COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3592406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 312..1849 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 2155..2230 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 rRNA 2567..5452 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5539..5648 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 5783..5983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 6055..6441 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene crcB CDS 6500..7255 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene ubiE CDS 7255..7872 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 7869..9506 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene ubiB CDS 9590..9844 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene tatA CDS 9848..10201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 note possible pseudo, internal stop codon, frameshifted CDS 10198..10944 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene tatC CDS 10941..11726 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 11729..12742 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene hemB CDS complement(12766..14247) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene gppA CDS complement(14252..15556) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene rhlB CDS 15673..15999 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307306.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene trxA CDS 16241..17446 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene rho CDS 17901..19400 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene ubiD CDS 19403..20098 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene fre CDS complement(20166..20432) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(20481..21380) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene ilvY CDS 21516..23000 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene ilvC CDS 23155..23949 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707894.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene tcdA CDS 24010..24291 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(24520..24942) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(24942..26156) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 26279..28297 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707891.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rep CDS complement(28402..28863) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 29025..29546 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 29696..30316 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(30313..31218) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 31344..32561 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene sbcD CDS 32558..35956 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene sbcC CDS complement(36095..37558) product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 37707..38384 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 38442..39731 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 40319..41146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 41193..41507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 41510..42187 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 42211..42654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 42983..44221 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 44224..45210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(45267..46316) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073761.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(46318..46932) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(47077..47577) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(47627..48514) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 48634..50061 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965040.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(50064..50957) product putative metalloprotease CJM1_0395 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704306.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 51384..52004 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 52017..52502 product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 52504..53313 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479623.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 53325..53624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479615.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 53611..54093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 54090..54971 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459333.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 54971..55666 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 55666..56544 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 56541..57326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 57556..59604 product colicin FY TonB-dependent receptor YuiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene yuiR CDS 59792..60712 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(60783..61133) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(61127..61540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(61637..62620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 62825..63559 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 63581..64576 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(64583..65464) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(65581..67881) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(67874..68551) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene ytfE CDS 68705..70240 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene norR CDS complement(70248..71909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(72048..73487) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 73429..73617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(73826..74908) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene pyrC CDS 75206..75979 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 75979..77277 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(77373..78101) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(78098..79036) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(79033..80208) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(80303..81214) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(81299..85315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 85540..86763 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene sstT CDS complement(86835..88241) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(88303..89412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(89603..90532) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(90630..91073) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(91085..92371) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(92384..92980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(93053..94075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(94553..95305) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(95542..97773) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 98117..99670 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103804.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(99700..99876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(99870..100457) product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(100498..100980) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(100977..101738) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(101731..102618) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(102634..102942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(103034..104398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(104471..105031) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(105132..106181) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(106174..106623) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(106633..108837) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(109260..109685) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(109746..111101) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(111098..112945) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 113042..113287 product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 113560..115242 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 115239..115511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 115622..116620 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 116703..117281 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 117457..118896 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 118917..120023 product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 120336..120875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(120983..122476) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(122487..123869) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(124004..124753) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 125029..126402 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 126417..128357 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 128506..128994 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(129026..129442) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(129472..130317) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(130332..131315) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(131475..131906) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene trxC CDS complement(131906..132316) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(132327..133316) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 133471..134172 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 tRNA 134223..134299 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(134388..134603) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ybcJ CDS 134702..136021 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 136306..137160 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene phnC CDS 137157..138146 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene phnD CDS 138202..138987 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene phnE CDS 139085..139780 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene phnF CDS 139781..140224 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene phnG CDS 140224..140820 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene phnH CDS 140824..141924 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 141921..142778 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene phnJ CDS 142775..143632 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene phnK CDS 143641..144351 product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene phnL CDS 144365..145501 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene phnM CDS 145551..146084 product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene phnN CDS 146075..146827 product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene phnP CDS complement(146879..148561) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 148827..149750 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 149743..149976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 149979..151334 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rmuC CDS complement(151309..152754) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(152766..154142) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene trkA CDS complement(154139..155434) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene rsmB CDS complement(155460..156404) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene fmt CDS complement(156426..156935) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene def CDS 157077..158108 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 158122..159186 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene dprA CDS 159189..159662 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 159710..160252 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 160285..160848 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 160872..161780 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene hemF CDS complement(161777..162646) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene hdfR CDS 162796..163620 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene aroE CDS 163617..163877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 163980..164297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 note possible pseudo, frameshifted CDS 164783..165157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(165222..165758) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 rRNA 166216..167755 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 167900..167976 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 168013..168088 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 rRNA 168330..171214 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 171303..171412 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 171727..173106 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(173132..173848) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene thiQ CDS complement(173832..175430) product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene thiP CDS complement(175430..176413) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene thiB CDS 176547..176837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(176895..177494) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene leuD CDS complement(177505..178902) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene leuC CDS complement(178902..180008) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene leuB CDS complement(180005..181570) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene leuA CDS 182286..184004 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 184004..184498 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene ilvN CDS 184641..185372 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 185369..185752 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 185804..186205 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene tusD CDS 186205..186561 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene tusC CDS 186568..186852 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene tusB CDS 187009..187383 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rpsL CDS 187468..187938 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene rpsG CDS 188014..190113 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707695.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene fusA CDS 190178..191362 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene tuf CDS 191525..191950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 192055..192246 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352142.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(192326..192898) product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 193150..193581 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 193746..194366 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(194372..195775) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 195994..197439 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene xdhA CDS 197432..199831 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene xdhB CDS 199875..200699 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene xdhC CDS 200729..202048 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene guaD CDS 202243..202977 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 203213..203611 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 203650..205074 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 205199..206665 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(206725..207765) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 207908..208804 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 209056..210819 product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene xsc CDS 210953..211906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 211923..212216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(212435..212935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(213082..214425) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(214418..215038) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(215105..216118) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(216439..218181) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene cobT CDS complement(218185..219165) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene cobS CDS complement(219278..221062) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 221230..222558 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 222764..223171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(223213..223458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 223670..224008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(224152..225495) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(225586..225939) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene uraH CDS 226303..227223 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene puuE CDS 227223..227738 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene uraD CDS 227798..228307 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(228489..229544) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(229871..231541) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 231745..233673 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(233603..234055) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(234181..235758) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(235767..236882) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(236893..238071) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(238068..238406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 238614..239300 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 239371..240189 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(240251..241687) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(241821..242531) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene btsR CDS complement(242528..244204) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(244311..245207) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 245514..248081 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 248123..249208 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 tRNA complement(249292..249368) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(249515..251359) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene rpoD CDS complement(251582..253360) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene dnaG CDS complement(253435..253878) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(253894..254109) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene rpsU CDS 254284..255306 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene tsaD CDS complement(255359..255967) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene plsY CDS 256071..256439 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene folB CDS 256503..257303 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479178.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(257294..258523) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(258754..261921) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene putA CDS 262062..263036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039214230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(263290..263901) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(264003..265268) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(265290..265952) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 266139..267650 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(267696..268028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(268025..268648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(268659..269072) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 269229..272102 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene glnE CDS complement(272176..273099) product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene lpxL CDS 273230..274654 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene hldE CDS complement(274715..275749) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038448.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(275746..277146) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(277143..277823) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 277980..278966 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365605.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 278978..279412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 279417..280931 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 280928..281950 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(281957..282430) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(282500..283801) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene tolC CDS 284027..284644 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene nudF CDS 284674..285114 product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 285123..285953 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene cpdA CDS 285956..286525 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707474.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 286707..288602 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene parE CDS 288616..290862 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene parC CDS complement(290919..291332) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene mutT CDS complement(291322..291513) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene yacG CDS complement(291510..292244) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene zapD CDS complement(292295..293440) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene hemW CDS complement(293440..294039) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(294251..294664) product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(294703..295017) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene yggU CDS complement(295002..295553) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(295563..296387) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene proC CDS complement(296398..297090) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 297132..298166 product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene tapT CDS 298187..299296 product type IVa pilus ATPase TapU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene tapU CDS 299304..300083 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene yaaA CDS complement(300242..300424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(300442..301740) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene srmB CDS 301811..302518 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 302815..303987 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene brnQ CDS complement(304051..304566) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene fldB CDS 304641..305528 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene xerD CDS 305607..307340 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene recJ CDS complement(307404..309284) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(309418..310170) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(310193..311293) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(311295..312479) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(312564..313577) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 313839..314933 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene prfB CDS 314961..316448 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene lysS CDS complement(316797..318209) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(318235..319725) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 319928..320644 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene trmB CDS complement(320719..321345) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene coaE CDS complement(321342..322196) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(322526..323752) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(323778..325490) product PilB family type IVa pilus assembly ATPase TapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene tapB CDS complement(325497..325940) product type IVa pilus major pilin TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene tapA CDS complement(326234..327088) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene nadC CDS complement(327138..327656) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 327729..328271 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ampD CDS 328745..329506 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene pdhR CDS 329568..332228 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene aceE CDS 332239..334146 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene aceF CDS 334299..335726 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene lpdA CDS 335937..336254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 note possible pseudo, frameshifted CDS 336740..337114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 337295..339199 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 339397..341637 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 341852..344449 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene acnB CDS 344680..346884 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 346990..347670 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(347776..349179) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 349457..350485 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 350510..350869 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene yacL CDS complement(350956..351372) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene arfB CDS 351549..351887 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene glnK CDS 351901..353127 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 353326..354339 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 354374..355996 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 355996..357060 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 357238..358152 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(358249..358749) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene argR CDS 358883..359620 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 359634..360374 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 360379..361023 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene artQ CDS 361016..361693 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene artM CDS 361820..362758 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene mdh CDS complement(363189..364091) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(364084..366051) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135484575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(366041..366835) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(366869..368473) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(368483..369646) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 369757..370944 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 370953..372446 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 372537..373688 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 374029..374811 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 374820..375932 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 375943..376842 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene mmsB CDS 376843..377604 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705951.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(377816..379459) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 379580..380332 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 380329..381267 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(381489..382157) product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 382436..384073 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene pyrG CDS 384161..385456 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene eno CDS 385606..385896 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene ftsB CDS 385893..386585 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene ispD CDS 386582..387058 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene ispF CDS 387055..388098 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene truD CDS 388079..388825 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene surE CDS 388815..389459 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 389456..390037 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 390037..391005 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 391048..392025 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene rpoS CDS complement(392107..394677) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707433.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene mutS CDS complement(394849..395223) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(395321..396883) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(396940..397950) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(397964..399406) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 399502..400392 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 400741..402462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 402462..403211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 403279..404013 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 404080..404574 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 404649..405719 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene recA CDS 405766..406230 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene recX CDS 406339..408960 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene alaS CDS 409165..409356 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene csrA tRNA 409497..409589 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 409600..409676 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 409703..409779 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 409802..409878 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 410206..410457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 410507..412294 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene oadA CDS 412305..413435 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(413859..414707) product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 414877..416271 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene dnaB CDS 416281..417369 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene alr CDS complement(417545..417751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(417790..418239) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene zur CDS 418372..419361 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene dusA CDS 419392..419628 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 419778..420503 product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 420548..421465 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene oxyR CDS complement(421510..423894) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 424060..425118 product PilM family type IVa pilus assembly protein TapM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene tapM CDS 425106..425660 product PilN family type IV pilus biogenesis protein TapN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene tapN CDS 425657..426241 product PilO family type IV pilus biogenesis protein TapO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene tapO CDS 426238..426759 product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 426799..428781 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 428974..429456 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene aroK CDS 429472..430539 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene aroB CDS 430552..431898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 431961..432788 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(432854..433228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(433714..434031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 note possible pseudo, frameshifted CDS complement(434090..434275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 434496..435170 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene rpe CDS 435163..435831 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 435855..436862 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene trpS CDS 436980..437192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706959.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(437222..439174) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(439171..440163) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(440184..441323) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 441450..441896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 441958..442350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 442490..443653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 443858..444322 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene bfr CDS 444335..444802 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene bfr CDS complement(444846..446291) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(446399..447895) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene putP CDS complement(448057..448818) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(448918..449787) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 449923..451047 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 451093..452013 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene fghA CDS complement(452050..452847) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene cysQ CDS 453000..453938 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 453935..454861 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 454858..455952 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(456050..457327) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene yjeH CDS 457467..457892 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 457902..459908 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene helD CDS 460022..460717 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(460745..462211) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(462263..462619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 462790..463866 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106569.