_11120 gene leuC 24299 25711 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_11120 25724 26326 gene locus_tag LOCUS_11130 gene leuD 25724 26326 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 protein_id gnl|my_center|LOCUS_11130 26689 28068 gene locus_tag LOCUS_11140 gene fumC 26689 28068 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_11140 28433 28218 gene locus_tag LOCUS_11150 28433 28218 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069660.1 protein_id gnl|my_center|LOCUS_11150 28707 28958 gene locus_tag LOCUS_11160 28707 28958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510476.1 protein_id gnl|my_center|LOCUS_11160 29034 29294 gene locus_tag LOCUS_11170 29034 29294 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 protein_id gnl|my_center|LOCUS_11170 29553 29362 gene locus_tag LOCUS_11180 29553 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 29838 29626 gene locus_tag LOCUS_11190 29838 29626 CDS product YheE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886462.1 protein_id gnl|my_center|LOCUS_11190 30170 31303 gene locus_tag LOCUS_11200 30170 31303 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245756.1 protein_id gnl|my_center|LOCUS_11200 31424 31777 gene locus_tag LOCUS_11210 31424 31777 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224239.1 protein_id gnl|my_center|LOCUS_11210 31937 32806 gene locus_tag LOCUS_11220 31937 32806 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047943043.1 protein_id gnl|my_center|LOCUS_11220 33239 34759 gene locus_tag LOCUS_11230 33239 34759 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 protein_id gnl|my_center|LOCUS_11230 34981 35778 gene locus_tag LOCUS_11240 34981 35778 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454174.1 protein_id gnl|my_center|LOCUS_11240 36235 36050 gene locus_tag LOCUS_11250 36235 36050 CDS product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539552.1 protein_id gnl|my_center|LOCUS_11250 36427 37326 gene locus_tag LOCUS_11260 36427 37326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_11260 37319 38566 gene locus_tag LOCUS_11270 37319 38566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_11270 38900 40120 gene locus_tag LOCUS_11280 38900 40120 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930566.1 protein_id gnl|my_center|LOCUS_11280 40117 43077 gene locus_tag LOCUS_11290 40117 43077 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242210.1 protein_id gnl|my_center|LOCUS_11290 43174 44118 gene locus_tag LOCUS_11300 gene yhaM 43174 44118 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_11300 44361 44552 gene locus_tag LOCUS_11310 44361 44552 CDS product sporulation YhaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449223.1 protein_id gnl|my_center|LOCUS_11310 45532 44627 gene locus_tag LOCUS_11320 gene prsA2 45532 44627 CDS product posttranslocation chaperone PrsA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989927.1 protein_id gnl|my_center|LOCUS_11320 46404 46225 gene locus_tag LOCUS_11330 46404 46225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172690.1 protein_id gnl|my_center|LOCUS_11330 47094 46558 gene locus_tag LOCUS_11340 47094 46558 CDS product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245590.1 protein_id gnl|my_center|LOCUS_11340 47588 47920 gene locus_tag LOCUS_11350 47588 47920 CDS product YhaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966921.1 protein_id gnl|my_center|LOCUS_11350 48486 47917 gene locus_tag LOCUS_11360 48486 47917 CDS product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834924.1 protein_id gnl|my_center|LOCUS_11360 49330 48977 gene locus_tag LOCUS_11370 49330 48977 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030302.1 protein_id gnl|my_center|LOCUS_11370 49650 49841 gene locus_tag LOCUS_11380 49650 49841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 50564 50046 gene locus_tag LOCUS_11390 gene trpP 50564 50046 CDS product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 protein_id gnl|my_center|LOCUS_11390 51497 51078 gene locus_tag LOCUS_11400 51497 51078 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016840.1 protein_id gnl|my_center|LOCUS_11400 52243 52980 gene locus_tag LOCUS_11410 gene ecsA 52243 52980 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292603.1 protein_id gnl|my_center|LOCUS_11410 52977 54203 gene locus_tag LOCUS_11420 52977 54203 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723832.1 protein_id gnl|my_center|LOCUS_11420 55652 54255 gene locus_tag LOCUS_11430 55652 54255 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_11430 56701 56186 gene locus_tag LOCUS_11440 gene hmoB 56701 56186 CDS product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 protein_id gnl|my_center|LOCUS_11440 57057 58097 gene locus_tag LOCUS_11450 gene hemE 57057 58097 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252605.1 protein_id gnl|my_center|LOCUS_11450 58508 59443 gene locus_tag LOCUS_11460 gene hemH 58508 59443 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_11460 59595 61016 gene locus_tag LOCUS_11470 gene hemY 59595 61016 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 protein_id gnl|my_center|LOCUS_11470 61144 62076 gene locus_tag LOCUS_11480 gene cyoE 61144 62076 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733858.1 protein_id gnl|my_center|LOCUS_11480 62300 62881 gene locus_tag LOCUS_11490 62300 62881 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963381.1 protein_id gnl|my_center|LOCUS_11490 62991 65267 gene locus_tag LOCUS_11500 62991 65267 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 protein_id gnl|my_center|LOCUS_11500 65561 66385 gene locus_tag LOCUS_11510 65561 66385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234152.1 protein_id gnl|my_center|LOCUS_11510 66392 67072 gene locus_tag LOCUS_11520 66392 67072 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046397.1 protein_id gnl|my_center|LOCUS_11520 67069 68463 gene locus_tag LOCUS_11530 67069 68463 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494832.1 protein_id gnl|my_center|LOCUS_11530 68486 68959 gene locus_tag LOCUS_11540 68486 68959 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398648.1 protein_id gnl|my_center|LOCUS_11540 69319 69185 gene locus_tag LOCUS_11550 gene yhfH 69319 69185 CDS product protein YhfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886464.1 protein_id gnl|my_center|LOCUS_11550 69442 70173 gene locus_tag LOCUS_11560 69442 70173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784668.1 protein_id gnl|my_center|LOCUS_11560 70189 71178 gene locus_tag LOCUS_11570 70189 71178 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897260.1 protein_id gnl|my_center|LOCUS_11570 71422 72981 gene locus_tag LOCUS_11580 71422 72981 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055169.1 protein_id gnl|my_center|LOCUS_11580 73166 74461 gene locus_tag LOCUS_11590 73166 74461 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233297.1 protein_id gnl|my_center|LOCUS_11590 74879 74646 gene locus_tag LOCUS_11600 74879 74646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 75065 75625 gene locus_tag LOCUS_11610 75065 75625 CDS product competence protein ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428958.1 protein_id gnl|my_center|LOCUS_11610 76161 75748 gene locus_tag LOCUS_11620 76161 75748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233132.1 protein_id gnl|my_center|LOCUS_11620 76575 77189 gene locus_tag LOCUS_11630 76575 77189 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347517.1 protein_id gnl|my_center|LOCUS_11630 77158 80820 gene locus_tag LOCUS_11640 gene addB 77158 80820 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244988.1 protein_id gnl|my_center|LOCUS_11640 80798 84565 gene locus_tag LOCUS_11650 gene addA 80798 84565 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018662405.1 protein_id gnl|my_center|LOCUS_11650 84926 84708 gene locus_tag LOCUS_11660 84926 84708 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 protein_id gnl|my_center|LOCUS_11660 85435 85052 gene locus_tag LOCUS_11670 85435 85052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 85608 85435 gene locus_tag LOCUS_11680 gene gerPD 85608 85435 CDS product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052807.1 protein_id gnl|my_center|LOCUS_11680 86280 85699 gene locus_tag LOCUS_11690 86280 85699 CDS product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 protein_id gnl|my_center|LOCUS_11690 86533 86306 gene locus_tag LOCUS_11700 86533 86306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 86766 86545 gene locus_tag LOCUS_11710 gene gerPA 86766 86545 CDS product spore germination protein GerPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111187.1 protein_id gnl|my_center|LOCUS_11710 86951 88120 gene locus_tag LOCUS_11720 86951 88120 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 protein_id gnl|my_center|LOCUS_11720 88148 89047 gene locus_tag LOCUS_11730 88148 89047 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213071.1 protein_id gnl|my_center|LOCUS_11730 89155 89538 gene locus_tag LOCUS_11740 89155 89538 CDS product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244937.1 protein_id gnl|my_center|LOCUS_11740 90191 89631 gene locus_tag LOCUS_11750 90191 89631 CDS product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616046.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence011 469 269 gene locus_tag LOCUS_11760 469 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250168.1 protein_id gnl|my_center|LOCUS_11760 622 1248 gene locus_tag LOCUS_11770 622 1248 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_11770 1598 1323 gene locus_tag LOCUS_11780 1598 1323 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456560.1 protein_id gnl|my_center|LOCUS_11780 2615 1659 gene locus_tag LOCUS_11790 2615 1659 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730367.1 protein_id gnl|my_center|LOCUS_11790 2855 4324 gene locus_tag LOCUS_11800 gene speA 2855 4324 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_11800 6627 5218 gene locus_tag LOCUS_11810 gene lpdA 6627 5218 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_11810 7918 6632 gene locus_tag LOCUS_11820 gene pdhC 7918 6632 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863427.1 protein_id gnl|my_center|LOCUS_11820 8965 7988 gene locus_tag LOCUS_11830 gene pdhB 8965 7988 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 protein_id gnl|my_center|LOCUS_11830 10084 8969 gene locus_tag LOCUS_11840 gene pdhA 10084 8969 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_11840 10860 11414 gene locus_tag LOCUS_11850 gene def 10860 11414 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957056.1 protein_id gnl|my_center|LOCUS_11850 12456 11683 gene locus_tag LOCUS_11860 12456 11683 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998268.1 protein_id gnl|my_center|LOCUS_11860 13110 13316 gene locus_tag LOCUS_11870 gene rnpZA 13110 13316 CDS product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 protein_id gnl|my_center|LOCUS_11870 13323 14990 gene locus_tag LOCUS_11880 gene rnjA 13323 14990 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_11880 15793 15128 gene locus_tag LOCUS_11890 gene ktrC 15793 15128 CDS product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 protein_id gnl|my_center|LOCUS_11890 16474 16019 gene locus_tag LOCUS_11900 gene ykuV 16474 16019 CDS product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 protein_id gnl|my_center|LOCUS_11900 17097 16549 gene locus_tag LOCUS_11910 gene ahpA 17097 16549 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_11910 18328 17453 gene locus_tag LOCUS_11920 gene ccpC 18328 17453 CDS product transcriptional regulator CcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232387.1 protein_id gnl|my_center|LOCUS_11920 19973 18468 gene locus_tag LOCUS_11930 19973 18468 CDS product LM6179_1298 family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732434.1 protein_id gnl|my_center|LOCUS_11930 20541 20077 gene locus_tag LOCUS_11940 20541 20077 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623565.1 protein_id gnl|my_center|LOCUS_11940 20816 20655 gene locus_tag LOCUS_11950 20816 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 21545 21291 gene locus_tag LOCUS_11960 21545 21291 CDS product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218671.1 protein_id gnl|my_center|LOCUS_11960 21767 22018 gene locus_tag LOCUS_11970 21767 22018 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717875.1 protein_id gnl|my_center|LOCUS_11970 22349 22113 gene locus_tag LOCUS_11980 22349 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 23633 22419 gene locus_tag LOCUS_11990 23633 22419 CDS product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 protein_id gnl|my_center|LOCUS_11990 24819 24055 gene locus_tag LOCUS_12000 gene fadH 24819 24055 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_12000 25215 25000 gene locus_tag LOCUS_12010 25215 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726553.1 protein_id gnl|my_center|LOCUS_12010 25466 26341 gene locus_tag LOCUS_12020 25466 26341 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_12020 28774 26675 gene locus_tag LOCUS_12030 28774 26675 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_12030 30333 28798 gene locus_tag LOCUS_12040 30333 28798 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002198132.1 protein_id gnl|my_center|LOCUS_12040 30585 30406 gene locus_tag LOCUS_12050 30585 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 30558 31022 gene locus_tag LOCUS_12060 30558 31022 CDS product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 protein_id gnl|my_center|LOCUS_12060 32066 31161 gene locus_tag LOCUS_12070 gene cheV 32066 31161 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 protein_id gnl|my_center|LOCUS_12070 33325 32330 gene locus_tag LOCUS_12080 gene corA 33325 32330 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003436.1 protein_id gnl|my_center|LOCUS_12080 33684 33508 gene locus_tag LOCUS_12090 33684 33508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 34617 33754 gene locus_tag LOCUS_12100 34617 33754 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_12100 35680 34898 gene locus_tag LOCUS_12110 35680 34898 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_12110 37765 36044 gene locus_tag LOCUS_12120 gene ptsP 37765 36044 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722867.1 protein_id gnl|my_center|LOCUS_12120 38031 37765 gene locus_tag LOCUS_12130 38031 37765 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831726.1 protein_id gnl|my_center|LOCUS_12130 38613 38425 gene locus_tag LOCUS_12140 38613 38425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356683.1 protein_id gnl|my_center|LOCUS_12140 38777 38953 gene locus_tag LOCUS_12150 38777 38953 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829339.1 protein_id gnl|my_center|LOCUS_12150 39330 39941 gene locus_tag LOCUS_12160 39330 39941 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732447.1 protein_id gnl|my_center|LOCUS_12160 40091 40834 gene locus_tag LOCUS_12170 40091 40834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 41951 40917 gene locus_tag LOCUS_12180 41951 40917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_12180 42415 44436 gene locus_tag LOCUS_12190 gene clpE 42415 44436 CDS product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 protein_id gnl|my_center|LOCUS_12190 46204 44501 gene locus_tag LOCUS_12200 46204 44501 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_12200 46805 46356 gene locus_tag LOCUS_12210 46805 46356 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203336.1 protein_id gnl|my_center|LOCUS_12210 47078 48559 gene locus_tag LOCUS_12220 gene kinD 47078 48559 CDS product sporulation kinase KinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886497.1 protein_id gnl|my_center|LOCUS_12220 49050 48793 gene locus_tag LOCUS_12230 49050 48793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 49851 49363 gene locus_tag LOCUS_12240 49851 49363 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 protein_id gnl|my_center|LOCUS_12240 52023 49867 gene locus_tag LOCUS_12250 gene kinE 52023 49867 CDS product sporulation two-component system sensor histidine kinase KinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232504.1 protein_id gnl|my_center|LOCUS_12250 52434 52180 gene locus_tag LOCUS_12260 52434 52180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 53922 55688 gene locus_tag LOCUS_12270 53922 55688 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_12270 55940 55812 gene locus_tag LOCUS_12280 55940 55812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 56101 55940 gene locus_tag LOCUS_12290 56101 55940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 57535 56180 gene locus_tag LOCUS_12300 gene ktrD 57535 56180 CDS product Ktr system potassium transporter KtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244672.1 protein_id gnl|my_center|LOCUS_12300 57815 58018 gene locus_tag LOCUS_12310 gene sspD 57815 58018 CDS product acid-soluble spore protein SspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218568.1 protein_id gnl|my_center|LOCUS_12310 58930 58163 gene locus_tag LOCUS_12320 58930 58163 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722856.1 protein_id gnl|my_center|LOCUS_12320 62279 59199 gene locus_tag LOCUS_12330 62279 59199 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_12330 63900 62524 gene locus_tag LOCUS_12340 gene nhaC 63900 62524 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253718.1 protein_id gnl|my_center|LOCUS_12340 65872 64301 gene locus_tag LOCUS_12350 65872 64301 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722853.1 protein_id gnl|my_center|LOCUS_12350 66185 65946 gene locus_tag LOCUS_12360 66185 65946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 66477 67694 gene locus_tag LOCUS_12370 66477 67694 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 protein_id gnl|my_center|LOCUS_12370 68842 67790 gene locus_tag LOCUS_12380 68842 67790 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930034.1 protein_id gnl|my_center|LOCUS_12380 70270 69095 gene locus_tag LOCUS_12390 gene metC 70270 69095 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_12390 71440 70277 gene locus_tag LOCUS_12400 gene metI 71440 70277 CDS product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 protein_id gnl|my_center|LOCUS_12400 72648 71626 gene locus_tag LOCUS_12410 72648 71626 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887920.1 protein_id gnl|my_center|LOCUS_12410 73499 72735 gene locus_tag LOCUS_12420 73499 72735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_12420 74268 73483 gene locus_tag LOCUS_12430 74268 73483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261606.1 protein_id gnl|my_center|LOCUS_12430 74560 75384 gene locus_tag LOCUS_12440 74560 75384 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368275.1 protein_id gnl|my_center|LOCUS_12440 75560 76816 gene locus_tag LOCUS_12450 gene maeB 75560 76816 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_12450 77032 77202 gene locus_tag LOCUS_12460 77032 77202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 77934 77299 gene locus_tag LOCUS_12470 77934 77299 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966881.1 protein_id gnl|my_center|LOCUS_12470 79213 78062 gene locus_tag LOCUS_12480 79213 78062 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_12480 79633 79409 gene locus_tag LOCUS_12490 79633 79409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501865.1 protein_id gnl|my_center|LOCUS_12490 80587 79661 gene locus_tag LOCUS_12500 80587 79661 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146242.1 protein_id gnl|my_center|LOCUS_12500 80997 80692 gene locus_tag LOCUS_12510 80997 80692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 81388 80999 gene locus_tag LOCUS_12520 81388 80999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 81536 81781 gene locus_tag LOCUS_12530 81536 81781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 81797 82027 gene locus_tag LOCUS_12540 81797 82027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 82746 82309 gene locus_tag LOCUS_12550 82746 82309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 83380 82913 gene locus_tag LOCUS_12560 83380 82913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 83534 83674 gene locus_tag LOCUS_12570 83534 83674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 84174 83767 gene locus_tag LOCUS_12580 84174 83767 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_12580 84514 84308 gene locus_tag LOCUS_12590 84514 84308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 85277 85187 gene locus_tag LOCUS_t00040 85277 85187 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85961 85476 gene locus_tag LOCUS_12600 85961 85476 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence012 1523 63 gene locus_tag LOCUS_12610 1523 63 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_12610 2416 1829 gene locus_tag LOCUS_12620 2416 1829 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269085.1 protein_id gnl|my_center|LOCUS_12620 3018 2413 gene locus_tag LOCUS_12630 3018 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3410 3264 gene locus_tag LOCUS_12640 3410 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3594 3773 gene locus_tag LOCUS_12650 3594 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5040 3781 gene locus_tag LOCUS_12660 5040 3781 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726096.1 protein_id gnl|my_center|LOCUS_12660 5967 5083 gene locus_tag LOCUS_12670 gene ftsX 5967 5083 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 protein_id gnl|my_center|LOCUS_12670 6643 5957 gene locus_tag LOCUS_12680 gene ftsE 6643 5957 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_12680 7318 6962 gene locus_tag LOCUS_12690 gene cccB 7318 6962 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727964.1 protein_id gnl|my_center|LOCUS_12690 7614 7318 gene locus_tag LOCUS_12700 7614 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9165 8185 gene locus_tag LOCUS_12710 gene prfB 9165 8185 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_12710 11992 9479 gene locus_tag LOCUS_12720 gene secA 11992 9479 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 protein_id gnl|my_center|LOCUS_12720 13404 12307 gene locus_tag LOCUS_12730 13404 12307 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 protein_id gnl|my_center|LOCUS_12730 14339 13809 gene locus_tag LOCUS_12740 gene chrA 14339 13809 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_12740 14899 14336 gene locus_tag LOCUS_12750 gene chrA 14899 14336 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_12750 16610 14997 gene locus_tag LOCUS_12760 16610 14997 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_12760 17224 17045 gene locus_tag LOCUS_12770 17224 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 18063 17518 gene locus_tag LOCUS_12780 gene raiA 18063 17518 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722643.1 protein_id gnl|my_center|LOCUS_12780 18391 18570 gene locus_tag LOCUS_12790 18391 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 18996 18598 gene locus_tag LOCUS_12800 18996 18598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 19108 19917 gene locus_tag LOCUS_12810 19108 19917 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_12810 20400 20050 gene locus_tag LOCUS_12820 20400 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 20801 20400 gene locus_tag LOCUS_12830 gene fliS 20801 20400 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_12830 22937 20841 gene locus_tag LOCUS_12840 22937 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 23299 22952 gene locus_tag LOCUS_12850 23299 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 23888 23511 gene locus_tag LOCUS_12860 23888 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 24145 25341 gene locus_tag LOCUS_12870 24145 25341 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 protein_id gnl|my_center|LOCUS_12870 25319 26005 gene locus_tag LOCUS_12880 25319 26005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631600.1 protein_id gnl|my_center|LOCUS_12880 25998 27239 gene locus_tag LOCUS_12890 25998 27239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_12890 27750 27304 gene locus_tag LOCUS_12900 27750 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 28417 28989 gene locus_tag LOCUS_12910 28417 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 29267 29608 gene locus_tag LOCUS_12920 29267 29608 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002032268.1 protein_id gnl|my_center|LOCUS_12920 29605 30117 gene locus_tag LOCUS_12930 29605 30117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181674.1 protein_id gnl|my_center|LOCUS_12930 30123 31571 gene locus_tag LOCUS_12940 30123 31571 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751431.1 protein_id gnl|my_center|LOCUS_12940 31718 32359 gene locus_tag LOCUS_12950 gene bluB 31718 32359 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992301.1 protein_id gnl|my_center|LOCUS_12950 32725 33234 gene locus_tag LOCUS_12960 32725 33234 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236612.1 protein_id gnl|my_center|LOCUS_12960 33623 33931 gene locus_tag LOCUS_12970 33623 33931 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_12970 33974 35182 gene locus_tag LOCUS_12980 33974 35182 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_12980 35414 35575 gene locus_tag LOCUS_12990 35414 35575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 35793 36836 gene locus_tag LOCUS_13000 35793 36836 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229874.1 protein_id gnl|my_center|LOCUS_13000 37817 38371 gene locus_tag LOCUS_13010 37817 38371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 protein_id gnl|my_center|LOCUS_13010 39143 38694 gene locus_tag LOCUS_13020 39143 38694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 40760 39168 gene locus_tag LOCUS_13030 40760 39168 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459443.1 protein_id gnl|my_center|LOCUS_13030 41969 40788 gene locus_tag LOCUS_13040 41969 40788 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_13040 42797 42018 gene locus_tag LOCUS_13050 42797 42018 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373316.1 protein_id gnl|my_center|LOCUS_13050 43671 42814 gene locus_tag LOCUS_13060 43671 42814 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 protein_id gnl|my_center|LOCUS_13060 44826 43690 gene locus_tag LOCUS_13070 44826 43690 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_13070 47211 45007 gene locus_tag LOCUS_13080 47211 45007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 47942 47703 gene locus_tag LOCUS_13090 47942 47703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 48899 48156 gene locus_tag LOCUS_13100 48899 48156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 49872 48904 gene locus_tag LOCUS_13110 49872 48904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_13110 50179 49847 gene locus_tag LOCUS_13120 50179 49847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 51934 50267 gene locus_tag LOCUS_13130 gene fliC 51934 50267 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079690.1 protein_id gnl|my_center|LOCUS_13130 52907 52134 gene locus_tag LOCUS_13140 52907 52134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 53778 52921 gene locus_tag LOCUS_13150 gene xerC 53778 52921 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707683.1 protein_id gnl|my_center|LOCUS_13150 56495 53919 gene locus_tag LOCUS_13160 56495 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 57080 56595 gene locus_tag LOCUS_13170 57080 56595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 57992 57249 gene locus_tag LOCUS_13180 57992 57249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 59208 58339 gene locus_tag LOCUS_13190 59208 58339 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049808538.1 protein_id gnl|my_center|LOCUS_13190 59784 59482 gene locus_tag LOCUS_13200 59784 59482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 61366 60059 gene locus_tag LOCUS_13210 61366 60059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 62568 61363 gene locus_tag LOCUS_13220 62568 61363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 62941 62723 gene locus_tag LOCUS_13230 62941 62723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 64347 63160 gene locus_tag LOCUS_13240 64347 63160 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 protein_id gnl|my_center|LOCUS_13240 64793 64572 gene locus_tag LOCUS_13250 gene csrA 64793 64572 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 protein_id gnl|my_center|LOCUS_13250 65226 64798 gene locus_tag LOCUS_13260 gene fliW 65226 64798 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_13260 65834 65244 gene locus_tag LOCUS_13270 65834 65244 CDS product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 protein_id gnl|my_center|LOCUS_13270 66816 65908 gene locus_tag LOCUS_13280 gene flgL 66816 65908 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 protein_id gnl|my_center|LOCUS_13280 68512 66833 gene locus_tag LOCUS_13290 gene flgK 68512 66833 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 protein_id gnl|my_center|LOCUS_13290 69015 68539 gene locus_tag LOCUS_13300 69015 68539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 69295 69032 gene locus_tag LOCUS_13310 69295 69032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 69886 69470 gene locus_tag LOCUS_13320 69886 69470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_13320 70685 69993 gene locus_tag LOCUS_13330 gene comFC 70685 69993 CDS product comF operon protein ComFC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181921.1 protein_id gnl|my_center|LOCUS_13330 71824 70694 gene locus_tag LOCUS_13340 gene comFA 71824 70694 CDS product ATP-dependent helicase ComFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225367.1 protein_id gnl|my_center|LOCUS_13340 71897 72052 gene locus_tag LOCUS_13350 71897 72052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 73897 74742 gene locus_tag LOCUS_13360 73897 74742 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_13360 76614 75193 gene locus_tag LOCUS_13370 76614 75193 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_13370 77494 77027 gene locus_tag LOCUS_13380 77494 77027 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164421.1 protein_id gnl|my_center|LOCUS_13380 78109 77567 gene locus_tag LOCUS_13390 78109 77567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 78655 78485 gene locus_tag LOCUS_13400 78655 78485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 79464 78784 gene locus_tag LOCUS_13410 gene degU 79464 78784 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_13410 80637 79486 gene locus_tag LOCUS_13420 gene degS 80637 79486 CDS product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 protein_id gnl|my_center|LOCUS_13420 81088 81729 gene locus_tag LOCUS_13430 81088 81729 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 protein_id gnl|my_center|LOCUS_13430 82063 83085 gene locus_tag LOCUS_13440 82063 83085 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724005.1 protein_id gnl|my_center|LOCUS_13440 83430 83251 gene locus_tag LOCUS_13450 83430 83251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence013 2969 339 gene locus_tag LOCUS_13460 gene polA 2969 339 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_13460 4971 3199 gene locus_tag LOCUS_13470 gene phoR 4971 3199 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032106.1 protein_id gnl|my_center|LOCUS_13470 5681 4968 gene locus_tag LOCUS_13480 gene phoP 5681 4968 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_13480 7223 6285 gene locus_tag LOCUS_13490 gene mdh 7223 6285 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153232.1 protein_id gnl|my_center|LOCUS_13490 8580 7309 gene locus_tag LOCUS_13500 gene icd 8580 7309 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_13500 9803 8685 gene locus_tag LOCUS_13510 gene citZ 9803 8685 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_13510 10506 10042 gene locus_tag LOCUS_13520 10506 10042 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398695.1 protein_id gnl|my_center|LOCUS_13520 10958 12091 gene locus_tag LOCUS_13530 gene ytvI 10958 12091 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_13530 12563 12177 gene locus_tag LOCUS_13540 gene fxsA 12563 12177 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871642.1 protein_id gnl|my_center|LOCUS_13540 14478 12718 gene locus_tag LOCUS_13550 gene pyk 14478 12718 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_13550 15755 14796 gene locus_tag LOCUS_13560 gene pfkA 15755 14796 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_13560 17062 16082 gene locus_tag LOCUS_13570 gene accA 17062 16082 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 protein_id gnl|my_center|LOCUS_13570 17922 17056 gene locus_tag LOCUS_13580 gene accD 17922 17056 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 protein_id gnl|my_center|LOCUS_13580 18644 18006 gene locus_tag LOCUS_13590 18644 18006 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204441.1 protein_id gnl|my_center|LOCUS_13590 19879 18641 gene locus_tag LOCUS_13600 gene maeB 19879 18641 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_13600 23362 19988 gene locus_tag LOCUS_13610 gene dnaE 23362 19988 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 protein_id gnl|my_center|LOCUS_13610 23575 23910 gene locus_tag LOCUS_13620 gene ytrH 23575 23910 CDS product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 protein_id gnl|my_center|LOCUS_13620 23907 24413 gene locus_tag LOCUS_13630 gene ytrI 23907 24413 CDS product sporulation membrane protein YtrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229408.1 protein_id gnl|my_center|LOCUS_13630 25379 24450 gene locus_tag LOCUS_13640 gene nrnA 25379 24450 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 protein_id gnl|my_center|LOCUS_13640 25474 25773 gene locus_tag LOCUS_13650 25474 25773 CDS product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229401.1 protein_id gnl|my_center|LOCUS_13650 27447 26119 gene locus_tag LOCUS_13660 27447 26119 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201572.1 protein_id gnl|my_center|LOCUS_13660 27876 27628 gene locus_tag LOCUS_13670 27876 27628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 28959 28279 gene locus_tag LOCUS_13680 28959 28279 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_13680 29126 30223 gene locus_tag LOCUS_13690 gene pepQ 29126 30223 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994025.1 protein_id gnl|my_center|LOCUS_13690 30485 30333 gene locus_tag LOCUS_13700 30485 30333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 30617 31063 gene locus_tag LOCUS_13710 30617 31063 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066673.1 protein_id gnl|my_center|LOCUS_13710 32605 31235 gene locus_tag LOCUS_13720 gene argH 32605 31235 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 protein_id gnl|my_center|LOCUS_13720 33810 32602 gene locus_tag LOCUS_13730 33810 32602 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 protein_id gnl|my_center|LOCUS_13730 34997 34014 gene locus_tag LOCUS_13740 34997 34014 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865853.1 protein_id gnl|my_center|LOCUS_13740 36393 35008 gene locus_tag LOCUS_13750 36393 35008 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406951.1 protein_id gnl|my_center|LOCUS_13750 36596 37315 gene locus_tag LOCUS_13760 36596 37315 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_13760 37409 37714 gene locus_tag LOCUS_13770 37409 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417212.1 protein_id gnl|my_center|LOCUS_13770 38275 37763 gene locus_tag LOCUS_13780 38275 37763 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_13780 39114 38272 gene locus_tag LOCUS_13790 39114 38272 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256850.1 