COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence002 source 1..241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence003 source 1..201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence004 source 1..223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence005 source 1..280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence006 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..472 product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 sequence007 source 1..222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence008 source 1..281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence009 source 1..288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 note possible pseudo, internal stop codon sequence010 source 1..39538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 172..282 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 308..383 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 416..491 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 529..604 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 615..701 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 707..781 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 796..881 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 891..967 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 983..1059 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 1065..1138 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 1158..1234 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 1237..1313 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 1320..1412 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 1430..1506 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 1571..1647 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1660..1735 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 1757..1832 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 1842..1915 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 1931..2007 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 2018..2092 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 2096..2186 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 2217..2288 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 2522..4405 product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene glgB CDS 4402..5544 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5567..6598 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene glgD CDS 6595..8049 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene glgA CDS 8036..10432 product glycogen phosphorylase GlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene glgP CDS complement(10461..10928) product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(11020..12081) product spore coat kinase CotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886600.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene cotI CDS 12283..13416 product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene cotSA CDS 13431..14486 product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene cotS CDS 14488..14910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(14987..16210) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229035.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(16213..17163) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(17160..18446) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 18618..19421 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(19445..20164) product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 20411..21871 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 21868..23610 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene menD CDS 23598..24446 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene menH CDS 24460..25278 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene menB CDS 25369..26829 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229056.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 26826..27941 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene menC CDS 28222..29142 product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene mntA CDS 29161..29913 product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene mntB CDS 29919..31226 product manganese ABC transporter permease MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229064.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene mntC CDS 31216..32103 product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene mntD CDS complement(32122..32280) product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(32334..33374) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(33417..34748) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 34954..35202 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 35321..35884 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(35881..36108) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene yidD CDS 36236..36709 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219361.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 36829..37269 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(37263..37403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 37535..37972 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 38138..38542 product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 38754..39230 product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene ytkD sequence011 source 1..275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence012 source 1..249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence013 source 1..299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence014 source 1..300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence015 source 1..269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence016 source 1..289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence017 source 1..243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence018 source 1..359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence019 source 1..320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence020 source 1..430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 sequence021 source 1..324783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(28..101) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(116..192) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(183..413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 525..1379 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(1431..2519) product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244107.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene gmuG CDS complement(2538..3485) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene manA CDS complement(3482..4381) product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene gmuE CDS complement(4410..5123) product transcriptional regulator GmuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene gmuR CDS complement(5272..6669) product 6-phospho-beta-glucosidase GmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene gmuD CDS complement(6687..8015) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene celB CDS complement(8035..8367) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(8367..8678) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 9010..10176 product purine transporter PbuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene pbuE CDS complement(10348..10914) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(11123..12100) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 12241..12660 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 note possible pseudo, frameshifted CDS 12679..13164 product YdhH/YoaO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234115.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 13639..15027 product alkaline phosphatase PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene phoB CDS 15093..15800 product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 assembly_gap 16852..16909 estimated_length known gap_type within scaffold linkage_evidence paired-ends repeat_region 16937..17358 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttccccggtagctcctgtcgctcc CDS complement(17897..19081) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(19240..20502) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(20626..21300) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 21549..22286 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(22322..23530) product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(23726..24049) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(24046..24771) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 24890..25447 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 25592..26026 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 26042..26671 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(26759..29416) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(29413..29871) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 30038..30556 product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene dinB CDS 30731..32107 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 32439..34067 product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene vmlR CDS complement(34114..34674) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(34693..35874) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(36124..36945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(36961..37146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 note possible pseudo, internal stop codon CDS complement(37159..37809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 note possible pseudo, internal stop codon, frameshifted CDS complement(37986..38306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 note possible pseudo, frameshifted CDS complement(38392..39396) product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene degA CDS complement(39490..40515) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 40825..41196 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(41207..41680) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(41834..42178) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(42175..42774) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 43014..43286 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 43300..43542 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 43555..43986 product spore coat protein CotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene cotP CDS 44174..44416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 note possible pseudo, internal stop codon, frameshifted CDS complement(44492..45130) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(45105..45473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(45661..46296) product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene paiB CDS 46443..47828 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(47896..48234) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(48419..48808) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(48948..49886) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(49913..50533) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244392.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 50988..51881 product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene mneP CDS 52067..52879 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 52970..53659 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(54124..54570) product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene rok CDS complement(54725..56047) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene brnQ CDS complement(56239..56574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(56950..57270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(57395..59566) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(59681..60322) product two-component system response regulator YdfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene ydfI CDS complement(60315..61478) product two-component system sensor histidine kinase YdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ydfH CDS 61809..61979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243880.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 61982..62152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886421.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 62241..62684 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(62749..63429) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244115.