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene hppD CDS 464005..465375 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(465460..467082) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 467341..468081 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(468145..469506) product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene atoC CDS complement(469503..471371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 471665..473071 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 473073..474068 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene cydB CDS 474305..476944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 476941..478677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(478728..480212) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(480275..481690) product glutamate-putrescine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene puuA CDS 481881..482645 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene puuD CDS 482642..483202 product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene puuR CDS 483221..484705 product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene puuC CDS 484721..485995 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(486076..486417) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(486427..487221) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene phhA CDS complement(487316..488512) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pncB CDS complement(488505..489152) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 489298..489639 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 489755..490354 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene wrbA CDS complement(490356..491009) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(491009..492025) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(492025..492807) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(492800..493735) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(493732..494535) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(494538..495584) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(495568..495810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 495783..496505 product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 496605..497294 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 497335..499260 product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(499268..499618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(499618..500106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(500232..501548) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(501545..503383) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 503282..503665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(503746..505122) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 505621..511119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 511212..514388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 514395..515396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 515458..516603 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene zapE CDS complement(516771..517205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 517647..517970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 note possible pseudo, frameshifted CDS 517967..519229 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 519350..519931 product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 520397..521611 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 521676..522704 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706956.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene astA CDS 522697..524166 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene astD CDS 524190..524993 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(525042..526247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 526363..527250 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 527330..528193 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 528413..528685 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene hupA CDS 528806..529225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707401.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 529227..529598 product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(529677..530963) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene purD CDS complement(530983..532566) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene purH CDS 532763..533191 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene zntR CDS 533293..534576 product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090635852.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(534730..535152) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene uspF CDS complement(535159..536475) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(536472..537005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(537058..538065) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(538361..539290) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 539458..540921 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 540945..542225 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene gabT CDS 542570..542761 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 542775..545231 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 545387..546562 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene purT CDS 547126..549633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 549647..550780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(550787..551890) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene chrA CDS 552379..552900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 552836..556405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 556423..557613 product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 557631..558740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 558881..561457 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 561525..561668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(561717..562553) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(562770..563966) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene hmpA CDS 564139..564729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 564862..566217 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(566263..567045) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(567042..568133) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(568210..569115) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 569212..570027 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(570096..571718) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 572051..573064 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 573075..575078 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 575131..575523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 575608..576375 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(576401..577870) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(578008..578319) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(578316..579023) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(579151..580818) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene ettA CDS complement(581270..582325) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(582507..582701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(582826..583248) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(583245..583865) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(583869..584540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 584823..585311 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene hutZ CDS 585442..585876 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 585934..587085 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(587122..588525) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(588629..589345) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene ugpQ CDS complement(589347..589679) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 589803..591167 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(591183..592082) product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 592167..593312 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 593309..596779 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(596925..597614) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 597697..599034 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 599046..599762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(599793..601097) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(601078..602835) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(602844..603215) product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(603212..605227) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(605328..606332) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 606526..607152 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 607220..607948 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(608193..609950) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(610071..611177) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene asd CDS complement(611298..612209) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 612610..613377 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 613408..614184 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 614370..615110 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 615114..615806 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(615916..616725) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene xthA CDS complement(616773..617543) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 617711..618727 product multidrug efflux RND transporter periplasmic adaptor subunit VmeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene vmeE CDS 618714..621800 product multidrug efflux RND transporter permease subunit VmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene vmeF CDS complement(621804..622274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 tRNA complement(622392..622476) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(622531..622615) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 622746..623225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(623297..624382) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(624450..624827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(624882..626357) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(626381..626962) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene smrA CDS complement(627077..627229) product DUF3149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064773827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(627300..628151) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(628198..629028) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 tRNA complement(629091..629165) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(629242..630375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 630552..631280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 631270..631671 product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene flgP CDS complement(631687..632100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(632100..632420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(632489..633208) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161785096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene flgA CDS 633377..634288 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 634309..635130 product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 635194..635595 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene flgB CDS 635592..636011 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene flgC CDS 636015..636698 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 636711..638792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 638935..639681 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene flgF CDS 639693..640481 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene flgG CDS 640494..641168 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene flgH CDS 641179..642270 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 642302..643282 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene flgJ CDS 643292..645232 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene flgK CDS 645242..646516 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene flgL CDS complement(646573..648873) product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 649023..649619 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(649740..651098) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(651315..652655) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(652756..654771) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(654743..655021) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(655027..655536) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene crr CDS complement(655661..656629) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene cysK CDS 656925..658382 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 658541..659086 product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(659053..659814) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene cysZ CDS 660081..661067 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167492733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene zipA CDS 661133..663169 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene ligA CDS 663580..665856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 666028..666405 product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 666452..667834 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene fliD CDS 667831..668130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 668134..668529 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene fliS CDS 668853..670301 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 670341..671372 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 671372..672700 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 672781..673095 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene fliE CDS 673107..674813 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene fliF CDS 674806..675852 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene fliG CDS 675849..676652 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene fliH CDS 676639..677970 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene fliI CDS 677970..678407 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene fliJ CDS 678559..679782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 679813..680292 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene fliL CDS 680300..681355 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene fliM CDS 681355..681750 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene fliN CDS 681978..682238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 682361..683107 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene fliP CDS 683107..683376 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene fliQ CDS 683379..684167 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene fliR CDS 684169..685302 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene flhB CDS 685444..687495 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene flhA CDS 687509..688867 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene flhF CDS 688860..689741 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 689728..690450 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 690583..690966 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene cheY CDS 690976..691728 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 691738..693783 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 693812..694948 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 694950..695693 product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 695690..696532 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 696529..697314 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 697311..698096 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 698116..698604 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 698604..699011 product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 699224..699856 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene ccmA CDS 699853..700521 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene ccmB CDS 700629..701375 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 701365..701571 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene ccmD CDS 701568..702062 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ccmE CDS 702059..704014 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 704011..704544 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 704551..705027 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 705029..706243 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene ccmI CDS 706347..707141 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(707275..707565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 707800..708870 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 708957..710087 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene tyrA CDS complement(710186..712063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(712363..712686) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene raiA CDS 712995..714878 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 714868..715680 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 715761..716159 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene yciA CDS 716137..716964 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(717026..718408) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(718472..719239) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene gloB CDS 719292..720008 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(719996..720460) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rnhA CDS 720596..721330 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene dnaQ CDS 721312..722436 product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 tRNA 722566..722642 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(722931..723395) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 723814..727431 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene putA CDS 727792..729429 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 729492..731363 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 731371..732102 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(732127..732741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 732921..733832 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 733829..734440 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 734427..734807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 734804..735895 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rlmM CDS complement(736001..737008) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(737100..737867) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene xni CDS complement(737873..739228) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene ppnN CDS complement(739260..740753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(740793..743033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(743118..743969) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene queF CDS 744083..744619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(744609..745382) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(745382..745663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(745678..745905) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(745948..746250) product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261354.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(746243..747277) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 747364..747699 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 747696..748445 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene truC CDS 748478..749392 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114599.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene glsB CDS 749404..749844 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(749938..750774) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 751015..752904 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 752914..753186 product DUF3081 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(753308..754687) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene dbpA CDS complement(754921..755952) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene dapD CDS complement(756005..758635) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene glnD CDS 758752..759342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(759417..759632) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171079.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene cspD CDS 759997..760314 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300028.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene clpS CDS 760362..762614 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene clpA CDS complement(762764..762982) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene infA CDS complement(763053..763763) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(763760..764458) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene aat CDS complement(764468..764638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 764746..766494 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene dauA CDS complement(766553..767512) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene trxB CDS 768125..768628 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene lrp CDS 768806..771367 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 771371..771979 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene lolA CDS 771989..773320 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196299305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 773431..774729 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene serS CDS 774949..775473 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 775494..777014 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene purF CDS complement(777068..777661) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 778004..780625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(780622..782208) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(782320..783246) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 783414..783878 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 783970..784917 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 784968..785780 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 786348..786812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 note possible pseudo, internal stop codon CDS 786813..787007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 note possible pseudo, internal stop codon CDS complement(787089..787766) product copper response regulator transcription factor CusR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene cusR CDS 787950..789818 product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 789905..790657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 790695..791183 product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 791261..791674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 791851..794157 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 794170..794523 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 794991..795431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 795482..795832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(795892..797292) product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene pcoS CDS complement(797661..797933) product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene rcnR CDS 798070..799146 product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(799279..799878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(799880..801157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(801177..802274) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 802390..802749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(802644..803846) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 804183..804377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 804694..806424 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 806436..808826 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 808823..810229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 810216..813314 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(813922..814266) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(814281..814778) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050665004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene radC CDS complement(814957..815859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(815856..816839) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(816917..817870) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(817999..818202) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 819501..820505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(820665..821858) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 tmRNA complement(822035..822395) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(822446..822931) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene smpB CDS 823069..823518 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 823499..823840 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(823884..824222) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 824385..825143 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene udp CDS complement(825198..826865) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene recN CDS complement(826974..827678) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene tsaA CDS complement(827675..828043) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene rcsF CDS complement(828525..828806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 828831..829730 product ISAs1-like element ISEc1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 830955..831431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 831529..832635 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 note possible pseudo, frameshifted CDS 832632..833513 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 833524..834621 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 834638..835789 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 835907..836791 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 836775..837326 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 837354..839297 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 839615..840964 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 841166..842191 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene galE CDS 842333..843943 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene pgi CDS 844197..845330 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 845529..847676 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 847669..849051 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 849074..850378 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 850398..850997 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 850994..851677 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 851775..853682 product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 853997..857554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 857572..858057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 858162..858866 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(858942..860171) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene serA CDS 860383..861258 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene tesB CDS 861331..862005 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene ung CDS complement(862048..862236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(862435..863388) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene tal CDS 863611..865032 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(865262..865813) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(865897..867780) product methyl-accepting chemotaxis protein Mlp37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene mlp37 CDS 868153..868488 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 868575..869198 product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(869251..869784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(869744..870520) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(870520..871941) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene nirK CDS complement(872131..873018) product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene bauR CDS complement(873069..873254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(873380..873931) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(874020..874769) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(874766..876052) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(876049..876498) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(876578..877609) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene dctP CDS complement(877724..878638) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092728.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(878655..879506) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(879579..880583) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(880583..881494) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene rbsK CDS complement(881626..882507) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene rbsB CDS complement(882533..883498) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene rbsC CDS complement(883495..884997) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene rbsA CDS complement(885006..885425) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene rbsD CDS 885741..886511 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene miaE CDS complement(886659..887459) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(887456..888457) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(888457..889350) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705750.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(889334..890296) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(890299..891897) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene sapA CDS complement(891900..892898) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene pspF CDS 893084..893752 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene pspA CDS 893749..893982 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene pspB CDS 893967..894362 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024941345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene pspC CDS 894359..895762 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 895759..896784 product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 tRNA complement(896777..896852) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(897433..898056) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172412315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(898868..900364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(900565..901563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(901583..902008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(902350..903570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 tRNA complement(903720..903796) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 903946..904803 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene folD CDS 904823..905647 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(905751..906149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(906385..906660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(906771..908150) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene cysS CDS 908299..908979 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 908970..910220 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 910315..911946 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 912026..913999 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 914049..914552 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 914640..915380 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene lpxH CDS 915377..915751 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 916046..917257 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 917430..919031 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 919032..919796 product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 919870..921267 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene asnS CDS 921408..923129 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943636.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 923470..924681 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 924986..926449 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene putP CDS 926685..928265 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(928363..929601) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(929811..931232) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 931351..932319 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(932337..933194) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(933299..934669) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 934873..935988 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 935985..937058 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 937055..937825 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 937903..939330 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 939549..940619 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 940679..941275 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 941278..942648 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 942675..943454 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 943464..945434 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(945451..945714) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(945923..947605) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214391123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene betA CDS complement(947627..949090) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene betB CDS complement(949081..949686) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097647.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene betI CDS 949928..951124 product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene fdhA CDS 951268..951759 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 951759..953300 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 953300..956155 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene fdhF CDS complement(956344..957156) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 957346..958743 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene aspA CDS complement(958821..959531) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 959804..960721 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 960739..962394 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 962391..963812 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 964127..965404 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 965649..966803 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(967427..968533) product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene gbcB CDS 968812..970092 product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene gbcA CDS complement(969988..970194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(970292..970519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 970879..972420 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 972875..973927 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 974245..975225 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 975257..975787 product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 975862..977925 product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene dgcA CDS 977968..979905 product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene dgcB CDS 979898..981115 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 981105..981884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 982018..982626 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 982738..983091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(983084..983434) product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(983552..984385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(985026..986402) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 986677..987591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 note possible pseudo, frameshifted CDS 987570..987743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 987886..988554 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 988583..989773 product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 989913..991259 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 991424..992359 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(992566..994272) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 994610..995797 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 995801..997228 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 997420..998793 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 998804..1000120 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1000117..1000470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(1000780..1001679) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1001807..1003273 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1003398..1004294 product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1004328..1005233) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene gcvA CDS 1005379..1006596 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1006604..1007470) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 1007588..1008304 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 1008294..1008602 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 1008792..1009343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1009455..1010432) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1010429..1011418) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1011626..1012510 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 1012701..1013741 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1013796..1014332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1014352..1015650 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1015726..1016463 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1016463..1016792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1016966..1017952 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1018338..1019243 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1019247..1020740 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1020808..1022154 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1022206..1023072) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1023228..1024703) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene nhaC CDS complement(1024828..1027092) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019372340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(1027093..1027848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(1027839..1028552) product two-component system response regulator AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene aruR CDS complement(1028620..1029687) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1030004..1031257 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1031306..1032559 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1032572..1032859 product sarcosine oxidase subunit delta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1032856..1035885 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1035878..1036507 product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene soxG CDS 1036617..1037483 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene purU CDS 1037536..1037880 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1037989..1038774) product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941416.