protein_id gnl|my_center|LOCUS_13790 40562 39570 gene locus_tag LOCUS_13800 40562 39570 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181883.1 protein_id gnl|my_center|LOCUS_13800 41130 40633 gene locus_tag LOCUS_13810 gene tpx 41130 40633 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_13810 41790 41323 gene locus_tag LOCUS_13820 gene ytfJ 41790 41323 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_13820 42533 41829 gene locus_tag LOCUS_13830 42533 41829 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 protein_id gnl|my_center|LOCUS_13830 43114 42596 gene locus_tag LOCUS_13840 43114 42596 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229340.1 protein_id gnl|my_center|LOCUS_13840 44136 43126 gene locus_tag LOCUS_13850 gene sppA 44136 43126 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_13850 45457 44483 gene locus_tag LOCUS_13860 gene rarD 45457 44483 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 protein_id gnl|my_center|LOCUS_13860 47213 45627 gene locus_tag LOCUS_13870 47213 45627 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 protein_id gnl|my_center|LOCUS_13870 48602 47394 gene locus_tag LOCUS_13880 gene thiI 48602 47394 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229326.1 protein_id gnl|my_center|LOCUS_13880 49747 48605 gene locus_tag LOCUS_13890 49747 48605 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_13890 50075 51424 gene locus_tag LOCUS_13900 gene brnQ 50075 51424 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 protein_id gnl|my_center|LOCUS_13900 53318 51612 gene locus_tag LOCUS_13910 gene ezrA 53318 51612 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229320.1 protein_id gnl|my_center|LOCUS_13910 54273 55064 gene locus_tag LOCUS_13920 gene hisJ 54273 55064 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229318.1 protein_id gnl|my_center|LOCUS_13920 55701 55057 gene locus_tag LOCUS_13930 gene refZ 55701 55057 CDS product transcriptional regulator RefZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229313.1 protein_id gnl|my_center|LOCUS_13930 55919 56413 gene locus_tag LOCUS_13940 55919 56413 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 protein_id gnl|my_center|LOCUS_13940 57679 56489 gene locus_tag LOCUS_13950 gene megL 57679 56489 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726594.1 protein_id gnl|my_center|LOCUS_13950 59560 57845 gene locus_tag LOCUS_13960 59560 57845 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 protein_id gnl|my_center|LOCUS_13960 60220 60822 gene locus_tag LOCUS_13970 gene rpsD 60220 60822 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_13970 62614 61355 gene locus_tag LOCUS_13980 gene tyrS 62614 61355 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727370.1 protein_id gnl|my_center|LOCUS_13980 64819 63101 gene locus_tag LOCUS_13990 gene acsA 64819 63101 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_13990 65051 65233 gene locus_tag LOCUS_14000 65051 65233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 65278 65910 gene locus_tag LOCUS_14010 gene acuA 65278 65910 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581400.1 protein_id gnl|my_center|LOCUS_14010 65945 66592 gene locus_tag LOCUS_14020 65945 66592 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634568.1 protein_id gnl|my_center|LOCUS_14020 66589 67752 gene locus_tag LOCUS_14030 gene acuC 66589 67752 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 protein_id gnl|my_center|LOCUS_14030 68632 67892 gene locus_tag LOCUS_14040 gene motS 68632 67892 CDS product flagellar motor protein MotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229290.1 protein_id gnl|my_center|LOCUS_14040 69444 68629 gene locus_tag LOCUS_14050 gene motP 69444 68629 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398692.1 protein_id gnl|my_center|LOCUS_14050 70505 69507 gene locus_tag LOCUS_14060 gene ccpA 70505 69507 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_14060 72091 71015 gene locus_tag LOCUS_14070 72091 71015 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 protein_id gnl|my_center|LOCUS_14070 72329 74584 gene locus_tag LOCUS_14080 72329 74584 CDS product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214035.1 protein_id gnl|my_center|LOCUS_14080 75003 74572 gene locus_tag LOCUS_14090 75003 74572 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398549.1 protein_id gnl|my_center|LOCUS_14090 75695 75219 gene locus_tag LOCUS_14100 75695 75219 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 protein_id gnl|my_center|LOCUS_14100 77218 75911 gene locus_tag LOCUS_14110 gene murC 77218 75911 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229274.1 protein_id gnl|my_center|LOCUS_14110 77780 77649 gene locus_tag LOCUS_14120 77780 77649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 80611 77873 gene locus_tag LOCUS_14130 80611 77873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 81743 80949 gene locus_tag LOCUS_14140 81743 80949 CDS product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 protein_id gnl|my_center|LOCUS_14140 82155 81838 gene locus_tag LOCUS_14150 82155 81838 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838193.1 protein_id gnl|my_center|LOCUS_14150 83173 82157 gene locus_tag LOCUS_14160 83173 82157 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence014 320 1096 gene locus_tag LOCUS_14170 gene sigG 320 1096 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_14170 1238 1513 gene locus_tag LOCUS_14180 1238 1513 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_14180 1580 2422 gene locus_tag LOCUS_14190 gene pgeF 1580 2422 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209009.1 protein_id gnl|my_center|LOCUS_14190 2400 3077 gene locus_tag LOCUS_14200 2400 3077 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_14200 3192 3632 gene locus_tag LOCUS_14210 3192 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3641 3901 gene locus_tag LOCUS_14220 3641 3901 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214233.1 protein_id gnl|my_center|LOCUS_14220 4080 4853 gene locus_tag LOCUS_14230 4080 4853 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731984.1 protein_id gnl|my_center|LOCUS_14230 4937 5446 gene locus_tag LOCUS_14240 gene divIVA 4937 5446 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 protein_id gnl|my_center|LOCUS_14240 5879 8647 gene locus_tag LOCUS_14250 gene ileS2 5879 8647 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455951.1 protein_id gnl|my_center|LOCUS_14250 8803 9081 gene locus_tag LOCUS_14260 8803 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 9329 9817 gene locus_tag LOCUS_14270 gene lspA 9329 9817 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642181.1 protein_id gnl|my_center|LOCUS_14270 9789 10700 gene locus_tag LOCUS_14280 9789 10700 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005836.1 protein_id gnl|my_center|LOCUS_14280 10910 11449 gene locus_tag LOCUS_14290 gene pyrR 10910 11449 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_14290 11611 11805 gene locus_tag LOCUS_14300 11611 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 11850 12782 gene locus_tag LOCUS_14310 gene pyrB 11850 12782 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 protein_id gnl|my_center|LOCUS_14310 12745 14034 gene locus_tag LOCUS_14320 12745 14034 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 protein_id gnl|my_center|LOCUS_14320 14031 15128 gene locus_tag LOCUS_14330 14031 15128 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828686.1 protein_id gnl|my_center|LOCUS_14330 15121 18336 gene locus_tag LOCUS_14340 gene carB 15121 18336 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_14340 18336 19112 gene locus_tag LOCUS_14350 gene pyrK 18336 19112 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_14350 19109 20050 gene locus_tag LOCUS_14360 gene pyrD 19109 20050 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_14360 20022 20732 gene locus_tag LOCUS_14370 gene pyrF 20022 20732 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723076.1 protein_id gnl|my_center|LOCUS_14370 20732 21358 gene locus_tag LOCUS_14380 gene pyrE 20732 21358 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711440.1 protein_id gnl|my_center|LOCUS_14380 23150 21441 gene locus_tag LOCUS_14390 gene rqcH 23150 21441 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_14390 23496 26174 gene locus_tag LOCUS_14400 23496 26174 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 protein_id gnl|my_center|LOCUS_14400 26351 27229 gene locus_tag LOCUS_14410 26351 27229 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564118.1 protein_id gnl|my_center|LOCUS_14410 27282 27551 gene locus_tag LOCUS_14420 gene remA 27282 27551 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_14420 27554 28168 gene locus_tag LOCUS_14430 gene gmk 27554 28168 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 protein_id gnl|my_center|LOCUS_14430 28172 28399 gene locus_tag LOCUS_14440 gene rpoZ 28172 28399 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728294.1 protein_id gnl|my_center|LOCUS_14440 28544 29758 gene locus_tag LOCUS_14450 gene coaBC 28544 29758 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_14450 29755 32163 gene locus_tag LOCUS_14460 gene priA 29755 32163 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666732.1 protein_id gnl|my_center|LOCUS_14460 32186 32671 gene locus_tag LOCUS_14470 gene def 32186 32671 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279455.1 protein_id gnl|my_center|LOCUS_14470 32668 33624 gene locus_tag LOCUS_14480 gene fmt 32668 33624 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_14480 33614 34951 gene locus_tag LOCUS_14490 gene rsmB 33614 34951 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 protein_id gnl|my_center|LOCUS_14490 34951 36045 gene locus_tag LOCUS_14500 gene rlmN 34951 36045 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_14500 36049 36801 gene locus_tag LOCUS_14510 36049 36801 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_14510 36809 38782 gene locus_tag LOCUS_14520 gene prkC 36809 38782 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_14520 38794 39678 gene locus_tag LOCUS_14530 gene rsgA 38794 39678 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_14530 39680 40336 gene locus_tag LOCUS_14540 gene rpe 39680 40336 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_14540 40410 41066 gene locus_tag LOCUS_14550 40410 41066 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 protein_id gnl|my_center|LOCUS_14550 41704 41516 gene locus_tag LOCUS_14560 gene rpmB 41704 41516 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720131.1 protein_id gnl|my_center|LOCUS_14560 42088 42450 gene locus_tag LOCUS_14570 42088 42450 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_14570 42468 44144 gene locus_tag LOCUS_14580 42468 44144 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027136.1 protein_id gnl|my_center|LOCUS_14580 44454 45116 gene locus_tag LOCUS_14590 gene sdaAB 44454 45116 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 protein_id gnl|my_center|LOCUS_14590 45205 46092 gene locus_tag LOCUS_14600 gene sdaAA 45205 46092 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 protein_id gnl|my_center|LOCUS_14600 46097 48139 gene locus_tag LOCUS_14610 gene recG 46097 48139 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 protein_id gnl|my_center|LOCUS_14610 48331 48915 gene locus_tag LOCUS_14620 gene fapR 48331 48915 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747348.1 protein_id gnl|my_center|LOCUS_14620 48912 49895 gene locus_tag LOCUS_14630 gene plsX 48912 49895 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_14630 49917 50864 gene locus_tag LOCUS_14640 gene fabD 49917 50864 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_14640 50861 51604 gene locus_tag LOCUS_14650 gene fabG 50861 51604 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_14650 51754 51987 gene locus_tag LOCUS_14660 gene acpP 51754 51987 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_14660 52472 53218 gene locus_tag LOCUS_14670 gene rncS 52472 53218 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_14670 53228 56815 gene locus_tag LOCUS_14680 gene smc 53228 56815 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_14680 56812 57807 gene locus_tag LOCUS_14690 gene ftsY 56812 57807 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_14690 57913 58245 gene locus_tag LOCUS_14700 57913 58245 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 protein_id gnl|my_center|LOCUS_14700 58258 59601 gene locus_tag LOCUS_14710 gene ffh 58258 59601 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_14710 59905 60177 gene locus_tag LOCUS_14720 gene rpsP 59905 60177 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_14720 60188 60421 gene locus_tag LOCUS_14730 60188 60421 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 protein_id gnl|my_center|LOCUS_14730 60662 61048 gene locus_tag LOCUS_14740 60662 61048 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948139.1 protein_id gnl|my_center|LOCUS_14740 61059 61577 gene locus_tag LOCUS_14750 gene rimM 61059 61577 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 protein_id gnl|my_center|LOCUS_14750 61574 62323 gene locus_tag LOCUS_14760 gene trmD 61574 62323 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_14760 62445 62789 gene locus_tag LOCUS_14770 gene rplS 62445 62789 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_14770 63091 63630 gene locus_tag LOCUS_14780 gene lepB 63091 63630 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 protein_id gnl|my_center|LOCUS_14780 63719 64573 gene locus_tag LOCUS_14790 gene ylqF 63719 64573 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_14790 64960 65538 gene locus_tag LOCUS_14800 gene rnhB 64960 65538 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221870.1 protein_id gnl|my_center|LOCUS_14800 65597 65809 gene locus_tag LOCUS_14810 65597 65809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 66096 66827 gene locus_tag LOCUS_14820 66096 66827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 67409 71524 gene locus_tag LOCUS_14830 67409 71524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 71536 72771 gene locus_tag LOCUS_14840 71536 72771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211973.1 protein_id gnl|my_center|LOCUS_14840 73689 73841 gene locus_tag LOCUS_14850 73689 73841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence015 946 191 gene locus_tag LOCUS_14860 946 191 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_14860 1676 963 gene locus_tag LOCUS_14870 1676 963 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837551.1 protein_id gnl|my_center|LOCUS_14870 2396 1689 gene locus_tag LOCUS_14880 2396 1689 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263653.1 protein_id gnl|my_center|LOCUS_14880 3461 2610 gene locus_tag LOCUS_14890 3461 2610 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263652.1 protein_id gnl|my_center|LOCUS_14890 4720 3572 gene locus_tag LOCUS_14900 4720 3572 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_14900 5148 5696 gene locus_tag LOCUS_14910 gene rfbC 5148 5696 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_14910 5868 6632 gene locus_tag LOCUS_14920 5868 6632 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_14920 6879 7400 gene locus_tag LOCUS_14930 gene ssuE 6879 7400 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_14930 7514 8488 gene locus_tag LOCUS_14940 7514 8488 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399250.1 protein_id gnl|my_center|LOCUS_14940 8880 9014 gene locus_tag LOCUS_14950 8880 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10501 9101 gene locus_tag LOCUS_14960 10501 9101 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443594.1 protein_id gnl|my_center|LOCUS_14960 11204 10464 gene locus_tag LOCUS_14970 11204 10464 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033865.1 protein_id gnl|my_center|LOCUS_14970 11448 11194 gene locus_tag LOCUS_14980 11448 11194 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252989.1 protein_id gnl|my_center|LOCUS_14980 12016 11699 gene locus_tag LOCUS_14990 12016 11699 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234326.1 protein_id gnl|my_center|LOCUS_14990 12217 13386 gene locus_tag LOCUS_15000 gene rodA 12217 13386 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723329.1 protein_id gnl|my_center|LOCUS_15000 13529 13915 gene locus_tag LOCUS_15010 gene mscL 13529 13915 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267011.1 protein_id gnl|my_center|LOCUS_15010 14068 14988 gene locus_tag LOCUS_15020 14068 14988 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_15020 15214 15083 gene locus_tag LOCUS_15030 15214 15083 CDS product YuzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228571.1 protein_id gnl|my_center|LOCUS_15030 15420 17801 gene locus_tag LOCUS_15040 15420 17801 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_15040 17870 19048 gene locus_tag LOCUS_15050 17870 19048 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 protein_id gnl|my_center|LOCUS_15050 19079 20866 gene locus_tag LOCUS_15060 19079 20866 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025016.1 protein_id gnl|my_center|LOCUS_15060 21367 21723 gene locus_tag LOCUS_15070 21367 21723 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_15070 21824 22207 gene locus_tag LOCUS_15080 gene gcvH 21824 22207 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_15080 22410 24857 gene locus_tag LOCUS_15090 22410 24857 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_15090 25077 25436 gene locus_tag LOCUS_15100 25077 25436 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640870.1 protein_id gnl|my_center|LOCUS_15100 25436 25747 gene locus_tag LOCUS_15110 25436 25747 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002008881.1 protein_id gnl|my_center|LOCUS_15110 26034 26384 gene locus_tag LOCUS_15120 26034 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 26697 27737 gene locus_tag LOCUS_15130 gene metN 26697 27737 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_15130 27730 28398 gene locus_tag LOCUS_15140 27730 28398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359401.1 protein_id gnl|my_center|LOCUS_15140 28415 29263 gene locus_tag LOCUS_15150 gene metQ 28415 29263 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735103.1 protein_id gnl|my_center|LOCUS_15150 30045 30830 gene locus_tag LOCUS_15160 gene sufC 30045 30830 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_15160 30849 32159 gene locus_tag LOCUS_15170 gene sufD 30849 32159 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 protein_id gnl|my_center|LOCUS_15170 32159 33388 gene locus_tag LOCUS_15180 gene sufS 32159 33388 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020767.1 protein_id gnl|my_center|LOCUS_15180 33378 33812 gene locus_tag LOCUS_15190 gene sufU 33378 33812 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_15190 33839 35236 gene locus_tag LOCUS_15200 gene sufB 33839 35236 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_15200 36928 35354 gene locus_tag LOCUS_15210 36928 35354 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437455.1 protein_id gnl|my_center|LOCUS_15210 37120 39729 gene locus_tag LOCUS_15220 37120 39729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 39745 40692 gene locus_tag LOCUS_15230 39745 40692 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_15230 40783 41550 gene locus_tag LOCUS_15240 gene phnC 40783 41550 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_15240 41547 42350 gene locus_tag LOCUS_15250 gene phnE 41547 42350 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000761.1 protein_id gnl|my_center|LOCUS_15250 42347 43132 gene locus_tag LOCUS_15260 gene phnE 42347 43132 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191092.1 protein_id gnl|my_center|LOCUS_15260 43680 44525 gene locus_tag LOCUS_15270 43680 44525 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 protein_id gnl|my_center|LOCUS_15270 44604 45428 gene locus_tag LOCUS_15280 44604 45428 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455762.1 protein_id gnl|my_center|LOCUS_15280 45428 46819 gene locus_tag LOCUS_15290 45428 46819 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 protein_id gnl|my_center|LOCUS_15290 46877 47179 gene locus_tag LOCUS_15300 46877 47179 CDS product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248466.1 protein_id gnl|my_center|LOCUS_15300 47256 48017 gene locus_tag LOCUS_15310 gene yunB 47256 48017 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 protein_id gnl|my_center|LOCUS_15310 48431 50005 gene locus_tag LOCUS_15320 48431 50005 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_15320 50459 51973 gene locus_tag LOCUS_15330 50459 51973 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450066.1 protein_id gnl|my_center|LOCUS_15330 53144 52143 gene locus_tag LOCUS_15340 gene lytH 53144 52143 CDS product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 protein_id gnl|my_center|LOCUS_15340 53525 54448 gene locus_tag LOCUS_15350 gene lipA 53525 54448 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_15350 55780 55109 gene locus_tag LOCUS_15360 55780 55109 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 protein_id gnl|my_center|LOCUS_15360 55984 56259 gene locus_tag LOCUS_15370 55984 56259 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 protein_id gnl|my_center|LOCUS_15370 56593 56279 gene locus_tag LOCUS_15380 56593 56279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 56930 56667 gene locus_tag LOCUS_15390 56930 56667 CDS product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392606.1 protein_id gnl|my_center|LOCUS_15390 57073 57510 gene locus_tag LOCUS_15400 57073 57510 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228684.1 protein_id gnl|my_center|LOCUS_15400 57581 58345 gene locus_tag LOCUS_15410 57581 58345 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 protein_id gnl|my_center|LOCUS_15410 59309 58803 gene locus_tag LOCUS_15420 59309 58803 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243814.1 protein_id gnl|my_center|LOCUS_15420 59510 60517 gene locus_tag LOCUS_15430 gene cotS 59510 60517 CDS product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614215.1 protein_id gnl|my_center|LOCUS_15430 60593 61570 gene locus_tag LOCUS_15440 60593 61570 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_15440 61867 61631 gene locus_tag LOCUS_15450 61867 61631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 62037 62360 gene locus_tag LOCUS_15460 62037 62360 CDS product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 protein_id gnl|my_center|LOCUS_15460 63761 62733 gene locus_tag LOCUS_15470 63761 62733 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 protein_id gnl|my_center|LOCUS_15470 64646 64882 gene locus_tag LOCUS_15480 64646 64882 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222913.1 protein_id gnl|my_center|LOCUS_15480 65855 65160 gene locus_tag LOCUS_15490 65855 65160 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 protein_id gnl|my_center|LOCUS_15490 66097 66459 gene locus_tag LOCUS_15500 66097 66459 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_15500 67586 66588 gene locus_tag LOCUS_15510 gene yumC 67586 66588 CDS product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 protein_id gnl|my_center|LOCUS_15510 68220 68089 gene locus_tag LOCUS_15520 68220 68089 CDS product YuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243733.1 protein_id gnl|my_center|LOCUS_15520 68427 68744 gene locus_tag LOCUS_15530 68427 68744 CDS product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027007.1 protein_id gnl|my_center|LOCUS_15530 68983 69636 gene locus_tag LOCUS_15540 gene spsC 68983 69636 CDS product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 protein_id gnl|my_center|LOCUS_15540 70477 69671 gene locus_tag LOCUS_15550 70477 69671 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_15550 70612 72102 gene locus_tag LOCUS_15560 70612 72102 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 protein_id gnl|my_center|LOCUS_15560 72391 72531 gene locus_tag LOCUS_15570 72391 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence016 256 1059 gene locus_tag LOCUS_15580 gene suhB 256 1059 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 protein_id gnl|my_center|LOCUS_15580 1646 1461 gene locus_tag LOCUS_15590 1646 1461 CDS product YlaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245500.1 protein_id gnl|my_center|LOCUS_15590 2075 3913 gene locus_tag LOCUS_15600 gene typA 2075 3913 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914763.1 protein_id gnl|my_center|LOCUS_15600 3934 4248 gene locus_tag LOCUS_15610 3934 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4765 4565 gene locus_tag LOCUS_15620 4765 4565 CDS product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995040.1 protein_id gnl|my_center|LOCUS_15620 5557 4946 gene locus_tag LOCUS_15630 5557 4946 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 protein_id gnl|my_center|LOCUS_15630 5888 7216 gene locus_tag LOCUS_15640 5888 7216 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 protein_id gnl|my_center|LOCUS_15640 7378 8505 gene locus_tag LOCUS_15650 7378 8505 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_15650 9119 8625 gene locus_tag LOCUS_15660 9119 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289792.1 protein_id gnl|my_center|LOCUS_15660 9578 9859 gene locus_tag LOCUS_15670 9578 9859 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 protein_id gnl|my_center|LOCUS_15670 10127 11323 gene locus_tag LOCUS_15680 gene ftsW 10127 11323 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 protein_id gnl|my_center|LOCUS_15680 11389 14832 gene locus_tag LOCUS_15690 gene pyc 11389 14832 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164080.1 protein_id gnl|my_center|LOCUS_15690 15981 15070 gene locus_tag LOCUS_15700 gene ctaA 15981 15070 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188743.1 protein_id gnl|my_center|LOCUS_15700 16495 17409 gene locus_tag LOCUS_15710 gene ctaB 16495 17409 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015052.1 protein_id gnl|my_center|LOCUS_15710 17492 18571 gene locus_tag LOCUS_15720 gene coxB 17492 18571 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 protein_id gnl|my_center|LOCUS_15720 18608 20485 gene locus_tag LOCUS_15730 gene ctaD 18608 20485 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_15730 20485 21114 gene locus_tag LOCUS_15740 gene ctaE 20485 21114 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 protein_id gnl|my_center|LOCUS_15740 21119 21451 gene locus_tag LOCUS_15750 gene ctaF 21119 21451 CDS product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985698.1 protein_id gnl|my_center|LOCUS_15750 21707 22621 gene locus_tag LOCUS_15760 gene ctaG 21707 22621 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069017.1 protein_id gnl|my_center|LOCUS_15760 22923 23384 gene locus_tag LOCUS_15770 22923 23384 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830117.1 protein_id gnl|my_center|LOCUS_15770 24492 23434 gene locus_tag LOCUS_15780 gene ytvI 24492 23434 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_15780 25052 24693 gene locus_tag LOCUS_15790 25052 24693 CDS product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160950.1 protein_id gnl|my_center|LOCUS_15790 25437 26459 gene locus_tag LOCUS_15800 25437 26459 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 protein_id gnl|my_center|LOCUS_15800 27054 26539 gene locus_tag LOCUS_15810 27054 26539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 27238 27654 gene locus_tag LOCUS_15820 27238 27654 CDS product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143346.1 protein_id gnl|my_center|LOCUS_15820 27670 27927 gene locus_tag LOCUS_15830 27670 27927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 28011 28403 gene locus_tag LOCUS_15840 28011 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 28457 28906 gene locus_tag LOCUS_15850 gene ricF 28457 28906 CDS product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 protein_id gnl|my_center|LOCUS_15850 28990 29265 gene locus_tag LOCUS_15860 28990 29265 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080814.1 protein_id gnl|my_center|LOCUS_15860 29723 29334 gene locus_tag LOCUS_15870 29723 29334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616017.1 protein_id gnl|my_center|LOCUS_15870 30119 31426 gene locus_tag LOCUS_15880 30119 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 31935 32498 gene locus_tag LOCUS_15890 gene rsmD 31935 32498 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232227.1 protein_id gnl|my_center|LOCUS_15890 32547 33026 gene locus_tag LOCUS_15900 gene coaD 32547 33026 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 protein_id gnl|my_center|LOCUS_15900 34498 33287 gene locus_tag LOCUS_15910 gene ylbJ 34498 33287 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 protein_id gnl|my_center|LOCUS_15910 34841 35635 gene locus_tag LOCUS_15920 34841 35635 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 protein_id gnl|my_center|LOCUS_15920 35625 36662 gene locus_tag LOCUS_15930 35625 36662 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989884.1 protein_id gnl|my_center|LOCUS_15930 38096 36861 gene locus_tag LOCUS_15940 38096 36861 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_15940 38502 39017 gene locus_tag LOCUS_15950 38502 39017 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872145.1 protein_id gnl|my_center|LOCUS_15950 39085 39258 gene locus_tag LOCUS_15960 gene rpmF 39085 39258 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_15960 39442 40212 gene locus_tag LOCUS_15970 39442 40212 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_15970 40335 40877 gene locus_tag LOCUS_15980 gene gerR 40335 40877 CDS product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 protein_id gnl|my_center|LOCUS_15980 41397 40939 gene locus_tag LOCUS_15990 41397 40939 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244940.1 protein_id gnl|my_center|LOCUS_15990 41772 42665 gene locus_tag LOCUS_16000 gene panE 41772 42665 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782397.1 protein_id gnl|my_center|LOCUS_16000 42665 43051 gene locus_tag LOCUS_16010 42665 43051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 43253 44881 gene locus_tag LOCUS_16020 gene bshC 43253 44881 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 protein_id gnl|my_center|LOCUS_16020 45217 45648 gene locus_tag LOCUS_16030 gene mraZ 45217 45648 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_16030 45672 46607 gene locus_tag LOCUS_16040 gene rsmH 45672 46607 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_16040 46631 46993 gene locus_tag LOCUS_16050 46631 46993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 46990 49233 gene locus_tag LOCUS_16060 46990 49233 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731976.1 protein_id gnl|my_center|LOCUS_16060 49537 51456 gene locus_tag LOCUS_16070 49537 51456 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_16070 52078 53538 gene locus_tag LOCUS_16080 52078 53538 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_16080 53543 53992 gene locus_tag LOCUS_16090 53543 53992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 53998 54969 gene locus_tag LOCUS_16100 gene mraY 53998 54969 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_16100 54970 56322 gene locus_tag LOCUS_16110 gene murD 54970 56322 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_16110 56435 57535 gene locus_tag LOCUS_16120 gene spoVE 56435 57535 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_16120 57921 59018 gene locus_tag LOCUS_16130 gene murG 57921 59018 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_16130 59254 60024 gene locus_tag LOCUS_16140 gene divIB 59254 60024 CDS product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 protein_id gnl|my_center|LOCUS_16140 60014 60733 gene locus_tag LOCUS_16150 60014 60733 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 protein_id gnl|my_center|LOCUS_16150 60759 61478 gene locus_tag LOCUS_16160 60759 61478 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967184.1 protein_id gnl|my_center|LOCUS_16160 61498 61851 gene locus_tag LOCUS_16170 61498 61851 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 protein_id gnl|my_center|LOCUS_16170 61977 63269 gene locus_tag LOCUS_16180 gene ftsA 61977 63269 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 protein_id gnl|my_center|LOCUS_16180 63309 64469 gene locus_tag LOCUS_16190 gene ftsZ 63309 64469 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 protein_id gnl|my_center|LOCUS_16190 64953 65876 gene locus_tag LOCUS_16200 gene spoIIGA 64953 65876 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 protein_id gnl|my_center|LOCUS_16200 66014 66733 gene locus_tag LOCUS_16210 gene sigE 66014 66733 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence017 136 209 gene locus_tag LOCUS_t00050 136 209 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 292 367 gene locus_tag LOCUS_t00060 292 367 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 387 462 gene locus_tag LOCUS_t00070 387 462 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 469 561 gene locus_tag LOCUS_t00080 469 561 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 698 773 gene locus_tag LOCUS_t00090 698 773 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 778 854 gene locus_tag LOCUS_t00100 778 854 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 883 955 gene locus_tag LOCUS_t00110 883 955 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 963 1047 gene locus_tag LOCUS_t00120 963 1047 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1103 1178 gene locus_tag LOCUS_t00130 1103 1178 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1187 1261 gene locus_tag LOCUS_t00140 1187 1261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1283 1356 gene locus_tag LOCUS_t00150 1283 1356 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1365 1441 gene locus_tag LOCUS_t00160 1365 1441 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1459 1533 gene locus_tag LOCUS_t00170 1459 1533 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1705 1780 gene locus_tag LOCUS_t00180 1705 1780 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2177 1953 gene locus_tag LOCUS_16220 2177 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2504 2184 gene locus_tag LOCUS_16230 2504 2184 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_16230 3898 2678 gene locus_tag LOCUS_16240 3898 2678 CDS product DUF6080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861056.1 protein_id gnl|my_center|LOCUS_16240 4064 4954 gene locus_tag LOCUS_16250 4064 4954 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_16250 4977 5324 gene locus_tag LOCUS_16260 4977 5324 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986781.1 protein_id gnl|my_center|LOCUS_16260 5355 5762 gene locus_tag LOCUS_16270 5355 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 7203 5827 gene locus_tag LOCUS_16280 7203 5827 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247526.1 protein_id gnl|my_center|LOCUS_16280 7393 8655 gene locus_tag LOCUS_16290 7393 8655 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015312606.1 protein_id gnl|my_center|LOCUS_16290 8954 11683 gene locus_tag LOCUS_16300 8954 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 11863 12585 gene locus_tag LOCUS_16310 11863 12585 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021473.1 protein_id gnl|my_center|LOCUS_16310 12591 12941 gene locus_tag LOCUS_16320 12591 12941 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985167.1 protein_id gnl|my_center|LOCUS_16320 12938 13279 gene locus_tag LOCUS_16330 12938 13279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 protein_id gnl|my_center|LOCUS_16330 13269 14543 gene locus_tag LOCUS_16340 13269 14543 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015312606.1 protein_id gnl|my_center|LOCUS_16340 14708 15247 gene locus_tag LOCUS_16350 