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 63519..64142 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(64255..65703) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 65837..66730 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 66830..66970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(67124..67924) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(68117..68536) product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(68552..69859) product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(69872..70219) product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene aseR CDS 70415..70576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 note possible pseudo, internal stop codon, frameshifted CDS complement(70957..71829) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 72354..72611 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 72696..73268 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(73328..73753) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(74151..75542) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 75920..76558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(76688..77098) product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246601.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene lrpA CDS 77356..78117 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 78258..78479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 78680..78856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 78910..79584 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(79800..80393) product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(80981..81364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 81877..82749 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(82784..82921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(83153..83938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 84556..85449 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 85920..86381 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(87129..87332) product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene cspC CDS 88116..89144 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(89670..90389) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(91051..91767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 note possible pseudo, frameshifted CDS complement(91745..92452) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(92669..93412) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(93560..94540) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(95204..96046) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(96170..96529) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(97129..97263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(97693..97872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 tRNA complement(98148..98231) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(98312..98394) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(98406..98481) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(98509..98583) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(98595..98666) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(98696..98786) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(98791..98865) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(98988..99440) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(99667..101826) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(101933..102532) product phosphoserine phosphatase RsbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene rsbX CDS complement(102532..103320) product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene sigB CDS complement(103286..103768) product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene rsbW CDS complement(103765..104094) product anti-sigma factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rsbV CDS complement(104156..105163) product phosphoserine phosphatase RsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rsbU CDS complement(105175..105576) product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene rsbT CDS complement(105580..105945) product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene rsbS CDS complement(105950..106774) product RsbT co-antagonist protein RsbRA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rsbRA CDS complement(106892..107242) product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene ndoA CDS complement(107247..107528) product type II toxin-antitoxin system antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene endB CDS complement(107644..108813) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene alr CDS complement(108928..109935) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(110109..110474) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene acpS CDS 110569..111168 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(111165..112646) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(112636..113115) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(113287..114771) product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene cshA CDS complement(115175..116548) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(116623..117708) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 117862..118182 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(118197..119069) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 119316..119480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 119467..119613 product Fur-regulated basic protein FbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene fbpB CDS complement(119637..120782) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(120912..121247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(121342..122109) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(122102..123028) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(123120..124358) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(124611..125663) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(125813..127078) product C4-dicarboxylate transporter DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene dctP CDS complement(127198..127878) product two-component system response regulator DctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene dctR CDS complement(127868..129475) product two-component system sensor histidine kinase DctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene dctS CDS 129545..130597 product C4-dicarboxylate TRAP transporter substrate-binding protein DctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234350.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene dctB CDS 130683..131504 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(131541..131900) product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(131894..132142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 note possible pseudo, internal stop codon, frameshifted CDS complement(132364..132735) product glucose starvation-inducible protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene gsiB CDS complement(132862..133680) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 133798..134250 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 134328..134585 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 134816..136090 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 136194..136460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(136691..138415) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(138482..138931) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene mutT CDS complement(138989..140812) product potassium transporter KimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene kimA CDS complement(141299..143395) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(143401..144663) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(144656..146386) product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(146376..147212) product cyclic-di-GMP receptor EpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene epsK CDS complement(147193..148281) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(148484..150670) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(150735..151169) product transcriptional regulator LrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene lrpC CDS 151355..151645 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(151690..152499) product lipid II flippase Amj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene amj CDS complement(153005..153427) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(153505..154056) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(154145..154648) product D-lyxose ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234400.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene lyxE CDS complement(154663..155523) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 155674..156270 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(156288..157799) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(158011..160095) product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene mtlR CDS complement(160284..161186) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(161287..163293) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene pbpC CDS 163445..163732 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(163738..163983) product YczI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003240256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(164157..164798) product spore germination lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene lipC CDS complement(164862..165614) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(165630..166643) product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene pxpC CDS complement(166640..167362) product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene pxpB CDS complement(167408..168199) product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(168205..169419) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(169434..170207) product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene pxpA CDS complement(170412..171161) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 171294..171458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(171493..171885) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 171970..172578 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(172664..173089) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene lepB CDS complement(173100..173342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(173361..174419) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(174516..175637) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(175639..176070) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(176095..177531) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(177704..178057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 178222..178794 product copper uptake transcriptional regulator YcnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene ycnK CDS 178826..180454 product copper transporter YcnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ycnJ CDS 180468..181088 product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(181131..181916) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene gdh CDS complement(181935..182798) product glucose uptake protein GlcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene glcU CDS complement(182924..184312) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene gabD CDS complement(184381..185691) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene gabT CDS 185797..187236 product transcriptional regulator GabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246571.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene gabR CDS complement(187238..187552) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 187693..187980 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 187997..188746 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene nfsA CDS 188909..189787 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246592.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 189807..191231 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(191278..192234) product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene yclQ CDS complement(192256..193014) product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene yclP CDS complement(193008..193955) product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene yclO CDS complement(193948..194898) product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene yclN CDS 195283..196647 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(197002..197124) product phosphatase RapC inhibitor PhrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene phrC CDS complement(197108..198256) product response regulator aspartate phosphatase RapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246686.