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1038937..1040487) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene tyrR CDS 1040703..1041260 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1041262..1042671 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 1042825..1044204 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene ccoG CDS complement(1044211..1047726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1047914..1048318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1048322..1048936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1048947..1049423 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1049437..1050492) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1050653..1052161) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1052161..1053465) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1053438..1053689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1053646..1054071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1054211..1054384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1054381..1054623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1054637..1055551) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1055757..1056833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1056867..1057112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1057109..1057651) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1057648..1058208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1058205..1058753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1058750..1059067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1059061..1059708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1059698..1060252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(1060249..1060629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1060626..1060964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1060961..1061257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1061254..1061772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1061769..1062695) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rdgC CDS complement(1062715..1063926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1063908..1064579) product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(1064576..1064833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1064879..1065937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1065950..1067359) product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1067375..1067578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(1067808..1067984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1068463..1068657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1068947..1069612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1069736..1069978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1069993..1070337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1070341..1070469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1070591..1071595 product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1071597..1072103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1072100..1072240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1072237..1072956 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004024.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1073047..1073292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1073270..1073860 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1073860..1074174 product Ref family recombination enhancement nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1074167..1074526 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1074585..1075232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1075225..1076244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1076244..1077761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1077819..1078025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1078156..1079034 product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1079128..1079292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1079307..1079699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1079710..1079874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1079886..1080074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1080317..1080676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1080687..1081034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1081135..1081983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1081976..1082701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1082698..1083183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1083180..1083518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1083518..1084561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1084561..1085076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1085230..1086903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1086916..1087386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1087407..1089053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1089064..1089744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1089814..1090599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1090596..1091366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1091410..1091580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1091651..1092007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1092007..1092288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1092288..1093070 product N-acetylmuramidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1093067..1093423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1093667..1094167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1094167..1094541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1094545..1095438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1095435..1095902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1095912..1096391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1096391..1096918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1096893..1097183 product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1097266..1100925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1100935..1103256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1103356..1104894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1104894..1105802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1105802..1108873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1108916..1109218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1109218..1110714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1110711..1112687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1112698..1113081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1113083..1114003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1114014..1114349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1114373..1115425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1115638..1115988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1115946..1116152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1116306..1117472 product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1117396..1117698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1117736..1117927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1118221..1118436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1118654..1119106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1119266..1119715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1119907..1120998) product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1121154..1122659 product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1122662..1123132) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene msrB CDS complement(1123135..1123749) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene msrA CDS 1123873..1124652 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1124654..1125679 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene btuC CDS 1125666..1126409 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1126444..1127496) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1127608..1128009) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1128083..1128385 product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene lsrG CDS 1128390..1128878 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1129032..1130720 product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene ttrS CDS 1130720..1131304 product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene ttrR CDS 1131362..1131679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 note possible pseudo, frameshifted CDS 1132165..1132539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1132605..1133021) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene ruvX CDS complement(1133018..1133572) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1133630..1134577) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene gshB CDS complement(1134574..1135305) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rsmE CDS complement(1135283..1135987) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060390007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1136091..1136561) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1136558..1137070) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1137337..1138494) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene metK CDS 1138733..1140730 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene tkt CDS 1141088..1142044 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042143812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1142041..1142598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1142595..1143875 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1143918..1144649 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1144839..1145534 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1145894..1147315 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene hydA CDS 1147393..1148559 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1148635..1149669 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1149811..1150422 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1150419..1151708 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1151687..1153096 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1153113..1153883 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223448.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1153905..1154858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1154855..1156186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1156167..1156841) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1156988..1157458 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1157474..1160431) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1160599..1161018 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1161021..1161443 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1161587..1162054) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene bcp CDS complement(1162051..1162599) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1162811..1163779 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene bamC CDS 1164152..1166494 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1166679..1166906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1166917..1167576) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1167573..1168706) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene dapE CDS complement(1168726..1169076) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1169305..1170387 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1170508..1172205 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705191.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1172371..1173984 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1174171..1175091 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene oppB CDS 1175099..1176007 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene oppC CDS 1176019..1176984 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1176977..1177957 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene oppF CDS 1178178..1179488 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene tig CDS 1179576..1180199 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene clpP CDS 1180282..1181562 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene clpX CDS 1181699..1184050 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene lon CDS 1184209..1184487 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene hupB CDS 1184601..1186499 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene ppiD CDS 1186831..1187394 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene uvrY CDS 1187432..1189261 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene uvrC CDS 1189310..1189858 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene pgsA tRNA 1189974..1190047 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 1190071..1190157 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(1190231..1190809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1191040..1191690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1191703..1193406) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1193620..1195137 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1195234..1196385 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene yiaY CDS complement(1196486..1198243) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1198313..1199173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1199450..1200355 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene rarD CDS complement(1200431..1201315) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1201441..1202052 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1202106..1203488) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1203663..1204913) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1205067..1205612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1205710..1206573 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene purU CDS 1206613..1208559 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1208939..1209478 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1209475..1211379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1211638..1212750 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene prpC CDS 1212818..1214269 product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1214511..1215866 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1215978..1216655) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene torD CDS complement(1216652..1219123) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene torA CDS complement(1219137..1220324) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene torC CDS complement(1220365..1220532) product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene torE CDS 1220896..1221753 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1221779..1222081 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1222091..1222411 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1222408..1224114 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene ureC CDS 1224127..1224579 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ureE CDS 1224569..1225231 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1225251..1225883 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene ureG CDS 1225880..1226431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1226641..1227933 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1228021..1229421) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene asnS CDS 1229534..1229878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1229927..1231255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1231623..1231829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1231919..1232392 product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1232446..1233681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1233726..1234520 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene cpaB CDS 1234563..1235972 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1235992..1236261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1236273..1237727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1237724..1238206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1238206..1238682 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1238697..1239905 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1239926..1241233 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1241246..1242214 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1242216..1243157 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1243287..1244219 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1244229..1244870 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781198.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene maiA CDS complement(1244942..1245349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1245490..1245684 product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1245736..1246389 product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1246626..1247990 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1248045..1248581 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1248642..1249277) product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1249388..1251442) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene dinG CDS 1251698..1252690 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1253858..1255555 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene ltrA CDS complement(1255778..1256149) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706064.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1256297..1257238) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene dusC CDS 1257362..1257754 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1257819..1258364 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene apt CDS 1258369..1260702 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene dnaX CDS 1260716..1261045 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1261156..1261761 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene recR CDS complement(1261768..1262007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1262099..1262788) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1262785..1263123) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705771.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1263133..1264548) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene sbcB CDS complement(1264660..1264995) product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1265128..1265991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1266519..1267025 product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene ectA CDS 1267084..1268355 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene ectB CDS 1268438..1268845 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1269223..1270659 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1270790..1271071 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene ppiC CDS 1271102..1272724 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1272756..1273484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1273577..1274716 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1274886..1275359 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1276058..1279936 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139499.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene hrpA CDS 1280170..1280457 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rplY CDS 1280668..1280892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1280883..1282241) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene yegD CDS complement(1282238..1282414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1282413..1283627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1283707..1284099 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1284172..1284678 product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1284884..1285234 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1285320..1286297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1286312..1287133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1287182..1288969) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1289191..1292604 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene recC CDS 1292601..1296215 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene recB CDS 1296212..1298212 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene recD CDS complement(1298283..1300115) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1300143..1302665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1302948..1303400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1303864..1304124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1304126..1304398) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene yfaE CDS complement(1304395..1305528) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene nrdB CDS complement(1305646..1307922) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene nrdA CDS complement(1308257..1308931) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1308939..1309637) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene ubiG CDS 1309788..1312400 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene gyrA CDS 1312541..1313614 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705848.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene serC CDS 1314181..1315281 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene hisC CDS 1315385..1316671 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene aroA CDS complement(1316735..1317130) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1317247..1317756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1317753..1319573) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 tRNA complement(1319804..1319879) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(1319894..1319969) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(1319984..1320059) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(1320075..1320150) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 1320996..1321742 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1321780..1322991 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1323051..1323386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1323504..1325282 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1325417..1327078 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene glnS CDS complement(1327165..1327614) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene fur CDS 1328038..1328280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1328388..1329296) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1329395..1329922) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705429.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene fldA CDS complement(1329967..1330251) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene ybfE CDS complement(1330255..1330476) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1330533..1331297) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1331419..1331931 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene seqA CDS 1331955..1333598 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene pgm CDS 1333733..1334758 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene astE CDS 1334943..1335806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1335902..1336687) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1336954..1337517) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1337651..1337851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 tRNA 1337905..1337995 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(1338071..1340650) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1340772..1341755) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1341928..1343064) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1343127..1344026) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1344102..1344902) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1345046..1346068 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706895.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene sohB CDS complement(1346156..1347490) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706894.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene astB CDS 1347826..1350453 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene topA CDS 1350555..1350719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1350735..1351073) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706891.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1351075..1352631) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1352728..1354446) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042987999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene ggt CDS 1354448..1354612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 tRNA 1354627..1354702 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 1354713..1354786 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1354755..1355597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1355651..1356409 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1356638..1358017 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1358010..1358384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1358872..1359849 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene moaA CDS 1360048..1360548 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene napF CDS 1360545..1360814 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705480.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1360811..1363300 product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene napA CDS 1363328..1363774 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1363784..1364377 product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1364510..1365019 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene moaB CDS 1365023..1365499 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene moaC CDS 1365496..1365741 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001575835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene moaD CDS 1365743..1366183 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene moaE CDS complement(1366285..1367526) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene moeA CDS 1367680..1368336 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene folE CDS 1368390..1368668 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1368674..1370389) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1370483..1371418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1371626..1373530 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene speA CDS complement(1373593..1373760) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene rsmS CDS 1374013..1374642 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1374667..1376934 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1376965..1377636 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1377706..1379145) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene pyk CDS complement(1379685..1380536) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1380891..1382204) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene rimO CDS complement(1382338..1382922) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene sodB CDS 1383198..1383536 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1383671..1384741) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene aguA CDS complement(1384741..1385631) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene aguB CDS 1385763..1386665 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1386772..1388094) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1388327..1388932 product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1388977..1389225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1389389..1389634) product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1389806..1391284 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene modF CDS 1391343..1392017 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1392049..1392723) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene rnt tRNA 1392924..1393011 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 1393639..1396932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1397045..1398703 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1398858..1399832) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1399852..1400544) product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1400599..1401324 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene nfsA CDS complement(1401281..1401757) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1401897..1402097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1402169..1402303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1402704..1403216 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene sixA CDS 1403277..1403489 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350921.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1403547..1404068) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene smrB CDS 1404118..1405038 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706198.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene prmB CDS 1405063..1406148 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene aroC CDS 1406273..1406797 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1406807..1407940 product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1407937..1408221 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705767.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1408330..1410252) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene cysN CDS complement(1410252..1411151) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene cysD CDS 1411272..1412999 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1413398..1413718 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1413729..1414100) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1414240..1414908 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1414908..1417379 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1417376..1418521 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974691.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1418553..1419827) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1420056..1421024 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1421037..1421714) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1421899..1423752 product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1423749..1424591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1424631..1425122 product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1425152..1425616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1425570..1427039) product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene pcoS CDS complement(1427056..1427736) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1427891..1428082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1428139..1430292) product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1430395..1431519 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1431519..1434623 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1434620..1435501 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1435566..1435889 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1435902..1436432 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1436544..1437617 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene nmoA CDS complement(1437605..1438084) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1438081..1439328) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1439309..1440007) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707299.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1440009..1440572) product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1440595..1441506) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1441598..1442809 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1442794..1443324) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517116.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1443318..1444082) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1444285..1445259 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene cysB CDS complement(1445373..1445780) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene gloA CDS complement(1445812..1446456) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene nth CDS complement(1446453..1447148) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1447145..1447777) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene rsxG CDS complement(1447777..1448826) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene rsxD CDS complement(1448826..1451084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1451085..1451639) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene rsxB CDS complement(1451641..1452222) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene rsxA CDS complement(1452303..1453028) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1453378..1454340) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene pfkA CDS complement(1454523..1455275) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene tpiA CDS complement(1455361..1456116) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene elyC CDS 1456204..1456974 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene cmoM CDS 1457201..1458526 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene mukF CDS 1458507..1459193 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene mukE CDS 1459190..1463605 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene mukB CDS 1464367..1466100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1466194..1466727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1466748..1467461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1467538..1468428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1468454..1469407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1469464..1469862 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1469998..1470270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1470335..1471648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1472002..1472340 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1472376..1472852 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069669028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1472926..1473216 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1473413..1475347 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216960.