14708 15247 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_16350 15375 16505 gene locus_tag LOCUS_16360 gene ugpC 15375 16505 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571379.1 protein_id gnl|my_center|LOCUS_16360 16502 17434 gene locus_tag LOCUS_16370 16502 17434 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_16370 17431 18243 gene locus_tag LOCUS_16380 17431 18243 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635946.1 protein_id gnl|my_center|LOCUS_16380 18262 19608 gene locus_tag LOCUS_16390 18262 19608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060609.1 protein_id gnl|my_center|LOCUS_16390 20393 19653 gene locus_tag LOCUS_16400 gene tatC 20393 19653 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246495.1 protein_id gnl|my_center|LOCUS_16400 20702 20505 gene locus_tag LOCUS_16410 20702 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 22361 20718 gene locus_tag LOCUS_16420 22361 20718 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_16420 23328 23543 gene locus_tag LOCUS_16430 23328 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 23884 24339 gene locus_tag LOCUS_16440 23884 24339 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_16440 24497 25882 gene locus_tag LOCUS_16450 gene tcyP 24497 25882 CDS product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 protein_id gnl|my_center|LOCUS_16450 26304 26026 gene locus_tag LOCUS_16460 26304 26026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 27010 26381 gene locus_tag LOCUS_16470 27010 26381 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963528.1 protein_id gnl|my_center|LOCUS_16470 28524 27112 gene locus_tag LOCUS_16480 28524 27112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 30849 28558 gene locus_tag LOCUS_16490 30849 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 31348 32571 gene locus_tag LOCUS_16500 31348 32571 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_16500 33774 32929 gene locus_tag LOCUS_16510 33774 32929 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 protein_id gnl|my_center|LOCUS_16510 34018 34698 gene locus_tag LOCUS_16520 34018 34698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 35062 36081 gene locus_tag LOCUS_16530 35062 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 36524 37387 gene locus_tag LOCUS_16540 36524 37387 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 protein_id gnl|my_center|LOCUS_16540 38722 37451 gene locus_tag LOCUS_16550 gene uraA 38722 37451 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815817.1 protein_id gnl|my_center|LOCUS_16550 38713 38919 gene locus_tag LOCUS_16560 38713 38919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 39003 39863 gene locus_tag LOCUS_16570 39003 39863 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948986.1 protein_id gnl|my_center|LOCUS_16570 40047 40319 gene locus_tag LOCUS_16580 40047 40319 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391619.1 protein_id gnl|my_center|LOCUS_16580 40393 41142 gene locus_tag LOCUS_16590 40393 41142 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_16590 41162 42421 gene locus_tag LOCUS_16600 41162 42421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 42445 44157 gene locus_tag LOCUS_16610 42445 44157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 44431 44931 gene locus_tag LOCUS_16620 44431 44931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 46967 45564 gene locus_tag LOCUS_16630 46967 45564 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_16630 47557 48639 gene locus_tag LOCUS_16640 gene serC 47557 48639 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_16640 48658 49833 gene locus_tag LOCUS_16650 48658 49833 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_16650 51162 49957 gene locus_tag LOCUS_16660 51162 49957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 51934 51272 gene locus_tag LOCUS_16670 51934 51272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 52427 53281 gene locus_tag LOCUS_16680 52427 53281 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231267.1 protein_id gnl|my_center|LOCUS_16680 55551 53353 gene locus_tag LOCUS_16690 55551 53353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 57488 55863 gene locus_tag LOCUS_16700 57488 55863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 57781 59205 gene locus_tag LOCUS_16710 57781 59205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 59602 59414 gene locus_tag LOCUS_16720 59602 59414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 59624 60808 gene locus_tag LOCUS_16730 gene csaB 59624 60808 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241591.1 protein_id gnl|my_center|LOCUS_16730 60814 61914 gene locus_tag LOCUS_16740 60814 61914 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_16740 61918 62394 gene locus_tag LOCUS_16750 61918 62394 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_16750 62391 62876 gene locus_tag LOCUS_16760 62391 62876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 62887 64407 gene locus_tag LOCUS_16770 gene murJ 62887 64407 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582940.1 protein_id gnl|my_center|LOCUS_16770 64595 65653 gene locus_tag LOCUS_16780 64595 65653 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence018 1114 98 gene locus_tag LOCUS_16790 1114 98 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840950.1 protein_id gnl|my_center|LOCUS_16790 1399 1166 gene locus_tag LOCUS_16800 gene moaD 1399 1166 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621786.1 protein_id gnl|my_center|LOCUS_16800 1854 1396 gene locus_tag LOCUS_16810 gene moaE 1854 1396 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_16810 2472 1867 gene locus_tag LOCUS_16820 2472 1867 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_16820 2706 3521 gene locus_tag LOCUS_16830 gene pdxK 2706 3521 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174258.1 protein_id gnl|my_center|LOCUS_16830 3704 4051 gene locus_tag LOCUS_16840 3704 4051 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 protein_id gnl|my_center|LOCUS_16840 4094 4783 gene locus_tag LOCUS_16850 gene bshB2 4094 4783 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456851.1 protein_id gnl|my_center|LOCUS_16850 5268 4981 gene locus_tag LOCUS_16860 5268 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6850 5591 gene locus_tag LOCUS_16870 gene ilvA 6850 5591 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 protein_id gnl|my_center|LOCUS_16870 7249 8607 gene locus_tag LOCUS_16880 7249 8607 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 protein_id gnl|my_center|LOCUS_16880 9793 8837 gene locus_tag LOCUS_16890 9793 8837 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723125.1 protein_id gnl|my_center|LOCUS_16890 11291 10101 gene locus_tag LOCUS_16900 11291 10101 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095906.1 protein_id gnl|my_center|LOCUS_16900 11611 12690 gene locus_tag LOCUS_16910 11611 12690 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829303.1 protein_id gnl|my_center|LOCUS_16910 13153 13022 gene locus_tag LOCUS_16920 13153 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 13335 14150 gene locus_tag LOCUS_16930 13335 14150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722772.1 protein_id gnl|my_center|LOCUS_16930 15316 14225 gene locus_tag LOCUS_16940 15316 14225 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147460.1 protein_id gnl|my_center|LOCUS_16940 15753 15469 gene locus_tag LOCUS_16950 15753 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 16473 15979 gene locus_tag LOCUS_16960 gene ybaK 16473 15979 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_16960 16645 17295 gene locus_tag LOCUS_16970 16645 17295 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389711.1 protein_id gnl|my_center|LOCUS_16970 17668 19191 gene locus_tag LOCUS_16980 17668 19191 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429812.1 protein_id gnl|my_center|LOCUS_16980 21513 19585 gene locus_tag LOCUS_16990 gene ltaS 21513 19585 CDS product lipoteichoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233694.1 protein_id gnl|my_center|LOCUS_16990 21697 23841 gene locus_tag LOCUS_17000 21697 23841 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047982.1 protein_id gnl|my_center|LOCUS_17000 25114 23954 gene locus_tag LOCUS_17010 gene trpB 25114 23954 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937396.1 protein_id gnl|my_center|LOCUS_17010 25420 26154 gene locus_tag LOCUS_17020 25420 26154 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828243.1 protein_id gnl|my_center|LOCUS_17020 27957 26299 gene locus_tag LOCUS_17030 27957 26299 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_17030 28932 28144 gene locus_tag LOCUS_17040 28932 28144 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258428.1 protein_id gnl|my_center|LOCUS_17040 30393 29704 gene locus_tag LOCUS_17050 30393 29704 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_17050 31068 30484 gene locus_tag LOCUS_17060 31068 30484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 32264 31080 gene locus_tag LOCUS_17070 32264 31080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 32790 32969 gene locus_tag LOCUS_17080 32790 32969 CDS product small acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244276.1 protein_id gnl|my_center|LOCUS_17080 33612 33181 gene locus_tag LOCUS_17090 33612 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 33981 33631 gene locus_tag LOCUS_17100 33981 33631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 36690 34429 gene locus_tag LOCUS_17110 36690 34429 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986267.1 protein_id gnl|my_center|LOCUS_17110 37360 36668 gene locus_tag LOCUS_17120 37360 36668 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 protein_id gnl|my_center|LOCUS_17120 39349 37640 gene locus_tag LOCUS_17130 39349 37640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 39759 41003 gene locus_tag LOCUS_17140 gene pepT 39759 41003 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_17140 42314 41016 gene locus_tag LOCUS_17150 42314 41016 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665473.1 protein_id gnl|my_center|LOCUS_17150 43699 42767 gene locus_tag LOCUS_17160 gene ppaC 43699 42767 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 protein_id gnl|my_center|LOCUS_17160 44702 43824 gene locus_tag LOCUS_17170 44702 43824 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968370.1 protein_id gnl|my_center|LOCUS_17170 47745 44857 gene locus_tag LOCUS_17180 47745 44857 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126795678.1 protein_id gnl|my_center|LOCUS_17180 48502 48107 gene locus_tag LOCUS_17190 48502 48107 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714149.1 protein_id gnl|my_center|LOCUS_17190 50716 48644 gene locus_tag LOCUS_17200 50716 48644 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_17200 52036 50900 gene locus_tag LOCUS_17210 52036 50900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 53086 52046 gene locus_tag LOCUS_17220 53086 52046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 54280 53324 gene locus_tag LOCUS_17230 gene msrB 54280 53324 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290155.1 protein_id gnl|my_center|LOCUS_17230 55740 54412 gene locus_tag LOCUS_17240 gene brnQ 55740 54412 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 protein_id gnl|my_center|LOCUS_17240 56304 56990 gene locus_tag LOCUS_17250 gene bceR 56304 56990 CDS product two-component response regulator BceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399109.1 protein_id gnl|my_center|LOCUS_17250 56992 57996 gene locus_tag LOCUS_17260 gene bceS 56992 57996 CDS product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 protein_id gnl|my_center|LOCUS_17260 58097 58858 gene locus_tag LOCUS_17270 gene bceA 58097 58858 CDS product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 protein_id gnl|my_center|LOCUS_17270 58848 60794 gene locus_tag LOCUS_17280 gene bceB 58848 60794 CDS product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 protein_id gnl|my_center|LOCUS_17280 60951 62294 gene locus_tag LOCUS_17290 60951 62294 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_17290 63131 62814 gene locus_tag LOCUS_17300 63131 62814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 64240 63476 gene locus_tag LOCUS_17310 64240 63476 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838616.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence019 985 1194 gene locus_tag LOCUS_17320 985 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1337 2512 gene locus_tag LOCUS_17330 1337 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2827 3324 gene locus_tag LOCUS_17340 2827 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4403 3594 gene locus_tag LOCUS_17350 4403 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17350 5808 4345 gene locus_tag LOCUS_17360 5808 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9186 6001 gene locus_tag LOCUS_17370 9186 6001 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_17370 12306 9199 gene locus_tag LOCUS_17380 12306 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 15195 12325 gene locus_tag LOCUS_17390 15195 12325 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_17390 16729 15758 gene locus_tag LOCUS_17400 16729 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 17544 17110 gene locus_tag LOCUS_17410 17544 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 18855 17866 gene locus_tag LOCUS_17420 18855 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 19468 19641 gene locus_tag LOCUS_17430 19468 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 19638 21140 gene locus_tag LOCUS_17440 19638 21140 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_17440 21223 22938 gene locus_tag LOCUS_17450 21223 22938 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_17450 23358 22879 gene locus_tag LOCUS_17460 gene rlmH 23358 22879 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027000.1 protein_id gnl|my_center|LOCUS_17460 23600 23442 gene locus_tag LOCUS_17470 23600 23442 CDS product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002183021.1 protein_id gnl|my_center|LOCUS_17470 24962 23748 gene locus_tag LOCUS_17480 gene htrC 24962 23748 CDS product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 protein_id gnl|my_center|LOCUS_17480 25947 25153 gene locus_tag LOCUS_17490 25947 25153 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 protein_id gnl|my_center|LOCUS_17490 26753 25965 gene locus_tag LOCUS_17500 gene walI 26753 25965 CDS product WalRK two-component regulatory system regulator WalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244037.1 protein_id gnl|my_center|LOCUS_17500 28071 26740 gene locus_tag LOCUS_17510 gene yycH 28071 26740 CDS product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061593.1 protein_id gnl|my_center|LOCUS_17510 29891 28071 gene locus_tag LOCUS_17520 gene walK 29891 28071 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 protein_id gnl|my_center|LOCUS_17520 30607 29897 gene locus_tag LOCUS_17530 gene yycF 30607 29897 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 protein_id gnl|my_center|LOCUS_17530 31383 31310 gene locus_tag LOCUS_t00190 31383 31310 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 31523 31447 gene locus_tag LOCUS_t00200 31523 31447 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31638 31565 gene locus_tag LOCUS_t00210 31638 31565 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31722 31647 gene locus_tag LOCUS_t00220 31722 31647 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32734 31943 gene locus_tag LOCUS_17540 32734 31943 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_17540 33978 32764 gene locus_tag LOCUS_17550 33978 32764 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_17550 34755 33994 gene locus_tag LOCUS_17560 gene pxpA 34755 33994 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_17560 35057 35803 gene locus_tag LOCUS_17570 gene pxpB 35057 35803 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672257.1 protein_id gnl|my_center|LOCUS_17570 35794 36783 gene locus_tag LOCUS_17580 35794 36783 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 protein_id gnl|my_center|LOCUS_17580 37659 36904 gene locus_tag LOCUS_17590 37659 36904 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026361.1 protein_id gnl|my_center|LOCUS_17590 39359 38073 gene locus_tag LOCUS_17600 gene purA 39359 38073 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_17600 41017 39653 gene locus_tag LOCUS_17610 gene dnaB 41017 39653 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_17610 41867 41418 gene locus_tag LOCUS_17620 gene rplI 41867 41418 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_17620 43837 41864 gene locus_tag LOCUS_17630 gene gdpP 43837 41864 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_17630 44778 43873 gene locus_tag LOCUS_17640 44778 43873 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799151.1 protein_id gnl|my_center|LOCUS_17640 47215 45206 gene locus_tag LOCUS_17650 47215 45206 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003782.1 protein_id gnl|my_center|LOCUS_17650 47827 47588 gene locus_tag LOCUS_17660 gene rpsR 47827 47588 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721669.1 protein_id gnl|my_center|LOCUS_17660 48373 47867 gene locus_tag LOCUS_17670 gene ssb 48373 47867 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981967.1 protein_id gnl|my_center|LOCUS_17670 48785 48498 gene locus_tag LOCUS_17680 gene rpsF 48785 48498 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_17680 49452 48931 gene locus_tag LOCUS_17690 49452 48931 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868582.1 protein_id gnl|my_center|LOCUS_17690 50716 51285 gene locus_tag LOCUS_17700 gene acuA 50716 51285 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581400.1 protein_id gnl|my_center|LOCUS_17700 51300 51488 gene locus_tag LOCUS_17710 51300 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 52680 51580 gene locus_tag LOCUS_17720 gene ychF 52680 51580 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 protein_id gnl|my_center|LOCUS_17720 53168 52968 gene locus_tag LOCUS_17730 53168 52968 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_17730 54083 53184 gene locus_tag LOCUS_17740 54083 53184 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_17740 54274 54888 gene locus_tag LOCUS_17750 gene yyaC 54274 54888 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_17750 55785 55078 gene locus_tag LOCUS_17760 55785 55078 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236018.1 protein_id gnl|my_center|LOCUS_17760 56877 56026 gene locus_tag LOCUS_17770 gene spo0J 56877 56026 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051839.1 protein_id gnl|my_center|LOCUS_17770 57631 56870 gene locus_tag LOCUS_17780 gene soj 57631 56870 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_17780 58740 57898 gene locus_tag LOCUS_17790 gene noc 58740 57898 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 protein_id gnl|my_center|LOCUS_17790 59736 59020 gene locus_tag LOCUS_17800 gene rsmG 59736 59020 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_17800 61643 59757 gene locus_tag LOCUS_17810 gene mnmG 61643 59757 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_17810 63056 61671 gene locus_tag LOCUS_17820 gene mnmE 63056 61671 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence020 1930 659 gene locus_tag LOCUS_17830 gene clpX 1930 659 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_17830 3523 2237 gene locus_tag LOCUS_17840 gene tig 3523 2237 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_17840 4680 3676 gene locus_tag LOCUS_17850 4680 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4995 4921 gene locus_tag LOCUS_t00230 4995 4921 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5637 5128 gene locus_tag LOCUS_17860 5637 5128 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989714.1 protein_id gnl|my_center|LOCUS_17860 6243 5644 gene locus_tag LOCUS_17870 6243 5644 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 protein_id gnl|my_center|LOCUS_17870 7006 6260 gene locus_tag LOCUS_17880 7006 6260 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261764.1 protein_id gnl|my_center|LOCUS_17880 8181 7111 gene locus_tag LOCUS_17890 gene gerM 8181 7111 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 protein_id gnl|my_center|LOCUS_17890 9081 8281 gene locus_tag LOCUS_17900 gene racE 9081 8281 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723856.1 protein_id gnl|my_center|LOCUS_17900 9550 9074 gene locus_tag LOCUS_17910 9550 9074 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 protein_id gnl|my_center|LOCUS_17910 10220 9996 gene locus_tag LOCUS_17920 gene gerE 10220 9996 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_17920 10820 10350 gene locus_tag LOCUS_17930 10820 10350 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822735.1 protein_id gnl|my_center|LOCUS_17930 11827 11060 gene locus_tag LOCUS_17940 gene sdhB 11827 11060 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_17940 13597 11846 gene locus_tag LOCUS_17950 gene sdhA 13597 11846 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676737.1 protein_id gnl|my_center|LOCUS_17950 14300 13692 gene locus_tag LOCUS_17960 gene sdhC 14300 13692 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_17960 14619 15044 gene locus_tag LOCUS_17970 14619 15044 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733801.1 protein_id gnl|my_center|LOCUS_17970 17030 15261 gene locus_tag LOCUS_17980 gene uvrC 17030 15261 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_17980 18487 17027 gene locus_tag LOCUS_17990 18487 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 19736 18783 gene locus_tag LOCUS_18000 19736 18783 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706367.1 protein_id gnl|my_center|LOCUS_18000 20519 19761 gene locus_tag LOCUS_18010 20519 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 21341 20568 gene locus_tag LOCUS_18020 21341 20568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 22843 21386 gene locus_tag LOCUS_18030 22843 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 23286 22840 gene locus_tag LOCUS_18040 23286 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 24712 23759 gene locus_tag LOCUS_18050 24712 23759 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_18050 26115 24919 gene locus_tag LOCUS_18060 26115 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 26595 26281 gene locus_tag LOCUS_18070 gene trxA 26595 26281 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 protein_id gnl|my_center|LOCUS_18070 27877 26897 gene locus_tag LOCUS_18080 gene etfA 27877 26897 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_18080 28684 27911 gene locus_tag LOCUS_18090 gene etfB 28684 27911 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029028.1 protein_id gnl|my_center|LOCUS_18090 29529 28756 gene locus_tag LOCUS_18100 29529 28756 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911295.1 protein_id gnl|my_center|LOCUS_18100 30141 29560 gene locus_tag LOCUS_18110 30141 29560 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_18110 31949 30261 gene locus_tag LOCUS_18120 31949 30261 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_18120 32810 32403 gene locus_tag LOCUS_18130 32810 32403 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 protein_id gnl|my_center|LOCUS_18130 35189 32832 gene locus_tag LOCUS_18140 35189 32832 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893750.1 protein_id gnl|my_center|LOCUS_18140 36929 35211 gene locus_tag LOCUS_18150 gene polX 36929 35211 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867515.1 protein_id gnl|my_center|LOCUS_18150 37841 37299 gene locus_tag LOCUS_18160 37841 37299 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 protein_id gnl|my_center|LOCUS_18160 38109 37849 gene locus_tag LOCUS_18170 gene zapA 38109 37849 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082701.1 protein_id gnl|my_center|LOCUS_18170 38194 39141 gene locus_tag LOCUS_18180 gene rnhC 38194 39141 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_18180 41697 39283 gene locus_tag LOCUS_18190 gene pheT 41697 39283 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_18190 42770 41730 gene locus_tag LOCUS_18200 gene pheS 42770 41730 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_18200 43997 43224 gene locus_tag LOCUS_18210 43997 43224 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_18210 44118 44327 gene locus_tag LOCUS_18220 gene sspI 44118 44327 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009509.1 protein_id gnl|my_center|LOCUS_18220 45492 44407 gene locus_tag LOCUS_18230 45492 44407 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 protein_id gnl|my_center|LOCUS_18230 45464 45637 gene locus_tag LOCUS_18240 45464 45637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 45711 46007 gene locus_tag LOCUS_18250 45711 46007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 46032 46562 gene locus_tag LOCUS_18260 46032 46562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 46559 48175 gene locus_tag LOCUS_18270 46559 48175 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_18270 48677 48240 gene locus_tag LOCUS_18280 gene dut 48677 48240 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_18280 50596 50237 gene locus_tag LOCUS_18290 gene rplT 50596 50237 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_18290 50823 50623 gene locus_tag LOCUS_18300 gene rpmI 50823 50623 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 protein_id gnl|my_center|LOCUS_18300 51352 50849 gene locus_tag LOCUS_18310 gene infC 51352 50849 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_18310 53647 51716 gene locus_tag LOCUS_18320 gene thrS 53647 51716 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_18320 54918 54052 gene locus_tag LOCUS_18330 gene ytxC 54918 54052 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569611.1 protein_id gnl|my_center|LOCUS_18330 55934 55002 gene locus_tag LOCUS_18340 gene dnaI 55934 55002 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400112.1 protein_id gnl|my_center|LOCUS_18340 57352 55931 gene locus_tag LOCUS_18350 gene dnaB 57352 55931 CDS product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 protein_id gnl|my_center|LOCUS_18350 58004 57546 gene locus_tag LOCUS_18360 gene nrdR 58004 57546 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_18360 58827 58453 gene locus_tag LOCUS_18370 gene speD 58827 58453 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 protein_id gnl|my_center|LOCUS_18370 60245 59214 gene locus_tag LOCUS_18380 60245 59214 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198972.1 protein_id gnl|my_center|LOCUS_18380 61013 60411 gene locus_tag LOCUS_18390 gene coaE 61013 60411 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 protein_id gnl|my_center|LOCUS_18390 61680 61045 gene locus_tag LOCUS_18400 gene ytaF 61680 61045 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 protein_id gnl|my_center|LOCUS_18400 62653 61805 gene locus_tag LOCUS_18410 gene mutM 62653 61805 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence021 532 969 gene locus_tag LOCUS_18420 532 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 987 1370 gene locus_tag LOCUS_18430 987 1370 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_18430 1500 2561 gene locus_tag LOCUS_18440 1500 2561 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_18440 2688 4304 gene locus_tag LOCUS_18450 2688 4304 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_18450 4599 4354 gene locus_tag LOCUS_18460 4599 4354 CDS product YkuS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101022.1 protein_id gnl|my_center|LOCUS_18460 4852 5244 gene locus_tag LOCUS_18470 4852 5244 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461358.1 protein_id gnl|my_center|LOCUS_18470 5219 5905 gene locus_tag LOCUS_18480 5219 5905 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461357.1 protein_id gnl|my_center|LOCUS_18480 5959 6090 gene locus_tag LOCUS_18490 5959 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 6439 7665 gene locus_tag LOCUS_18500 6439 7665 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_18500 7662 8480 gene locus_tag LOCUS_18510 7662 8480 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 protein_id gnl|my_center|LOCUS_18510 8622 9191 gene locus_tag LOCUS_18520 8622 9191 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851111.1 protein_id gnl|my_center|LOCUS_18520 9308 10366 gene locus_tag LOCUS_18530 9308 10366 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762579.1 protein_id gnl|my_center|LOCUS_18530 10377 11117 gene locus_tag LOCUS_18540 10377 11117 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099545.1 protein_id gnl|my_center|LOCUS_18540 11359 13707 gene locus_tag LOCUS_18550 11359 13707 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208599863.1 protein_id gnl|my_center|LOCUS_18550 13825 15324 gene locus_tag LOCUS_18560 gene narK 13825 15324 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841841.1 protein_id gnl|my_center|LOCUS_18560 15458 19141 gene locus_tag LOCUS_18570 15458 19141 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_18570 19131 20681 gene locus_tag LOCUS_18580 gene narH 19131 20681 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_18580 20656 21186 gene locus_tag LOCUS_18590 gene narJ 20656 21186 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 protein_id gnl|my_center|LOCUS_18590 21214 21918 gene locus_tag LOCUS_18600 gene narI 21214 21918 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969195.1 protein_id gnl|my_center|LOCUS_18600 22005 22433 gene locus_tag LOCUS_18610 22005 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 22677 23282 gene locus_tag LOCUS_18620 gene tenI 22677 23282 CDS product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232908.1 protein_id gnl|my_center|LOCUS_18620 23287 24417 gene locus_tag LOCUS_18630 gene thiO 23287 24417 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335173.1 protein_id gnl|my_center|LOCUS_18630 24414 24617 gene locus_tag LOCUS_18640 gene thiS 24414 24617 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049507.1 protein_id gnl|my_center|LOCUS_18640 24622 25389 gene locus_tag LOCUS_18650 gene thiG 24622 25389 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 protein_id gnl|my_center|LOCUS_18650 25386 26411 gene locus_tag LOCUS_18660 gene thiF 25386 26411 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 protein_id gnl|my_center|LOCUS_18660 26648 28048 gene locus_tag LOCUS_18670 26648 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 29288 28107 gene locus_tag LOCUS_18680 29288 28107 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_18680 29408 29734 gene locus_tag LOCUS_18690 29408 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 29896 30036 gene locus_tag LOCUS_18700 29896 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 30684 32135 gene locus_tag LOCUS_18710 gene cshA 30684 32135 CDS product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246685.1 protein_id gnl|my_center|LOCUS_18710 32330 32476 gene locus_tag LOCUS_18720 32330 32476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 32669 32872 gene locus_tag LOCUS_18730 32669 32872 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216166.1 protein_id gnl|my_center|LOCUS_18730 32958 33434 gene locus_tag LOCUS_18740 gene spoVAC 32958 33434 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146953.1 protein_id gnl|my_center|LOCUS_18740 33436 34455 gene locus_tag LOCUS_18750 gene spoVAD 33436 34455 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938965.1 protein_id gnl|my_center|LOCUS_18750 34452 34658 gene locus_tag LOCUS_18760 34452 34658 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215913.1 protein_id gnl|my_center|LOCUS_18760 34676 35533 gene locus_tag LOCUS_18770 34676 35533 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018922.1 protein_id gnl|my_center|LOCUS_18770 35701 36060 gene locus_tag LOCUS_18780 gene rtp 35701 36060 CDS product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 protein_id gnl|my_center|LOCUS_18780 37041 36178 gene locus_tag LOCUS_18790 gene mneS 37041 36178 CDS product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 protein_id gnl|my_center|LOCUS_18790 37117 37302 gene locus_tag LOCUS_18800 37117 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 37639 39201 gene locus_tag LOCUS_18810 37639 39201 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_18810 39591 40745 gene locus_tag LOCUS_18820 39591 40745 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_18820 41329 43359 gene locus_tag LOCUS_18830 41329 43359 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533168.1 protein_id gnl|my_center|LOCUS_18830 43372 45348 gene locus_tag LOCUS_18840 43372 45348 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_18840 45477 45641 gene locus_tag LOCUS_18850 45477 45641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 46130 46786 gene locus_tag LOCUS_18860 46130 46786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 47528 46833 gene locus_tag LOCUS_18870 47528 46833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 48346 47525 gene locus_tag LOCUS_18880 48346 47525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 48792 48343 gene locus_tag LOCUS_18890 48792 48343 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865665.1 protein_id gnl|my_center|LOCUS_18890 50105 48789 gene locus_tag LOCUS_18900 50105 48789 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_18900 50545 51105 gene locus_tag LOCUS_18910 gene thiT 50545 51105 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246583.1 protein_id gnl|my_center|LOCUS_18910 51235 51804 gene locus_tag LOCUS_18920 51235 51804 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_18920 52136 52666 gene locus_tag LOCUS_18930 52136 52666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 53010 53591 gene locus_tag LOCUS_18940 53010 53591 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045791.1 protein_id gnl|my_center|LOCUS_18940 53698 54372 gene locus_tag LOCUS_18950 53698 54372 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015543.1 protein_id gnl|my_center|LOCUS_18950 56312 54693 gene locus_tag LOCUS_18960 56312 54693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_18960 56520 57779 gene locus_tag LOCUS_18970 56520 57779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 protein_id gnl|my_center|LOCUS_18970 57941 58126 gene locus_tag LOCUS_18980 57941 58126 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234008.1 protein_id gnl|my_center|LOCUS_18980 58288 59043 gene locus_tag LOCUS_18990 58288 59043 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 protein_id gnl|my_center|LOCUS_18990 59067 59276 gene locus_tag LOCUS_19000 59067 59276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 59921 59214 gene locus_tag LOCUS_19010 59921 59214 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_19010 60107 60850 gene locus_tag LOCUS_19020 gene map 60107 60850 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002096176.