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene rapC CDS complement(198418..199839) product two-component system sensor histidine kinase YclK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene yclK CDS complement(199826..200509) product two-component system response regulator YclJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246532.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene yclJ CDS 200722..202176 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 202192..202872 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234507.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(202975..204099) product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene gerKB CDS complement(204124..205347) product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene gerKC CDS complement(205337..206971) product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene gerKA CDS 207097..207318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(207334..209088) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 209368..210846 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(210884..211729) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(211797..212243) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(212258..212485) product phenolic acid decarboxylase subunit BsdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene bsdD CDS complement(212502..213923) product phenolic acid decarboxylase BsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene bsdC CDS complement(213926..214504) product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966530.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 214630..215502 product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene bsdA CDS 215618..216424 product cystine ABC transporter substrate-binding lipoprotein TcyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene tcyA CDS 216411..217115 product cystine ABC transporter permease TcyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene tcyB CDS 217129..217872 product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene tcyC CDS 217994..218641 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 218746..219420 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(219415..220749) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 220870..221808 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(222434..223660) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(223759..224364) product surfactin biosynthesis thioesterase SrfAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene srfAD CDS complement(224515..228342) product surfactin non-ribosomal peptide synthetase SrfAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene srfAC CDS complement(228379..239130) product surfactin non-ribosomal peptide synthetase SrfAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene srfAB CDS complement(239143..249906) product surfactin non-ribosomal peptide synthetase SrfAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene srfAA CDS complement(250484..250846) product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene hxlR CDS 251077..251709 product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene hxlA CDS 251714..252271 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene hxlB CDS 252387..254108 product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene tlpC CDS 254294..254731 product DNA-entry nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene nucA CDS 254754..255152 product DNA-entry nuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene nin CDS complement(255189..256622) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene bglC CDS complement(256695..257423) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(257443..257784) product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(257772..258194) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(258329..258661) product YckD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(258744..259199) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(259196..259366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 259614..260477 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 260487..261167 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(261216..262409) product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene zinU CDS complement(262446..263618) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(263702..263902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(263931..264845) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene folE2 CDS complement(264961..266166) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 266347..268671 product assimilatory nitrate reductase electron transfer subunit NasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene nasB CDS 268668..270800 product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene nasC CDS 270921..273338 product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene nasD CDS 273371..273691 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene nirD CDS 273757..275202 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene cobA CDS complement(275233..276243) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene ffoR CDS 276406..277260 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 277360..278244 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 278249..279106 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(279143..280378) product proline utilization transcriptional regulator PutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene putR CDS complement(280531..281946) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene putP CDS complement(282077..283624) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene pruA CDS complement(283641..284558) product proline dehydrogenase PutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene putB CDS complement(284740..285522) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(285606..286562) product cephalosporin C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene cah CDS complement(286634..287608) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 287725..288486 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(288516..289076) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 289383..289976 product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene tmrB CDS complement(290250..291068) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene nadE CDS complement(291201..291797) product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 291921..293267 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(293269..294030) product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(294100..294729) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(294804..295268) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 295381..296922 product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene bmr3 CDS complement(296962..298587) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(298619..299584) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(299758..301737) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene amyE CDS complement(301990..302478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 note possible pseudo, internal stop codon CDS complement(302594..304027) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 304177..305328 product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(305366..306247) product glycine/proline betaine ABC transporter substrate-binding protein OpuAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene opuAC CDS complement(306247..307095) product glycine/proline betaine ABC transporter permease subunit OpuAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene opuAB CDS complement(307097..308350) product glycine/proline betaine ABC transporter ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene opuAA CDS 308638..308877 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(309151..310353) product niacin permease NiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene niaP CDS complement(310476..311567) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(311583..313196) product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(313280..314053) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(314105..314683) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(314718..315299) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(315321..315920) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 316257..317198 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(317236..318078) product zinc ABC transporter permease ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246340.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene znuB CDS complement(318036..318731) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene znuC CDS complement(318786..319754) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(319937..321628) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(321653..322429) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246415.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(322539..323660) product response regulator aspartate phosphatase RapJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246478.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rapJ CDS 323781..324284 product peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene cwlK sequence022 source 1..220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence023 source 1..331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence024 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 note possible pseudo, internal stop codon sequence025 source 1..278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence026 source 1..344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence027 source 1..393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence028 source 1..234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence029 source 1..478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 sequence030 source 1..252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence031 source 1..243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence032 source 1..122695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 161..271 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 409..546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 506..916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 1188..2624 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 2732..3691 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(3708..4457) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(4454..5464) product iron ABC transporter permease FeuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene feuC CDS complement(5457..6461) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(6480..7433) product iron ABC transporter substrate-binding protein FeuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene feuA CDS complement(7524..9113) product bacillibactin transport transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene btr CDS complement(9304..10548) product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(10562..12490) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene nagZ CDS complement(12518..13843) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene amiE CDS complement(13899..15266) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(15292..16143) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(16157..17074) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246253.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene murQ CDS complement(17184..17666) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(17679..18134) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 tRNA 18315..18389 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 18393..18468 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 18473..18546 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 18567..18651 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 18658..18732 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 18959..19522 product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene sigW CDS 19536..20162 product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene rsiW CDS 20329..21150 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene cdaA CDS 21143..22597 product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene cdaR CDS 22616..23962 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene glmM CDS 24394..26196 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene glmS CDS 26971..28488 product NADH dehydrogenase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 28500..31121 product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 31194..31712 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 31793..32083 product DUF6407 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 32139..32513 product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 33202..34179 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 34181..34852 product two-component system response regulator YbdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234895.