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1475394..1476065) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1476245..1476541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1476685..1477038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1477031..1477207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1477255..1477812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1478145..1479302 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1479303..1479812 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1479855..1480400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1480572..1481174) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1481171..1482808) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene pqiB CDS complement(1482801..1484150) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1484343..1485965 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269183.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1486052..1487242) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1487357..1488547) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1488605..1489504) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706671.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 1489856..1490131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1490166..1491953) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1492027..1492488 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1492580..1493125 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706143.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene proQ CDS 1493136..1495142 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene prc CDS 1495217..1497823 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706141.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene pepN CDS 1497823..1498047 product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1498335..1503170 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1503231..1504238 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene pyrD CDS 1504326..1504862 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 tRNA complement(1504930..1505006) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(1505044..1505120) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(1505163..1505239) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1505274..1505350) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1505568..1507670 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rlmKL CDS 1507667..1507900 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1507897..1509804 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 1510134..1510310 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene rmf CDS complement(1510383..1510913) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene fabA CDS complement(1511006..1512961) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1513040..1513783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1514086..1514388) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1514685..1515974) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1516119..1516589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1516896..1518320 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene ccoN CDS 1518333..1518941 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene ccoO CDS 1518953..1519168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1519165..1520136 product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene ccoP CDS 1520228..1520713 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1520716..1523085 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1523082..1523282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1523266..1523949 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1524013..1524756 product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1524779..1525690 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300766.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene uspE CDS 1525760..1526677 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene ttcA CDS complement(1526791..1527390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1527387..1528148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029303065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1528379..1529482 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene potA CDS 1529469..1530326 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene potB CDS 1530323..1531090 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012968557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene potC CDS 1531092..1532141 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1532190..1532924) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706162.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene cobB CDS complement(1533033..1533335) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene ihfA CDS complement(1533340..1535727) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene pheT CDS complement(1535743..1536726) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene pheS CDS complement(1536880..1537236) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rplT CDS complement(1537251..1537448) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rpmI CDS complement(1537523..1537963) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene infC CDS complement(1538062..1539996) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene thrS CDS complement(1540183..1540632) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1540719..1541582 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1541591..1542337 product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1542364..1542567 product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1542641..1543249) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1543410..1544798 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1544743..1545774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 tRNA 1545867..1545943 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 1545957..1546033 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 1546051..1546127 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 1546396..1547718 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039185890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1547786..1548376) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1549039..1550967 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1550989..1552257 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1552266..1553789 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1553824..1554540) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene fadR CDS 1554662..1555165 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene dsbB CDS complement(1555258..1555692) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1555693..1556355) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284280.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1556367..1556654) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1556760..1557437 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene minC CDS 1557465..1558277 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene minD CDS 1558281..1558574 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007648439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene minE CDS complement(1558649..1559743) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene rnd CDS complement(1559798..1559944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1559954..1560634) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene tsaB CDS complement(1560641..1562560) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1562637..1563368) product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1563423..1566131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1566128..1567075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1567666..1568568 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706053.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene hisG CDS 1568572..1569864 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene hisD CDS 1569861..1570919 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene hisC CDS 1570920..1571990 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene hisB CDS 1571987..1572577 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene hisH CDS 1572577..1573314 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene hisA CDS 1573296..1574069 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene hisF CDS 1574062..1574670 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene hisIE CDS complement(1575026..1575358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1575516..1575935) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1575936..1576844) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1577746..1579863) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1579854..1580711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1580801..1581397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1581501..1582802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1582900..1583130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1583129..1584106 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1584277..1584924) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1584932..1585213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1585341..1586870) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1587095..1588969) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1589048..1590232) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene prpF CDS complement(1590345..1592930) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene acnD CDS complement(1593031..1594191) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene prpC CDS complement(1594284..1595162) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881094.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene prpB CDS complement(1595159..1595911) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842742.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1596226..1597179) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1597232..1597654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1597999..1598784) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1598822..1599781) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163136678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene holB CDS complement(1599766..1600389) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene tmk CDS complement(1600393..1601397) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene mltG CDS complement(1601381..1602166) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene pabC CDS complement(1602223..1603428) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene fabF CDS complement(1603537..1603773) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene acpP CDS complement(1603932..1604666) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene fabG CDS complement(1604688..1605626) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene fabD CDS complement(1605638..1606597) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706104.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1606603..1607613) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene plsX CDS complement(1607624..1607794) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene rpmF CDS complement(1607816..1608337) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene yceD CDS 1608473..1609051 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1609110..1609751) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1609748..1610698) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rluC CDS 1611034..1613988 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene rne CDS complement(1614195..1614680) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1614993..1616408) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1616473..1617318) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene proC CDS complement(1617330..1618370) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1618506..1618991 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1619186..1620187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1620328..1621353) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1621384..1622364) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1622689..1623573) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1623732..1624955) product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene arsJ CDS complement(1624956..1625957) product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1626012..1627034) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene arsB CDS complement(1627049..1627201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1627191..1627985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1628235..1629578) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1629711..1629956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1630311..1630667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1630671..1631828) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1631985..1632866 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479133.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1632815..1634092) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1634370..1634747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1634828..1636255) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1636248..1639430) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1639447..1640604) product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene mexE CDS 1641016..1641672 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1641723..1642127) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1642191..1643273) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1643479..1644396) product TIGR03571 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1644448..1645623) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1645715..1646605 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1646762..1647436 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1647457..1648299 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene yghU CDS 1648362..1649288 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1649294..1650226) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1650328..1651035) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444023.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1651045..1651962) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1652083..1653126 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1653215..1654318) product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1654469..1655341 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1655490..1657448) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1657634..1658215) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene dcd CDS complement(1658319..1659392) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene apbC CDS 1659533..1661563 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene metG CDS complement(1661711..1663093) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1663249..1663812) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1663809..1665185) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene pabB CDS 1665311..1666831 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1666946..1667218) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1667298..1668491 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1668573..1669610 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene selD CDS 1669603..1670688 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene mnmH CDS 1670717..1671349 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1671421..1673262 product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1673387..1674265) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1674308..1674916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1674988..1675779 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819795.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene mepA CDS 1675779..1677275 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene glpK CDS 1677272..1678771 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene glpD CDS complement(1678842..1680620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1680748..1682784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1682781..1683155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1683145..1683894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1683891..1684421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1684408..1684947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1684993..1685334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1685635..1686858) product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene mshG CDS complement(1686858..1688555) product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene mshE CDS complement(1688533..1689264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1689264..1690853) product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene mshL CDS complement(1690850..1691176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1691169..1691813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1691810..1692388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1692385..1693242) product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene mshI CDS complement(1693375..1695075) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(1695088..1695354) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1695509..1696453) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1696478..1697731) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972918.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1697983..1700652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 1700734..1702098 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1702155..1702364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1702941..1704416 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1704586..1705026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1705219..1706031 product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1706087..1707055 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705968.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene lpxM CDS 1707055..1707183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1707245..1708036) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1708243..1709112) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1709168..1710193) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1710316..1710990 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene mtgA CDS 1711081..1711833 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1711936..1713510 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1713595..1713996) product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1714205..1715689 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1715706..1716560 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1716557..1717825) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene mtnK CDS 1717991..1718953 product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene arsS CDS 1718953..1719609 product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1719606..1720220 product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1720214..1721014 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1721074..1721265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1721583..1722437 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1722600..1724192) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1724313..1725176) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1725363..1725788 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301206.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 tRNA 1725937..1726024 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 1726194..1726832 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819905.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1727020..1728684 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene asnB CDS complement(1728740..1729141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1729657..1730490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1730444..1731442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1731833..1732291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 1732582..1733001 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1733160..1733588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1733588..1734163 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064380616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1734725..1736302) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene guaA CDS complement(1736396..1737859) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene guaB CDS 1738020..1739363 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene xseA CDS complement(1739365..1740741) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1740731..1740997) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1740951..1742075) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1742164..1743102 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1743063..1743854) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1744100..1745731) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 1745964..1746464 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1746538..1747410) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene sucD CDS complement(1747415..1748581) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene sucC CDS complement(1748651..1749856) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene odhB CDS complement(1749875..1752688) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene sucA CDS complement(1752783..1753499) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1753515..1755290) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene sdhA CDS complement(1755283..1755627) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene sdhD CDS complement(1755621..1756019) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene sdhC CDS 1756422..1757711 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1757853..1758872) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene fbp CDS complement(1758986..1759735) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706580.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene kdsB CDS complement(1759732..1759920) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1759910..1760872) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene lpxK CDS complement(1760872..1762623) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene msbA CDS complement(1762651..1764855) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1764883..1765395 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1765395..1765904 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1765919..1767160) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene lolE CDS complement(1767161..1767829) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene lolD CDS complement(1767834..1769045) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1769138..1769710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1769707..1773144 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene mfd CDS 1773328..1774773 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028024693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 1774952..1776196 product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1776575..1778149) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1778776..1780128 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1780412..1780606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 1780682..1781815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1781809..1782309) product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1782409..1783299 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1783296..1783763 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1783760..1784035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1784186..1784413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1784407..1785024) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene cobO CDS complement(1785014..1786561) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1786734..1788026) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1788176..1789186) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene nagZ CDS complement(1789230..1790042) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1790032..1790637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1790648..1790998) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene hinT tRNA 1791216..1791292 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1791435..1792085 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928746.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1792186..1792578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1792615..1794432) product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1794597..1798295) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1798295..1800010) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1800138..1800680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 note possible pseudo, internal stop codon CDS complement(1800663..1801214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1801406..1804510 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1804627..1805595) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1805692..1806744 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene cobT CDS 1806741..1807505 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1807502..1808050 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1808028..1808429) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1808449..1808799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1808868..1809116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386920.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 repeat_region 1809507..1812775 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctgtgcggcagcgaac CDS complement(1812905..1813468) product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene cas6f CDS complement(1813470..1814507) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene csy3 CDS complement(1814510..1815478) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene csy2 CDS complement(1815471..1816769) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene csy1 CDS complement(1816819..1820124) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene cas3f CDS complement(1820121..1821098) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene cas1f CDS complement(1821199..1822035) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1822397..1823275) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene htpX CDS complement(1823350..1824033) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene bioD CDS complement(1824026..1824781) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene bioC CDS complement(1825006..1826142) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene bioF CDS complement(1826146..1827177) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene bioB CDS 1827289..1828563 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene bioA CDS complement(1828606..1829574) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene hemH CDS complement(1829644..1830288) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene adk CDS 1830584..1831723 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1831720..1833129 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780438.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 1833126..1833473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1833683..1834942 product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1835177..1835512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1835862..1837526 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1837526..1838323 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1838320..1839000 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169038807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1839263..1840345 product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1840471..1842264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1842284..1843708 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1843708..1845795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1845799..1846755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1846757..1848037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1848034..1848747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1848735..1852457 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1852480..1853211 product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1853256..1854287 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene gmd CDS 1854332..1855240 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1855277..1856677 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1856743..1858245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1858326..1859675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1859911..1860603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1860616..1861683 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene rfbB CDS 1861683..1862588 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene rfbD CDS 1862575..1863462 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene rfbA CDS 1863462..1864049 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene rfbC CDS complement(1864001..1865725) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1865867..1866136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1866698..1867597 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene cysD CDS 1867705..1868064 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1868119..1870023 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene cysN CDS 1870138..1870935 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene cysQ CDS 1871003..1873063 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1873137..1873541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 note possible pseudo, internal stop codon, frameshifted CDS complement(1874102..1876018) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene htpG CDS complement(1876273..1878381) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene fadJ CDS complement(1878378..1879691) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene fadI CDS 1879869..1880438 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1880431..1881156 product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706005.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1881316..1882779 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene putP CDS 1882950..1884257 product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene fadL CDS 1884383..1885609 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1885697..1887247) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1887853..1888260 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1888414..1888662) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1888643..1889356) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene pyrF CDS complement(1889458..1890627) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene lapB CDS complement(1890636..1890923) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1891014..1891295) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene ihfB CDS complement(1891362..1893032) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rpsA CDS complement(1893141..1893821) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene cmk CDS 1894024..1894623 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene ribA CDS complement(1894695..1895996) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1896172..1897920) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene fruA CDS complement(1897917..1898867) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene pfkB CDS complement(1898864..1901713) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene ptsP CDS complement(1901879..1902568) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1902631..1903278) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 tRNA complement(1903354..1903444) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 1903640..1904299 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 1904411..1906543 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene yccS CDS 1906570..1906899 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene tusE CDS complement(1906928..1907620) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene dedD CDS complement(1907622..1908878) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene folC CDS complement(1908878..1909741) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene accD CDS complement(1909817..1910608) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene truA CDS complement(1910719..1912755) product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1912927..1914036) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1914150..1914896 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706498.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1915186..1916400) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene fabB CDS 1916507..1918492 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene mnmC CDS complement(1918545..1919042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1919223..1920170 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705843.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene corA CDS complement(1920284..1922056) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene nrdD CDS complement(1922053..1922508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 1922695..1923162 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454218.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1923179..1925179) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene uvrB tRNA 1925330..1925405 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(1925901..1927412) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene nagE CDS 1927493..1928296 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene nagB CDS 1928301..1929443 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene nagA CDS 1929440..1930654 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 1930651..1930968 product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123987.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1931212..1931775 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1931831..1933276) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene nhaD CDS 1933527..1934855 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene argA CDS 1935172..1936509 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene lysC CDS complement(1936604..1937887) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1937904..1939028) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene ald CDS 1939188..1939736 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1939733..1940275) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1940286..1941131) product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene potI CDS complement(1941135..1942028) product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene potH CDS complement(1942038..1943159) product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene potG CDS complement(1943346..1944452) product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene potF CDS complement(1944454..1945827) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1945858..1947186) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1947409..1948764 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1948792..1950066 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1950116..1950376 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1950404..1951348) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 1951459..1952685 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1952731..1954137 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1954147..1955007) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1955000..1955806) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706499.