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence022 1422 139 gene locus_tag LOCUS_19030 gene aceA 1422 139 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 protein_id gnl|my_center|LOCUS_19030 3041 1449 gene locus_tag LOCUS_19040 gene aceB 3041 1449 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107325.1 protein_id gnl|my_center|LOCUS_19040 4799 3633 gene locus_tag LOCUS_19050 4799 3633 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 protein_id gnl|my_center|LOCUS_19050 6376 4883 gene locus_tag LOCUS_19060 6376 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6711 8045 gene locus_tag LOCUS_19070 6711 8045 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375121.1 protein_id gnl|my_center|LOCUS_19070 8059 10230 gene locus_tag LOCUS_19080 8059 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 10227 12107 gene locus_tag LOCUS_19090 10227 12107 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435847.1 protein_id gnl|my_center|LOCUS_19090 12095 12631 gene locus_tag LOCUS_19100 12095 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 13114 12884 gene locus_tag LOCUS_19110 13114 12884 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_19110 13377 13796 gene locus_tag LOCUS_19120 13377 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 13867 14193 gene locus_tag LOCUS_19130 13867 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 14206 14628 gene locus_tag LOCUS_19140 14206 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 14898 14683 gene locus_tag LOCUS_19150 14898 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 16016 14979 gene locus_tag LOCUS_19160 16016 14979 CDS product IS1595-like element ISSsu9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775606.1 protein_id gnl|my_center|LOCUS_19160 15984 16196 gene locus_tag LOCUS_19170 15984 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 16528 16343 gene locus_tag LOCUS_19180 16528 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 18707 16593 gene locus_tag LOCUS_19190 18707 16593 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_19190 19068 18700 gene locus_tag LOCUS_19200 19068 18700 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 protein_id gnl|my_center|LOCUS_19200 19263 19898 gene locus_tag LOCUS_19210 19263 19898 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_19210 22211 20277 gene locus_tag LOCUS_19220 22211 20277 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249724.1 protein_id gnl|my_center|LOCUS_19220 22507 24039 gene locus_tag LOCUS_19230 22507 24039 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_19230 24056 24997 gene locus_tag LOCUS_19240 24056 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19240 25414 25142 gene locus_tag LOCUS_19250 25414 25142 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_19250 25664 25482 gene locus_tag LOCUS_19260 25664 25482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 25805 26164 gene locus_tag LOCUS_19270 25805 26164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 26464 26604 gene locus_tag LOCUS_19280 26464 26604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 28802 26811 gene locus_tag LOCUS_19290 gene ligA 28802 26811 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_19290 29410 28799 gene locus_tag LOCUS_19300 29410 28799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 30845 29445 gene locus_tag LOCUS_19310 30845 29445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 32819 31068 gene locus_tag LOCUS_19320 32819 31068 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680466.1 protein_id gnl|my_center|LOCUS_19320 34227 33448 gene locus_tag LOCUS_19330 34227 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 34957 34253 gene locus_tag LOCUS_19340 34957 34253 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272099.1 protein_id gnl|my_center|LOCUS_19340 35437 35135 gene locus_tag LOCUS_19350 35437 35135 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_19350 36489 35464 gene locus_tag LOCUS_19360 36489 35464 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_19360 38550 36811 gene locus_tag LOCUS_19370 38550 36811 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517625.1 protein_id gnl|my_center|LOCUS_19370 38680 38952 gene locus_tag LOCUS_19380 38680 38952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 40383 39115 gene locus_tag LOCUS_19390 gene purD 40383 39115 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 protein_id gnl|my_center|LOCUS_19390 42271 40736 gene locus_tag LOCUS_19400 gene purH 42271 40736 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_19400 42870 42268 gene locus_tag LOCUS_19410 gene purN 42870 42268 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_19410 44009 42972 gene locus_tag LOCUS_19420 gene purM 44009 42972 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 protein_id gnl|my_center|LOCUS_19420 45693 44275 gene locus_tag LOCUS_19430 gene purF 45693 44275 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_19430 47897 45669 gene locus_tag LOCUS_19440 gene purL 47897 45669 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 protein_id gnl|my_center|LOCUS_19440 48564 47881 gene locus_tag LOCUS_19450 gene purQ 48564 47881 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_19450 48815 48561 gene locus_tag LOCUS_19460 gene purS 48815 48561 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278823.1 protein_id gnl|my_center|LOCUS_19460 49528 48803 gene locus_tag LOCUS_19470 gene purC 49528 48803 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170544.1 protein_id gnl|my_center|LOCUS_19470 50932 49640 gene locus_tag LOCUS_19480 gene purB 50932 49640 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_19480 52087 50960 gene locus_tag LOCUS_19490 gene purK 52087 50960 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_19490 52568 52080 gene locus_tag LOCUS_19500 gene purE 52568 52080 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 protein_id gnl|my_center|LOCUS_19500 53119 52922 gene locus_tag LOCUS_19510 53119 52922 CDS product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166303.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence023 1183 983 gene locus_tag LOCUS_19520 1183 983 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 protein_id gnl|my_center|LOCUS_19520 3400 1430 gene locus_tag LOCUS_19530 3400 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5484 3415 gene locus_tag LOCUS_19540 5484 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706312.1 protein_id gnl|my_center|LOCUS_19540 6611 5727 gene locus_tag LOCUS_19550 6611 5727 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099971.1 protein_id gnl|my_center|LOCUS_19550 6719 7726 gene locus_tag LOCUS_19560 6719 7726 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461666.1 protein_id gnl|my_center|LOCUS_19560 8814 7861 gene locus_tag LOCUS_19570 gene argF 8814 7861 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 protein_id gnl|my_center|LOCUS_19570 11933 8811 gene locus_tag LOCUS_19580 11933 8811 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 protein_id gnl|my_center|LOCUS_19580 12375 11962 gene locus_tag LOCUS_19590 12375 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 12683 13186 gene locus_tag LOCUS_19600 12683 13186 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_19600 13626 14633 gene locus_tag LOCUS_19610 gene mreBH 13626 14633 CDS product cell shape-determining protein MreBH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245743.1 protein_id gnl|my_center|LOCUS_19610 15533 15760 gene locus_tag LOCUS_19620 15533 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 16749 15850 gene locus_tag LOCUS_19630 16749 15850 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410481.1 protein_id gnl|my_center|LOCUS_19630 17365 19230 gene locus_tag LOCUS_19640 17365 19230 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_19640 19208 22654 gene locus_tag LOCUS_19650 gene metH 19208 22654 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_19650 23009 22812 gene locus_tag LOCUS_19660 23009 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 23057 23239 gene locus_tag LOCUS_19670 23057 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 23914 23417 gene locus_tag LOCUS_19680 gene queF 23914 23417 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_19680 24238 24816 gene locus_tag LOCUS_19690 24238 24816 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 protein_id gnl|my_center|LOCUS_19690 26860 25142 gene locus_tag LOCUS_19700 gene acsA 26860 25142 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_19700 27275 28600 gene locus_tag LOCUS_19710 27275 28600 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_19710 29112 28657 gene locus_tag LOCUS_19720 29112 28657 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062763.1 protein_id gnl|my_center|LOCUS_19720 29153 31271 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttaaatcccactacgttcagataaaag 31689 31426 gene locus_tag LOCUS_19730 gene cas2 31689 31426 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546411.1 protein_id gnl|my_center|LOCUS_19730 32679 31696 gene locus_tag LOCUS_19740 gene cas1b 32679 31696 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_19740 33184 32669 gene locus_tag LOCUS_19750 gene cas4 33184 32669 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180703501.1 protein_id gnl|my_center|LOCUS_19750 35526 33199 gene locus_tag LOCUS_19760 35526 33199 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_19760 36240 35527 gene locus_tag LOCUS_19770 gene cas5b 36240 35527 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_19770 37126 36221 gene locus_tag LOCUS_19780 gene cas7i 37126 36221 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_19780 38931 37141 gene locus_tag LOCUS_19790 38931 37141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 39640 38909 gene locus_tag LOCUS_19800 gene cas6 39640 38909 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861772.1 protein_id gnl|my_center|LOCUS_19800 40051 41578 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttaaatcccactacgttcagataaaag 42250 41801 gene locus_tag LOCUS_19810 42250 41801 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062763.1 protein_id gnl|my_center|LOCUS_19810 42515 43228 gene locus_tag LOCUS_19820 42515 43228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229230.1 protein_id gnl|my_center|LOCUS_19820 43221 44363 gene locus_tag LOCUS_19830 43221 44363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 46045 45323 gene locus_tag LOCUS_19840 46045 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 46410 46051 gene locus_tag LOCUS_19850 46410 46051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 47075 46410 gene locus_tag LOCUS_19860 47075 46410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 47868 47068 gene locus_tag LOCUS_19870 47868 47068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 49229 47910 gene locus_tag LOCUS_19880 49229 47910 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_19880 49852 49226 gene locus_tag LOCUS_19890 49852 49226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_19890 51730 49856 gene locus_tag LOCUS_19900 gene nosZ 51730 49856 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_19900 52195 51749 gene locus_tag LOCUS_19910 52195 51749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942628.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence024 103 873 gene locus_tag LOCUS_19920 gene istB 103 873 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_19920 1231 1306 gene locus_tag LOCUS_t00240 1231 1306 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3647 1695 gene locus_tag LOCUS_19930 3647 1695 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_19930 4158 3637 gene locus_tag LOCUS_19940 4158 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5265 4279 gene locus_tag LOCUS_19950 5265 4279 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_19950 6166 5618 gene locus_tag LOCUS_19960 6166 5618 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243814.1 protein_id gnl|my_center|LOCUS_19960 6367 7098 gene locus_tag LOCUS_19970 6367 7098 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 protein_id gnl|my_center|LOCUS_19970 7402 7908 gene locus_tag LOCUS_19980 7402 7908 CDS product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 protein_id gnl|my_center|LOCUS_19980 7916 8341 gene locus_tag LOCUS_19990 7916 8341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 protein_id gnl|my_center|LOCUS_19990 8445 9143 gene locus_tag LOCUS_20000 8445 9143 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 protein_id gnl|my_center|LOCUS_20000 9765 9511 gene locus_tag LOCUS_20010 gene spoVIF 9765 9511 CDS product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 protein_id gnl|my_center|LOCUS_20010 10295 10149 gene locus_tag LOCUS_20020 10295 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 10799 10443 gene locus_tag LOCUS_20030 gene spoVAE 10799 10443 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_20030 11572 11102 gene locus_tag LOCUS_20040 gene spoVAC 11572 11102 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146953.1 protein_id gnl|my_center|LOCUS_20040 12057 11590 gene locus_tag LOCUS_20050 12057 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 12979 12203 gene locus_tag LOCUS_20060 gene fabI 12979 12203 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_20060 15090 13231 gene locus_tag LOCUS_20070 15090 13231 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 protein_id gnl|my_center|LOCUS_20070 15623 16363 gene locus_tag LOCUS_20080 gene prpE 15623 16363 CDS product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872716.1 protein_id gnl|my_center|LOCUS_20080 17287 16394 gene locus_tag LOCUS_20090 17287 16394 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 protein_id gnl|my_center|LOCUS_20090 18131 17337 gene locus_tag LOCUS_20100 18131 17337 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 protein_id gnl|my_center|LOCUS_20100 18788 18144 gene locus_tag LOCUS_20110 18788 18144 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722788.1 protein_id gnl|my_center|LOCUS_20110 19224 18850 gene locus_tag LOCUS_20120 19224 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180003.1 protein_id gnl|my_center|LOCUS_20120 19407 19994 gene locus_tag LOCUS_20130 19407 19994 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262290.1 protein_id gnl|my_center|LOCUS_20130 20036 20662 gene locus_tag LOCUS_20140 20036 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 20844 21248 gene locus_tag LOCUS_20150 20844 21248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043386.1 protein_id gnl|my_center|LOCUS_20150 21245 22096 gene locus_tag LOCUS_20160 gene spxH 21245 22096 CDS product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 protein_id gnl|my_center|LOCUS_20160 24557 22737 gene locus_tag LOCUS_20170 gene pepF 24557 22737 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_20170 24930 24634 gene locus_tag LOCUS_20180 24930 24634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 27517 26009 gene locus_tag LOCUS_20190 27517 26009 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_20190 28514 27801 gene locus_tag LOCUS_20200 gene mecA 28514 27801 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 protein_id gnl|my_center|LOCUS_20200 29804 29409 gene locus_tag LOCUS_20210 gene spxA 29804 29409 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 protein_id gnl|my_center|LOCUS_20210 30768 30193 gene locus_tag LOCUS_20220 30768 30193 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244921.1 protein_id gnl|my_center|LOCUS_20220 31965 31027 gene locus_tag LOCUS_20230 gene oppF 31965 31027 CDS product oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245567.1 protein_id gnl|my_center|LOCUS_20230 33034 31967 gene locus_tag LOCUS_20240 gene oppD 33034 31967 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 protein_id gnl|my_center|LOCUS_20240 34083 33055 gene locus_tag LOCUS_20250 34083 33055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 protein_id gnl|my_center|LOCUS_20250 35012 34083 gene locus_tag LOCUS_20260 35012 34083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_20260 36775 35132 gene locus_tag LOCUS_20270 36775 35132 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 protein_id gnl|my_center|LOCUS_20270 37199 37582 gene locus_tag LOCUS_20280 37199 37582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 38079 39065 gene locus_tag LOCUS_20290 gene trpS 38079 39065 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 protein_id gnl|my_center|LOCUS_20290 39845 39099 gene locus_tag LOCUS_20300 39845 39099 CDS product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966134.1 protein_id gnl|my_center|LOCUS_20300 40164 39952 gene locus_tag LOCUS_20310 40164 39952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 41081 40314 gene locus_tag LOCUS_20320 41081 40314 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 protein_id gnl|my_center|LOCUS_20320 42450 41209 gene locus_tag LOCUS_20330 gene fabF 42450 41209 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_20330 43446 42514 gene locus_tag LOCUS_20340 gene fabH 43446 42514 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100539.1 protein_id gnl|my_center|LOCUS_20340 43869 44141 gene locus_tag LOCUS_20350 43869 44141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 44528 44337 gene locus_tag LOCUS_20360 gene comZ 44528 44337 CDS product ComG operon transcriptional repressor ComZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224559.1 protein_id gnl|my_center|LOCUS_20360 45502 44525 gene locus_tag LOCUS_20370 gene med 45502 44525 CDS product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 protein_id gnl|my_center|LOCUS_20370 46611 45808 gene locus_tag LOCUS_20380 46611 45808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 47398 46661 gene locus_tag LOCUS_20390 47398 46661 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028702.1 protein_id gnl|my_center|LOCUS_20390 47680 47862 gene locus_tag LOCUS_20400 47680 47862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence025 746 1207 gene locus_tag LOCUS_20410 gene ctsR 746 1207 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244565.1 protein_id gnl|my_center|LOCUS_20410 1227 1775 gene locus_tag LOCUS_20420 gene mcsA 1227 1775 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_20420 1772 2848 gene locus_tag LOCUS_20430 1772 2848 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_20430 2852 5293 gene locus_tag LOCUS_20440 gene clpC 2852 5293 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_20440 5400 6776 gene locus_tag LOCUS_20450 gene radA 5400 6776 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_20450 6776 7849 gene locus_tag LOCUS_20460 gene disA 6776 7849 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392163.1 protein_id gnl|my_center|LOCUS_20460 8041 9129 gene locus_tag LOCUS_20470 8041 9129 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_20470 9142 9828 gene locus_tag LOCUS_20480 gene ispD 9142 9828 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_20480 9847 10326 gene locus_tag LOCUS_20490 gene ispF 9847 10326 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_20490 10480 11937 gene locus_tag LOCUS_20500 gene gltX 10480 11937 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_20500 12325 12999 gene locus_tag LOCUS_20510 gene cysE 12325 12999 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_20510 12980 14377 gene locus_tag LOCUS_20520 gene cysS 12980 14377 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 protein_id gnl|my_center|LOCUS_20520 14381 14806 gene locus_tag LOCUS_20530 14381 14806 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564262.1 protein_id gnl|my_center|LOCUS_20530 14803 15552 gene locus_tag LOCUS_20540 gene rlmB 14803 15552 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 protein_id gnl|my_center|LOCUS_20540 15555 16064 gene locus_tag LOCUS_20550 gene rae1 15555 16064 CDS product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 protein_id gnl|my_center|LOCUS_20550 16133 16780 gene locus_tag LOCUS_20560 16133 16780 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_20560 17047 17232 gene locus_tag LOCUS_20570 gene secE 17047 17232 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241323.1 protein_id gnl|my_center|LOCUS_20570 17423 17956 gene locus_tag LOCUS_20580 gene nusG 17423 17956 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_20580 18128 18553 gene locus_tag LOCUS_20590 gene rplK 18128 18553 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_20590 18673 19365 gene locus_tag LOCUS_20600 gene rplA 18673 19365 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_20600 19608 20111 gene locus_tag LOCUS_20610 gene rplJ 19608 20111 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_20610 20172 20537 gene locus_tag LOCUS_20620 gene rplL 20172 20537 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159736.1 protein_id gnl|my_center|LOCUS_20620 20708 21310 gene locus_tag LOCUS_20630 20708 21310 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235045.1 protein_id gnl|my_center|LOCUS_20630 21553 25110 gene locus_tag LOCUS_20640 gene rpoB 21553 25110 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_20640 25163 28765 gene locus_tag LOCUS_20650 gene rpoC 25163 28765 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_20650 28886 29137 gene locus_tag LOCUS_20660 28886 29137 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 protein_id gnl|my_center|LOCUS_20660 29232 29651 gene locus_tag LOCUS_20670 gene rpsL 29232 29651 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_20670 29694 30164 gene locus_tag LOCUS_20680 gene rpsG 29694 30164 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_20680 30210 32288 gene locus_tag LOCUS_20690 gene fusA 30210 32288 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 protein_id gnl|my_center|LOCUS_20690 32419 33606 gene locus_tag LOCUS_20700 gene tuf 32419 33606 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 protein_id gnl|my_center|LOCUS_20700 34359 34667 gene locus_tag LOCUS_20710 gene rpsJ 34359 34667 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 protein_id gnl|my_center|LOCUS_20710 34703 35332 gene locus_tag LOCUS_20720 gene rplC 34703 35332 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_20720 35363 35986 gene locus_tag LOCUS_20730 gene rplD 35363 35986 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_20730 35986 36270 gene locus_tag LOCUS_20740 gene rplW 35986 36270 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720948.1 protein_id gnl|my_center|LOCUS_20740 36299 37129 gene locus_tag LOCUS_20750 gene rplB 36299 37129 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_20750 37190 37468 gene locus_tag LOCUS_20760 gene rpsS 37190 37468 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156472.1 protein_id gnl|my_center|LOCUS_20760 37487 37828 gene locus_tag LOCUS_20770 gene rplV 37487 37828 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_20770 37832 38488 gene locus_tag LOCUS_20780 gene rpsC 37832 38488 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720944.1 protein_id gnl|my_center|LOCUS_20780 38492 38926 gene locus_tag LOCUS_20790 gene rplP 38492 38926 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_20790 38916 39116 gene locus_tag LOCUS_20800 gene rpmC 38916 39116 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_20800 39141 39404 gene locus_tag LOCUS_20810 gene rpsQ 39141 39404 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004106.1 protein_id gnl|my_center|LOCUS_20810 39450 39818 gene locus_tag LOCUS_20820 gene rplN 39450 39818 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615921.1 protein_id gnl|my_center|LOCUS_20820 39858 40169 gene locus_tag LOCUS_20830 gene rplX 39858 40169 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_20830 40195 40734 gene locus_tag LOCUS_20840 gene rplE 40195 40734 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_20840 40760 40945 gene locus_tag LOCUS_20850 gene rpsN 40760 40945 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_20850 40975 41373 gene locus_tag LOCUS_20860 gene rpsH 40975 41373 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_20860 41404 41940 gene locus_tag LOCUS_20870 gene rplF 41404 41940 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_20870 41975 42337 gene locus_tag LOCUS_20880 gene rplR 41975 42337 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_20880 42359 42859 gene locus_tag LOCUS_20890 gene rpsE 42359 42859 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_20890 42872 43054 gene locus_tag LOCUS_20900 gene rpmD 42872 43054 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_20900 43086 43526 gene locus_tag LOCUS_20910 gene rplO 43086 43526 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_20910 43526 44818 gene locus_tag LOCUS_20920 gene secY 43526 44818 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399662.1 protein_id gnl|my_center|LOCUS_20920 44875 45528 gene locus_tag LOCUS_20930 44875 45528 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_20930 46238 46456 gene locus_tag LOCUS_20940 gene infA 46238 46456 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_20940 46626 46991 gene locus_tag LOCUS_20950 gene rpsM 46626 46991 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_20950 47014 47403 gene locus_tag LOCUS_20960 gene rpsK 47014 47403 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence026 207 653 gene locus_tag LOCUS_20970 207 653 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_20970 1796 723 gene locus_tag LOCUS_20980 1796 723 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031514.1 protein_id gnl|my_center|LOCUS_20980 2122 2442 gene locus_tag LOCUS_20990 2122 2442 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723577.1 protein_id gnl|my_center|LOCUS_20990 3410 2568 gene locus_tag LOCUS_21000 3410 2568 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436855.1 protein_id gnl|my_center|LOCUS_21000 4611 3967 gene locus_tag LOCUS_21010 gene trmB 4611 3967 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_21010 4870 5148 gene locus_tag LOCUS_21020 4870 5148 CDS product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122235.1 protein_id gnl|my_center|LOCUS_21020 5920 5150 gene locus_tag LOCUS_21030 5920 5150 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055736.1 protein_id gnl|my_center|LOCUS_21030 7376 6396 gene locus_tag LOCUS_21040 7376 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 protein_id gnl|my_center|LOCUS_21040 7940 7398 gene locus_tag LOCUS_21050 gene thpR 7940 7398 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418986.1 protein_id gnl|my_center|LOCUS_21050 8292 9224 gene locus_tag LOCUS_21060 gene cysK 8292 9224 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 protein_id gnl|my_center|LOCUS_21060 10755 9331 gene locus_tag LOCUS_21070 gene pepV 10755 9331 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274260.1 protein_id gnl|my_center|LOCUS_21070 11308 11529 gene locus_tag LOCUS_21080 11308 11529 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 protein_id gnl|my_center|LOCUS_21080 12352 11624 gene locus_tag LOCUS_21090 12352 11624 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 protein_id gnl|my_center|LOCUS_21090 13447 12404 gene locus_tag LOCUS_21100 gene cobT 13447 12404 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437772.1 protein_id gnl|my_center|LOCUS_21100 13652 13858 gene locus_tag LOCUS_21110 13652 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 15611 13989 gene locus_tag LOCUS_21120 15611 13989 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732534.1 protein_id gnl|my_center|LOCUS_21120 15746 17014 gene locus_tag LOCUS_21130 15746 17014 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558883.1 protein_id gnl|my_center|LOCUS_21130 17236 17054 gene locus_tag LOCUS_21140 17236 17054 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 protein_id gnl|my_center|LOCUS_21140 17419 18096 gene locus_tag LOCUS_21150 17419 18096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_21150 18149 19324 gene locus_tag LOCUS_21160 18149 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 20895 20008 gene locus_tag LOCUS_21170 20895 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 21143 20907 gene locus_tag LOCUS_21180 21143 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 21838 21158 gene locus_tag LOCUS_21190 21838 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 22426 22112 gene locus_tag LOCUS_21200 22426 22112 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141204.1 protein_id gnl|my_center|LOCUS_21200 24956 22545 gene locus_tag LOCUS_21210 gene leuS 24956 22545 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_21210 26527 25334 gene locus_tag LOCUS_21220 26527 25334 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 protein_id gnl|my_center|LOCUS_21220 27106 26951 gene locus_tag LOCUS_21230 27106 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 27390 27103 gene locus_tag LOCUS_21240 27390 27103 CDS product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229117.1 protein_id gnl|my_center|LOCUS_21240 27598 28560 gene locus_tag LOCUS_21250 27598 28560 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 protein_id gnl|my_center|LOCUS_21250 28557 29147 gene locus_tag LOCUS_21260 28557 29147 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764471.1 protein_id gnl|my_center|LOCUS_21260 30233 29229 gene locus_tag LOCUS_21270 30233 29229 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_21270 31380 30322 gene locus_tag LOCUS_21280 gene tbcS 31380 30322 CDS product tetraprenyl-beta-curcumene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399076.1 protein_id gnl|my_center|LOCUS_21280 32204 31395 gene locus_tag LOCUS_21290 gene ytpA 32204 31395 CDS product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 protein_id gnl|my_center|LOCUS_21290 32307 32822 gene locus_tag LOCUS_21300 32307 32822 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_21300 32887 33717 gene locus_tag LOCUS_21310 32887 33717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 35935 34046 gene locus_tag LOCUS_21320 gene asnB 35935 34046 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_21320 37366 36167 gene locus_tag LOCUS_21330 gene metK 37366 36167 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_21330 38176 39762 gene locus_tag LOCUS_21340 gene pckA 38176 39762 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108804.1 protein_id gnl|my_center|LOCUS_21340 40067 39825 gene locus_tag LOCUS_21350 40067 39825 CDS product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398611.1 protein_id gnl|my_center|LOCUS_21350 40926 40108 gene locus_tag LOCUS_21360 40926 40108 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246204.1 protein_id gnl|my_center|LOCUS_21360 41049 42059 gene locus_tag LOCUS_21370 41049 42059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245977.1 protein_id gnl|my_center|LOCUS_21370 42258 43028 gene locus_tag LOCUS_21380 42258 43028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229092.1 protein_id gnl|my_center|LOCUS_21380 43015 43827 gene locus_tag LOCUS_21390 43015 43827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 protein_id gnl|my_center|LOCUS_21390 44303 43824 gene locus_tag LOCUS_21400 gene ytkD 44303 43824 CDS product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229087.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence027 1799 318 gene locus_tag LOCUS_21410 gene putP 1799 318 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687602.1 protein_id gnl|my_center|LOCUS_21410 2292 2582 gene locus_tag LOCUS_21420 gene gatC 2292 2582 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 protein_id gnl|my_center|LOCUS_21420 2598 4055 gene locus_tag LOCUS_21430 gene gatA 2598 4055 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 protein_id gnl|my_center|LOCUS_21430 4070 5500 gene locus_tag LOCUS_21440 gene gatB 4070 5500 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_21440 5643 6389 gene locus_tag LOCUS_21450 5643 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287728.1 protein_id gnl|my_center|LOCUS_21450 6783 7355 gene locus_tag LOCUS_21460 6783 7355 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_21460 7359 8150 gene locus_tag LOCUS_21470 7359 8150 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080600.1 protein_id gnl|my_center|LOCUS_21470 9345 8191 gene locus_tag LOCUS_21480 9345 8191 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 protein_id gnl|my_center|LOCUS_21480 10112 9342 gene locus_tag LOCUS_21490 gene argB 10112 9342 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 protein_id gnl|my_center|LOCUS_21490 11358 10123 gene locus_tag LOCUS_21500 gene argJ 11358 10123 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241357.1 protein_id gnl|my_center|LOCUS_21500 12413 11376 gene locus_tag LOCUS_21510 gene argC 12413 11376 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861219.1 protein_id gnl|my_center|LOCUS_21510 12633 13202 gene locus_tag LOCUS_21520 12633 13202 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 protein_id gnl|my_center|LOCUS_21520 13790 13308 gene locus_tag LOCUS_21530 13790 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 14119 14922 gene locus_tag LOCUS_21540 14119 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 15041 15955 gene locus_tag LOCUS_21550 15041 15955 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_21550 16252 17595 gene locus_tag LOCUS_21560 gene rlmD 16252 17595 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_21560 18128 20062 gene locus_tag LOCUS_21570 18128 20062 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_21570 20903 20229 gene locus_tag LOCUS_21580 20903 20229 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724076.1 protein_id gnl|my_center|LOCUS_21580 21055 20906 gene locus_tag LOCUS_21590 21055 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 21122 21280 gene locus_tag LOCUS_21600 21122 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21600 21752 21937 gene locus_tag LOCUS_21610 21752 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 22333 21953 gene locus_tag LOCUS_21620 22333 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 22578 22333 gene locus_tag LOCUS_21630 22578 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 23245 22898 gene locus_tag LOCUS_21640 23245 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 23916 23761 gene locus_tag LOCUS_21650 23916 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 24598 24119 gene locus_tag LOCUS_21660 24598 24119 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801042.1 protein_id gnl|my_center|LOCUS_21660 24705 25667 gene locus_tag LOCUS_21670 24705 25667 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_21670 25784 26128 gene locus_tag LOCUS_21680 25784 26128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 26908 27525 gene locus_tag LOCUS_21690 26908 27525 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_21690 27783 28766 gene locus_tag LOCUS_21700 27783 28766 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566703.1 protein_id gnl|my_center|LOCUS_21700 29375 29052 gene locus_tag LOCUS_21710 29375 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 29806 29384 gene locus_tag LOCUS_21720 29806 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 30609 30022 gene locus_tag LOCUS_21730 30609 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 31503 30616 gene locus_tag LOCUS_21740 31503 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 33016 32642 gene locus_tag LOCUS_21750 33016 32642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21750 33480 35078 gene locus_tag LOCUS_21760 gene gerKA 33480 35078 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_21760 35687 36892 gene locus_tag LOCUS_21770 35687 36892 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_21770 36966 38072 gene locus_tag LOCUS_21780 36966 38072 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393537.1 protein_id gnl|my_center|LOCUS_21780 39174 38074 gene locus_tag LOCUS_21790 39174 38074 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393537.1 protein_id gnl|my_center|LOCUS_21790 39467 39670 gene locus_tag LOCUS_21800 39467 39670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 39708 39890 gene locus_tag LOCUS_21810 39708 39890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21810 39920 40234 gene locus_tag LOCUS_21820 39920 40234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 40737 41258 gene locus_tag LOCUS_21830 40737 41258 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301974.1 protein_id gnl|my_center|LOCUS_21830 41999 41559 gene locus_tag LOCUS_21840 41999 41559 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987100.1 protein_id gnl|my_center|LOCUS_21840 42491 43441 gene locus_tag LOCUS_21850 42491 43441 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643657.