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene ybdJ CDS 34930..35841 product two-component system sensor histidine kinase YbdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene ybdK CDS complement(36067..36957) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 37112..38413 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene thrC CDS 38534..39676 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 40648..40884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 40920..41423 product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene comD CDS 41435..41995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 41992..43005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 43002..43892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 43915..45003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 45039..45437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 45479..46618 product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 46611..46868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 46884..47531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 47548..48789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 48899..49066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(49109..49879) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(50003..50857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 50993..52177 product DUF4885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 52494..53882 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 53995..54243 product sigma-G-dependent sporulation-specific acid-soluble spore protein CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene csgA CDS 54258..54449 product DUF5370 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(54479..55282) product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene blaOXA CDS 55456..56709 product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene cypC CDS complement(56750..57010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 57383..59011 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(59037..59927) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(60026..61360) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene glpT CDS 61649..61903 product YbeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 61995..62912 product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 62864..64162 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(64195..64620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010331443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(64682..65593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(65754..66680) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(66677..67504) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 67735..68889 product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene purT CDS 69031..69969 product extracellular metalloprotease Mpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene mpr CDS 69932..70330 product YbfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 70503..71387 product enantioselective carboxylesterase CesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene cesB CDS 71586..72119 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene pssA CDS 72110..72598 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 72591..73400 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 73437..73715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 73819..75159 product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 75412..76380 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(76416..77660) product glutamate-aspartate/proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene gltP CDS complement(77803..78843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 note possible pseudo, frameshifted CDS complement(78867..79697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 note possible pseudo, frameshifted CDS complement(79718..80467) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene nagB CDS 80686..81393 product transcriptional regulator GamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene gamR CDS 81428..81703 product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 81784..82986 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(83022..84368) product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene mmuP CDS complement(84555..85502) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene mmuM CDS complement(85627..87063) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(87085..88068) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 88312..89601 product two-component system sensor histidine kinase GlnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene glnK CDS 89612..90556 product glutamine utilization two-component system response regulator GlnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene glnL CDS 90623..90769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 90785..91711 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246372.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene kdgD CDS 91741..93207 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 93292..94659 product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene gudP CDS 94696..96063 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene gudD CDS 96133..96834 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 96927..98459 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene garD CDS 98736..99656 product macrolide 2'-phosphotransferase MphK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene mphK CDS 100449..101129 product two-component system response regulator YcbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene ycbL CDS 101131..102066 product two-component system sensor histidine kinase YcbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene ycbM CDS 102161..103084 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 103100..103789 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(103843..104229) product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 104344..105579 product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 105662..106090 product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene cwlJ CDS 106196..106927 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 107202..108953 product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene phoD CDS 108967..109179 product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene tatAD CDS 109241..109966 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene tatC CDS complement(109963..110610) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene pcp CDS 110690..111802 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(111845..113278) product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene lmr(B) CDS complement(113328..113894) product transcriptional regulator LmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene lmrA CDS 114688..115326 product lipase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene lipA CDS complement(115364..115747) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 115982..117058 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(117098..117310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 117325..117576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 117712..118644 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(118684..119748) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 120095..121492 product DUF4901 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 121678..122583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 sequence033 source 1..230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence034 source 1..252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence035 source 1..388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 sequence036 source 1..300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence037 source 1..303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence038 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 28..162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 sequence039 source 1..335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence040 source 1..336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence041 source 1..300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence042 source 1..283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence043 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence044 source 1..344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence045 source 1..247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence046 source 1..316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence047 source 1..371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence048 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence049 source 1..312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence050 source 1..356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence051 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(98..208) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence052 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence053 source 1..343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 258..339 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence054 source 1..137225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..1128) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene ftsY CDS complement(1148..4708) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene smc CDS complement(4810..5559) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rncS CDS complement(5699..5932) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene acpP CDS complement(6016..6756) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene fabG CDS complement(6749..7702) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene fabD CDS complement(7721..8722) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene plsX CDS complement(8736..9302) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene fapR CDS complement(9411..11459) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene recG CDS complement(11437..12339) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene sdaAA CDS complement(12363..13025) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene sdaAB CDS complement(13164..14825) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(14841..15203) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 15482..15670 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rpmB CDS complement(15743..15892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(15894..16538) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(16608..17261) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rpe CDS complement(17266..18162) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rsgA CDS complement(18177..20123) product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene prkC CDS complement(20117..20881) product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene prpC CDS complement(20888..21979) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rlmN CDS complement(21982..23325) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rsmB CDS complement(23312..24265) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene fmt CDS complement(24270..24752) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene def CDS complement(24779..27196) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene priA CDS complement(27193..28413) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene coaBC CDS complement(28495..28698) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rpoZ CDS complement(28702..29340) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene gmk CDS complement(29324..29593) product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene remA CDS complement(29670..30545) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(30628..33300) product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 33422..35134 product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rqcH CDS complement(35172..35660) product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene sirC CDS complement(35641..36426) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene sirB CDS complement(36429..37202) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene cobA CDS complement(37301..37894) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene cysC CDS complement(37907..39055) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene sat CDS complement(39104..40168) product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene cysP CDS complement(40180..40881) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(41293..41925) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene pyrE CDS complement(41922..42641) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene pyrF CDS complement(42610..43545) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(43545..44315) product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene pyrK CDS complement(44312..47527) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene carB CDS complement(47512..48606) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(48603..49889) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(49873..50787) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(50932..52239) product uracil permease PyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene pyrP CDS complement(52414..52959) product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene pyrR CDS complement(53141..54052) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(54054..54518) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene lspA CDS complement(54621..54995) product sporulation-related RNA polymerase-binding protein YlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene ylyA CDS complement(55141..57906) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene ileS CDS complement(58248..58742) product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene divIVA CDS complement(58836..59609) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(59670..59942) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(59949..60368) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene sepF CDS complement(60400..61092) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(61099..61935) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene pgeF CDS complement(62097..62342) product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(62425..63705) product N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene ylmB CDS complement(63908..64702) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(64856..65638) product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene sigG CDS complement(65778..66497) product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene sigE CDS complement(66560..67513) product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene spoIIGA CDS complement(67681..71982) product bacillopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(72282..73430) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene ftsZ CDS complement(73466..74788) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene ftsA CDS complement(74963..75328) product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(75346..76053) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(76076..76771) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(76768..77559) product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene divIB CDS complement(77690..78601) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene murB CDS complement(78633..79724) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene murG CDS complement(79844..80944) product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene spoVE CDS complement(81005..82360) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene murD CDS complement(82361..83335) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene mraY CDS complement(83447..84931) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(85108..87048) product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(87182..89302) product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene pbpB CDS complement(89329..89682) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene ftsL CDS complement(89721..90656) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene rsmH CDS complement(90726..91172) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene mraZ CDS complement(91283..92902) product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene bshC CDS complement(92973..93869) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 94029..94511 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(94568..95149) product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene gerR CDS complement(95295..95474) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene rpmF CDS complement(95496..96014) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 96224..97471 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(97488..98513) product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene ddcP CDS complement(98515..99297) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 99478..100704 product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene spoVV CDS complement(100715..101200) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene coaD CDS complement(101205..101759) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene rsmD CDS complement(102079..102351) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(102406..102855) product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene ricF CDS complement(102975..103214) product YlbE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(103229..103627) product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(103886..104926) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(105011..105457) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 105600..105959 product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(105991..106884) product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene ctaG CDS complement(106911..107243) product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene ctaF CDS complement(107246..107869) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene ctaE CDS complement(107869..109737) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene ctaD CDS complement(109770..110840) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene coxB CDS complement(111081..111998) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene cyoE CDS 112353..113273 product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene ctaA CDS complement(113714..117160) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene pyc CDS complement(117235..118446) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene ftsW CDS complement(118646..118927) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(119025..119954) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene glsA CDS 120057..120542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(120545..121873) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 122029..122658 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 122744..122950 product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(123009..123326) product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(123382..125220) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene typA CDS 125333..125521 product YlaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 125795..126406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(126446..126739) product anti-SigP sigma factor SigQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene sigQ CDS complement(126736..127257) product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene ylaC CDS complement(127257..127526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(127516..129453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 129741..131306 product neutral metalloprotease NprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene nprE CDS 131738..132652 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245561.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(132729..133157) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(133183..133980) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene suhB CDS complement(134118..134306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 134546..135184 product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(135217..135483) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 135668..137140 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene speA sequence055 source 1..351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 120..192 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 sequence056 source 1..606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence057 source 1..205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence058 source 1..219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence059 source 1..263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence060 source 1..257311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(574..783) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234008.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(866..1681) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(1695..2684) product DUF4003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(2783..4324) product outer spore coat copper-dependent laccase CotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene cotA CDS complement(4476..5885) product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene gabP CDS 6299..7171 product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene mneS CDS 7323..8285 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 8297..9481 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 9497..11716 product DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 11871..13421 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene guaA CDS 13802..15124 product hypoxanthine/guanine permease PbuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene pbuG CDS 15335..16138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 16297..16464 product Fur-regulated basic protein FbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 16679..17233 product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 17233..17430 product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 17752..18240 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene purE CDS 18224..19375 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene purK CDS 19372..20667 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene purB CDS 20742..21467 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 21460..21714 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene purS CDS 21711..22394 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene purQ CDS 22378..24606 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene purL CDS 24582..26012 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene purF CDS 26113..27153 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene purM CDS 27150..27737 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene purN CDS 27734..29272 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene purH CDS 29288..30556 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene purD CDS complement(30596..31018) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 31165..32436 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(32451..32684) product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 32814..34556 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 34583..35578 product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 35581..35895 product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(35933..37510) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 37756..38442 product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 38504..40723 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene pcrA CDS 40747..42753 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene ligA CDS 42769..43959 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 43919..44140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 44143..45144 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(45181..45873) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(45985..47463) product proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene opuE CDS 47878..48168 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene gatC CDS 48184..49641 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene gatA CDS 49655..51085 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene gatB CDS complement(51120..51965) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 52097..55255 product surfactin resistance protein SrfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene srfP CDS 55408..56319 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 56376..57755 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene rlmD CDS 58534..58656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 58746..60758 