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1955957..1956673) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172402078.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene queE CDS complement(1956670..1957026) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene queD CDS complement(1957026..1957721) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975901.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene queC CDS complement(1957952..1960327) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene ppsA CDS 1960512..1961324 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1961600..1963018 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1963164..1965284) product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene ovoA CDS 1965462..1965788 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1965791..1967497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1967509..1968525) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1968715..1969149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 1969154..1970245 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1970323..1970772 product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1970928..1971299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1971303..1973024) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1973129..1973662) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1973697..1974476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1974658..1975329) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178963.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene osmY CDS 1975580..1976740 product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 1976814..1977752 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1977724..1978728) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1978838..1979602 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083886.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1980086..1980544) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene decR CDS 1980673..1981713 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1981941..1985003) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(1985000..1986094) product multidrug efflux RND transporter periplasmic adaptor subunit VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene vexE CDS complement(1986250..1987317) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene purK CDS complement(1987314..1987808) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene purE CDS 1988234..1989913 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 1989915..1990046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1990096..1991028) product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1991223..1992182 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1992269..1993033) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1993087..1993926) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110402348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1993983..1995191) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 1995357..1995947 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene mobA CDS complement(1995993..1996547) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1996610..1998616) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 1998800..2000635 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene sppA CDS 2000636..2001655 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene ansA CDS complement(2001718..2001921) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(2002182..2005409) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene carB CDS complement(2005426..2006457) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene carA CDS complement(2006969..2007781) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene dapB CDS complement(2007920..2008531) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(2008574..2009503) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705173.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(2009503..2010285) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2010419..2010673) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 2011062..2012015 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene ompA CDS 2012123..2012584 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2012614..2013450 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene purU CDS complement(2013527..2013823) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2013892..2014485 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene yfbR CDS complement(2014547..2015071) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2015073..2015555) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(2015552..2016040) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2016010..2017263) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705033.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2017274..2017993) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2017990..2019237) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2019234..2019962) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2019959..2020381) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2020378..2021787) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene phrB CDS complement(2021765..2022604) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705027.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(2022594..2023547) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(2023777..2024055) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707127.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(2024155..2025591) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102988105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2025754..2025963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 2025847..2026542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 2026725..2027720 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene gap CDS complement(2027937..2029019) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene nadA tRNA complement(2029137..2029212) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(2029244..2029319) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(2029326..2029401) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(2029427..2029502) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(2029535..2029610) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(2029618..2029693) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(2029719..2029794) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(2029827..2029902) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(2029910..2029985) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(2030011..2030086) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(2030119..2030194) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(2030202..2030277) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(2030418..2031179) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene ybgF CDS complement(2031196..2031723) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene pal CDS complement(2031750..2033051) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene tolB CDS complement(2033051..2034292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2034296..2034721) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene tolR CDS complement(2034721..2035401) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene tolQ CDS complement(2035391..2035801) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707367.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ybgC CDS complement(2035968..2036972) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene ruvB CDS complement(2036976..2037578) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene ruvA CDS complement(2037725..2038246) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene ruvC CDS complement(2038376..2039116) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(2039131..2039559) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653696.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene nudB CDS complement(2039563..2041326) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene aspS CDS 2041538..2042380 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 2042504..2043232 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene cmoA CDS 2043229..2044236 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene cmoB CDS 2044233..2044997 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2045003..2046517 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2046510..2047481 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(2047612..2048547) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene rluB CDS complement(2048557..2049177) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(2049196..2050020) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 2050404..2051951 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2051948..2052544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 note possible pseudo, frameshifted CDS 2052541..2053548 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene trpD CDS 2053542..2054927 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene trpCF CDS 2054924..2056117 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706727.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene trpB CDS 2056114..2056920 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene trpA CDS 2057267..2058283 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2058379..2059212) product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2059411..2059902) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081117.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 2060066..2060821 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727184.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene fabG CDS complement(2060861..2061943) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2062097..2062873) product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene hdhA CDS complement(2062885..2064192) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2064487..2065461) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2065811..2067301) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2067381..2068733) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2069013..2069300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2069395..2070300 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene galU CDS complement(2070294..2071247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 2071402..2072085 product DnaT-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707252.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2072069..2072917 product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2072914..2073153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2073163..2073555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2073560..2073874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2074085..2074657 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2074744..2075157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2075521..2078403) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene gcvP CDS complement(2078575..2078964) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene gcvH CDS complement(2078984..2080087) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705608.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene gcvT CDS complement(2080419..2081633) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2081638..2082828) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene ubiH CDS complement(2082853..2083422) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2083565..2083864 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350376.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene zapA CDS 2084083..2084316 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2084382..2084960 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2085028..2085687 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene rpiA CDS complement(2085699..2086748) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene modC CDS complement(2086745..2087425) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene modB CDS complement(2087426..2088175) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene modA CDS 2088300..2089076 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene modE CDS complement(2089140..2091845) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene acnA CDS 2092103..2093005 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene rimK CDS 2093005..2094024 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2094725..2095999) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene thrC CDS complement(2095996..2096952) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706815.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene thrB CDS complement(2096953..2099409) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene thrA CDS complement(2099629..2100327) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2100327..2101469) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705314.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2101570..2102064) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2102092..2102727) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096909.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene pdxH CDS complement(2102899..2105049) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene pnp CDS complement(2105261..2105530) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rpsO CDS complement(2105643..2106578) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene truB CDS complement(2106580..2106984) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene rbfA CDS complement(2107058..2109766) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene infB CDS complement(2109786..2111288) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene nusA CDS complement(2111303..2111761) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147148.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene rimP tRNA complement(2111941..2112017) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(2112076..2112162) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(2112170..2112505) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633113.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene secG CDS complement(2112728..2114056) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene glmM CDS complement(2114053..2114895) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene folP CDS complement(2114964..2116856) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene ftsH CDS complement(2116955..2117584) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene rlmE CDS 2117670..2117966 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene yhbY CDS 2118101..2118700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2118719..2119180) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene greA CDS complement(2119347..2120480) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706780.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene dnaJ CDS complement(2120569..2122491) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene dnaK CDS complement(2122617..2123243) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene grpE CDS 2123426..2124310 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene nadK CDS 2124468..2126180 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene proS CDS 2126311..2127465 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2127547..2128860) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene tilS CDS complement(2128951..2129907) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene accA CDS complement(2129917..2133390) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene dnaE CDS complement(2133387..2133980) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene rnhB CDS complement(2133977..2135122) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene lpxB CDS complement(2135115..2135888) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705103.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene lpxA CDS complement(2135909..2136370) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene fabZ CDS complement(2136396..2137418) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705102.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene lpxD CDS complement(2137432..2137932) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2138020..2140428) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene bamA CDS complement(2140458..2141807) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene rseP CDS complement(2141804..2142997) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705098.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene ispC CDS complement(2142999..2143853) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2143913..2144689) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene uppS CDS complement(2144762..2145319) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene frr CDS complement(2145447..2146178) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene pyrH CDS complement(2146250..2147128) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene tsf CDS complement(2147236..2148000) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene rpsB CDS 2148252..2149037 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958195.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene map CDS 2149443..2150033 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rluE note possible pseudo, internal stop codon, frameshifted CDS 2150030..2150482 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2150523..2151638 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene mnmA CDS 2151635..2152258 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene hflD CDS 2152295..2153665 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene purB CDS 2153827..2155551 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene aceK CDS complement(2155608..2156099) product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2156446..2157042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2157109..2157474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2157539..2157811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2158095..2161907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2162083..2163171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2163622..2163939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2163923..2164279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2164276..2169960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2169992..2170729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(2170722..2171078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2171071..2171559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2171569..2172060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2172375..2172761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2172761..2178484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2178527..2178787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2178802..2179212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2179261..2180016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2180148..2180477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2180474..2180929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2180926..2181885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2181885..2182364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2182367..2183047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2183053..2183385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2183435..2184631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2184683..2185090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2185106..2186206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2186318..2187784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2187800..2190028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2190021..2190326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2190323..2190829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2190840..2191133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2191188..2191667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2191695..2194241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 2194205..2194510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2194873..2195064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2195179..2195928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2196385..2196765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2196905..2197399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2197492..2197740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2198055..2198474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2198565..2199008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2199005..2199334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2199327..2199623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2199654..2199953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2200089..2200451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2200516..2200845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2200842..2201072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2201082..2201471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2201535..2202203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2202285..2202935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2202932..2203099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2203099..2203335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2203335..2203808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2203808..2204041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2204031..2204354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2204419..2204601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 2204676..2205491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2205482..2205748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2205741..2206148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2206151..2206438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2206510..2207028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2207021..2207782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2207858..2208064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2208064..2208294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 2208759..2208899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 2208922..2209191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 2209222..2209581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2209571..2210395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 2210513..2211214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 2211204..2212709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 2212847..2213713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2213779..2214057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2214444..2214884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 2214910..2215038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2215345..2216136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 2216358..2216627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2216787..2217389 product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2217442..2218359 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2218356..2218742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2218793..2221606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 2221701..2221967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2221964..2222521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2222696..2226142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2226209..2226667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2226667..2227188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2227229..2228206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2228229..2230349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2230596..2231432 product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 2231429..2231734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 2231800..2233161 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877001.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 2233460..2234176 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene arcA CDS complement(2234307..2235386) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene fbaA CDS complement(2235447..2236610) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005018348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene pgk CDS complement(2236654..2237673) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene epd CDS complement(2238141..2239535) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2239719..2241896) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2242251..2242955) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene phoU CDS complement(2242970..2243788) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene pstB CDS complement(2243821..2245470) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene pstA CDS complement(2245483..2247702) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2247858..2248358 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 2248435..2250489 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene ppk1 CDS 2250496..2252013 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene ppx CDS complement(2252021..2252545) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene tadA tRNA 2252714..2252790 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(2252946..2253407) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2253717..2254688) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(2254877..2256193) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene phoR CDS complement(2256201..2256890) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene phoB CDS complement(2257009..2257437) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2257613..2258521 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene rdgC CDS 2258711..2259121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 2259216..2260616 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene yegQ CDS 2260594..2260845 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2260882..2262057) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene emrD CDS complement(2262172..2262678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2262806..2263609 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene suhB CDS complement(2263749..2264123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2264609..2264926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 note possible pseudo, frameshifted CDS complement(2265237..2267015) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2267138..2267563) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706462.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2267651..2267896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2268013..2271069) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2271187..2272143) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419811.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene rluF CDS complement(2272497..2272952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2272949..2274715) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705399.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2275068..2276069 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 2276074..2277033 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2277049..2277546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2277697..2278896) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2279117..2280859 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706440.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2280868..2282319 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene dacB CDS 2282383..2282646 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2282911..2284125 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2284194..2285651) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene cls CDS 2285725..2286270 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2286233..2287885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2288141..2292028) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene purL CDS 2292221..2293633 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene mltF CDS 2293717..2293857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2293888..2294328) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2294451..2295968) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705649.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene der CDS complement(2296042..2297214) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944077.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene bamB CDS complement(2297211..2297855) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2297857..2299104) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene hisS CDS complement(2299175..2300293) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705645.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene ispG CDS complement(2300315..2301280) product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2301270..2302016) product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene tapF CDS complement(2302075..2303193) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2303346..2304863) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2305049..2305480) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705641.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene ndk CDS complement(2305588..2306886) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705639.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene pepB CDS complement(2307287..2307487) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene iscX CDS complement(2307519..2307857) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene fdx CDS complement(2307860..2309704) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene hscA CDS complement(2309710..2310228) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105747.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene hscB CDS complement(2310239..2310562) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705636.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene iscA CDS complement(2310575..2310961) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene iscU CDS complement(2310991..2312205) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2312257..2312754) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene iscR CDS complement(2312838..2313566) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene trmJ CDS complement(2313626..2314147) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2314299..2315294 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 2315303..2316193 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705629.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2316215..2317090) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705628.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene nlpI CDS complement(2317265..2318209) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene secF CDS complement(2318222..2320075) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene secD CDS complement(2320100..2320429) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene yajC CDS complement(2320462..2321604) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634306.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene tgt CDS complement(2321770..2322831) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene queA CDS 2323016..2323528 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2323529..2324116 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2324062..2325912) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2325912..2327108) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2327117..2328094) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2328091..2329275) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2329410..2331008) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2331858..2332424 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene ahpC CDS 2332509..2334050 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene ahpF CDS complement(2334085..2335083) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene yejK CDS 2335161..2335388 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2335421..2337274 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2337343..2337786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 2337939..2338655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2338668..2339504 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2339675..2341006) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2341039..2342100) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2342112..2342333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2342450..2343892 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2343917..2344390) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2344441..2344791 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene arsC CDS 2344788..2345165 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2345403..2346125) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205596950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene hda CDS complement(2346122..2347084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2347147..2348415) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2348469..2349095) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene upp CDS 2349385..2350422 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene purM CDS 2350419..2351057 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene purN CDS complement(2351225..2351524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 2351636..2352133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2352264..2352743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2352997..2353548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2353826..2354590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2354587..2356959) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2357006..2357791) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705470.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2357797..2358378) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene lpcA CDS complement(2358467..2359390) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 2359491..2360105 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 2360178..2361632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2361634..2363058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2363158..2363592) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2363770..2365119 product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 2365116..2365916 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2365994..2366839) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene kdsA CDS complement(2366849..2367655) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706932.