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence028 628 158 gene locus_tag LOCUS_21860 628 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 946 647 gene locus_tag LOCUS_21870 946 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2287 1052 gene locus_tag LOCUS_21880 2287 1052 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551899.1 protein_id gnl|my_center|LOCUS_21880 3218 2436 gene locus_tag LOCUS_21890 3218 2436 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504233.1 protein_id gnl|my_center|LOCUS_21890 3428 3643 gene locus_tag LOCUS_21900 3428 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4461 3640 gene locus_tag LOCUS_21910 4461 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 5542 5060 gene locus_tag LOCUS_21920 5542 5060 CDS product antitoxin YezG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997347.1 protein_id gnl|my_center|LOCUS_21920 7274 5535 gene locus_tag LOCUS_21930 7274 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 7566 7288 gene locus_tag LOCUS_21940 7566 7288 CDS product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244193.1 protein_id gnl|my_center|LOCUS_21940 7958 7623 gene locus_tag LOCUS_21950 7958 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 8492 8046 gene locus_tag LOCUS_21960 8492 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 11118 8521 gene locus_tag LOCUS_21970 11118 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 15596 11115 gene locus_tag LOCUS_21980 gene essC 15596 11115 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243866.1 protein_id gnl|my_center|LOCUS_21980 16960 15608 gene locus_tag LOCUS_21990 gene essB 16960 15608 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243575.1 protein_id gnl|my_center|LOCUS_21990 17214 16975 gene locus_tag LOCUS_22000 gene yukD 17214 16975 CDS product ESX secretion system protein YukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228763.1 protein_id gnl|my_center|LOCUS_22000 17595 17302 gene locus_tag LOCUS_22010 17595 17302 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220661.1 protein_id gnl|my_center|LOCUS_22010 18485 17991 gene locus_tag LOCUS_22020 gene dfrA 18485 17991 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_22020 19535 18579 gene locus_tag LOCUS_22030 gene thyA 19535 18579 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679609.1 protein_id gnl|my_center|LOCUS_22030 19750 21921 gene locus_tag LOCUS_22040 19750 21921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 23562 22249 gene locus_tag LOCUS_22050 23562 22249 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768549.1 protein_id gnl|my_center|LOCUS_22050 23783 25156 gene locus_tag LOCUS_22060 23783 25156 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 protein_id gnl|my_center|LOCUS_22060 25264 26529 gene locus_tag LOCUS_22070 25264 26529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 26686 27474 gene locus_tag LOCUS_22080 26686 27474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 27564 28949 gene locus_tag LOCUS_22090 27564 28949 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139120446.1 protein_id gnl|my_center|LOCUS_22090 30544 29201 gene locus_tag LOCUS_22100 30544 29201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 31524 30823 gene locus_tag LOCUS_22110 gene zmp1 31524 30823 CDS product zinc metalloprotease Zmp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861706.1 protein_id gnl|my_center|LOCUS_22110 32450 31698 gene locus_tag LOCUS_22120 32450 31698 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025704.1 protein_id gnl|my_center|LOCUS_22120 33295 32522 gene locus_tag LOCUS_22130 33295 32522 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637470.1 protein_id gnl|my_center|LOCUS_22130 33818 33381 gene locus_tag LOCUS_22140 gene brxA 33818 33381 CDS product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 protein_id gnl|my_center|LOCUS_22140 34957 33818 gene locus_tag LOCUS_22150 34957 33818 CDS product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 protein_id gnl|my_center|LOCUS_22150 36916 35042 gene locus_tag LOCUS_22160 36916 35042 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_22160 37482 36991 gene locus_tag LOCUS_22170 37482 36991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460219.1 protein_id gnl|my_center|LOCUS_22170 39264 37579 gene locus_tag LOCUS_22180 39264 37579 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 protein_id gnl|my_center|LOCUS_22180 40197 39517 gene locus_tag LOCUS_22190 40197 39517 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160042.1 protein_id gnl|my_center|LOCUS_22190 40858 40349 gene locus_tag LOCUS_22200 40858 40349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 41029 41313 gene locus_tag LOCUS_22210 41029 41313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22210 41550 42158 gene locus_tag LOCUS_22220 41550 42158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22220 >Feature sequence029 1759 191 gene locus_tag LOCUS_22230 1759 191 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939840.1 protein_id gnl|my_center|LOCUS_22230 4288 1784 gene locus_tag LOCUS_22240 4288 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4629 4766 gene locus_tag LOCUS_22250 4629 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 5591 4908 gene locus_tag LOCUS_22260 5591 4908 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217589597.1 protein_id gnl|my_center|LOCUS_22260 5781 6359 gene locus_tag LOCUS_22270 5781 6359 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 protein_id gnl|my_center|LOCUS_22270 8088 6532 gene locus_tag LOCUS_22280 8088 6532 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_22280 8509 9036 gene locus_tag LOCUS_22290 gene lepB 8509 9036 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751900.1 protein_id gnl|my_center|LOCUS_22290 9059 9682 gene locus_tag LOCUS_22300 9059 9682 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283347.1 protein_id gnl|my_center|LOCUS_22300 10425 9751 gene locus_tag LOCUS_22310 10425 9751 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 protein_id gnl|my_center|LOCUS_22310 10545 11171 gene locus_tag LOCUS_22320 10545 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 12419 11835 gene locus_tag LOCUS_22330 12419 11835 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434872.1 protein_id gnl|my_center|LOCUS_22330 14756 12573 gene locus_tag LOCUS_22340 14756 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 14882 15202 gene locus_tag LOCUS_22350 14882 15202 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_22350 15202 16068 gene locus_tag LOCUS_22360 15202 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 16086 17102 gene locus_tag LOCUS_22370 16086 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 17453 19618 gene locus_tag LOCUS_22380 17453 19618 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 protein_id gnl|my_center|LOCUS_22380 20039 20947 gene locus_tag LOCUS_22390 gene metA 20039 20947 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 protein_id gnl|my_center|LOCUS_22390 21786 21004 gene locus_tag LOCUS_22400 21786 21004 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_22400 22003 23175 gene locus_tag LOCUS_22410 22003 23175 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765527.1 protein_id gnl|my_center|LOCUS_22410 23350 25230 gene locus_tag LOCUS_22420 23350 25230 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881412.1 protein_id gnl|my_center|LOCUS_22420 25576 27057 gene locus_tag LOCUS_22430 gene dhaS 25576 27057 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_22430 27200 27520 gene locus_tag LOCUS_22440 27200 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 27535 29157 gene locus_tag LOCUS_22450 27535 29157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 29319 30632 gene locus_tag LOCUS_22460 gene scfB 29319 30632 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965577.1 protein_id gnl|my_center|LOCUS_22460 30632 31702 gene locus_tag LOCUS_22470 30632 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 31875 32807 gene locus_tag LOCUS_22480 31875 32807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371580.1 protein_id gnl|my_center|LOCUS_22480 32825 33817 gene locus_tag LOCUS_22490 32825 33817 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459270.1 protein_id gnl|my_center|LOCUS_22490 33829 35502 gene locus_tag LOCUS_22500 33829 35502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_22500 35480 36208 gene locus_tag LOCUS_22510 35480 36208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 37134 36337 gene locus_tag LOCUS_22520 37134 36337 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_22520 37304 38698 gene locus_tag LOCUS_22530 gene pabB 37304 38698 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 protein_id gnl|my_center|LOCUS_22530 38695 39297 gene locus_tag LOCUS_22540 gene pabA 38695 39297 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_22540 39297 40139 gene locus_tag LOCUS_22550 gene pabC 39297 40139 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 protein_id gnl|my_center|LOCUS_22550 40411 40184 gene locus_tag LOCUS_22560 40411 40184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence030 1579 581 gene locus_tag LOCUS_22570 1579 581 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531471.1 protein_id gnl|my_center|LOCUS_22570 2110 3141 gene locus_tag LOCUS_22580 2110 3141 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622979.1 protein_id gnl|my_center|LOCUS_22580 3131 3781 gene locus_tag LOCUS_22590 3131 3781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 protein_id gnl|my_center|LOCUS_22590 3799 4629 gene locus_tag LOCUS_22600 3799 4629 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721578.1 protein_id gnl|my_center|LOCUS_22600 4660 5856 gene locus_tag LOCUS_22610 4660 5856 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_22610 6036 7193 gene locus_tag LOCUS_22620 6036 7193 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459150.1 protein_id gnl|my_center|LOCUS_22620 8122 7469 gene locus_tag LOCUS_22630 8122 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 9757 8243 gene locus_tag LOCUS_22640 9757 8243 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_22640 11978 10008 gene locus_tag LOCUS_22650 11978 10008 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533108.1 protein_id gnl|my_center|LOCUS_22650 12239 12075 gene locus_tag LOCUS_22660 12239 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 14113 12677 gene locus_tag LOCUS_22670 14113 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 15309 14875 gene locus_tag LOCUS_22680 15309 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 15857 15324 gene locus_tag LOCUS_22690 15857 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 16072 16365 gene locus_tag LOCUS_22700 16072 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 16576 16373 gene locus_tag LOCUS_22710 16576 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 16917 16765 gene locus_tag LOCUS_22720 16917 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165762389.1 protein_id gnl|my_center|LOCUS_22720 20252 17259 gene locus_tag LOCUS_22730 20252 17259 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107329.1 protein_id gnl|my_center|LOCUS_22730 20698 21678 gene locus_tag LOCUS_22740 20698 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 24238 21803 gene locus_tag LOCUS_22750 24238 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 27845 24390 gene locus_tag LOCUS_22760 27845 24390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 27763 27984 gene locus_tag LOCUS_22770 27763 27984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 28042 30390 gene locus_tag LOCUS_22780 gene secA2 28042 30390 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935165.1 protein_id gnl|my_center|LOCUS_22780 30433 31320 gene locus_tag LOCUS_22790 30433 31320 CDS product accessory Sec system S-layer assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016716591.1 protein_id gnl|my_center|LOCUS_22790 33748 32471 gene locus_tag LOCUS_22800 33748 32471 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876293.1 protein_id gnl|my_center|LOCUS_22800 35289 33766 gene locus_tag LOCUS_22810 gene murJ 35289 33766 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_22810 36007 35297 gene locus_tag LOCUS_22820 36007 35297 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_22820 37316 36039 gene locus_tag LOCUS_22830 37316 36039 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717669.1 protein_id gnl|my_center|LOCUS_22830 38711 37392 gene locus_tag LOCUS_22840 38711 37392 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287640.1 protein_id gnl|my_center|LOCUS_22840 39593 38712 gene locus_tag LOCUS_22850 gene galU 39593 38712 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence031 527 1711 gene locus_tag LOCUS_22860 gene minJ 527 1711 CDS product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 protein_id gnl|my_center|LOCUS_22860 1860 2510 gene locus_tag LOCUS_22870 1860 2510 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538141.1 protein_id gnl|my_center|LOCUS_22870 2630 3184 gene locus_tag LOCUS_22880 2630 3184 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_22880 3375 3608 gene locus_tag LOCUS_22890 3375 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3789 4181 gene locus_tag LOCUS_22900 3789 4181 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_22900 4217 4453 gene locus_tag LOCUS_22910 4217 4453 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_22910 4516 4776 gene locus_tag LOCUS_22920 4516 4776 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 protein_id gnl|my_center|LOCUS_22920 5031 5588 gene locus_tag LOCUS_22930 5031 5588 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023971.1 protein_id gnl|my_center|LOCUS_22930 5658 5885 gene locus_tag LOCUS_22940 5658 5885 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182462.1 protein_id gnl|my_center|LOCUS_22940 6037 6822 gene locus_tag LOCUS_22950 6037 6822 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 protein_id gnl|my_center|LOCUS_22950 7493 9472 gene locus_tag LOCUS_22960 gene uvrB 7493 9472 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_22960 9479 12358 gene locus_tag LOCUS_22970 gene uvrA 9479 12358 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 protein_id gnl|my_center|LOCUS_22970 12517 13239 gene locus_tag LOCUS_22980 gene nagB 12517 13239 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 protein_id gnl|my_center|LOCUS_22980 13460 14560 gene locus_tag LOCUS_22990 13460 14560 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228061.1 protein_id gnl|my_center|LOCUS_22990 14697 14900 gene locus_tag LOCUS_23000 14697 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 14897 15250 gene locus_tag LOCUS_23010 14897 15250 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 protein_id gnl|my_center|LOCUS_23010 16373 15555 gene locus_tag LOCUS_23020 gene cwlC 16373 15555 CDS product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 protein_id gnl|my_center|LOCUS_23020 16569 17516 gene locus_tag LOCUS_23030 gene hprK 16569 17516 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_23030 17541 18359 gene locus_tag LOCUS_23040 gene lgt 17541 18359 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_23040 18499 19437 gene locus_tag LOCUS_23050 18499 19437 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_23050 19434 20087 gene locus_tag LOCUS_23060 gene ppaX 19434 20087 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 protein_id gnl|my_center|LOCUS_23060 20084 20614 gene locus_tag LOCUS_23070 20084 20614 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_23070 21102 22538 gene locus_tag LOCUS_23080 21102 22538 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_23080 22791 23978 gene locus_tag LOCUS_23090 22791 23978 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_23090 23978 24610 gene locus_tag LOCUS_23100 gene hisG 23978 24610 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_23100 24703 25968 gene locus_tag LOCUS_23110 gene hisD 24703 25968 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_23110 26003 26593 gene locus_tag LOCUS_23120 gene hisB 26003 26593 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_23120 26593 27225 gene locus_tag LOCUS_23130 gene hisH 26593 27225 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_23130 27222 27950 gene locus_tag LOCUS_23140 gene hisA 27222 27950 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_23140 27951 28709 gene locus_tag LOCUS_23150 gene hisF 27951 28709 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 protein_id gnl|my_center|LOCUS_23150 28706 29329 gene locus_tag LOCUS_23160 gene hisIE 28706 29329 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_23160 29545 31062 gene locus_tag LOCUS_23170 29545 31062 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242799.1 protein_id gnl|my_center|LOCUS_23170 31159 32106 gene locus_tag LOCUS_23180 gene trxB 31159 32106 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 protein_id gnl|my_center|LOCUS_23180 32841 33203 gene locus_tag LOCUS_23190 32841 33203 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886622.1 protein_id gnl|my_center|LOCUS_23190 33233 34126 gene locus_tag LOCUS_23200 gene rapZ 33233 34126 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_23200 34123 35085 gene locus_tag LOCUS_23210 gene mgfK 34123 35085 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_23210 35121 36062 gene locus_tag LOCUS_23220 gene whiA 35121 36062 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 protein_id gnl|my_center|LOCUS_23220 36112 36366 gene locus_tag LOCUS_23230 36112 36366 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_23230 37237 36638 gene locus_tag LOCUS_23240 gene clpP 37237 36638 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049162.1 protein_id gnl|my_center|LOCUS_23240 37492 37565 gene locus_tag LOCUS_t00250 37492 37565 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 1067 78 gene locus_tag LOCUS_23250 1067 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2099 1131 gene locus_tag LOCUS_23260 2099 1131 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_23260 3084 2092 gene locus_tag LOCUS_23270 3084 2092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030783.1 protein_id gnl|my_center|LOCUS_23270 5249 3501 gene locus_tag LOCUS_23280 5249 3501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_23280 6000 5470 gene locus_tag LOCUS_23290 6000 5470 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506622.1 protein_id gnl|my_center|LOCUS_23290 6412 6158 gene locus_tag LOCUS_23300 6412 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 6533 6399 gene locus_tag LOCUS_23310 6533 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 6636 7526 gene locus_tag LOCUS_23320 gene purU 6636 7526 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_23320 7946 7638 gene locus_tag LOCUS_23330 gene sspE 7946 7638 CDS product gamma type acid-soluble spore protein SspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233541.1 protein_id gnl|my_center|LOCUS_23330 8764 8015 gene locus_tag LOCUS_23340 gene fabL 8764 8015 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_23340 8846 9025 gene locus_tag LOCUS_23350 8846 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275436.1 protein_id gnl|my_center|LOCUS_23350 10172 9078 gene locus_tag LOCUS_23360 gene mutY 10172 9078 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_23360 10526 10218 gene locus_tag LOCUS_23370 10526 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 10646 11632 gene locus_tag LOCUS_23380 10646 11632 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 protein_id gnl|my_center|LOCUS_23380 12022 11759 gene locus_tag LOCUS_23390 12022 11759 CDS product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998166.1 protein_id gnl|my_center|LOCUS_23390 12142 12312 gene locus_tag LOCUS_23400 12142 12312 CDS product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223241.1 protein_id gnl|my_center|LOCUS_23400 12358 12516 gene locus_tag LOCUS_23410 12358 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 12870 12538 gene locus_tag LOCUS_23420 12870 12538 CDS product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 protein_id gnl|my_center|LOCUS_23420 13748 12957 gene locus_tag LOCUS_23430 gene recX 13748 12957 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 protein_id gnl|my_center|LOCUS_23430 13900 14025 gene locus_tag LOCUS_23440 13900 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 13997 14320 gene locus_tag LOCUS_23450 13997 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 15765 14620 gene locus_tag LOCUS_23460 15765 14620 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588613.1 protein_id gnl|my_center|LOCUS_23460 17593 15881 gene locus_tag LOCUS_23470 17593 15881 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_23470 18453 17800 gene locus_tag LOCUS_23480 18453 17800 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064856.1 protein_id gnl|my_center|LOCUS_23480 18794 20176 gene locus_tag LOCUS_23490 gene gdhA 18794 20176 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721354.1 protein_id gnl|my_center|LOCUS_23490 21103 20300 gene locus_tag LOCUS_23500 21103 20300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_23500 21718 21191 gene locus_tag LOCUS_23510 21718 21191 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_23510 23211 21895 gene locus_tag LOCUS_23520 gene cwlO 23211 21895 CDS product peptidoglycan DL-endopeptidase CwlO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968231.1 protein_id gnl|my_center|LOCUS_23520 23565 24065 gene locus_tag LOCUS_23530 23565 24065 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_23530 24400 25629 gene locus_tag LOCUS_23540 24400 25629 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106396.1 protein_id gnl|my_center|LOCUS_23540 27285 25837 gene locus_tag LOCUS_23550 27285 25837 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_23550 29361 27622 gene locus_tag LOCUS_23560 gene cydC 29361 27622 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073484.1 protein_id gnl|my_center|LOCUS_23560 31082 29358 gene locus_tag LOCUS_23570 gene cydD 31082 29358 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824076.1 protein_id gnl|my_center|LOCUS_23570 32095 31082 gene locus_tag LOCUS_23580 gene cydB 32095 31082 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244559.1 protein_id gnl|my_center|LOCUS_23580 33485 32082 gene locus_tag LOCUS_23590 33485 32082 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722078.1 protein_id gnl|my_center|LOCUS_23590 33982 33761 gene locus_tag LOCUS_23600 33982 33761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 34281 34574 gene locus_tag LOCUS_23610 34281 34574 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_23610 34602 36275 gene locus_tag LOCUS_23620 34602 36275 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence033 1525 773 gene locus_tag LOCUS_23630 1525 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 4344 1792 gene locus_tag LOCUS_23640 4344 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 5678 4485 gene locus_tag LOCUS_23650 gene bioF 5678 4485 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_23650 6476 5682 gene locus_tag LOCUS_23660 gene bioW 6476 5682 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 protein_id gnl|my_center|LOCUS_23660 6954 6460 gene locus_tag LOCUS_23670 6954 6460 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200956.1 protein_id gnl|my_center|LOCUS_23670 7137 7292 gene locus_tag LOCUS_23680 7137 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7766 7332 gene locus_tag LOCUS_23690 7766 7332 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_23690 8008 9135 gene locus_tag LOCUS_23700 8008 9135 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380730.1 protein_id gnl|my_center|LOCUS_23700 10816 9389 gene locus_tag LOCUS_23710 10816 9389 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716485.1 protein_id gnl|my_center|LOCUS_23710 12472 10838 gene locus_tag LOCUS_23720 12472 10838 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_23720 12623 14224 gene locus_tag LOCUS_23730 12623 14224 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233925.1 protein_id gnl|my_center|LOCUS_23730 15794 14613 gene locus_tag LOCUS_23740 15794 14613 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232765.1 protein_id gnl|my_center|LOCUS_23740 16269 15832 gene locus_tag LOCUS_23750 16269 15832 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115309.1 protein_id gnl|my_center|LOCUS_23750 17085 16639 gene locus_tag LOCUS_23760 gene psiE 17085 16639 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246154.1 protein_id gnl|my_center|LOCUS_23760 18589 17567 gene locus_tag LOCUS_23770 18589 17567 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 protein_id gnl|my_center|LOCUS_23770 19834 18596 gene locus_tag LOCUS_23780 19834 18596 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381849.1 protein_id gnl|my_center|LOCUS_23780 20171 19950 gene locus_tag LOCUS_23790 20171 19950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 21794 20337 gene locus_tag LOCUS_23800 21794 20337 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_23800 22794 21853 gene locus_tag LOCUS_23810 gene glaH 22794 21853 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993126.1 protein_id gnl|my_center|LOCUS_23810 23412 23080 gene locus_tag LOCUS_23820 23412 23080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 24647 23433 gene locus_tag LOCUS_23830 gene lhgO 24647 23433 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_23830 25437 25042 gene locus_tag LOCUS_23840 25437 25042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 25752 25567 gene locus_tag LOCUS_23850 25752 25567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 26997 25918 gene locus_tag LOCUS_23860 26997 25918 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_23860 27238 27005 gene locus_tag LOCUS_23870 27238 27005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 28418 27240 gene locus_tag LOCUS_23880 28418 27240 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_23880 29954 28440 gene locus_tag LOCUS_23890 29954 28440 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_23890 31360 30146 gene locus_tag LOCUS_23900 gene bioI 31360 30146 CDS product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398783.1 protein_id gnl|my_center|LOCUS_23900 32372 31566 gene locus_tag LOCUS_23910 32372 31566 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 protein_id gnl|my_center|LOCUS_23910 35009 32718 gene locus_tag LOCUS_23920 gene metE 35009 32718 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007608.1 protein_id gnl|my_center|LOCUS_23920 35386 35156 gene locus_tag LOCUS_23930 35386 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence034 401 195 gene locus_tag LOCUS_23940 401 195 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216166.1 protein_id gnl|my_center|LOCUS_23940 742 587 gene locus_tag LOCUS_23950 742 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 1235 915 gene locus_tag LOCUS_23960 1235 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1753 1896 gene locus_tag LOCUS_23970 1753 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1868 2149 gene locus_tag LOCUS_23980 1868 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 protein_id gnl|my_center|LOCUS_23980 2163 2510 gene locus_tag LOCUS_23990 2163 2510 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 protein_id gnl|my_center|LOCUS_23990 2642 3043 gene locus_tag LOCUS_24000 2642 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3163 4548 gene locus_tag LOCUS_24010 3163 4548 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790944.1 protein_id gnl|my_center|LOCUS_24010 5017 4850 gene locus_tag LOCUS_24020 5017 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 6307 5534 gene locus_tag LOCUS_24030 gene istB 6307 5534 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041219237.1 protein_id gnl|my_center|LOCUS_24030 7847 6309 gene locus_tag LOCUS_24040 gene istA 7847 6309 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 protein_id gnl|my_center|LOCUS_24040 8101 8382 gene locus_tag LOCUS_24050 8101 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 8690 8451 gene locus_tag LOCUS_24060 8690 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 9040 8870 gene locus_tag LOCUS_24070 9040 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 9134 9292 gene locus_tag LOCUS_24080 9134 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 9776 9324 gene locus_tag LOCUS_24090 9776 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 12456 10297 gene locus_tag LOCUS_24100 12456 10297 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949064.1 protein_id gnl|my_center|LOCUS_24100 14148 12613 gene locus_tag LOCUS_24110 14148 12613 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949064.1 protein_id gnl|my_center|LOCUS_24110 15653 14610 gene locus_tag LOCUS_24120 15653 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 17227 16034 gene locus_tag LOCUS_24130 17227 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 19240 18305 gene locus_tag LOCUS_24140 19240 18305 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002180310.1 protein_id gnl|my_center|LOCUS_24140 19396 20208 gene locus_tag LOCUS_24150 gene modA 19396 20208 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_24150 20251 20928 gene locus_tag LOCUS_24160 gene modB 20251 20928 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949047.1 protein_id gnl|my_center|LOCUS_24160 20947 21627 gene locus_tag LOCUS_24170 20947 21627 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272548.1 protein_id gnl|my_center|LOCUS_24170 22516 21716 gene locus_tag LOCUS_24180 22516 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 23487 22879 gene locus_tag LOCUS_24190 23487 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 25159 23621 gene locus_tag LOCUS_24200 gene opuD 25159 23621 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 protein_id gnl|my_center|LOCUS_24200 26720 25485 gene locus_tag LOCUS_24210 26720 25485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 26857 27201 gene locus_tag LOCUS_24220 26857 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 27201 28766 gene locus_tag LOCUS_24230 27201 28766 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098240.1 protein_id gnl|my_center|LOCUS_24230 30538 28958 gene locus_tag LOCUS_24240 30538 28958 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176762.1 protein_id gnl|my_center|LOCUS_24240 32503 30560 gene locus_tag LOCUS_24250 32503 30560 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075677560.1 protein_id gnl|my_center|LOCUS_24250 34467 32500 gene locus_tag LOCUS_24260 34467 32500 CDS product putative thiazole-containing bacteriocin maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067621.1 protein_id gnl|my_center|LOCUS_24260 34913 34650 gene locus_tag LOCUS_24270 34913 34650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence035 735 550 gene locus_tag LOCUS_24280 735 550 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464456.1 protein_id gnl|my_center|LOCUS_24280 1832 774 gene locus_tag LOCUS_24290 1832 774 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267236.1 protein_id gnl|my_center|LOCUS_24290 2033 1851 gene locus_tag LOCUS_24300 2033 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2032 2214 gene locus_tag LOCUS_24310 2032 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2337 2750 gene locus_tag LOCUS_24320 2337 2750 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199006.1 protein_id gnl|my_center|LOCUS_24320 3371 3937 gene locus_tag LOCUS_24330 3371 3937 CDS product DUF3967 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033679177.1 protein_id gnl|my_center|LOCUS_24330 4260 5108 gene locus_tag LOCUS_24340 4260 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 5705 5211 gene locus_tag LOCUS_24350 5705 5211 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094918.1 protein_id gnl|my_center|LOCUS_24350 5893 6678 gene locus_tag LOCUS_24360 5893 6678 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_24360 7528 6746 gene locus_tag LOCUS_24370 gene fetB 7528 6746 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082840.1 protein_id gnl|my_center|LOCUS_24370 8146 7532 gene locus_tag LOCUS_24380 8146 7532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082842.1 protein_id gnl|my_center|LOCUS_24380 9303 8266 gene locus_tag LOCUS_24390 9303 8266 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729560.1 protein_id gnl|my_center|LOCUS_24390 11572 9320 gene locus_tag LOCUS_24400 11572 9320 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722279.1 protein_id gnl|my_center|LOCUS_24400 12065 11592 gene locus_tag LOCUS_24410 12065 11592 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_24410 13731 12793 gene locus_tag LOCUS_24420 13731 12793 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059054.1 protein_id gnl|my_center|LOCUS_24420 13844 15229 gene locus_tag LOCUS_24430 13844 15229 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_24430 15385 16140 gene locus_tag LOCUS_24440 15385 16140 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 protein_id gnl|my_center|LOCUS_24440 16191 16628 gene locus_tag LOCUS_24450 16191 16628 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899890.1 protein_id gnl|my_center|LOCUS_24450 16803 18080 gene locus_tag LOCUS_24460 gene yjoB 16803 18080 CDS product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 protein_id gnl|my_center|LOCUS_24460 18301 18924 gene locus_tag LOCUS_24470 18301 18924 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624900.1 protein_id gnl|my_center|LOCUS_24470 19885 18944 gene locus_tag LOCUS_24480 19885 18944 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 protein_id gnl|my_center|LOCUS_24480 20506 19931 gene locus_tag LOCUS_24490 20506 19931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 21781 20678 gene locus_tag LOCUS_24500 gene lnrN 21781 20678 CDS product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 protein_id gnl|my_center|LOCUS_24500 23046 21778 gene locus_tag LOCUS_24510 23046 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 23992 23060 gene locus_tag LOCUS_24520 23992 23060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_24520 24152 24027 gene locus_tag LOCUS_24530 24152 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 24977 24345 gene locus_tag LOCUS_24540 24977 24345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966222.1 protein_id gnl|my_center|LOCUS_24540 25795 25127 gene locus_tag LOCUS_24550 25795 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 25872 26087 gene locus_tag LOCUS_24560 25872 26087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 26774 26622 gene locus_tag LOCUS_24570 26774 26622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24570 27111 26917 gene locus_tag LOCUS_24580 27111 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 27042 27935 gene locus_tag LOCUS_24590 27042 27935 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246240.1 protein_id gnl|my_center|LOCUS_24590 29496 28207 gene locus_tag LOCUS_24600 29496 28207 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034616.1 protein_id gnl|my_center|LOCUS_24600 29911 29486 gene locus_tag LOCUS_24610 29911 29486 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390166.1 protein_id gnl|my_center|LOCUS_24610 30450 29914 gene locus_tag LOCUS_24620 30450 29914 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_24620 31581 30568 gene locus_tag LOCUS_24630 31581 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_24630 32199 31687 gene locus_tag LOCUS_24640 gene speG 32199 31687 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071095.1 protein_id gnl|my_center|LOCUS_24640 32916 32317 gene locus_tag LOCUS_24650 32916 32317 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723074.1 protein_id gnl|my_center|LOCUS_24650 33093 33569 gene locus_tag LOCUS_24660 33093 33569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 33737 34519 gene locus_tag LOCUS_24670 33737 34519 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence036 211 393 gene locus_tag LOCUS_24680 211 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1683 913 gene