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 60755..62056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 62063..65053 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 65144..65788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(65870..66325) product TIGR01741 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(66339..66824) product TIGR01741 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(66829..68838) product LXG family T7SS effector deoxyribonuclease toxin YeeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene yeeF CDS 68942..70039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 70183..71325 product response regulator aspartate phosphatase RapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene rapH CDS 71315..71491 product phosphatase RapH inhibitor PhrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene phrH CDS 71651..72370 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 72506..72961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 73063..73647 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 73725..74168 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 74165..75013 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(75072..76055) product gamma-resorcylate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene tsdA CDS 76305..76934 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 77008..77256 product spore coat-associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene cotJA CDS 77240..77503 product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene cotJB CDS 77518..78087 product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene cotJC CDS 78212..78754 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 78917..79081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 note possible pseudo, internal stop codon, frameshifted CDS 79202..79825 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 79993..81555 product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene yesM CDS 81555..82661 product two-component system response regulator YesN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244566.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene yesN CDS 82765..84048 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 84069..84974 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 84978..85868 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 85884..86918 product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene yesR CDS 86941..89226 product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene yesS CDS 89243..89938 product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene rhgT CDS 89931..90593 product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 90590..91216 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 91355..93199 product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene rhgW CDS 93276..95084 product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rhgX CDS 95247..95900 product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 95906..97900 product beta-galactosidase YesZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene yesZ CDS 97945..100518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 100608..102149 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 102204..103160 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 103174..104061 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 104070..105413 product alpha-galacturonidase LplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene lplD CDS 105489..106184 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(106221..106544) product heme-degrading oxygenase HmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene hmoA CDS complement(106644..107006) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(107101..107745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 107942..108814 product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rsbRD CDS 108971..109138 product YezD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 109246..109890 product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(110009..110512) product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene yetL CDS 110671..111780 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(111815..112885) product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 113035..116220 product bifunctional P-450/NADPH--P450 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene cypD CDS 116629..118572 product lipoteichoic acid synthase LtaS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene ltaS1 CDS 118809..119573 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 119646..120548 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 120566..121483 product putative nucleotide-diphospho-sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 121511..122674 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 122689..123624 product putative nucleotide-diphospho-sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(123656..124885) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(124997..125704) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(125796..127181) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 127430..128887 product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene yfmT CDS 128907..129761 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 129895..131784 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 131908..132354 product YfmQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 132478..132900 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 132965..134155 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 134483..134677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(134757..136313) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 136261..136476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 136488..137618 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 137688..138134 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(138187..139206) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(139314..140111) product Fe(3+)-citrate ABC transporter ATP-binding protein YfmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene yfmF CDS complement(140124..141125) product Fe(3+)-citrate ABC transporter permease YfmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene yfmE CDS complement(141122..142123) product Fe(3+) dicitrate ABC transporter permease FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene fecD CDS complement(142196..143143) product Fe(3+)-citrate ABC transporter substrate-binding protein YfmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene yfmC CDS complement(143253..143621) product YfmB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 143865..144212 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 144407..145669 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 145797..147230 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 147413..148999 product two-component sensor histidine kinase CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene yflR CDS 149013..149693 product two-component response regulator CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene citT CDS 149696..150655 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 150847..152148 product citrate transporter CitM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene citM CDS 152204..152998 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 153118..154209 product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene nosA CDS complement(154200..154475) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 154540..155205 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(155253..155384) product YflJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(155557..155712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(155822..156136) product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(156217..156966) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene map CDS 157137..158495 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene nagE CDS complement(158529..160478) product lipoteichoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233694.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ltaS CDS 160736..161128 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 161256..162671 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(162668..163744) product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(163768..163968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(163984..165138) product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(165119..166660) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 166856..168268 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene treP CDS 168340..170028 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene treC CDS 170049..170765 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene treR CDS 170904..171569 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(171607..175986) product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886443.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 176230..176748 product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene yfkM CDS complement(176786..177985) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(178201..178416) product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 178620..179090 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene yfkJ CDS 179108..179428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 179452..180279 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(180478..181653) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 181820..182875 product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene cax CDS 182949..183740 product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(183779..184615) product mechanosensitive ion channel protein MscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene mscC CDS complement(184622..185743) product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene yfkAB CDS 185889..186074 product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 186176..186967 product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene pdaA CDS complement(187005..187865) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243106.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(187966..188925) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene corA CDS 189042..189905 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(189938..190936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 191126..192526 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rlmD CDS 192871..193875 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 194148..194699 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 194867..195319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 195349..196038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 196267..197268 product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene acoA CDS 197270..198298 product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene acoB CDS 198312..199508 product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene acoC CDS 199528..200904 product acetoin dehydrogenase complex dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene acoL CDS 201022..202839 product acetoin dehydrogenase operon transcriptional activator AcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene acoR CDS 202892..203071 product small acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(203107..203433) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(203486..204043) product DUF5381 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(204067..204834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(204846..206069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(206075..206389) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 206725..208074 product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene glvA CDS 208139..208903 product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene glvR CDS 208918..210501 product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene malP CDS 210607..212325 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 212319..214133 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 214287..214691 product DoxX family oxidoreductase CatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene catD CDS 214709..215566 product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene catE CDS 215670..216887 product two-component system sensor histidine kinase LnrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene lnrJ CDS 216884..217546 product two-component system response regulator LnrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene lnrK CDS 217690..218625 product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene lnrL CDS 218638..219828 product linearmycin resistance permease LnrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene lnrM CDS 219843..221000 product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene lnrN CDS complement(221036..221635) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(221684..222232) product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene padR CDS 222506..223138 product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene estB CDS 223357..224445 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 224579..225115 product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene bstA CDS complement(225112..226668) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(226780..227262) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 227435..230005 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene mprF CDS complement(230023..231000) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 231131..232132 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 232129..233160 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 233274..233648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 233620..234081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 234168..234752 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(234791..234982) product YfhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(235214..236125) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244332.