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2367648..2368490) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706934.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene prmC CDS complement(2368490..2369575) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647701.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene prfA CDS complement(2369600..2370859) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene hemA CDS 2371012..2371563 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706937.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene lolB CDS 2371560..2372390 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene ispE CDS 2372671..2373618 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2373779..2374507) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 2374708..2375304 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene pth CDS 2375320..2376411 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene ychF tRNA 2376636..2376712 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 2376717..2376791 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 2376915..2376989 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 2377051..2377127 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 2377136..2377220 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 2377229..2377303 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(2377425..2378594) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 2378768..2380198 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene miaB CDS 2380285..2381349 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 2381346..2381810 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191149949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene ybeY CDS 2381886..2382695 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707019.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene corC CDS 2382696..2384213 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene lnt CDS complement(2384307..2384792) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 2384908..2387487 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077392314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene leuS CDS 2387577..2388062 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene lptE CDS 2388062..2389084 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene holA CDS 2389081..2389728 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene nadD CDS 2389761..2390105 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene rsfS CDS 2390102..2390572 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene rlmH CDS 2390576..2392462 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene mrdA CDS 2392455..2393555 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene rodA CDS 2393613..2394545 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene mltB CDS 2394529..2395350 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 2395347..2396594 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 2396762..2397025 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene ybeD CDS 2397035..2397688 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene lipB CDS 2397685..2398650 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene lipA CDS 2398800..2399117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 note possible pseudo, frameshifted CDS 2399603..2399977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2400049..2401104) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene aroG CDS 2401321..2401521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2401555..2401956 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2401956..2402393 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2402477..2403022 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2403139..2403741 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 2403723..2404082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2404135..2406177 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 2406174..2406662 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2406718..2407146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2407200..2408456) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2408465..2409568) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707186.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene proB CDS complement(2409671..2410069) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene crl CDS complement(2410176..2411423) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707188.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene frsA CDS complement(2411472..2411942) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene gpt CDS 2412220..2413854 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2413920..2415398 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 2415481..2415810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2416049..2417092) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226167.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene dinB CDS complement(2417169..2417393) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene nqrM CDS complement(2417395..2418429) product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(2418436..2419659) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705064.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene nqrF CDS complement(2419686..2420282) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene nqrE CDS complement(2420286..2420918) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2420911..2421681) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705063.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2421674..2422912) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2422918..2424261) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(2424627..2424944) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2424998..2425585) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 2425647..2426783 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705059.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2426795..2427376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 2427550..2428104 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303575.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2428123..2429475 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2429634..2430116) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 2430222..2431112 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2431218..2432666) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene thiI CDS complement(2432749..2433648) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2433648..2434403) product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene pomA CDS 2434608..2434853 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene xseB CDS 2434850..2435737 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene ispA CDS 2435762..2437627 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene dxs CDS complement(2437929..2438528) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2438675..2440768) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene fusA CDS complement(2441146..2442477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(2442735..2443670) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2443675..2444649) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(2444740..2446293) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2446314..2448053) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(2448595..2449074) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(2449071..2450039) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene thiL CDS complement(2450089..2450499) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene nusB CDS complement(2450513..2450980) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene ribE CDS complement(2451071..2452135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 2452206..2453102 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2453204..2453551) product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451084.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(2453568..2454227) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2454211..2454765) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2454802..2455584) product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene siaD CDS complement(2455577..2455954) product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene siaC CDS complement(2455976..2456518) product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene siaB CDS complement(2456478..2458526) product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene siaA CDS complement(2458807..2459916) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene ribBA CDS complement(2459947..2460600) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(2460600..2461688) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene ribD CDS complement(2461716..2462165) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene nrdR CDS complement(2462287..2463540) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2463791..2464411 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707104.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene torD CDS 2464420..2464773 product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 2464786..2465754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 2465742..2466431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 2466424..2466855 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2466933..2468723 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2468723..2469340 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104320.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2469506..2471455 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707110.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene acs CDS 2471918..2472367 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene aroQ CDS 2472404..2472868 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene accB CDS 2472878..2474218 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707113.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene accC CDS 2474249..2474704 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2474897..2475133 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2475130..2476581 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene panF CDS 2476663..2477538 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675412.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene prmA CDS 2477876..2478865 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene dusB CDS 2478868..2479167 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene fis CDS complement(2479323..2479535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2479640..2480179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 2480179..2482203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 2482281..2483366 product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene dndB CDS 2483378..2484997 product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene dndC CDS 2484987..2486996 product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene dndD CDS 2486996..2487343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2487500..2489395) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2489403..2494475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2494456..2495772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2495775..2497388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2497696..2498010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 note possible pseudo, frameshifted CDS complement(2498176..2498577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 note possible pseudo, internal stop codon, frameshifted CDS complement(2498832..2499140) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112569.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2499483..2501144 product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 2501265..2502116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2502336..2502998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 2503271..2506297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 2506242..2507723 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2507889..2508224 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530063.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 2508237..2509391 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143706.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 2509403..2510818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2510773..2512056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2512067..2513098 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 2513277..2514758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 2514775..2516181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2516174..2517466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(2517621..2518097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2519141..2520631) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2520716..2522059) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 2523651..2523929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 note possible pseudo, frameshifted CDS complement(2524545..2525201) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480654.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2525468..2527027) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene nhaC CDS 2527945..2528760 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142898278.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene gcvA CDS complement(2528774..2529679) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2529784..2530386 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 2530502..2531140 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene pdxH CDS complement(2531196..2531966) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973483.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(2532087..2533304) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(2533858..2534586) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2534642..2535670) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401358.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2535681..2537162) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2537179..2538441) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2538519..2539397) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene dapA CDS complement(2539581..2540492) product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene bauR CDS 2540802..2541506 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2541517..2542338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2542552..2543253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(2543438..2544883) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(2545049..2546542) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(2547036..2547815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2547958..2548143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(2548205..2550364) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410280.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene pta CDS complement(2550361..2551575) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 2551852..2552292 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704832.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene yfbV CDS 2552590..2553090 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene tpx CDS 2553243..2554151 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(2554148..2556571) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(2556564..2557247) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 2557246..2557842 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707238.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(2557839..2558510) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 tRNA complement(2558611..2558686) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(2558706..2558781) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(2558820..2558895) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(2558924..2558999) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS complement(2559219..2560631) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene gltX CDS 2560820..2561368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2561372..2561923) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene cobU CDS 2562055..2562342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 2562426..2563154 product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071239.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 2563281..2563535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2563602..2564120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 note possible pseudo, internal stop codon CDS complement(2564117..2564551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 2565271..2566059 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2566177..2567196) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(2567264..2568865) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2569103..2570602) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(2570696..2572315) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2572321..2573559) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2573625..2575049) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene aldA CDS 2575403..2576167 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894185.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2576286..2577791) product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene dhaS CDS complement(2577942..2579291) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene aspA CDS complement(2579641..2582160) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 2582675..2584192 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2584287..2585375 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 2585443..2586939 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 2587132..2588055 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 tRNA complement(2588272..2588348) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 rRNA complement(2588387..2588496) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(2588588..2591474) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(2591713..2591788) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(2591825..2591901) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 rRNA complement(2592047..2593586) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS 2594106..2596979 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rapA CDS 2596995..2597660 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704807.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene rluA CDS 2597672..2598460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 2598393..2599343 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2599422..2600225) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene djlA CDS 2600471..2602849 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704882.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene lptD CDS 2602873..2604189 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704881.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene surA CDS 2604186..2605175 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene pdxA CDS 2605168..2605977 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene rsmA CDS 2605977..2606351 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene apaG CDS 2606351..2607166 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(2607234..2607719) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene folA CDS complement(2607724..2608890) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene cgtA CDS complement(2609009..2609266) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rpmA CDS complement(2609284..2609595) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene rplU CDS 2609830..2610804 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene ispB CDS complement(2610989..2612287) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2612427..2613314) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene hflC CDS complement(2613318..2614487) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene hflK CDS complement(2614538..2615836) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene hflX CDS complement(2615906..2616172) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene hfq CDS complement(2616209..2617123) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280341.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene miaA CDS complement(2617143..2618927) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704862.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene mutL CDS complement(2618929..2620245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(2620242..2620709) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene tsaE CDS complement(2620672..2622189) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2622188..2623318 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819425.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene queG CDS 2623358..2624011 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene bluB tRNA complement(2624056..2624131) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(2624268..2624343) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(2624480..2624555) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(2624692..2624767) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 CDS 2624741..2625046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2624942..2625487) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene orn CDS 2625577..2626611 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene rsgA CDS 2626630..2627487 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene asd CDS 2627503..2630838 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706981.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene mscM CDS 2630904..2631392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2631467..2632402) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene epmA CDS complement(2632480..2632896) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 2633125..2634168 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707000.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2634233..2634799) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene efp CDS 2634840..2635859 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene epmB CDS 2635869..2636177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(2636161..2638119) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704806.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2638116..2638613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(2638858..2640495) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene groL CDS complement(2640528..2640821) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2641019..2642371 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(2642508..2642981) product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946196.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2643095..2643526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2643523..2643846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2643860..2644660) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene fkpA CDS complement(2644823..2645344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 2645535..2646530 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 2646520..2646738 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704936.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2646858..2647376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2647614..2647814) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 2647877..2648566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 2648597..2650495 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 2650492..2650917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 2650929..2651768 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene rlmJ CDS 2651898..2652230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(2652198..2653049) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(2653098..2654201) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(2654279..2654866) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 2655011..2655235 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 2655294..2656163 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(2656247..2656651) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 2656825..2657463 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene crp CDS complement(2657732..2658835) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(2658934..2659602) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(2659724..2661766) product TonB-dependent siderophore vibrioferrin receptor PvuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460644.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene pvuA CDS 2662094..2662864 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 2662903..2664060 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 2664057..2665754 product siderophore biosynthesis protein PsvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477461.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 2665751..2666920 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 2666883..2668649 product siderophore biosynthesis protein PvsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477449.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 2668646..2669863 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038170.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(2669915..2671447) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene hutH CDS complement(2671453..2673147) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(2673196..2674401) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene hutI CDS 2674656..2675192 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2675281..2675988) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483583.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene hutC CDS 2676150..2676623 product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene cosR CDS complement(2676638..2677216) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 2677365..2678309 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 2678309..2678881 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(2678969..2679757) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene znuB CDS complement(2679747..2680484) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707444.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene znuC CDS 2680573..2681544 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene znuA CDS 2681775..2683091 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707439.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene mepM CDS complement(2683153..2684220) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene hemE CDS 2684397..2684861 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 2684871..2685230 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707404.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(2685288..2686655) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene radA CDS 2686727..2688988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(2688948..2689931) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707408.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene serB CDS 2690004..2690549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(2690555..2691268) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene deoD CDS complement(2691299..2692516) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368379.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene deoB CDS complement(2692551..2693324) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene deoC CDS complement(2693366..2694130) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(2694242..2695831) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene prfC CDS 2696029..2696595 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 2697026..2698288 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2698504..2699256 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(2699562..2701031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(2701028..2701699) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(2701699..2702571) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(2702628..2702957) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(2702950..2703630) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2703952..2705283) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268395.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(2705307..2705978) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2706163..2706570 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene uraH CDS complement(2706692..2708068) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene pntB CDS complement(2708073..2709599) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene pntA CDS complement(2710004..2710762) product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705936.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(2710767..2712062) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(2712304..2713320) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269387.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(2713361..2713804) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene rimI CDS complement(2713780..2714181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 tRNA complement(2714206..2714282) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 CDS 2714593..2715516 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene pyrB CDS 2715526..2715981 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene pyrI CDS complement(2716003..2716302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(2716460..2716714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(2716771..2717385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 tRNA complement(2717774..2717850) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 rRNA complement(2717890..2717999) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2718086..2720971) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(2721308..2721383) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 rRNA complement(2721605..2723144) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 2723630..2724829 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(2724908..2727481) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene clpB CDS complement(2727587..2728312) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene yfiH CDS complement(2728303..2729283) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene rluD CDS 2729386..2730132 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409782.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(2730312..2731055) product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(2731052..2732653) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704677.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene gshA CDS complement(2732709..2735513) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704676.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(2735544..2736476) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051773499.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 2736639..2736806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(2736859..2737596) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(2737693..2738142) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene rplI CDS complement(2738183..2738410) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308890.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene rpsR CDS complement(2738438..2738809) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rpsF CDS complement(2739027..2739890) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819329.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(2739985..2740719) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene rlmB CDS complement(2740815..2743151) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704662.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene rnr CDS complement(2743268..2743777) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704660.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene luxS CDS complement(2743900..2744238) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene glnB CDS complement(2744249..2745868) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(2745951..2747939) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704657.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(2747951..2749105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704656.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(2749092..2749763) product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704655.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(2749757..2750257) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704654.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 2750301..2750720 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(2750746..2751690) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene ispH CDS complement(2751693..2752142) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene fkpB CDS complement(2752139..2752627) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene lspA CDS complement(2752627..2755452) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene ileS CDS complement(2755458..2756405) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene ribF CDS complement(2756509..2758071) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene murJ CDS 2758268..2758528 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene rpsT CDS complement(2758676..2758969) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(2758998..2759942) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704639.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene nhaR CDS complement(2760031..2761230) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene nhaA CDS complement(2761408..2762202) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene thyA CDS complement(2762199..2763017) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704636.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene lgt CDS complement(2763083..2765341) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene ptsP CDS complement(2765358..2765912) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704634.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene rppH CDS 2766528..2767205 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704633.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene mutH CDS complement(2767207..2768373) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(2768477..2768830) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene rplS CDS complement(2768863..2769609) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene trmD CDS complement(2769637..2770158) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene rimM CDS complement(2770182..2770433) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene rpsP CDS complement(2770602..2771987) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene ffh CDS 2772156..2772923 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704628.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene ccsA CDS 2772980..2774257 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(2774265..2774723) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704626.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(2774817..2775485) product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349413.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(2775539..2776342) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene mazG CDS complement(2776387..2778597) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene relA CDS complement(2778607..2779917) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene rlmD CDS 2779998..2782694 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704764.