locus_tag LOCUS_24690 1683 913 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_24690 3275 1680 gene locus_tag LOCUS_24700 3275 1680 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_24700 4804 3293 gene locus_tag LOCUS_24710 gene putP 4804 3293 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_24710 4917 4792 gene locus_tag LOCUS_24720 4917 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5811 6227 gene locus_tag LOCUS_24730 5811 6227 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256363.1 protein_id gnl|my_center|LOCUS_24730 6211 8058 gene locus_tag LOCUS_24740 6211 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 8244 9032 gene locus_tag LOCUS_24750 8244 9032 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948837.1 protein_id gnl|my_center|LOCUS_24750 9292 13812 gene locus_tag LOCUS_24760 gene gltB 9292 13812 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967365.1 protein_id gnl|my_center|LOCUS_24760 13877 15331 gene locus_tag LOCUS_24770 gene gltD 13877 15331 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_24770 15355 16611 gene locus_tag LOCUS_24780 15355 16611 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_24780 16613 17491 gene locus_tag LOCUS_24790 gene dapF 16613 17491 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077385.1 protein_id gnl|my_center|LOCUS_24790 17534 18871 gene locus_tag LOCUS_24800 gene glnA 17534 18871 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 protein_id gnl|my_center|LOCUS_24800 19000 20307 gene locus_tag LOCUS_24810 19000 20307 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_24810 20389 20571 gene locus_tag LOCUS_24820 20389 20571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 20635 20769 gene locus_tag LOCUS_24830 20635 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 21371 21583 gene locus_tag LOCUS_24840 21371 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24840 21869 22792 gene locus_tag LOCUS_24850 21869 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 23037 23162 gene locus_tag LOCUS_24860 23037 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 23170 23364 gene locus_tag LOCUS_24870 23170 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 23361 25763 gene locus_tag LOCUS_24880 23361 25763 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966109.1 protein_id gnl|my_center|LOCUS_24880 25771 26145 gene locus_tag LOCUS_24890 25771 26145 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_24890 27437 26322 gene locus_tag LOCUS_24900 27437 26322 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844369.1 protein_id gnl|my_center|LOCUS_24900 27909 27589 gene locus_tag LOCUS_24910 27909 27589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 28680 28201 gene locus_tag LOCUS_24920 28680 28201 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287397.1 protein_id gnl|my_center|LOCUS_24920 28982 29057 gene locus_tag LOCUS_t00260 28982 29057 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29082 29157 gene locus_tag LOCUS_t00270 29082 29157 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29161 29249 gene locus_tag LOCUS_t00280 29161 29249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29252 29327 gene locus_tag LOCUS_t00290 29252 29327 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29346 29421 gene locus_tag LOCUS_t00300 29346 29421 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29438 29513 gene locus_tag LOCUS_t00310 29438 29513 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29529 29621 gene locus_tag LOCUS_t00320 29529 29621 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29636 29711 gene locus_tag LOCUS_t00330 29636 29711 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29793 29877 gene locus_tag LOCUS_t00340 29793 29877 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 29880 29952 gene locus_tag LOCUS_t00350 29880 29952 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 29969 30042 gene locus_tag LOCUS_t00360 29969 30042 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30050 30123 gene locus_tag LOCUS_t00370 30050 30123 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 30130 30203 gene locus_tag LOCUS_t00380 30130 30203 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30227 30301 gene locus_tag LOCUS_t00390 30227 30301 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 30308 30381 gene locus_tag LOCUS_t00400 30308 30381 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31275 31490 gene locus_tag LOCUS_24930 31275 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 31435 31791 gene locus_tag LOCUS_24940 31435 31791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24940 >Feature sequence037 <1 768 gene locus_tag LOCUS_24950 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003225835.1:DNA-directed RNA polymerase subunit alpha 812 1207 gene locus_tag LOCUS_24960 gene rplQ 812 1207 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_24960 1505 2347 gene locus_tag LOCUS_24970 1505 2347 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 protein_id gnl|my_center|LOCUS_24970 2323 3192 gene locus_tag LOCUS_24980 2323 3192 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728531.1 protein_id gnl|my_center|LOCUS_24980 3189 3986 gene locus_tag LOCUS_24990 3189 3986 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 protein_id gnl|my_center|LOCUS_24990 4008 4751 gene locus_tag LOCUS_25000 gene truA 4008 4751 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_25000 4904 5341 gene locus_tag LOCUS_25010 gene rplM 4904 5341 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241966.1 protein_id gnl|my_center|LOCUS_25010 5364 5756 gene locus_tag LOCUS_25020 gene rpsI 5364 5756 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_25020 6948 6049 gene locus_tag LOCUS_25030 6948 6049 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_25030 7642 9414 gene locus_tag LOCUS_25040 7642 9414 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831657.1 protein_id gnl|my_center|LOCUS_25040 10122 10619 gene locus_tag LOCUS_25050 gene sigV 10122 10619 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_25050 10619 11470 gene locus_tag LOCUS_25060 gene rsiV 10619 11470 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_25060 11974 13914 gene locus_tag LOCUS_25070 gene oatA 11974 13914 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398729.1 protein_id gnl|my_center|LOCUS_25070 15231 14239 gene locus_tag LOCUS_25080 15231 14239 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 protein_id gnl|my_center|LOCUS_25080 15433 16428 gene locus_tag LOCUS_25090 15433 16428 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 protein_id gnl|my_center|LOCUS_25090 16431 17486 gene locus_tag LOCUS_25100 16431 17486 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760047.1 protein_id gnl|my_center|LOCUS_25100 17501 18319 gene locus_tag LOCUS_25110 17501 18319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_25110 19623 18616 gene locus_tag LOCUS_25120 19623 18616 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983751.1 protein_id gnl|my_center|LOCUS_25120 20675 19620 gene locus_tag LOCUS_25130 20675 19620 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 protein_id gnl|my_center|LOCUS_25130 21682 20768 gene locus_tag LOCUS_25140 21682 20768 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_25140 22476 21679 gene locus_tag LOCUS_25150 22476 21679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964109.1 protein_id gnl|my_center|LOCUS_25150 22647 23696 gene locus_tag LOCUS_25160 22647 23696 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 protein_id gnl|my_center|LOCUS_25160 23867 24328 gene locus_tag LOCUS_25170 23867 24328 CDS product DUF2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101005.1 protein_id gnl|my_center|LOCUS_25170 24395 25111 gene locus_tag LOCUS_25180 gene cwlD 24395 25111 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_25180 25510 26571 gene locus_tag LOCUS_25190 25510 26571 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256628.1 protein_id gnl|my_center|LOCUS_25190 27487 26936 gene locus_tag LOCUS_25200 27487 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 27714 28364 gene locus_tag LOCUS_25210 gene kbaA 27714 28364 CDS product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088508.1 protein_id gnl|my_center|LOCUS_25210 29340 28591 gene locus_tag LOCUS_25220 gene pdaB 29340 28591 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 protein_id gnl|my_center|LOCUS_25220 29481 29714 gene locus_tag LOCUS_25230 29481 29714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901147.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence038 1664 177 gene locus_tag LOCUS_25240 gene lysS 1664 177 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369671.1 protein_id gnl|my_center|LOCUS_25240 2851 1853 gene locus_tag LOCUS_25250 gene dusB 2851 1853 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_25250 3080 2871 gene locus_tag LOCUS_25260 3080 2871 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387027.1 protein_id gnl|my_center|LOCUS_25260 3559 3032 gene locus_tag LOCUS_25270 gene folK 3559 3032 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059449.1 protein_id gnl|my_center|LOCUS_25270 3921 3562 gene locus_tag LOCUS_25280 gene folB 3921 3562 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358062.1 protein_id gnl|my_center|LOCUS_25280 4741 3914 gene locus_tag LOCUS_25290 gene folP 4741 3914 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_25290 6004 5075 gene locus_tag LOCUS_25300 gene cysK 6004 5075 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_25300 7293 6418 gene locus_tag LOCUS_25310 gene hslO 7293 6418 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_25310 8074 7307 gene locus_tag LOCUS_25320 8074 7307 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_25320 10576 8588 gene locus_tag LOCUS_25330 gene ftsH 10576 8588 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079674.1 protein_id gnl|my_center|LOCUS_25330 11247 10693 gene locus_tag LOCUS_25340 gene hpt 11247 10693 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 protein_id gnl|my_center|LOCUS_25340 12653 11241 gene locus_tag LOCUS_25350 gene tilS 12653 11241 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655465.1 protein_id gnl|my_center|LOCUS_25350 14000 13005 gene locus_tag LOCUS_25360 gene prkT 14000 13005 CDS product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 protein_id gnl|my_center|LOCUS_25360 14703 13969 gene locus_tag LOCUS_25370 14703 13969 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 protein_id gnl|my_center|LOCUS_25370 17278 14789 gene locus_tag LOCUS_25380 gene spoIIE 17278 14789 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_25380 17595 17670 gene locus_tag LOCUS_t00410 17595 17670 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17685 17756 gene locus_tag LOCUS_t00420 17685 17756 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18495 18079 gene locus_tag LOCUS_25390 18495 18079 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_25390 18969 18562 gene locus_tag LOCUS_25400 gene divIC 18969 18562 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243211.1 protein_id gnl|my_center|LOCUS_25400 19609 18986 gene locus_tag LOCUS_25410 gene yabQ 19609 18986 CDS product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059767.1 protein_id gnl|my_center|LOCUS_25410 19908 19606 gene locus_tag LOCUS_25420 gene yabP 19908 19606 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 protein_id gnl|my_center|LOCUS_25420 20299 20033 gene locus_tag LOCUS_25430 20299 20033 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 protein_id gnl|my_center|LOCUS_25430 21774 20314 gene locus_tag LOCUS_25440 gene mazG 21774 20314 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 protein_id gnl|my_center|LOCUS_25440 23369 21780 gene locus_tag LOCUS_25450 23369 21780 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387598.1 protein_id gnl|my_center|LOCUS_25450 24192 23656 gene locus_tag LOCUS_25460 gene spoVT 24192 23656 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648307.1 protein_id gnl|my_center|LOCUS_25460 29061 25543 gene locus_tag LOCUS_25470 gene mfd 29061 25543 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence039 364 134 gene locus_tag LOCUS_25480 gene fin 364 134 CDS product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 protein_id gnl|my_center|LOCUS_25480 996 436 gene locus_tag LOCUS_25490 gene pth 996 436 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_25490 1846 1229 gene locus_tag LOCUS_25500 1846 1229 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 protein_id gnl|my_center|LOCUS_25500 3038 2082 gene locus_tag LOCUS_25510 3038 2082 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_25510 4429 3053 gene locus_tag LOCUS_25520 gene glmU 4429 3053 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_25520 5080 4787 gene locus_tag LOCUS_25530 gene spoVG 5080 4787 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966269.1 protein_id gnl|my_center|LOCUS_25530 5606 5232 gene locus_tag LOCUS_25540 5606 5232 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 protein_id gnl|my_center|LOCUS_25540 6820 5978 gene locus_tag LOCUS_25550 gene purR 6820 5978 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 protein_id gnl|my_center|LOCUS_25550 7749 6880 gene locus_tag LOCUS_25560 gene ispE 7749 6880 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_25560 8189 8013 gene locus_tag LOCUS_25570 gene sspF 8189 8013 CDS product acid-soluble spore protein SspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985066.1 protein_id gnl|my_center|LOCUS_25570 8815 8546 gene locus_tag LOCUS_25580 8815 8546 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 protein_id gnl|my_center|LOCUS_25580 9920 9042 gene locus_tag LOCUS_25590 gene yabG 9920 9042 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173738.1 protein_id gnl|my_center|LOCUS_25590 11521 10646 gene locus_tag LOCUS_25600 gene rsmA 11521 10646 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_25600 12075 11518 gene locus_tag LOCUS_25610 gene rnmV 12075 11518 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_25610 13364 12168 gene locus_tag LOCUS_25620 13364 12168 CDS product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 protein_id gnl|my_center|LOCUS_25620 14356 13589 gene locus_tag LOCUS_25630 14356 13589 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895851.1 protein_id gnl|my_center|LOCUS_25630 16755 14800 gene locus_tag LOCUS_25640 gene metG 16755 14800 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 protein_id gnl|my_center|LOCUS_25640 17343 17627 gene locus_tag LOCUS_25650 gene abrB 17343 17627 CDS product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 protein_id gnl|my_center|LOCUS_25650 18803 17922 gene locus_tag LOCUS_25660 gene rsmI 18803 17922 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 protein_id gnl|my_center|LOCUS_25660 19072 18800 gene locus_tag LOCUS_25670 19072 18800 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 protein_id gnl|my_center|LOCUS_25670 19802 19059 gene locus_tag LOCUS_25680 19802 19059 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 protein_id gnl|my_center|LOCUS_25680 20443 20075 gene locus_tag LOCUS_25690 gene yabA 20443 20075 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412063.1 protein_id gnl|my_center|LOCUS_25690 21284 20457 gene locus_tag LOCUS_25700 21284 20457 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_25700 22284 21277 gene locus_tag LOCUS_25710 gene holB 22284 21277 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169577.1 protein_id gnl|my_center|LOCUS_25710 22737 22297 gene locus_tag LOCUS_25720 22737 22297 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_25720 23081 22752 gene locus_tag LOCUS_25730 gene darA 23081 22752 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_25730 23886 23245 gene locus_tag LOCUS_25740 gene tmk 23886 23245 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_25740 25408 23984 gene locus_tag LOCUS_25750 25408 23984 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_25750 25724 25530 gene locus_tag LOCUS_25760 gene csfB 25724 25530 CDS product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence040 514 1542 gene locus_tag LOCUS_25770 gene lytR 514 1542 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_25770 1577 2029 gene locus_tag LOCUS_25780 1577 2029 CDS product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997708.1 protein_id gnl|my_center|LOCUS_25780 2057 2188 gene locus_tag LOCUS_25790 2057 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3067 2231 gene locus_tag LOCUS_25800 3067 2231 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 protein_id gnl|my_center|LOCUS_25800 4140 3172 gene locus_tag LOCUS_25810 4140 3172 CDS product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635759.1 protein_id gnl|my_center|LOCUS_25810 5257 4430 gene locus_tag LOCUS_25820 5257 4430 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 protein_id gnl|my_center|LOCUS_25820 5616 5362 gene locus_tag LOCUS_25830 5616 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 7152 5881 gene locus_tag LOCUS_25840 7152 5881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_25840 8456 7677 gene locus_tag LOCUS_25850 8456 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 9242 8823 gene locus_tag LOCUS_25860 9242 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 9954 9592 gene locus_tag LOCUS_tm00010 9954 9592 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10543 10076 gene locus_tag LOCUS_25870 gene smpB 10543 10076 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723350.1 protein_id gnl|my_center|LOCUS_25870 12998 10674 gene locus_tag LOCUS_25880 gene rnr 12998 10674 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_25880 13767 13021 gene locus_tag LOCUS_25890 13767 13021 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_25890 14181 13948 gene locus_tag LOCUS_25900 gene secG 14181 13948 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_25900 16003 14264 gene locus_tag LOCUS_25910 16003 14264 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942560.1 protein_id gnl|my_center|LOCUS_25910 17440 16151 gene locus_tag LOCUS_25920 gene eno 17440 16151 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_25920 19000 17465 gene locus_tag LOCUS_25930 gene gpmI 19000 17465 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_25930 19754 18993 gene locus_tag LOCUS_25940 gene tpiA 19754 18993 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_25940 21023 19839 gene locus_tag LOCUS_25950 21023 19839 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_25950 22341 21334 gene locus_tag LOCUS_25960 gene gap 22341 21334 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_25960 23423 22389 gene locus_tag LOCUS_25970 23423 22389 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732486.1 protein_id gnl|my_center|LOCUS_25970 23820 23578 gene locus_tag LOCUS_25980 23820 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 25217 23892 gene locus_tag LOCUS_25990 gene rpoN 25217 23892 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732487.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence041 430 597 gene locus_tag LOCUS_26000 430 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1427 1296 gene locus_tag LOCUS_26010 1427 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1615 1779 gene locus_tag LOCUS_26020 1615 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2202 2023 gene locus_tag LOCUS_26030 2202 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3616 2243 gene locus_tag LOCUS_26040 3616 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4218 4667 gene locus_tag LOCUS_26050 4218 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 6041 4710 gene locus_tag LOCUS_26060 6041 4710 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393514.1 protein_id gnl|my_center|LOCUS_26060 6667 7065 gene locus_tag LOCUS_26070 6667 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 7197 8291 gene locus_tag LOCUS_26080 7197 8291 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943959.1 protein_id gnl|my_center|LOCUS_26080 8366 9952 gene locus_tag LOCUS_26090 8366 9952 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_26090 9971 11176 gene locus_tag LOCUS_26100 9971 11176 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_26100 11177 11398 gene locus_tag LOCUS_26110 11177 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 11448 12545 gene locus_tag LOCUS_26120 11448 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 12771 13805 gene locus_tag LOCUS_26130 12771 13805 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_26130 13922 15043 gene locus_tag LOCUS_26140 gene desK 13922 15043 CDS product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 protein_id gnl|my_center|LOCUS_26140 15049 15648 gene locus_tag LOCUS_26150 gene desR 15049 15648 CDS product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 protein_id gnl|my_center|LOCUS_26150 15782 16012 gene locus_tag LOCUS_26160 15782 16012 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025240.1 protein_id gnl|my_center|LOCUS_26160 16609 16259 gene locus_tag LOCUS_26170 16609 16259 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400857.1 protein_id gnl|my_center|LOCUS_26170 16742 17356 gene locus_tag LOCUS_26180 16742 17356 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185385.1 protein_id gnl|my_center|LOCUS_26180 17934 20669 gene locus_tag LOCUS_26190 17934 20669 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235309.1 protein_id gnl|my_center|LOCUS_26190 21504 20737 gene locus_tag LOCUS_26200 21504 20737 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_26200 21608 21880 gene locus_tag LOCUS_26210 21608 21880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 23097 21898 gene locus_tag LOCUS_26220 23097 21898 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235507.1 protein_id gnl|my_center|LOCUS_26220 23291 24529 gene locus_tag LOCUS_26230 23291 24529 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831928.1 protein_id gnl|my_center|LOCUS_26230 25235 24720 gene locus_tag LOCUS_26240 25235 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence042 439 1617 gene locus_tag LOCUS_26250 439 1617 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460305.1 protein_id gnl|my_center|LOCUS_26250 2303 3442 gene locus_tag LOCUS_26260 2303 3442 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964208.1 protein_id gnl|my_center|LOCUS_26260 3439 4230 gene locus_tag LOCUS_26270 3439 4230 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994678.1 protein_id gnl|my_center|LOCUS_26270 5015 4263 gene locus_tag LOCUS_26280 5015 4263 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034195.1 protein_id gnl|my_center|LOCUS_26280 5221 5970 gene locus_tag LOCUS_26290 5221 5970 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393150.1 protein_id gnl|my_center|LOCUS_26290 5960 6658 gene locus_tag LOCUS_26300 gene ptkA 5960 6658 CDS product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 protein_id gnl|my_center|LOCUS_26300 6744 7511 gene locus_tag LOCUS_26310 6744 7511 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_26310 7915 8796 gene locus_tag LOCUS_26320 gene galU 7915 8796 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 protein_id gnl|my_center|LOCUS_26320 8856 9935 gene locus_tag LOCUS_26330 8856 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 10596 10297 gene locus_tag LOCUS_26340 10596 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 11628 12962 gene locus_tag LOCUS_26350 11628 12962 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_26350 12949 13683 gene locus_tag LOCUS_26360 12949 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068694.1 protein_id gnl|my_center|LOCUS_26360 14893 13937 gene locus_tag LOCUS_26370 14893 13937 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801979.1 protein_id gnl|my_center|LOCUS_26370 15329 16705 gene locus_tag LOCUS_26380 15329 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 16671 17717 gene locus_tag LOCUS_26390 16671 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 17880 18128 gene locus_tag LOCUS_26400 17880 18128 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_26400 18135 18446 gene locus_tag LOCUS_26410 18135 18446 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460091.1 protein_id gnl|my_center|LOCUS_26410 19155 18685 gene locus_tag LOCUS_26420 19155 18685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26420 19473 19243 gene locus_tag LOCUS_26430 19473 19243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26430 19871 20215 gene locus_tag LOCUS_26440 19871 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 21807 20362 gene locus_tag LOCUS_26450 21807 20362 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627647.1 protein_id gnl|my_center|LOCUS_26450 23287 22931 gene locus_tag LOCUS_26460 23287 22931 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899662.1 protein_id gnl|my_center|LOCUS_26460 24162 23728 gene locus_tag LOCUS_26470 24162 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence043 629 985 gene locus_tag LOCUS_26480 629 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1707 2063 gene locus_tag LOCUS_26490 1707 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2090 2821 gene locus_tag LOCUS_26500 2090 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2827 3306 gene locus_tag LOCUS_26510 2827 3306 CDS product DUF600 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462363.1 protein_id gnl|my_center|LOCUS_26510 3947 4375 gene locus_tag LOCUS_26520 3947 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 6575 5127 gene locus_tag LOCUS_26530 gene cls 6575 5127 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_26530 7033 7176 gene locus_tag LOCUS_26540 7033 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 7814 7233 gene locus_tag LOCUS_26550 7814 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 9492 8119 gene locus_tag LOCUS_26560 9492 8119 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 protein_id gnl|my_center|LOCUS_26560 11624 10314 gene locus_tag LOCUS_26570 11624 10314 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 protein_id gnl|my_center|LOCUS_26570 13247 11889 gene locus_tag LOCUS_26580 gene mgtE 13247 11889 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_26580 13661 14431 gene locus_tag LOCUS_26590 13661 14431 CDS product oxalate:formate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014091.1 protein_id gnl|my_center|LOCUS_26590 15750 14587 gene locus_tag LOCUS_26600 15750 14587 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 protein_id gnl|my_center|LOCUS_26600 16062 17129 gene locus_tag LOCUS_26610 16062 17129 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161427.1 protein_id gnl|my_center|LOCUS_26610 17226 18599 gene locus_tag LOCUS_26620 gene murF 17226 18599 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 protein_id gnl|my_center|LOCUS_26620 18627 18752 gene locus_tag LOCUS_26630 18627 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 18754 18906 gene locus_tag LOCUS_26640 18754 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 18900 19421 gene locus_tag LOCUS_26650 18900 19421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26650 19782 21233 gene locus_tag LOCUS_26660 gene cshA 19782 21233 CDS product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732374.1 protein_id gnl|my_center|LOCUS_26660 21610 22089 gene locus_tag LOCUS_26670 21610 22089 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 protein_id gnl|my_center|LOCUS_26670 22079 23584 gene locus_tag LOCUS_26680 22079 23584 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966602.1 protein_id gnl|my_center|LOCUS_26680 23665 23949 gene locus_tag LOCUS_26690 23665 23949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence044 306 417 gene locus_tag LOCUS_r00010 306 417 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 428 502 gene locus_tag LOCUS_t00430 428 502 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 506 597 gene locus_tag LOCUS_t00440 506 597 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 608 682 gene locus_tag LOCUS_t00450 608 682 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 750 825 gene locus_tag LOCUS_t00460 750 825 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 844 919 gene locus_tag LOCUS_t00470 844 919 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 924 1000 gene locus_tag LOCUS_t00480 924 1000 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1022 1096 gene locus_tag LOCUS_t00490 1022 1096 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1102 1177 gene locus_tag LOCUS_t00500 1102 1177 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1190 1274 gene locus_tag LOCUS_t00510 1190 1274 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1277 1349 gene locus_tag LOCUS_t00520 1277 1349 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1361 1436 gene locus_tag LOCUS_t00530 1361 1436 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1446 1519 gene locus_tag LOCUS_t00540 1446 1519 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1522 1594 gene locus_tag LOCUS_t00550 1522 1594 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1601 1672 gene locus_tag LOCUS_t00560 1601 1672 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1678 1762 gene locus_tag LOCUS_t00570 1678 1762 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2076 2615 gene locus_tag LOCUS_26700 2076 2615 CDS product PRK06770 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428230.1 protein_id gnl|my_center|LOCUS_26700 3185 2814 gene locus_tag LOCUS_26710 3185 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3453 4883 gene locus_tag LOCUS_26720 3453 4883 CDS product DUF4901 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943666.1 protein_id gnl|my_center|LOCUS_26720 4981 5127 gene locus_tag LOCUS_26730 4981 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5179 5823 gene locus_tag LOCUS_26740 5179 5823 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458823.1 protein_id gnl|my_center|LOCUS_26740 6391 5981 gene locus_tag LOCUS_26750 6391 5981 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966084.1 protein_id gnl|my_center|LOCUS_26750 6665 7486 gene locus_tag LOCUS_26760 6665 7486 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689749.1 protein_id gnl|my_center|LOCUS_26760 7553 8209 gene locus_tag LOCUS_26770 7553 8209 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583415.1 protein_id gnl|my_center|LOCUS_26770 8206 8928 gene locus_tag LOCUS_26780 8206 8928 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_26780 9216 10568 gene locus_tag LOCUS_26790 gene alaP 9216 10568 CDS product alanine permease AlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229105.1 protein_id gnl|my_center|LOCUS_26790 10775 10848 gene locus_tag LOCUS_t00580 10775 10848 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11065 12195 gene locus_tag LOCUS_26800 gene queG 11065 12195 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_26800 12246 13103 gene locus_tag LOCUS_26810 12246 13103 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260551.1 protein_id gnl|my_center|LOCUS_26810 13171 13650 gene locus_tag LOCUS_26820 gene trmL 13171 13650 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_26820 14110 16005 gene locus_tag LOCUS_26830 14110 16005 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353280.1 protein_id gnl|my_center|LOCUS_26830 16410 16087 gene locus_tag LOCUS_26840 16410 16087 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 protein_id gnl|my_center|LOCUS_26840 16766 17935 gene locus_tag LOCUS_26850 gene yhbH 16766 17935 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503517.1 protein_id gnl|my_center|LOCUS_26850 19410 18019 gene locus_tag LOCUS_26860 19410 18019 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443134.1 protein_id gnl|my_center|LOCUS_26860 21074 19779 gene locus_tag LOCUS_26870 gene pbuO 21074 19779 CDS product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 protein_id gnl|my_center|LOCUS_26870 22354 21356 gene locus_tag LOCUS_26880 22354 21356 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_26880 22988 22368 gene locus_tag LOCUS_26890 22988 22368 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231442.