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 236214..237005 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene recX CDS 237014..237334 product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 237472..238665 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(238699..238851) product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 238976..239245 product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 239389..239907 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 239993..240325 product SdpC immunity protein SpdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene spdL CDS 240312..241172 product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene ephM CDS 241397..242386 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 242459..245041 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(245038..246021) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 246238..247347 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene mutY CDS complement(247354..247578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 247660..248412 product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene fabL CDS 248481..248738 product gamma type acid-soluble spore protein SspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene sspE CDS 248912..249172 product YgaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 249316..249846 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 249933..251675 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(251751..252860) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233537.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(253031..254320) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 254473..254946 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene bcp CDS 255079..255516 product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene perR CDS complement(255551..255904) product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 256113..256997 product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 sequence061 source 1..83068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(509..1702) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(1739..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(2355..3602) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(3608..3826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(3839..5548) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(5548..6081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(6153..6494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(6944..7699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(7762..8100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(8294..8989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(9279..9821) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(9821..10270) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(10510..11205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(11220..11726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(11779..12675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(12688..12936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(12933..13160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(13157..13474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(13517..13714) product phage-like element PBSX protein XtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene xtrA CDS complement(13792..13947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(13960..14100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(14069..14239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(14208..14756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(14753..14911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(14908..15057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(15072..15959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(15886..16758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(16751..16969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(16984..17313) product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286573.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(17448..17651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 17817..18215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(18505..18633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(18652..19752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 20007..21116 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 tRNA complement(21275..21347) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(21400..21945) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(22261..22491) product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 22676..24439 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene ggt CDS complement(24602..24781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 24814..25023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 note possible pseudo, frameshifted CDS 25020..25529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 note possible pseudo, frameshifted CDS complement(25582..27063) product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene gltD CDS complement(27080..31642) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene gltB CDS 31788..32690 product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene gltC CDS complement(32744..33859) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene proB CDS complement(33856..34671) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene proC CDS complement(34895..35263) product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene rtp CDS 35568..36785 product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene yjiB CDS complement(36817..37533) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 37692..37997 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 38067..38825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 38882..39415 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(39603..40595) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(40589..41335) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(41345..42061) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(42709..43953) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(44048..45511) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(45529..46530) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 46889..48931 product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 49040..49333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(49425..49640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 50415..50537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 50594..50887 product YozQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(51028..52632) product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 53029..54480 product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene hpaB CDS complement(54545..55243) product expansin ExlX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231419.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene exlX CDS complement(55506..56183) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 56355..57392 product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(57711..58340) product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 note possible pseudo, internal stop codon, frameshifted CDS complement(58526..58840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 note possible pseudo, frameshifted CDS complement(59100..59816) product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 60073..60759 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(60948..61139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(61136..61438) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(61674..62159) product YdhH/YoaO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 62372..62494 product phosphatase RapK inhibitor PhrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene phrK CDS 62729..63091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(63180..63374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(63519..64013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(64062..64973) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 65345..65827 product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 65838..66062 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 66186..66983 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(67069..67956) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 68057..68935 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(69290..69454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(69539..70003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(70088..70234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(71831..72463) product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 72811..73725 product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene bla CDS complement(73770..73976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, frameshifted CDS complement(74478..75098) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 75633..76136 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(76526..77038) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 77327..77527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 note possible pseudo, frameshifted CDS complement(77777..77977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(78138..78302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 note possible pseudo, frameshifted CDS 78686..80059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 80056..81162 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 81149..81856 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 82003..82521 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 sequence062 source 1..263500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..1419) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1463..2140) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(2185..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 2496..2828 product biofilm formation protein MstX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene mstX CDS 2825..3811 product potassium channel protein KbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene kbfO CDS complement(3808..4212) product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(4273..4638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(4703..6055) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(6167..7339) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(7442..8605) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 8836..9072 product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(9117..9509) product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene yugI CDS complement(9711..10871) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(10872..11372) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 11522..12343 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(12370..12630) product YugE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 12717..13880 product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene patB CDS 14006..15292 product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene kinB CDS 15338..15724 product kinase-associated lipoprotein KapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene kapB CDS complement(15751..16368) product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene kapD CDS complement(16444..16647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 16700..17758 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228842.