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene barA CDS complement(2782755..2783492) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene pdxJ CDS complement(2783485..2784192) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704751.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene recO CDS complement(2784195..2785100) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704750.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene era CDS complement(2785097..2785765) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704749.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene rnc CDS complement(2785765..2786679) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704748.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene lepB CDS complement(2786682..2788478) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene lepA CDS complement(2788565..2789005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(2789002..2789979) product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(2789995..2790567) product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2790581..2791147) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene rpoE CDS 2791341..2792966 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene nadB CDS complement(2792954..2793337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2793306..2793581) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 2793688..2794590 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene ygfZ CDS complement(2794572..2795462) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967943.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 2795553..2795984 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2796027..2797292) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482999.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 2797670..2798857 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969329.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene doeA CDS 2798865..2799356 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(2799382..2800560) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 2800715..2801770 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene mutY CDS 2801770..2802045 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 tRNA 2802139..2802214 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA 2802247..2802322 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 2802355..2802430 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS 2802591..2803568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 2803823..2804032 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 2804152..2805336 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260921.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(2805347..2806519) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2806695..2807063 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707507.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene hfq CDS complement(2807117..2807989) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene dapA CDS 2808279..2809298 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene rsmC tRNA 2809421..2809506 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA 2809533..2809618 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA 2809690..2809775 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 CDS complement(2809871..2810089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(2810148..2811488) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene rlmD CDS 2811823..2812713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 2812749..2813234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 2813425..2814045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 2814416..2815570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2815707..2816357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 note possible pseudo, frameshifted CDS complement(2816329..2816634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 note possible pseudo, frameshifted CDS 2816826..2818088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(2818102..2818590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 tRNA complement(2818723..2818807) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 CDS 2818982..2819473 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045788985.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(2819545..2820615) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene lptG CDS complement(2820615..2821775) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene lptF CDS 2821887..2823398 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene pepA CDS 2823400..2823843 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene holC CDS 2823848..2826700 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(2826763..2828064) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065016884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 2828271..2828738 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(2828755..2828961) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169916.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene osmB CDS complement(2829091..2829492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(2829522..2831786) product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(2831857..2832216) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076360509.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene rraB CDS complement(2832213..2832962) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707454.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(2833055..2834722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(2834834..2835553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(2835791..2838517) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene secA CDS complement(2838870..2839793) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene lpxC CDS complement(2839890..2841029) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene ftsZ CDS complement(2841074..2842330) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305690.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene ftsA CDS complement(2842290..2843054) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707579.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(2843056..2843973) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210432.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(2843973..2845430) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene murC CDS complement(2845444..2846511) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene murG CDS complement(2846508..2847683) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352178.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene ftsW CDS complement(2847680..2848978) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene murD CDS complement(2848983..2850065) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene mraY CDS complement(2850059..2851399) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene murF CDS complement(2851396..2852868) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene murE CDS complement(2852852..2854600) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(2854597..2854908) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene ftsL CDS complement(2854908..2855852) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene rsmH CDS complement(2855855..2856313) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene mraZ CDS complement(2856988..2857827) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene rsmI CDS 2857897..2859738 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 2859695..2860075 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 2860084..2860674 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 2860679..2861257 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene dolP CDS complement(2861304..2861741) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(2861744..2862373) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene sspA CDS complement(2862462..2863175) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(2863193..2864410) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707596.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(2864415..2864822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(2865304..2865696) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene rpsI CDS complement(2865712..2866140) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene rplM CDS complement(2866395..2867495) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene zapE CDS 2867707..2869065 product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 2869199..2870257 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene degS CDS complement(2870356..2871612) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene murA CDS complement(2871624..2871884) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306001.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene ibaG CDS complement(2871871..2872155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(2872152..2872784) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707621.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene mlaC CDS complement(2872811..2873284) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707620.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene mlaD CDS complement(2873291..2874070) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene mlaE CDS complement(2874060..2874785) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene mlaF CDS 2875035..2876009 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 2876009..2876560 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707616.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene kdsC CDS 2876557..2877105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 2877074..2877595 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene lptA CDS 2877598..2878323 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene lptB CDS 2878366..2879802 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707612.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 2879827..2880114 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene hpf CDS 2880117..2880563 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305951.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene ptsN CDS 2880573..2881439 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707611.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene rapZ CDS 2881426..2881701 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 2881720..2883081 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene mgtE CDS complement(2883144..2884484) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene pmbA CDS 2884588..2885109 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene yjgA CDS complement(2885228..2886673) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene tldD CDS complement(2886670..2887497) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(2887501..2891244) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819191.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(2891247..2892716) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene rng CDS complement(2892788..2893363) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(2893373..2893861) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene mreD CDS complement(2893858..2894727) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene mreC CDS complement(2894764..2895807) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 2895949..2896887 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(2896884..2898797) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039212856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(2898972..2899553) product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene ssb1 CDS complement(2899568..2900941) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 2901075..2903918 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707637.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene uvrA CDS 2903938..2905665 product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(2905605..2906393) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230213.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(2906411..2906992) product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(2907007..2907924) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(2907928..2908707) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(2908704..2909813) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(2909810..2911468) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 2911581..2911892 product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(2911894..2912187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 2912241..2912693 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(2913188..2914417) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(2914649..2918329) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene metH CDS 2918573..2919862 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(2919902..2922352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(2922408..2923487) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(2923626..2924579) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464332.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene metA CDS 2924721..2925896 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704460.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2925936..2926637) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(2926764..2928107) product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(2928232..2929668) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 rRNA complement(2930236..2930345) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA complement(2930432..2933317) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA complement(2933654..2933729) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 rRNA complement(2934035..2935574) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS complement(2935941..2936498) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044801009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene gmhB CDS complement(2936513..2937526) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(2937523..2938503) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(2938500..2940305) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(2940318..2941364) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(2941357..2942376) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 2942855..2943898 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704855.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene metN CDS 2943879..2944532 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 2944558..2945388 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261412.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 2945488..2945991 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349600.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene rfaH CDS complement(2946030..2947385) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene dgt CDS complement(2947382..2949733) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene arcB CDS 2950427..2954884 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706515.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene gltB CDS 2954897..2956312 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706516.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 2956618..2957316 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705596.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene mtnN CDS 2957320..2958243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 2958236..2959051 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705594.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 2959106..2959735 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(2959939..2961135) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633247.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene tyrS CDS 2961303..2962598 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706904.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(2962633..2963061) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(2963058..2963384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(2963392..2963736) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene erpA CDS 2963908..2965194 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene hemL CDS complement(2965391..2965816) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(2965950..2968280) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene mrcB CDS complement(2968283..2970715) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818758.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene hrpB CDS 2970972..2973197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 2973218..2973739 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene thpR CDS complement(2974028..2974732) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene sfsA CDS 2975016..2975468 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene dksA CDS 2975485..2976408 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818759.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene gluQRS CDS 2976511..2977830 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene pcnB CDS 2977827..2978315 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene folK CDS 2978327..2979121 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene panB CDS 2979131..2979976 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene panC CDS 2980098..2980484 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2980570..2981343) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(2981340..2982260) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(2982339..2982869) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene hpt CDS complement(2983404..2984051) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(2984044..2985402) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene mpl CDS 2985603..2986133 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene ppa CDS 2986433..2987251 product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(2987248..2988648) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene cysG CDS complement(2989031..2989798) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(2989788..2991479) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene cysI CDS complement(2991481..2993280) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(2993459..2993833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(2994319..2994636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 note possible pseudo, frameshifted CDS complement(2994770..2998981) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene rpoC CDS complement(2999069..3003097) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635847.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene rpoB CDS complement(3003321..3003689) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene rplL CDS complement(3003744..3004247) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene rplJ CDS complement(3004488..3005186) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene rplA CDS complement(3005191..3005619) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene rplK CDS complement(3005749..3006291) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306318.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene nusG CDS complement(3006301..3006672) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene secE tRNA complement(3006738..3006814) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 CDS complement(3006867..3008051) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210669.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene tuf tRNA complement(3008150..3008225) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(3008228..3008302) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(3008370..3008454) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(3008465..3008540) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 CDS 3008770..3009711 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene coaA CDS complement(3009745..3010734) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene birA CDS complement(3010722..3011750) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene murB CDS 3011938..3012348 product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 3012345..3012944 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 3012941..3013807 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037818.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(3013970..3015034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(3015115..3015891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 3016036..3016713 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 3016802..3018241 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813514.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 3018313..3019233 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526839.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 3019293..3019751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 3019755..3021263 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(3021383..3023305) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(3023319..3023780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(3023857..3024453) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707719.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene msrQ CDS complement(3024453..3025469) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707720.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene msrP CDS complement(3025529..3026869) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene glrR CDS complement(3026866..3027363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(3027356..3028795) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 3029011..3029418 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(3029484..3030476) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene asnA CDS 3030613..3031089 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene asnC CDS complement(3031090..3031548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 3031727..3032452 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 3032442..3033812 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 3033881..3035149 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3035183..3035800) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 3035907..3036830 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 3036985..3039105 product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337457.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(3039157..3040062) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306036.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene metF CDS complement(3040513..3041202) product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene csiR CDS 3041368..3042336 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene glaH CDS 3042441..3043652 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene lhgO CDS complement(3043753..3044385) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 3044631..3045038 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096424.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene rnk CDS 3045168..3046124 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 3046182..3047099 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(3047085..3047780) product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297918.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene lpxT tRNA complement(3047953..3048029) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 rRNA complement(3048069..3048178) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA complement(3048267..3051145) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 tRNA complement(3051374..3051449) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 rRNA complement(3051755..3053290) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 CDS 3054080..3054358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(3054363..3055163) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704112.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene murI CDS complement(3055263..3057095) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704111.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 3057423..3058877 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 3058887..3059252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(3059246..3059773) product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707846.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 3059909..3061006 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene trmA CDS complement(3061106..3062350) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(3062471..3062899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(3063323..3063538) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene rpmE CDS 3063664..3065874 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707854.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene priA CDS complement(3065880..3066470) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043164119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 3066708..3068462 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707774.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene argS CDS 3068466..3069050 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene ftsN CDS 3069206..3069736 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene hslV CDS 3069763..3071091 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene hslU CDS 3071188..3071673 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306574.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene rraA CDS complement(3071752..3071961) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349028.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(3072103..3072885) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene cysE CDS complement(3072914..3073813) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(3073892..3074188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(3074279..3074755) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene trmL CDS complement(3074760..3076121) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene dinF CDS complement(3076149..3076796) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(3076789..3077685) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene cyoE CDS complement(3077622..3078653) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(3078662..3079105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3079083..3079763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 3079775..3079999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(3080015..3080884) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3080898..3081425) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3081422..3083026) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene ctaD CDS complement(3083036..3084169) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene coxB CDS complement(3084487..3085101) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene lexA CDS complement(3085180..3086052) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127681.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene ubiA CDS complement(3086052..3086600) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 3086765..3087166 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704197.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(3087144..3087995) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene glpG CDS complement(3087992..3088312) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704135.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene glpE CDS complement(3088357..3089061) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(3089061..3089825) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene livG CDS complement(3089822..3091063) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410832.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(3091060..3091983) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene livH CDS complement(3092067..3093182) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704142.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(3093414..3094439) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene tdh CDS complement(3094451..3095641) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 3096034..3096987 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene rfaD CDS 3096996..3098759 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(3099371..3100384) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 3100571..3101554 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene waaF CDS 3101560..3102819 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704189.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene waaA CDS complement(3102855..3103601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(3104962..3105672) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 3105759..3106820 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 3106817..3107593 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(3107562..3108581) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 3108660..3109145 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene coaD CDS complement(3109224..3110036) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene mutM CDS complement(3110135..3110305) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene rpmG CDS complement(3110317..3110553) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417050.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene rpmB CDS complement(3110684..3111358) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene radC CDS 3111474..3112682 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene coaBC CDS 3112654..3113124 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene dut CDS 3113141..3113740 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene slmA CDS 3113785..3114639 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(3114720..3115571) product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 3115746..3116615 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(3116635..3117120) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109548.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(3117223..3117918) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 3118390..3120471 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020393730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(3120543..3121976) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038716188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(3122015..3122674) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969683.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(3122736..3124124) product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(3124212..3124946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(3125309..3126025) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(3126092..3126802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(3126821..3127141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(3127225..3127995) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene bioH CDS 3127999..3128712 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 3128784..3129362 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene nfuA CDS complement(3129447..3130448) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene gpsA CDS complement(3130448..3130930) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene secB CDS complement(3130964..3131392) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 3131610..3133142 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene gpmM CDS 3133153..3134379 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene envC CDS complement(3134390..3134641) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704438.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(3134641..3135237) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 3135321..3135692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 3135722..3137098 product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene fumC CDS complement(3137095..3138438) product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(3138510..3139517) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene glpX CDS complement(3139540..3140193) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene can CDS complement(3140299..3141171) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene rpoH CDS complement(3141332..3142282) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene ftsX CDS complement(3142279..3142944) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene ftsE CDS complement(3142945..3144582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 3144667..3145266 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene rsmD CDS 3145263..3145547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(3145549..3145869) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 3146457..3147314 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene sseA CDS complement(3147362..3147739) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113995426.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(3147763..3148374) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308043.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene fabR CDS 3148683..3150032 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(3150098..3152278) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819168.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(3152427..3152726) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(3152751..3152933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(3152930..3154717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 3154786..3155142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(3155123..3155551) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 3155672..3156061 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(3156058..3157539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 3157829..3158791 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 3158856..3159938 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene ftsZ CDS complement(3160005..3161213) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene gltS CDS complement(3161248..3162198) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113438.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene hutG CDS complement(3162220..3162942) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(3163363..3164478) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 3164546..3164866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 3164935..3165624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 3165753..3166427 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(3166484..3166942) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 3167160..3167576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 3168041..3169258 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(3169265..3169894) product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(3169934..3170218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 3170273..3170902 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 3170956..3171942 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(3171944..3173740) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(3173748..3174401) product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(3174491..3175021) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 3175188..3176147 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene zntB CDS complement(3176149..3177528) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982234.