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence045 409 1254 gene locus_tag LOCUS_26900 409 1254 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049808538.1 protein_id gnl|my_center|LOCUS_26900 1561 2538 gene locus_tag LOCUS_26910 1561 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 3452 2589 gene locus_tag LOCUS_26920 3452 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 4381 3602 gene locus_tag LOCUS_26930 4381 3602 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_26930 5839 4502 gene locus_tag LOCUS_26940 5839 4502 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814537.1 protein_id gnl|my_center|LOCUS_26940 6062 6595 gene locus_tag LOCUS_26950 6062 6595 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_26950 6767 8296 gene locus_tag LOCUS_26960 6767 8296 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199961.1 protein_id gnl|my_center|LOCUS_26960 8516 10636 gene locus_tag LOCUS_26970 gene recQ 8516 10636 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494262.1 protein_id gnl|my_center|LOCUS_26970 10671 11129 gene locus_tag LOCUS_26980 10671 11129 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635466.1 protein_id gnl|my_center|LOCUS_26980 11397 11263 gene locus_tag LOCUS_26990 11397 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 12576 12046 gene locus_tag LOCUS_27000 12576 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 13411 12668 gene locus_tag LOCUS_27010 13411 12668 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447231.1 protein_id gnl|my_center|LOCUS_27010 13585 14034 gene locus_tag LOCUS_27020 13585 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914472.1 protein_id gnl|my_center|LOCUS_27020 14022 14312 gene locus_tag LOCUS_27030 14022 14312 CDS product YxcD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447746.1 protein_id gnl|my_center|LOCUS_27030 14821 14534 gene locus_tag LOCUS_27040 14821 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 15904 14837 gene locus_tag LOCUS_27050 15904 14837 CDS product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345046.1 protein_id gnl|my_center|LOCUS_27050 16036 16191 gene locus_tag LOCUS_27060 16036 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 16312 17070 gene locus_tag LOCUS_27070 gene fabG 16312 17070 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_27070 18959 17205 gene locus_tag LOCUS_27080 18959 17205 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732387.1 protein_id gnl|my_center|LOCUS_27080 19709 21004 gene locus_tag LOCUS_27090 19709 21004 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_27090 21403 21221 gene locus_tag LOCUS_27100 21403 21221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 21684 21508 gene locus_tag LOCUS_27110 21684 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 21943 22707 gene locus_tag LOCUS_27120 21943 22707 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence046 1049 1612 gene locus_tag LOCUS_27130 gene ahpC 1049 1612 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243686.1 protein_id gnl|my_center|LOCUS_27130 1634 3163 gene locus_tag LOCUS_27140 gene ahpF 1634 3163 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243077.1 protein_id gnl|my_center|LOCUS_27140 4431 3415 gene locus_tag LOCUS_27150 4431 3415 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126169.1 protein_id gnl|my_center|LOCUS_27150 4749 5312 gene locus_tag LOCUS_27160 gene ahpC 4749 5312 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243686.1 protein_id gnl|my_center|LOCUS_27160 5575 6150 gene locus_tag LOCUS_27170 5575 6150 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025356.1 protein_id gnl|my_center|LOCUS_27170 6252 6614 gene locus_tag LOCUS_27180 6252 6614 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790630.1 protein_id gnl|my_center|LOCUS_27180 6616 6930 gene locus_tag LOCUS_27190 6616 6930 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539671.1 protein_id gnl|my_center|LOCUS_27190 7539 7760 gene locus_tag LOCUS_27200 7539 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 7878 11027 gene locus_tag LOCUS_27210 7878 11027 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 protein_id gnl|my_center|LOCUS_27210 11721 11065 gene locus_tag LOCUS_27220 11721 11065 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573662.1 protein_id gnl|my_center|LOCUS_27220 13214 11727 gene locus_tag LOCUS_27230 13214 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 14151 14324 gene locus_tag LOCUS_27240 14151 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 15312 14362 gene locus_tag LOCUS_27250 gene comQ 15312 14362 CDS product ComX modifying isoprenyl transferase ComQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243039.1 protein_id gnl|my_center|LOCUS_27250 15654 15890 gene locus_tag LOCUS_27260 15654 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 15920 18076 gene locus_tag LOCUS_27270 15920 18076 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 protein_id gnl|my_center|LOCUS_27270 18057 19532 gene locus_tag LOCUS_27280 18057 19532 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699969.1 protein_id gnl|my_center|LOCUS_27280 19640 20524 gene locus_tag LOCUS_27290 19640 20524 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058115.1 protein_id gnl|my_center|LOCUS_27290 20527 21744 gene locus_tag LOCUS_27300 20527 21744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224962.1 protein_id gnl|my_center|LOCUS_27300 21762 21944 gene locus_tag LOCUS_27310 21762 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence047 860 2389 gene locus_tag LOCUS_27320 860 2389 CDS product NADH dehydrogenase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234919.1 protein_id gnl|my_center|LOCUS_27320 2392 5016 gene locus_tag LOCUS_27330 2392 5016 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234917.1 protein_id gnl|my_center|LOCUS_27330 5101 5466 gene locus_tag LOCUS_27340 5101 5466 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798157.1 protein_id gnl|my_center|LOCUS_27340 5494 5976 gene locus_tag LOCUS_27350 5494 5976 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992194.1 protein_id gnl|my_center|LOCUS_27350 6259 6402 gene locus_tag LOCUS_27360 6259 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 6587 6841 gene locus_tag LOCUS_27370 6587 6841 CDS product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222348.1 protein_id gnl|my_center|LOCUS_27370 6997 7317 gene locus_tag LOCUS_27380 6997 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 7721 7440 gene locus_tag LOCUS_27390 7721 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27390 7976 8545 gene locus_tag LOCUS_27400 7976 8545 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443797.1 protein_id gnl|my_center|LOCUS_27400 8725 9066 gene locus_tag LOCUS_27410 gene phnA 8725 9066 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_27410 9362 9213 gene locus_tag LOCUS_27420 9362 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 9585 9941 gene locus_tag LOCUS_27430 9585 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 10526 10041 gene locus_tag LOCUS_27440 10526 10041 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451443.1 protein_id gnl|my_center|LOCUS_27440 10841 11161 gene locus_tag LOCUS_27450 10841 11161 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_27450 11154 11753 gene locus_tag LOCUS_27460 11154 11753 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262569.1 protein_id gnl|my_center|LOCUS_27460 11754 12710 gene locus_tag LOCUS_27470 11754 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 13296 13850 gene locus_tag LOCUS_27480 13296 13850 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 protein_id gnl|my_center|LOCUS_27480 13958 15418 gene locus_tag LOCUS_27490 13958 15418 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228788.1 protein_id gnl|my_center|LOCUS_27490 15435 16262 gene locus_tag LOCUS_27500 gene nadE 15435 16262 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175037.1 protein_id gnl|my_center|LOCUS_27500 16626 18161 gene locus_tag LOCUS_27510 gene guaA 16626 18161 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 protein_id gnl|my_center|LOCUS_27510 18683 20017 gene locus_tag LOCUS_27520 18683 20017 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833082.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence048 1270 365 gene locus_tag LOCUS_27530 1270 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27530 2219 1296 gene locus_tag LOCUS_27540 2219 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27540 3168 2527 gene locus_tag LOCUS_27550 3168 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3950 3183 gene locus_tag LOCUS_27560 3950 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 5108 3975 gene locus_tag LOCUS_27570 gene pseC 5108 3975 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_27570 5711 5148 gene locus_tag LOCUS_27580 gene rfbC 5711 5148 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_27580 6804 5701 gene locus_tag LOCUS_27590 gene rfbG 6804 5701 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_27590 7582 6809 gene locus_tag LOCUS_27600 gene rfbF 7582 6809 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_27600 9104 8517 gene locus_tag LOCUS_27610 9104 8517 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781269.1 protein_id gnl|my_center|LOCUS_27610 9542 9117 gene locus_tag LOCUS_27620 9542 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 10120 9494 gene locus_tag LOCUS_27630 gene cobC 10120 9494 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_27630 10794 10078 gene locus_tag LOCUS_27640 gene cobS 10794 10078 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_27640 12346 10853 gene locus_tag LOCUS_27650 12346 10853 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989707.1 protein_id gnl|my_center|LOCUS_27650 12933 12343 gene locus_tag LOCUS_27660 gene cobU 12933 12343 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546718.1 protein_id gnl|my_center|LOCUS_27660 13991 12915 gene locus_tag LOCUS_27670 gene cobD 13991 12915 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_27670 14934 13966 gene locus_tag LOCUS_27680 gene cbiB 14934 13966 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461545.1 protein_id gnl|my_center|LOCUS_27680 16397 14931 gene locus_tag LOCUS_27690 16397 14931 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886611.1 protein_id gnl|my_center|LOCUS_27690 17455 16394 gene locus_tag LOCUS_27700 17455 16394 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 protein_id gnl|my_center|LOCUS_27700 18386 17418 gene locus_tag LOCUS_27710 18386 17418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_27710 18940 19320 gene locus_tag LOCUS_27720 18940 19320 CDS product group 2 truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232928.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence049 789 103 gene locus_tag LOCUS_27730 gene narI 789 103 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003331448.1 protein_id gnl|my_center|LOCUS_27730 1337 786 gene locus_tag LOCUS_27740 gene narJ 1337 786 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 protein_id gnl|my_center|LOCUS_27740 3141 1672 gene locus_tag LOCUS_27750 gene narH 3141 1672 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_27750 6814 3131 gene locus_tag LOCUS_27760 6814 3131 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_27760 7095 8687 gene locus_tag LOCUS_27770 7095 8687 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_27770 8859 9980 gene locus_tag LOCUS_27780 8859 9980 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046900.1 protein_id gnl|my_center|LOCUS_27780 10823 10122 gene locus_tag LOCUS_27790 10823 10122 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013859.1 protein_id gnl|my_center|LOCUS_27790 11082 12593 gene locus_tag LOCUS_27800 gene narK 11082 12593 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841841.1 protein_id gnl|my_center|LOCUS_27800 12755 13768 gene locus_tag LOCUS_27810 gene moaA 12755 13768 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076572118.1 protein_id gnl|my_center|LOCUS_27810 13787 14725 gene locus_tag LOCUS_27820 13787 14725 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495008.1 protein_id gnl|my_center|LOCUS_27820 14738 16033 gene locus_tag LOCUS_27830 14738 16033 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880215.1 protein_id gnl|my_center|LOCUS_27830 16000 16512 gene locus_tag LOCUS_27840 gene mobB 16000 16512 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513649.1 protein_id gnl|my_center|LOCUS_27840 17142 16606 gene locus_tag LOCUS_27850 17142 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 17244 17945 gene locus_tag LOCUS_27860 17244 17945 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_27860 18729 18025 gene locus_tag LOCUS_27870 gene ric 18729 18025 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401352.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence050 1746 550 gene locus_tag LOCUS_27880 1746 550 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_27880 2445 1984 gene locus_tag LOCUS_27890 gene lepB 2445 1984 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_27890 3736 2849 gene locus_tag LOCUS_27900 gene mntD 3736 2849 CDS product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 protein_id gnl|my_center|LOCUS_27900 5064 3733 gene locus_tag LOCUS_27910 gene mntC 5064 3733 CDS product manganese ABC transporter permease MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229064.1 protein_id gnl|my_center|LOCUS_27910 5824 5075 gene locus_tag LOCUS_27920 gene mntB 5824 5075 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_27920 6769 5837 gene locus_tag LOCUS_27930 gene mntA 6769 5837 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_27930 7162 7866 gene locus_tag LOCUS_27940 7162 7866 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_27940 8224 8922 gene locus_tag LOCUS_27950 gene ykoG 8224 8922 CDS product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 protein_id gnl|my_center|LOCUS_27950 8919 10277 gene locus_tag LOCUS_27960 gene ykoH 8919 10277 CDS product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 protein_id gnl|my_center|LOCUS_27960 10329 11039 gene locus_tag LOCUS_27970 10329 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 11141 11671 gene locus_tag LOCUS_27980 11141 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 11844 12029 gene locus_tag LOCUS_27990 11844 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 12893 13285 gene locus_tag LOCUS_28000 12893 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 14495 13341 gene locus_tag LOCUS_28010 14495 13341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873272.1 protein_id gnl|my_center|LOCUS_28010 14676 15191 gene locus_tag LOCUS_28020 14676 15191 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454210.1 protein_id gnl|my_center|LOCUS_28020 15232 16734 gene locus_tag LOCUS_28030 15232 16734 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence051 <1 730 gene locus_tag LOCUS_28040 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 930 2600 gene locus_tag LOCUS_28050 gene lonB 930 2600 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119176.1 protein_id gnl|my_center|LOCUS_28050 3353 5677 gene locus_tag LOCUS_28060 gene lon 3353 5677 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_28060 5674 6255 gene locus_tag LOCUS_28070 gene ysxC 5674 6255 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869113.1 protein_id gnl|my_center|LOCUS_28070 6762 6277 gene locus_tag LOCUS_28080 6762 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 7094 8431 gene locus_tag LOCUS_28090 gene hemA 7094 8431 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_28090 8451 9284 gene locus_tag LOCUS_28100 8451 9284 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 protein_id gnl|my_center|LOCUS_28100 9306 10235 gene locus_tag LOCUS_28110 gene hemC 9306 10235 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_28110 10235 11023 gene locus_tag LOCUS_28120 gene hemD 10235 11023 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992353.1 protein_id gnl|my_center|LOCUS_28120 11023 12003 gene locus_tag LOCUS_28130 gene hemB 11023 12003 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087065.1 protein_id gnl|my_center|LOCUS_28130 12027 13316 gene locus_tag LOCUS_28140 gene hemL 12027 13316 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_28140 13562 14833 gene locus_tag LOCUS_28150 gene spoVID 13562 14833 CDS product stage VI sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024850.1 protein_id gnl|my_center|LOCUS_28150 14933 15949 gene locus_tag LOCUS_28160 gene cotN 14933 15949 CDS product spore coat protein CotN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399056.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence052 17 93 gene locus_tag LOCUS_t00590 17 93 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 224 679 gene locus_tag LOCUS_28170 gene tsaE 224 679 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 protein_id gnl|my_center|LOCUS_28170 676 1380 gene locus_tag LOCUS_28180 gene tsaB 676 1380 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234078.1 protein_id gnl|my_center|LOCUS_28180 1380 1826 gene locus_tag LOCUS_28190 gene rimI 1380 1826 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_28190 1826 2845 gene locus_tag LOCUS_28200 gene tsaD 1826 2845 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_28200 4040 3642 gene locus_tag LOCUS_28210 4040 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 4291 4094 gene locus_tag LOCUS_28220 4291 4094 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001843884.1 protein_id gnl|my_center|LOCUS_28220 6388 4436 gene locus_tag LOCUS_28230 6388 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6646 6398 gene locus_tag LOCUS_28240 6646 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 8861 6927 gene locus_tag LOCUS_28250 8861 6927 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602146.1 protein_id gnl|my_center|LOCUS_28250 9048 9566 gene locus_tag LOCUS_28260 gene moaC 9048 9566 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094151.1 protein_id gnl|my_center|LOCUS_28260 9651 10313 gene locus_tag LOCUS_28270 9651 10313 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437705.1 protein_id gnl|my_center|LOCUS_28270 10366 10542 gene locus_tag LOCUS_28280 gene tatAY 10366 10542 CDS product sec-independent protein translocase protein TatAY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234072.1 protein_id gnl|my_center|LOCUS_28280 10560 11330 gene locus_tag LOCUS_28290 gene tatC 10560 11330 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_28290 11545 11345 gene locus_tag LOCUS_28300 11545 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 12285 11545 gene locus_tag LOCUS_28310 12285 11545 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745340.1 protein_id gnl|my_center|LOCUS_28310 12635 12922 gene locus_tag LOCUS_28320 gene groES 12635 12922 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917311.1 protein_id gnl|my_center|LOCUS_28320 12975 14603 gene locus_tag LOCUS_28330 gene groL 12975 14603 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_28330 15316 14786 gene locus_tag LOCUS_28340 15316 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28340 15954 15307 gene locus_tag LOCUS_28350 15954 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28350 >Feature sequence053 269 1204 gene locus_tag LOCUS_28360 gene kbfO 269 1204 CDS product potassium channel protein KbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242502.1 protein_id gnl|my_center|LOCUS_28360 1605 1201 gene locus_tag LOCUS_28370 1605 1201 CDS product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612327.1 protein_id gnl|my_center|LOCUS_28370 3063 1693 gene locus_tag LOCUS_28380 3063 1693 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_28380 3305 3538 gene locus_tag LOCUS_28390 3305 3538 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 protein_id gnl|my_center|LOCUS_28390 4883 3639 gene locus_tag LOCUS_28400 4883 3639 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831995.1 protein_id gnl|my_center|LOCUS_28400 6122 4929 gene locus_tag LOCUS_28410 gene rocD 6122 4929 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616652.1 protein_id gnl|my_center|LOCUS_28410 8262 6718 gene locus_tag LOCUS_28420 gene pruA 8262 6718 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259555.1 protein_id gnl|my_center|LOCUS_28420 9557 9156 gene locus_tag LOCUS_28430 gene yugI 9557 9156 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228864.1 protein_id gnl|my_center|LOCUS_28430 9762 11105 gene locus_tag LOCUS_28440 9762 11105 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814537.1 protein_id gnl|my_center|LOCUS_28440 12552 11386 gene locus_tag LOCUS_28450 12552 11386 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_28450 13052 12549 gene locus_tag LOCUS_28460 13052 12549 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_28460 13173 13988 gene locus_tag LOCUS_28470 13173 13988 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_28470 14251 13985 gene locus_tag LOCUS_28480 14251 13985 CDS product YugE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537641.1 protein_id gnl|my_center|LOCUS_28480 14406 15572 gene locus_tag LOCUS_28490 gene patB 14406 15572 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence054 1641 439 gene locus_tag LOCUS_28500 gene hmpA 1641 439 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947707.1 protein_id gnl|my_center|LOCUS_28500 1854 2306 gene locus_tag LOCUS_28510 gene nsrR 1854 2306 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_28510 2870 2511 gene locus_tag LOCUS_28520 2870 2511 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393398.1 protein_id gnl|my_center|LOCUS_28520 2869 3057 gene locus_tag LOCUS_28530 2869 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3258 3476 gene locus_tag LOCUS_28540 3258 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 4922 3543 gene locus_tag LOCUS_28550 4922 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 6747 5635 gene locus_tag LOCUS_28560 6747 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 7620 6754 gene locus_tag LOCUS_28570 7620 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 7778 8323 gene locus_tag LOCUS_28580 7778 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431334.1 protein_id gnl|my_center|LOCUS_28580 8387 8896 gene locus_tag LOCUS_28590 8387 8896 CDS product DUF3189 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639421.1 protein_id gnl|my_center|LOCUS_28590 9018 10250 gene locus_tag LOCUS_28600 9018 10250 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_28600 10437 10264 gene locus_tag LOCUS_28610 10437 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 11505 10600 gene locus_tag LOCUS_28620 gene gltC 11505 10600 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_28620 11994 11812 gene locus_tag LOCUS_28630 11994 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 12498 12794 gene locus_tag LOCUS_28640 12498 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 12875 13159 gene locus_tag LOCUS_28650 12875 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 13620 13297 gene locus_tag LOCUS_28660 13620 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 14501 14052 gene locus_tag LOCUS_28670 14501 14052 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060032.1 protein_id gnl|my_center|LOCUS_28670 14971 14516 gene locus_tag LOCUS_28680 14971 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence055 559 1038 gene locus_tag LOCUS_28690 559 1038 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_28690 2061 1102 gene locus_tag LOCUS_28700 2061 1102 CDS product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554260.1 protein_id gnl|my_center|LOCUS_28700 2170 3636 gene locus_tag LOCUS_28710 gene guaB 2170 3636 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_28710 4031 5386 gene locus_tag LOCUS_28720 gene dacA 4031 5386 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053075.1 protein_id gnl|my_center|LOCUS_28720 5526 6407 gene locus_tag LOCUS_28730 gene pdxS 5526 6407 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_28730 6407 6997 gene locus_tag LOCUS_28740 gene pdxT 6407 6997 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 protein_id gnl|my_center|LOCUS_28740 7345 8628 gene locus_tag LOCUS_28750 gene serS 7345 8628 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_28750 8826 8918 gene locus_tag LOCUS_t00600 8826 8918 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10443 9229 gene locus_tag LOCUS_28760 10443 9229 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_28760 10598 11074 gene locus_tag LOCUS_28770 gene tadA 10598 11074 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_28770 11784 13460 gene locus_tag LOCUS_28780 gene dnaX 11784 13460 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 protein_id gnl|my_center|LOCUS_28780 13477 13800 gene locus_tag LOCUS_28790 13477 13800 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 protein_id gnl|my_center|LOCUS_28790 13816 14412 gene locus_tag LOCUS_28800 gene recR 13816 14412 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_28800 14427 14645 gene locus_tag LOCUS_28810 14427 14645 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466019.1 protein_id gnl|my_center|LOCUS_28810 14701 14967 gene locus_tag LOCUS_28820 gene bofA 14701 14967 CDS product sigma-K factor-processing regulator BofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225421.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence056 384 1700 gene locus_tag LOCUS_28830 384 1700 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228736.1 protein_id gnl|my_center|LOCUS_28830 1796 2005 gene locus_tag LOCUS_28840 1796 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 2635 2396 gene locus_tag LOCUS_28850 2635 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3188 2973 gene locus_tag LOCUS_28860 3188 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 3546 3950 gene locus_tag LOCUS_28870 3546 3950 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140612.1 protein_id gnl|my_center|LOCUS_28870 4480 4118 gene locus_tag LOCUS_28880 gene mnhG 4480 4118 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244302.1 protein_id gnl|my_center|LOCUS_28880 4748 4464 gene locus_tag LOCUS_28890 4748 4464 CDS product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 protein_id gnl|my_center|LOCUS_28890 5224 4742 gene locus_tag LOCUS_28900 5224 4742 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 protein_id gnl|my_center|LOCUS_28900 6712 5231 gene locus_tag LOCUS_28910 6712 5231 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 protein_id gnl|my_center|LOCUS_28910 7046 6705 gene locus_tag LOCUS_28920 7046 6705 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 protein_id gnl|my_center|LOCUS_28920 7468 7046 gene locus_tag LOCUS_28930 7468 7046 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 protein_id gnl|my_center|LOCUS_28930 9870 7465 gene locus_tag LOCUS_28940 9870 7465 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 protein_id gnl|my_center|LOCUS_28940 10327 10536 gene locus_tag LOCUS_28950 10327 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 10636 11199 gene locus_tag LOCUS_28960 10636 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 13936 12089 gene locus_tag LOCUS_28970 13936 12089 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886602.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence057 184 1014 gene locus_tag LOCUS_28980 184 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1423 1088 gene locus_tag LOCUS_28990 1423 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435818.1 protein_id gnl|my_center|LOCUS_28990 1882 2130 gene locus_tag LOCUS_29000 1882 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2816 2196 gene locus_tag LOCUS_29010 2816 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3028 2843 gene locus_tag LOCUS_29020 3028 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3899 3462 gene locus_tag LOCUS_29030 3899 3462 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_29030 4033 4194 gene locus_tag LOCUS_29040 4033 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 4284 4526 gene locus_tag LOCUS_29050 gene yidD 4284 4526 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 protein_id gnl|my_center|LOCUS_29050 4608 5543 gene locus_tag LOCUS_29060 4608 5543 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733831.1 protein_id gnl|my_center|LOCUS_29060 5643 5795 gene locus_tag LOCUS_29070 5643 5795 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 protein_id gnl|my_center|LOCUS_29070 7161 6058 gene locus_tag LOCUS_29080 gene menC 7161 6058 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403270.1 protein_id gnl|my_center|LOCUS_29080 8623 7151 gene locus_tag LOCUS_29090 8623 7151 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449553.1 protein_id gnl|my_center|LOCUS_29090 9569 8751 gene locus_tag LOCUS_29100 gene menB 9569 8751 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_29100 10392 9559 gene locus_tag LOCUS_29110 gene menH 10392 9559 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 protein_id gnl|my_center|LOCUS_29110 12140 10389 gene locus_tag LOCUS_29120 gene menD 12140 10389 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059249.1 protein_id gnl|my_center|LOCUS_29120 13551 12133 gene locus_tag LOCUS_29130 13551 12133 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence058 411 148 gene locus_tag LOCUS_29140 411 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1010 474 gene locus_tag LOCUS_29150 1010 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_29150 1177 1001 gene locus_tag LOCUS_29160 1177 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1759 1373 gene locus_tag LOCUS_29170 1759 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2995 2285 gene locus_tag LOCUS_29180 2995 2285 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891631.1 protein_id gnl|my_center|LOCUS_29180 3147 4025 gene locus_tag LOCUS_29190 3147 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 5527 4766 gene locus_tag LOCUS_29200 5527 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 6510 5545 gene locus_tag LOCUS_29210 6510 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 8153 6771 gene locus_tag LOCUS_29220 gene rlmD 8153 6771 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 protein_id gnl|my_center|LOCUS_29220 9028 8159 gene locus_tag LOCUS_29230 9028 8159 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 protein_id gnl|my_center|LOCUS_29230 10079 9291 gene locus_tag LOCUS_29240 gene pdaA 10079 9291 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681209.1 protein_id gnl|my_center|LOCUS_29240 11759 10215 gene locus_tag LOCUS_29250 gene fumA 11759 10215 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_29250 12204 12004 gene locus_tag LOCUS_29260 12204 12004 CDS product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513558.1 protein_id gnl|my_center|LOCUS_29260 12368 13495 gene locus_tag LOCUS_29270 gene yfkAB 12368 13495 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence059 917 1267 gene locus_tag LOCUS_29280 gene acpS 917 1267 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721452.1 protein_id gnl|my_center|LOCUS_29280 1516 2529 gene locus_tag LOCUS_29290 1516 2529 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_29290 2716 3882 gene locus_tag LOCUS_29300 gene alr 2716 3882 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 protein_id gnl|my_center|LOCUS_29300 4072 4353 gene locus_tag LOCUS_29310 4072 4353 CDS product antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004570.1 protein_id gnl|my_center|LOCUS_29310 4359 4709 gene locus_tag LOCUS_29320 gene ndoA 4359 4709 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_29320 4912 5745 gene locus_tag LOCUS_29330 4912 5745 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721456.1 protein_id gnl|my_center|LOCUS_29330 5742 6104 gene locus_tag LOCUS_29340 gene rsbS 5742 6104 CDS product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 protein_id gnl|my_center|LOCUS_29340 6109 6504 gene locus_tag LOCUS_29350 gene rsbT 6109 6504 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_29350 6515 7525 gene locus_tag LOCUS_29360 gene rsbU 6515 7525 CDS product phosphoserine phosphatase RsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234295.1 protein_id gnl|my_center|LOCUS_29360 7598 7927 gene locus_tag LOCUS_29370 gene rsbV 7598 7927 CDS product anti-sigma factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234298.1 protein_id gnl|my_center|LOCUS_29370 7931 8398 gene locus_tag LOCUS_29380 gene rsbW 7931 8398 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_29380 8376 9170 gene locus_tag LOCUS_29390 gene sigB 8376 9170 CDS product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 protein_id gnl|my_center|LOCUS_29390 9170 9763 gene locus_tag LOCUS_29400 gene rsbX 9170 9763 CDS product phosphoserine phosphatase RsbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246608.1 protein_id gnl|my_center|LOCUS_29400 9975 12152 gene locus_tag LOCUS_29410 9975 12152 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477896.1 protein_id gnl|my_center|LOCUS_29410 12368 12835 gene locus_tag LOCUS_29420 12368 12835 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246525.1 protein_id gnl|my_center|LOCUS_29420 12984 13058 gene locus_tag LOCUS_t00610 12984 13058 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13067 13157 gene locus_tag LOCUS_t00620 13067 13157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13169 13242 gene locus_tag LOCUS_t00630 13169 13242 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13265 13340 gene locus_tag LOCUS_t00640 13265 13340 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13348 13422 gene locus_tag LOCUS_t00650 13348 13422 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13570 13643 gene locus_tag LOCUS_t00660 13570 13643 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13650 13734 gene locus_tag LOCUS_t00670 13650 13734 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13805 13889 gene locus_tag LOCUS_t00680 13805 13889 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13895 13970 gene locus_tag LOCUS_t00690 13895 13970 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13982 14055 gene locus_tag LOCUS_t00700 13982 14055 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14075 14148 gene locus_tag LOCUS_t00710 14075 14148 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 1718 633 gene locus_tag LOCUS_29430 1718 633 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_29430 4284 1819 gene locus_tag LOCUS_29440 gene gyrA 4284 1819 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_29440 6347 4419 gene locus_tag LOCUS_29450 gene gyrB 6347 4419 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_29450 6698 6441 gene locus_tag LOCUS_29460 gene remB 6698 6441 CDS product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 protein_id gnl|my_center|LOCUS_29460 7827 6709 gene locus_tag LOCUS_29470 gene recF 7827 6709 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_29470 8130 7912 gene locus_tag LOCUS_29480 gene rlbA 8130 7912 CDS product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 protein_id gnl|my_center|LOCUS_29480 9454 8318 gene locus_tag LOCUS_29490 gene dnaN 9454 8318 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_29490 10988 9645 gene locus_tag LOCUS_29500 gene dnaA 10988 9645 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_29500 11705 11839 gene locus_tag LOCUS_29510 gene rpmH 11705 11839 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 protein_id gnl|my_center|LOCUS_29510 11957 12346 gene locus_tag LOCUS_29520 gene rnpA 11957 12346 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 protein_id gnl|my_center|LOCUS_29520 12429 13202 gene locus_tag LOCUS_29530 gene spoIIIJ 12429 13202 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 protein_id gnl|my_center|LOCUS_29530 13199 13816 gene locus_tag LOCUS_29540 13199 13816 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111516.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence061 1587 304 gene locus_tag LOCUS_29550 1587 304 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_29550 1838 2404 gene locus_tag LOCUS_29560 1838 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2482 3474 gene locus_tag LOCUS_29570 2482 3474 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974328.1 protein_id gnl|my_center|LOCUS_29570 3975 4133 gene locus_tag LOCUS_29580 3975 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 5235 4339 gene locus_tag LOCUS_29590 gene opuAC 5235 4339 CDS product glycine/proline betaine ABC transporter substrate-binding protein OpuAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246462.1 protein_id gnl|my_center|LOCUS_29590 6083 5235 gene locus_tag LOCUS_29600 gene opuAB 6083 5235 CDS product glycine/proline betaine ABC transporter permease subunit OpuAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234703.1 protein_id gnl|my_center|LOCUS_29600 7334 6084 gene locus_tag LOCUS_29610 gene opuAA 7334 6084 CDS product glycine/proline betaine ABC transporter ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246301.1 protein_id gnl|my_center|LOCUS_29610 7570 8112 gene locus_tag LOCUS_29620 gene gbsR 7570 8112 CDS product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 protein_id gnl|my_center|LOCUS_29620 9867 8341 gene locus_tag LOCUS_29630 9867 8341 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098240.1 protein_id gnl|my_center|LOCUS_29630 10247 9864 gene locus_tag LOCUS_29640 10247 9864 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817360.1 protein_id gnl|my_center|LOCUS_29640 10595 12151 gene locus_tag LOCUS_29650 10595 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 12380 13105 gene locus_tag LOCUS_29660 12380 13105 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence062 132 701 gene locus_tag LOCUS_29670 132 701 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_29670 1010 1237 gene locus_tag LOCUS_29680 1010 1237 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254393.1 protein_id gnl|my_center|LOCUS_29680 2025 1300 gene locus_tag LOCUS_29690 2025 1300 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 protein_id gnl|my_center|LOCUS_29690 2893 2174 gene locus_tag LOCUS_29700 2893 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 4029 2890 gene locus_tag LOCUS_29710 4029 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 5228 4005 gene locus_tag LOCUS_29720 5228 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 7039 5243 gene locus_tag LOCUS_29730 7039 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 7399 8754 gene locus_tag LOCUS_29740 7399 8754 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110056.1 protein_id gnl|my_center|LOCUS_29740 9729 9064 gene locus_tag LOCUS_29750 9729 9064 CDS product DUF2642 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242695.1 protein_id gnl|my_center|LOCUS_29750 10778 9825 gene locus_tag LOCUS_29760 10778 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 11981 10899 gene locus_tag LOCUS_29770 gene cotH 11981 10899 CDS product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227854.