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(3177525..3178361) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(3178358..3179293) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(3179290..3180810) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 3180978..3181517 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3181868..3183400) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706466.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 3183731..3184477 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 3184474..3185178 product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 3185175..3186095 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(3186256..3187638) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(3187775..3188389) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482839.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene thiE CDS complement(3188386..3189195) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482855.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene thiM CDS complement(3189273..3189761) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 3189867..3190433 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(3190440..3190841) product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3191038..3192159) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene thiH CDS complement(3192156..3192926) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(3192928..3193128) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005357774.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene thiS CDS complement(3193133..3193885) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(3193888..3195396) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene thiE CDS complement(3195393..3197348) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene thiC CDS complement(3197988..3198860) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene menA CDS 3198990..3199901 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704501.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene menC CDS 3200008..3201984 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(3202051..3202833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(3202887..3204092) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene pcaF CDS complement(3204089..3204883) product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(3204883..3205701) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 3205955..3206740 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(3206742..3207644) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 3207753..3208892 product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 3208906..3209196 product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807674.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene catC CDS 3209253..3210191 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene catA CDS 3210267..3211643 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 3211640..3212131 product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene benB CDS 3212149..3213177 product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene benC CDS 3213174..3213953 product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 3214055..3215389 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 3215484..3216701 product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene benE CDS 3216853..3217857 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815856.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 3217861..3218703 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene cysT CDS 3218703..3219542 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene cysW CDS 3219548..3220639 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene cysA CDS complement(3220684..3221583) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene cysM CDS complement(3221648..3222265) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365424.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 3222373..3225033 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816953.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 rRNA complement(3225225..3225334) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 rRNA complement(3225423..3228309) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 tRNA complement(3228645..3228720) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 rRNA complement(3229025..3230564) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 CDS complement(3230951..3231475) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945460.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene hemG CDS complement(3231486..3232943) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(3232965..3233585) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3233815..3235953 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704165.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene fadB CDS 3235974..3237137 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene fadA CDS 3237272..3237517 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143763.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene tusA CDS 3237591..3238508 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(3238559..3239209) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(3239294..3239863) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 3239964..3240875 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209624.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene glyQ CDS 3240879..3242948 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene glyS CDS 3243150..3243491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 3243613..3244872 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(3245181..3245624) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704053.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(3245684..3246106) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(3246255..3247940) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene ilvD CDS 3247870..3248049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(3248098..3250515) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene gyrB CDS complement(3250508..3251614) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704049.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene recF CDS complement(3251616..3252716) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704048.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene dnaN CDS complement(3252729..3254111) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene dnaA CDS 3254573..3255331 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 3255334..3255999 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707929.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 3256010..3256750 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707928.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 3257000..3257134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 3257134..3257496 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene rnpA CDS 3257707..3259368 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene yidC CDS 3259487..3260848 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene mnmE CDS 3260868..3261233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(3261187..3262011) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970363.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(3262008..3262865) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene sitC CDS complement(3262849..3263742) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901062.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(3263739..3264647) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(3264700..3265572) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705966.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 3265664..3266635 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705967.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(3266629..3267663) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134026.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 3268059..3269504 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene glcD CDS 3269504..3270562 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene glcE CDS 3270574..3271788 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194680.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene glcF CDS complement(3271804..3272709) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200834.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 3272877..3274577 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 3274635..3275405 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 3275398..3276816 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 3276816..3277469 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706378.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 3277469..3280270 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 3280428..3280778 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3280897..3282249) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene gdhA CDS 3282476..3284188 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene gspE CDS 3284190..3285410 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene gspF CDS 3285435..3285863 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene gspG CDS 3285832..3286302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 3286295..3286696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 3286693..3287367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 3287345..3288331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 3288268..3289341 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035907.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 3289338..3289946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 3289943..3290467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 3290464..3292551 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene gspD CDS complement(3292634..3293698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 3294255..3295526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 3295595..3297613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(3297673..3298842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(3299728..3301113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 3301229..3302842 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 3302855..3303589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 3303735..3304223 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene mioC CDS 3304746..3306635 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene mnmG CDS 3306644..3307267 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707917.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene rsmG CDS 3307277..3308080 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 3308077..3308982 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 3309181..3309573 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302496.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 3309582..3310361 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene atpB CDS 3310424..3310648 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene atpE CDS 3310699..3311169 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707912.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene atpF CDS 3311183..3311713 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707911.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene atpH CDS 3311728..3313269 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene atpA CDS 3313315..3314175 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene atpG CDS 3314209..3315597 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene atpD CDS 3315616..3316041 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307217.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 3316226..3317590 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene glmU CDS 3317772..3318542 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 3318553..3320382 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene glmS CDS complement(3320462..3322294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(3322272..3323330) product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(3323570..3325759) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene katG CDS complement(3325909..3327873) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 3328077..3329393 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815438.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 rRNA 3329795..3331334 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 tRNA 3331479..3331555 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA 3331592..3331667 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 rRNA 3331918..3334805 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA 3334892..3335001 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 tRNA 3335016..3335091 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 rRNA 3335103..3335204 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 CDS 3335341..3335754 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene cueR CDS 3335885..3337306 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene ccoG CDS 3337368..3338336 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707873.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 3338379..3338987 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707872.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(3339031..3339321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(3339351..3340862) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 3341239..3342888 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene ilvG CDS 3342885..3343145 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212016.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene ilvM CDS 3343157..3344080 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 3344148..3345998 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene ilvD CDS 3346003..3347559 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene ilvA CDS 3347743..3348585 product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 3348582..3349451 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3349513..3350691) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704439.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(3350701..3351840) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(3351827..3352582) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704441.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(3352579..3353508) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene hemC CDS 3353706..3356285 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704443.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(3356312..3356623) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704445.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene cyaY CDS 3356651..3356818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 3356830..3358086 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene lysA CDS 3358090..3358923 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene dapF CDS 3358920..3359603 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349251.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 3359590..3360510 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene xerC CDS 3360586..3361293 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704450.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 3361329..3363497 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704228.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene uvrD CDS complement(3363814..3364716) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene rarD CDS 3364867..3366693 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene recQ CDS complement(3366742..3367041) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 3367208..3368641 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 3368671..3368901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 3369029..3369688 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707785.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(3370066..3370713) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704213.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene elbB CDS 3371024..3373753 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene polA CDS 3374191..3374997 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene thiD CDS 3375197..3377494 product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 3377491..3377922 product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 3377923..3378270 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 3378267..3379769 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 3379766..3380239 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 3380244..3380519 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 3380509..3380883 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene mnhG CDS complement(3380923..3381318) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(3381346..3382503) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(3382511..3384163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 note possible pseudo, frameshifted CDS 3384306..3386105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 3386102..3388939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(3388997..3389686) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208832.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene rsuA CDS complement(3389686..3390324) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704276.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene yihA CDS 3390467..3391084 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 3391130..3391789 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 3391786..3392331 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041217267.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene yihI CDS 3392328..3392786 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704279.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 3392801..3394168 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene hemN CDS complement(3394251..3395255) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704281.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene add CDS complement(3395289..3396722) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene glnG CDS complement(3396732..3397781) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704282.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene glnL CDS 3398002..3398451 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445640.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene slyA CDS 3398448..3399497 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 3399505..3400524 product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122410.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(3400607..3400981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(3401467..3401784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 note possible pseudo, frameshifted CDS complement(3401943..3403352) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene glnA CDS 3403870..3405705 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene typA CDS 3405989..3406510 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 3406534..3407112 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 3407258..3408154 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704286.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 3408154..3409113 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene pip CDS 3409110..3409547 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene dtd CDS 3409677..3410567 product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(3410723..3411460) product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(3411504..3412784) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(3412806..3413408) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(3413512..3414510) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(3414565..3415785) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(3415827..3417140) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene hisD CDS complement(3417229..3418239) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 3418394..3419332 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(3419340..3421370) product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(3421435..3423507) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene recG CDS complement(3423603..3424952) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene pssA CDS complement(3425112..3426902) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(3426978..3427886) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(3427991..3428182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(3428276..3431353) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704065.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3431366..3432487) product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene vmeC CDS complement(3432513..3433079) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262873.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 tRNA 3433303..3433379 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA 3433405..3433480 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 tRNA 3433513..3433598 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 tRNA 3433732..3433808 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 CDS 3433966..3434784 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(3435053..3436291) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(3436343..3437455) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene nspC CDS complement(3437661..3438929) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(3439117..3440004) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(3440074..3440856) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene hyi CDS complement(3440926..3442701) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene gcl CDS 3443390..3444019 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 3444157..3444639 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(3444710..3445234) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene phaR CDS complement(3445387..3445842) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(3445970..3447322) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene gorA CDS 3447541..3449583 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene prlC CDS 3449689..3452091 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 3452060..3452818 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 3452899..3453765 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(3453762..3455684) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704982.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(3455733..3456731) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208819.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(3456977..3457951) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(3458054..3458920) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 3459387..3460316 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(3460313..3460753) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(3460896..3461672) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(3461694..3462869) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 3462963..3464135 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 3464258..3465079 product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 3465069..3467216 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 3467213..3468655 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049180.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 3469647..3470081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 3470320..3470736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 3470720..3471358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 3471355..3472878 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 3472868..3474067 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166061917.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 3474067..3475998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 3476129..3478120 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 3478117..3479430 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704236.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 3479464..3482736 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 3482739..3483485 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 3483485..3484693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(3484717..3485277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 3485384..3485608 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(3485773..3486849) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703366.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 3486984..3487256 product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369853.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene rcnR CDS complement(3487345..3488019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(3488037..3488753) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(3488804..3489157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 3489267..3489548 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 3489564..3490865 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3490922..3492118) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene trpB CDS complement(3492238..3493116) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 3493257..3493583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 3493735..3494769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 3494769..3497345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(3497340..3498251) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene murQ CDS complement(3498262..3499359) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477894.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(3499353..3499541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 3499642..3500094 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(3500091..3500885) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(3500902..3501942) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(3502062..3504170) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene spoT CDS complement(3504264..3504539) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307060.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene rpoZ CDS complement(3504589..3505218) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348898.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene gmk CDS 3505525..3505833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(3505837..3506625) product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(3506752..3507450) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261713.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 3507641..3508252 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(3508313..3509176) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707879.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 3509330..3510052 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene rph CDS 3510103..3510744 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707877.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene pyrE CDS complement(3510750..3511427) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872931.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene yjjG CDS 3511580..3512188 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 3512316..3512729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 3512898..3513806 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene cyoA CDS 3513808..3515790 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266851.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene cyoB CDS 3515790..3516410 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086858.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene cyoC CDS 3516407..3516727 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 3516994..3517881 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082726.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene cyoE CDS complement(3517940..3519295) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(3519322..3519696) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(3519716..3520612) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(3520609..3522117) product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 3522201..3522956 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 3523350..3523646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 3523807..3524727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(3524771..3526336) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242456.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(3526486..3526938) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(3526974..3528077) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(3528197..3530521) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819165.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(3530525..3531007) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene greB CDS complement(3531106..3532113) product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(3532272..3533471) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene zigA CDS 3533570..3534196 product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 3534354..3534719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 3534785..3536509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(3536603..3536803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 3536696..3537493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(3537498..3537743) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(3537785..3538270) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(3538577..3538756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(3538810..3540204) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(3540191..3540523) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402017.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(3540501..3541625) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891452.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(3541678..3542679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(3542698..3543996) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(3543989..3544546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 3544709..3545653 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(3545660..3547951) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816272.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(3547926..3548741) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401939.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene fdhD CDS 3548883..3549770 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816367.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 3549888..3552389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(3552449..3554062) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704536.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene pckA CDS complement(3554366..3555232) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene hslO CDS complement(3555248..3555640) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819274.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene hslR CDS 3555793..3556356 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene nudE CDS 3556359..3557174 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704554.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene cysQ CDS complement(3557206..3557532) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308521.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene metJ CDS 3557708..3558868 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene metB CDS 3558869..3561301 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(3561350..3561751) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528320.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(3561829..3562080) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(3562284..3563363) product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796599.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(3563363..3564361) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261812.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(3564361..3565746) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(3565838..3567097) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(3567240..3567701) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707484.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene ybaK CDS complement(3567987..3570608) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene ppc CDS complement(3570720..3571871) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704559.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene argE CDS 3572119..3573132 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene argC CDS 3573139..3573924 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene argB CDS 3573935..3574843 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 3574850..3576061 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 3576457..3577839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 3578216..3578527 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene rpsJ CDS 3578549..3579187 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene rplC CDS 3579205..3579810 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene rplD CDS 3579807..3580109 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene rplW CDS 3580127..3580951 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene rplB CDS 3580973..3581251 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene rpsS CDS 3581262..3581594 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene rplV CDS 3581613..3582308 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331168.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 gene rpsC CDS 3582321..3582734 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 gene rplP CDS 3582734..3582925 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene rpmC CDS 3582927..3583187 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene rpsQ CDS 3583348..3583716 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene rplN CDS 3583727..3584044 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307977.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene rplX CDS 3584058..3584597 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene rplE CDS 3584609..3584914 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704315.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene rpsN CDS 3584937..3585329 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704316.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene rpsH CDS 3585339..3585872 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307981.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene rplF CDS 3585882..3586235 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene rplR CDS 3586250..3586750 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940115.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene rpsE CDS 3586757..3586939 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene rpmD CDS 3586944..3587378 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene rplO CDS 3587387..3588718 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene secY CDS 3589009..3589365 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene rpsM CDS 3589380..3589772 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene rpsK CDS 3589803..3590423 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704319.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene rpsD CDS 3590448..3591437 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307997.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene rpoA CDS 3591482..3591874 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene rplQ