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence063 286 519 gene locus_tag LOCUS_29780 286 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 961 650 gene locus_tag LOCUS_29790 961 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29790 1371 1132 gene locus_tag LOCUS_29800 1371 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29800 1685 1416 gene locus_tag LOCUS_29810 1685 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1959 1678 gene locus_tag LOCUS_29820 1959 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2170 1916 gene locus_tag LOCUS_29830 2170 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29830 2786 2145 gene locus_tag LOCUS_29840 2786 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29840 3080 2838 gene locus_tag LOCUS_29850 3080 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3039 3212 gene locus_tag LOCUS_29860 3039 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3374 3712 gene locus_tag LOCUS_29870 3374 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3950 4675 gene locus_tag LOCUS_29880 3950 4675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642546.1 protein_id gnl|my_center|LOCUS_29880 4672 5736 gene locus_tag LOCUS_29890 4672 5736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 protein_id gnl|my_center|LOCUS_29890 5765 6415 gene locus_tag LOCUS_29900 5765 6415 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734004.1 protein_id gnl|my_center|LOCUS_29900 7340 6459 gene locus_tag LOCUS_29910 7340 6459 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841777.1 protein_id gnl|my_center|LOCUS_29910 7835 7524 gene locus_tag LOCUS_29920 7835 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 8803 8648 gene locus_tag LOCUS_29930 8803 8648 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 protein_id gnl|my_center|LOCUS_29930 10501 9071 gene locus_tag LOCUS_29940 10501 9071 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 protein_id gnl|my_center|LOCUS_29940 11363 11148 gene locus_tag LOCUS_29950 11363 11148 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_29950 11736 11374 gene locus_tag LOCUS_29960 11736 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence064 1378 239 gene locus_tag LOCUS_29970 gene htrA 1378 239 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 protein_id gnl|my_center|LOCUS_29970 2844 1525 gene locus_tag LOCUS_29980 gene baeS 2844 1525 CDS product sensor histidine kinase efflux regulator BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 protein_id gnl|my_center|LOCUS_29980 3610 2933 gene locus_tag LOCUS_29990 3610 2933 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_29990 5399 3621 gene locus_tag LOCUS_30000 5399 3621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_30000 7122 5368 gene locus_tag LOCUS_30010 7122 5368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 protein_id gnl|my_center|LOCUS_30010 8314 7355 gene locus_tag LOCUS_30020 gene yclQ 8314 7355 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_30020 9190 8435 gene locus_tag LOCUS_30030 9190 8435 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 protein_id gnl|my_center|LOCUS_30030 10134 9184 gene locus_tag LOCUS_30040 gene yclO 10134 9184 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_30040 11077 10127 gene locus_tag LOCUS_30050 gene yclN 11077 10127 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_30050 11426 11566 gene locus_tag LOCUS_30060 11426 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence065 738 91 gene locus_tag LOCUS_30070 738 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 870 1115 gene locus_tag LOCUS_30080 870 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1394 2083 gene locus_tag LOCUS_30090 1394 2083 CDS product DUF3885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043321894.1 protein_id gnl|my_center|LOCUS_30090 2080 2550 gene locus_tag LOCUS_30100 2080 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2595 2777 gene locus_tag LOCUS_30110 2595 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3390 3779 gene locus_tag LOCUS_30120 3390 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 5260 4025 gene locus_tag LOCUS_30130 5260 4025 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287107.1 protein_id gnl|my_center|LOCUS_30130 5641 5898 gene locus_tag LOCUS_30140 5641 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974801.1 protein_id gnl|my_center|LOCUS_30140 6287 6484 gene locus_tag LOCUS_30150 6287 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910604.1 protein_id gnl|my_center|LOCUS_30150 6560 6745 gene locus_tag LOCUS_30160 6560 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 6807 7043 gene locus_tag LOCUS_30170 6807 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 7568 7155 gene locus_tag LOCUS_30180 7568 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 7655 9208 gene locus_tag LOCUS_30190 gene istA 7655 9208 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 protein_id gnl|my_center|LOCUS_30190 9208 9639 gene locus_tag LOCUS_30200 9208 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 9669 9977 gene locus_tag LOCUS_30210 9669 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30210 10093 10302 gene locus_tag LOCUS_30220 10093 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 10331 10822 gene locus_tag LOCUS_30230 10331 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 10847 11443 gene locus_tag LOCUS_30240 10847 11443 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195901.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence066 207 317 gene locus_tag LOCUS_r00020 207 317 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 331 405 gene locus_tag LOCUS_t00720 331 405 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 408 480 gene locus_tag LOCUS_t00730 408 480 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 499 573 gene locus_tag LOCUS_t00740 499 573 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 607 682 gene locus_tag LOCUS_t00750 607 682 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 686 761 gene locus_tag LOCUS_t00760 686 761 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 777 861 gene locus_tag LOCUS_t00770 777 861 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 869 943 gene locus_tag LOCUS_t00780 869 943 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1142 1215 gene locus_tag LOCUS_t00790 1142 1215 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1220 1291 gene locus_tag LOCUS_t00800 1220 1291 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1560 2459 gene locus_tag LOCUS_30250 gene rocF 1560 2459 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 protein_id gnl|my_center|LOCUS_30250 2746 2585 gene locus_tag LOCUS_30260 2746 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2973 3536 gene locus_tag LOCUS_30270 gene sigW 2973 3536 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_30270 3554 4159 gene locus_tag LOCUS_30280 gene rsiW 3554 4159 CDS product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 protein_id gnl|my_center|LOCUS_30280 4537 5373 gene locus_tag LOCUS_30290 gene cdaA 4537 5373 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_30290 5366 6676 gene locus_tag LOCUS_30300 5366 6676 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731931.1 protein_id gnl|my_center|LOCUS_30300 6705 8051 gene locus_tag LOCUS_30310 gene glmM 6705 8051 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_30310 8757 10559 gene locus_tag LOCUS_30320 gene glmS 8757 10559 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234943.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence067 254 1777 gene locus_tag LOCUS_30330 254 1777 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042441161.1 protein_id gnl|my_center|LOCUS_30330 2118 1987 gene locus_tag LOCUS_30340 2118 1987 CDS product DUF3941 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120851.1 protein_id gnl|my_center|LOCUS_30340 3039 2182 gene locus_tag LOCUS_30350 3039 2182 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538278.1 protein_id gnl|my_center|LOCUS_30350 3464 3288 gene locus_tag LOCUS_30360 3464 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3618 3466 gene locus_tag LOCUS_30370 3618 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 4660 3851 gene locus_tag LOCUS_30380 gene yitU 4660 3851 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 protein_id gnl|my_center|LOCUS_30380 4824 5591 gene locus_tag LOCUS_30390 4824 5591 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233006.1 protein_id gnl|my_center|LOCUS_30390 5664 5972 gene locus_tag LOCUS_30400 5664 5972 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720638.1 protein_id gnl|my_center|LOCUS_30400 6720 6028 gene locus_tag LOCUS_30410 6720 6028 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013859.1 protein_id gnl|my_center|LOCUS_30410 6993 7172 gene locus_tag LOCUS_30420 6993 7172 CDS product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531418.1 protein_id gnl|my_center|LOCUS_30420 7357 9954 gene locus_tag LOCUS_30430 gene clpB 7357 9954 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence068 702 2147 gene locus_tag LOCUS_30440 gene aspA 702 2147 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562128.1 protein_id gnl|my_center|LOCUS_30440 2737 2219 gene locus_tag LOCUS_30450 2737 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3282 3088 gene locus_tag LOCUS_30460 3282 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 5032 3260 gene locus_tag LOCUS_30470 gene thiC 5032 3260 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_30470 5699 7009 gene locus_tag LOCUS_30480 5699 7009 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003471527.1 protein_id gnl|my_center|LOCUS_30480 7141 7998 gene locus_tag LOCUS_30490 7141 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 8303 8782 gene locus_tag LOCUS_30500 gene rraA 8303 8782 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266027.1 protein_id gnl|my_center|LOCUS_30500 9591 10310 gene locus_tag LOCUS_30510 9591 10310 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence069 179 877 gene locus_tag LOCUS_30520 gene mtnN 179 877 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217024.1 protein_id gnl|my_center|LOCUS_30520 1070 1318 gene locus_tag LOCUS_30530 1070 1318 CDS product YrhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237358.1 protein_id gnl|my_center|LOCUS_30530 2478 1753 gene locus_tag LOCUS_30540 gene sigK 2478 1753 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_30540 3183 2644 gene locus_tag LOCUS_30550 gene pssA 3183 2644 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963995.1 protein_id gnl|my_center|LOCUS_30550 3441 4238 gene locus_tag LOCUS_30560 3441 4238 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255010.1 protein_id gnl|my_center|LOCUS_30560 4533 4393 gene locus_tag LOCUS_30570 gene sda 4533 4393 CDS product sporulation histidine kinase inhibitor Sda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886571.1 protein_id gnl|my_center|LOCUS_30570 4808 4620 gene locus_tag LOCUS_30580 4808 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 4923 5438 gene locus_tag LOCUS_30590 4923 5438 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 protein_id gnl|my_center|LOCUS_30590 5441 6547 gene locus_tag LOCUS_30600 gene yqeH 5441 6547 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140799.1 protein_id gnl|my_center|LOCUS_30600 6754 7602 gene locus_tag LOCUS_30610 gene aroE 6754 7602 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812091.1 protein_id gnl|my_center|LOCUS_30610 7589 7882 gene locus_tag LOCUS_30620 gene yhbY 7589 7882 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 protein_id gnl|my_center|LOCUS_30620 7879 8472 gene locus_tag LOCUS_30630 7879 8472 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_30630 8441 9022 gene locus_tag LOCUS_30640 gene yqeK 8441 9022 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_30640 9019 9375 gene locus_tag LOCUS_30650 gene rsfS 9019 9375 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998173.1 protein_id gnl|my_center|LOCUS_30650 9372 10190 gene locus_tag LOCUS_30660 9372 10190 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence070 487 993 gene locus_tag LOCUS_30670 487 993 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949392.1 protein_id gnl|my_center|LOCUS_30670 1328 1531 gene locus_tag LOCUS_30680 1328 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1826 2026 gene locus_tag LOCUS_30690 gene cspD 1826 2026 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_30690 2520 2077 gene locus_tag LOCUS_30700 2520 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2799 4142 gene locus_tag LOCUS_30710 2799 4142 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814537.1 protein_id gnl|my_center|LOCUS_30710 4788 4534 gene locus_tag LOCUS_30720 4788 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 4951 5961 gene locus_tag LOCUS_30730 4951 5961 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_30730 6787 6008 gene locus_tag LOCUS_30740 6787 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30740 7326 6838 gene locus_tag LOCUS_30750 7326 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30750 7725 7597 gene locus_tag LOCUS_30760 7725 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 7744 7962 gene locus_tag LOCUS_30770 7744 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 9109 8084 gene locus_tag LOCUS_30780 9109 8084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 9323 9078 gene locus_tag LOCUS_30790 9323 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence071 1457 96 gene locus_tag LOCUS_30800 gene bioA 1457 96 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398913.1 protein_id gnl|my_center|LOCUS_30800 2169 1435 gene locus_tag LOCUS_30810 gene bioD 2169 1435 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016822.1 protein_id gnl|my_center|LOCUS_30810 2451 3026 gene locus_tag LOCUS_30820 2451 3026 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252167.1 protein_id gnl|my_center|LOCUS_30820 4677 3346 gene locus_tag LOCUS_30830 gene ykvU 4677 3346 CDS product sporulation protein YkvU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245552.1 protein_id gnl|my_center|LOCUS_30830 4972 5649 gene locus_tag LOCUS_30840 4972 5649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781961.1 protein_id gnl|my_center|LOCUS_30840 5646 7025 gene locus_tag LOCUS_30850 5646 7025 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839485.1 protein_id gnl|my_center|LOCUS_30850 7101 8183 gene locus_tag LOCUS_30860 7101 8183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477770.1 protein_id gnl|my_center|LOCUS_30860 8183 8863 gene locus_tag LOCUS_30870 8183 8863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence072 746 3388 gene locus_tag LOCUS_30880 gene valS 746 3388 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_30880 3680 4972 gene locus_tag LOCUS_30890 gene folC 3680 4972 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_30890 5126 8974 gene locus_tag LOCUS_30900 5126 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence073 1356 181 gene locus_tag LOCUS_30910 1356 181 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_30910 2628 2999 gene locus_tag LOCUS_30920 2628 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3560 4708 gene locus_tag LOCUS_30930 3560 4708 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_30930 4730 5314 gene locus_tag LOCUS_30940 4730 5314 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_30940 5347 6849 gene locus_tag LOCUS_30950 gene lcfB 5347 6849 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_30950 6892 7689 gene locus_tag LOCUS_30960 6892 7689 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_30960 7711 8592 gene locus_tag LOCUS_30970 7711 8592 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence074 1109 3166 gene locus_tag LOCUS_30980 1109 3166 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_30980 4007 3825 gene locus_tag LOCUS_30990 4007 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4956 5135 gene locus_tag LOCUS_31000 4956 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 6553 5312 gene locus_tag LOCUS_31010 6553 5312 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517080.1 protein_id gnl|my_center|LOCUS_31010 6964 7104 gene locus_tag LOCUS_31020 6964 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7599 7991 gene locus_tag LOCUS_31030 7599 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 8643 8053 gene locus_tag LOCUS_31040 8643 8053 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_31040 8837 8643 gene locus_tag LOCUS_31050 8837 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence075 605 2281 gene locus_tag LOCUS_31060 605 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459431.1 protein_id gnl|my_center|LOCUS_31060 3210 3566 gene locus_tag LOCUS_31070 3210 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3808 3883 gene locus_tag LOCUS_t00810 3808 3883 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4553 4053 gene locus_tag LOCUS_31080 4553 4053 CDS product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 protein_id gnl|my_center|LOCUS_31080 4722 4844 gene locus_tag LOCUS_31090 4722 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 6352 4994 gene locus_tag LOCUS_31100 gene glpT 6352 4994 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831473.1 protein_id gnl|my_center|LOCUS_31100 7488 6784 gene locus_tag LOCUS_31110 7488 6784 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386690.1 protein_id gnl|my_center|LOCUS_31110 7824 7636 gene locus_tag LOCUS_31120 7824 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence076 1319 570 gene locus_tag LOCUS_31130 gene map 1319 570 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 protein_id gnl|my_center|LOCUS_31130 1595 2005 gene locus_tag LOCUS_31140 1595 2005 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343680.1 protein_id gnl|my_center|LOCUS_31140 2071 3273 gene locus_tag LOCUS_31150 2071 3273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_31150 4422 3679 gene locus_tag LOCUS_31160 gene motB 4422 3679 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 protein_id gnl|my_center|LOCUS_31160 5212 4409 gene locus_tag LOCUS_31170 gene motA 5212 4409 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 protein_id gnl|my_center|LOCUS_31170 7308 5683 gene locus_tag LOCUS_31180 7308 5683 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_31180 7582 7740 gene locus_tag LOCUS_31190 7582 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence077 698 859 gene locus_tag LOCUS_31200 698 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1448 891 gene locus_tag LOCUS_31210 1448 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 2062 1601 gene locus_tag LOCUS_31220 2062 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2189 2845 gene locus_tag LOCUS_31230 2189 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 3279 4349 gene locus_tag LOCUS_31240 3279 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4671 4919 gene locus_tag LOCUS_31250 4671 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 5028 5396 gene locus_tag LOCUS_31260 5028 5396 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 protein_id gnl|my_center|LOCUS_31260 5472 5753 gene locus_tag LOCUS_31270 5472 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 5779 6348 gene locus_tag LOCUS_31280 5779 6348 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 protein_id gnl|my_center|LOCUS_31280 7043 6720 gene locus_tag LOCUS_31290 7043 6720 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628051.1 protein_id gnl|my_center|LOCUS_31290 7765 7040 gene locus_tag LOCUS_31300 7765 7040 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190726.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence078 172 813 gene locus_tag LOCUS_31310 172 813 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836620.1 protein_id gnl|my_center|LOCUS_31310 941 2104 gene locus_tag LOCUS_31320 941 2104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021185.1 protein_id gnl|my_center|LOCUS_31320 2089 4407 gene locus_tag LOCUS_31330 2089 4407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_31330 4411 5169 gene locus_tag LOCUS_31340 4411 5169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_31340 6159 5701 gene locus_tag LOCUS_31350 6159 5701 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_31350 6611 6216 gene locus_tag LOCUS_31360 gene merR 6611 6216 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640387.1 protein_id gnl|my_center|LOCUS_31360 6735 7211 gene locus_tag LOCUS_31370 6735 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence079 1136 318 gene locus_tag LOCUS_31380 gene comER 1136 318 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020551.1 protein_id gnl|my_center|LOCUS_31380 1206 1859 gene locus_tag LOCUS_31390 1206 1859 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320838.1 protein_id gnl|my_center|LOCUS_31390 1921 2382 gene locus_tag LOCUS_31400 1921 2382 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439783.1 protein_id gnl|my_center|LOCUS_31400 3000 4724 gene locus_tag LOCUS_31410 3000 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 4932 4801 gene locus_tag LOCUS_31420 4932 4801 CDS product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 protein_id gnl|my_center|LOCUS_31420 5358 6383 gene locus_tag LOCUS_31430 gene holA 5358 6383 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_31430 6525 6929 gene locus_tag LOCUS_31440 6525 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence080 1066 344 gene locus_tag LOCUS_31450 gene queE 1066 344 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232460.1 protein_id gnl|my_center|LOCUS_31450 1500 1063 gene locus_tag LOCUS_31460 gene queD 1500 1063 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 protein_id gnl|my_center|LOCUS_31460 2162 1500 gene locus_tag LOCUS_31470 gene queC 2162 1500 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711596.1 protein_id gnl|my_center|LOCUS_31470 2956 2429 gene locus_tag LOCUS_31480 gene sodC 2956 2429 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746504.1 protein_id gnl|my_center|LOCUS_31480 4006 3800 gene locus_tag LOCUS_31490 4006 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 4977 4387 gene locus_tag LOCUS_31500 4977 4387 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722402.1 protein_id gnl|my_center|LOCUS_31500 5144 5533 gene locus_tag LOCUS_31510 5144 5533 CDS product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209332.1 protein_id gnl|my_center|LOCUS_31510 6247 5630 gene locus_tag LOCUS_31520 gene kapD 6247 5630 CDS product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344361.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence081 1383 148 gene locus_tag LOCUS_31530 1383 148 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551899.1 protein_id gnl|my_center|LOCUS_31530 2323 1541 gene locus_tag LOCUS_31540 2323 1541 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504233.1 protein_id gnl|my_center|LOCUS_31540 4094 2493 gene locus_tag LOCUS_31550 4094 2493 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674296.1 protein_id gnl|my_center|LOCUS_31550 4541 4185 gene locus_tag LOCUS_31560 gene tnpB 4541 4185 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287659.1 protein_id gnl|my_center|LOCUS_31560 4729 4535 gene locus_tag LOCUS_31570 4729 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 5795 5373 gene locus_tag LOCUS_31580 5795 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence082 139 732 gene locus_tag LOCUS_31590 139 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 823 1827 gene locus_tag LOCUS_31600 823 1827 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947999.1 protein_id gnl|my_center|LOCUS_31600 1842 2750 gene locus_tag LOCUS_31610 1842 2750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_31610 3965 2823 gene locus_tag LOCUS_31620 3965 2823 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233537.1 protein_id gnl|my_center|LOCUS_31620 5539 4247 gene locus_tag LOCUS_31630 gene hemL 5539 4247 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011863.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence083 1165 296 gene locus_tag LOCUS_31640 1165 296 CDS product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 protein_id gnl|my_center|LOCUS_31640 1312 1665 gene locus_tag LOCUS_31650 1312 1665 CDS product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025063.1 protein_id gnl|my_center|LOCUS_31650 2142 1699 gene locus_tag LOCUS_31660 gene perR 2142 1699 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_31660 2818 2273 gene locus_tag LOCUS_31670 2818 2273 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_31670 3768 2821 gene locus_tag LOCUS_31680 3768 2821 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989785.1 protein_id gnl|my_center|LOCUS_31680 4654 4181 gene locus_tag LOCUS_31690 gene bcp 4654 4181 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_31690 5136 4723 gene locus_tag LOCUS_31700 5136 4723 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964343.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence084 108 182 gene locus_tag LOCUS_t00820 108 182 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 205 280 gene locus_tag LOCUS_t00830 205 280 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 297 372 gene locus_tag LOCUS_t00840 297 372 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 457 532 gene locus_tag LOCUS_t00850 457 532 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 536 624 gene locus_tag LOCUS_t00860 536 624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 627 702 gene locus_tag LOCUS_t00870 627 702 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 707 782 gene locus_tag LOCUS_t00880 707 782 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 796 869 gene locus_tag LOCUS_t00890 796 869 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 972 1045 gene locus_tag LOCUS_t00900 972 1045 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1152 1226 gene locus_tag LOCUS_t00910 1152 1226 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1296 1371 gene locus_tag LOCUS_t00920 1296 1371 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2309 1422 gene locus_tag LOCUS_31710 2309 1422 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_31710 2425 3615 gene locus_tag LOCUS_31720 2425 3615 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_31720 3681 4874 gene locus_tag LOCUS_31730 gene sndC 3681 4874 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_31730 4915 5148 gene locus_tag LOCUS_31740 4915 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence085 220 59 gene locus_tag LOCUS_31750 220 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1197 844 gene locus_tag LOCUS_31760 1197 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1681 4785 gene locus_tag LOCUS_31770 1681 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 4785 5192 gene locus_tag LOCUS_31780 4785 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence086 979 176 gene locus_tag LOCUS_31790 979 176 CDS product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 protein_id gnl|my_center|LOCUS_31790 2199 1144 gene locus_tag LOCUS_31800 gene cax 2199 1144 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242902.1 protein_id gnl|my_center|LOCUS_31800 2654 2265 gene locus_tag LOCUS_31810 2654 2265 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_31810 3053 4969 gene locus_tag LOCUS_31820 3053 4969 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence087 897 286 gene locus_tag LOCUS_31830 897 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1138 1599 gene locus_tag LOCUS_31840 1138 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 1818 1949 gene locus_tag LOCUS_31850 1818 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2113 3042 gene locus_tag LOCUS_31860 2113 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3711 3851 gene locus_tag LOCUS_31870 3711 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence088 1237 251 gene locus_tag LOCUS_31880 1237 251 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_31880 1560 1375 gene locus_tag LOCUS_31890 1560 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2722 1976 gene locus_tag LOCUS_31900 2722 1976 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240990.1 protein_id gnl|my_center|LOCUS_31900 2983 3963 gene locus_tag LOCUS_31910 2983 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence089 765 196 gene locus_tag LOCUS_31920 765 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1728 1597 gene locus_tag LOCUS_31930 1728 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 2239 1967 gene locus_tag LOCUS_31940 2239 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3641 3339 gene locus_tag LOCUS_31950 3641 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence090 992 267 gene locus_tag LOCUS_31960 gene ecsC 992 267 CDS product ecs operon protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634142.1 protein_id gnl|my_center|LOCUS_31960 2121 1651 gene locus_tag LOCUS_31970 2121 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 2709 2266 gene locus_tag LOCUS_31980 2709 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3167 2661 gene locus_tag LOCUS_31990 3167 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3470 3622 gene locus_tag LOCUS_32000 3470 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence091 242 916 gene locus_tag LOCUS_32010 242 916 CDS product putative immunity/bacteriocin fusion bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691527.1 protein_id gnl|my_center|LOCUS_32010 2304 976 gene locus_tag LOCUS_32020 2304 976 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094396572.1 protein_id gnl|my_center|LOCUS_32020 2508 2864 gene locus_tag LOCUS_32030 2508 2864 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245674.1 protein_id gnl|my_center|LOCUS_32030 2857 3519 gene locus_tag LOCUS_32040 2857 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence092 647 192 gene locus_tag LOCUS_32050 647 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 1352 672 gene locus_tag LOCUS_32060 1352 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1470 1610 gene locus_tag LOCUS_32070 1470 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1771 1649 gene locus_tag LOCUS_32080 1771 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2855 2349 gene locus_tag LOCUS_32090 2855 2349 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071759460.1 protein_id gnl|my_center|LOCUS_32090 <3573 2834 gene locus_tag LOCUS_32100 <3573 2834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002237787.1:HNH endonuclease >Feature sequence093 1365 892 gene locus_tag LOCUS_32110 1365 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 2418 1573 gene locus_tag LOCUS_32120 2418 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 2851 2501 gene locus_tag LOCUS_32130 2851 2501 CDS product DUF4275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272658.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32130 3290 2841 gene locus_tag LOCUS_32140 3290 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence094 37 186 gene locus_tag LOCUS_32150 37 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 947 261 gene locus_tag LOCUS_32160 947 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 1781 1176 gene locus_tag LOCUS_32170 1781 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2113 2259 gene locus_tag LOCUS_32180 2113 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2243 2371 gene locus_tag LOCUS_32190 2243 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2403 2678 gene locus_tag LOCUS_32200 2403 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 2795 3016 gene locus_tag LOCUS_32210 2795 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3054 3194 gene locus_tag LOCUS_32220 3054 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence095 1159 326 gene locus_tag LOCUS_32230 1159 326 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_32230 1510 1172 gene locus_tag LOCUS_32240 1510 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2004 1522 gene locus_tag LOCUS_32250 2004 1522 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250910.1 protein_id gnl|my_center|LOCUS_32250 2466 2687 gene locus_tag LOCUS_32260 2466 2687 CDS product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366196.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence096 350 274 gene locus_tag LOCUS_t00930 350 274 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 445 355 gene locus_tag LOCUS_t00940 445 355 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 526 452 gene locus_tag LOCUS_t00950 526 452 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 614 539 gene locus_tag LOCUS_t00960 614 539 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 699 626 gene locus_tag LOCUS_t00970 699 626 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 783 709 gene locus_tag LOCUS_t00980 783 709 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 875 800 gene locus_tag LOCUS_t00990 875 800 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 960 884 gene locus_tag LOCUS_t01000 960 884 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1040 964 gene locus_tag LOCUS_t01010 1040 964 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1155 1063 gene locus_tag LOCUS_t01020 1155 1063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1245 1169 gene locus_tag LOCUS_t01030 1245 1169 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1334 1259 gene locus_tag LOCUS_t01040 1334 1259 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1422 1347 gene locus_tag LOCUS_t01050 1422 1347 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1511 1436 gene locus_tag LOCUS_t01060 1511 1436 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1591 1516 gene locus_tag LOCUS_t01070 1591 1516 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1682 1594 gene locus_tag LOCUS_t01080 1682 1594 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1762 1688 gene locus_tag LOCUS_t01090 1762 1688 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1852 1769 gene locus_tag LOCUS_t01100 1852 1769 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1931 1858 gene locus_tag LOCUS_t01110 1931 1858 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2015 1940 gene locus_tag LOCUS_t01120 2015 1940 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2099 2024 gene locus_tag LOCUS_t01130 2099 2024 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 589 1383 gene locus_tag LOCUS_32270 gene imm47 589 1383 CDS product Imm47 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059303621.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence098 167 45 gene locus_tag LOCUS_32280 167 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 582 364 gene locus_tag LOCUS_32290 582 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1185 700 gene locus_tag LOCUS_32300 1185 700 CDS product DUF600 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845734.1 protein_id gnl|my_center|LOCUS_32300 <1784 1186 gene locus_tag LOCUS_32310 <1784 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000382718.1:DNA/RNA non-specific endonuclease >Feature sequence099 305 60 gene locus_tag LOCUS_32320 305 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32320 1151 936 gene locus_tag LOCUS_32330 1151 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1440 1183 gene locus_tag LOCUS_32340 1440 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence100 151 1536 gene locus_tag LOCUS_32350 gene ltrA 151 1536 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence101 618 1268 gene locus_tag LOCUS_32360 618 1268 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609233.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence102 1362 445 gene locus_tag LOCUS_32370 gene aprE 1362 445 CDS product subtilisin AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233171.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence103 82 366 gene locus_tag LOCUS_32380 82 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32380 369 1211 gene locus_tag LOCUS_32390 369 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 >Feature sequence104 1306 131 gene locus_tag LOCUS_32400 1306 131 CDS product IS256-like element IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195429.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence105 >Feature sequence106 1264 149 gene locus_tag LOCUS_32410 1264 149 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289051.1 protein_id gnl|my_center|LOCUS_32410 >Feature sequence107 >Feature sequence108 598 437 gene locus_tag LOCUS_32420 598 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence109 1100 894 gene locus_tag LOCUS_32430 1100 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence110 <1 1019 gene locus_tag LOCUS_32440 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000453221.1:ISLre2 family transposase