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 17851..19725 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 19746..20159 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(20177..20734) product YufK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 20912..22513 product two-component system sensor histidine kinase MaeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene maeL CDS 22506..23213 product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene maeM CDS 23643..24989 product sodium/malate symporter MaeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene maeN CDS complement(25026..25241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 25471..27876 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 27869..28300 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 28300..28641 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 28634..30115 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 30121..30597 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 30597..30881 product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 30865..31239 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene mnhG CDS complement(31278..31658) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(31674..32318) product two-component system response regulator ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene comA CDS complement(32399..34723) product two-component system sensor histidine kinase ComP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene comP CDS complement(34731..34895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(34908..35768) product ComX modifying isoprenyl transferase ComQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene comQ CDS complement(35954..36094) product degradation enzyme regulation protein DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene degQ CDS 36557..36925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(36901..38130) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene pdeH CDS complement(38265..39737) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(39753..40304) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(40401..40799) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242987.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(40871..41119) product YueH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(41192..41413) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(41473..42582) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 42697..43086 product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(43127..43363) product YuzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(43549..44079) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(44276..45007) product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(45074..45529) product type VII secretion protein EssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene essA CDS complement(45561..48794) product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene esaA CDS complement(48791..53278) product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene essC CDS complement(53339..54670) product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene essB CDS complement(54685..54924) product ESX secretion system protein YukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene yukD CDS complement(54995..55288) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 55863..57086 product sporulation transcriptional activator AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene adeR CDS 57188..58324 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene ald CDS 58437..59114 product YukJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(59157..59366) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(59381..66520) product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene dhbF CDS complement(66540..67475) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(67508..69127) product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(69156..70355) product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene dhbC CDS complement(70381..71166) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(71368..72246) product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene besA CDS complement(72448..73044) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 73147..73749 product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(73817..75145) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(75290..76792) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 76950..77426 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(77455..78111) product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene spsC CDS complement(78215..78535) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(78904..80124) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 80456..81454 product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene yumC CDS complement(81494..81634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 81912..82892 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene guaC CDS complement(82966..83187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(83204..83731) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(83728..84432) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 84705..84851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(86163..86498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(86563..87135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(88209..88355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 note possible pseudo, internal stop codon, frameshifted CDS complement(88569..89087) product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene paiA CDS complement(89164..89337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(89639..90001) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(90080..90934) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene dapF CDS complement(91057..92271) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(92410..92646) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222913.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 92909..93976 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(94163..94489) product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 94686..94922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(94964..96937) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(97046..97975) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene thrB CDS complement(97972..99039) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene thrC CDS complement(99030..100331) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(100499..101524) product spore coat-associated protein CotNH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene cotNH CDS 101680..102180 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(102206..102976) product 5' nucleotidase NucF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene nucF CDS complement(103005..103439) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(103463..103738) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 103852..104487 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(104503..105399) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene lipA CDS 105634..106614 product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene lytH CDS complement(106642..107409) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene yunB CDS complement(107481..107786) product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(107852..109240) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(109260..110081) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(110099..110953) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(110985..111332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242865.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(111429..112772) product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 112947..114542 product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene pucR CDS 114686..116038 product uric acid permease PucJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene pucJ CDS 116044..117336 product uric acid permease PucK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene pucK CDS 117349..118833 product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242600.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene pucL CDS 118833..119177 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene uraH CDS 119416..119970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(120712..121248) product xanthine dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene pucE CDS complement(121239..123476) product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene pucD CDS complement(123477..124310) product xanthine dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene pucC CDS complement(124307..124924) product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene pucB CDS complement(124921..125913) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 126016..126213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(126143..127393) product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene pucG CDS complement(127410..128648) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene allC CDS 128846..129328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 note possible pseudo, internal stop codon CDS 129377..129907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 note possible pseudo, internal stop codon CDS 129989..130855 product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(130888..131991) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene ugpC CDS 132172..132900 product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene frlR CDS complement(132925..133779) product fructosamine kinase FrlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene frlD CDS complement(133793..134695) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(134699..135577) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(135635..136903) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(136984..137970) product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene frlB CDS complement(138185..138418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(138655..139779) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 139938..140087 product acid-soluble spore protein SspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene sspG CDS 140087..140359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(140513..140896) product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene glxB CDS complement(141005..141283) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(141707..143104) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene sufB CDS complement(143125..143568) product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene sufU CDS complement(143558..144778) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene sufS CDS complement(144778..146091) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene sufD CDS complement(146109..146894) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene sufC CDS complement(147087..147224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(147417..147779) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(147880..148704) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene metQ CDS complement(148718..149386) product methionine ABC transporter permease MetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene metP CDS complement(149379..150404) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene metN CDS complement(150731..151075) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(151183..151503) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228585.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(151505..151873) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(151945..152181) product YusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(152237..152620) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene gcvH CDS complement(152687..153043) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(153152..154936) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene fadE CDS complement(154951..156126) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(156137..158506) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 158681..158827 product YuzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(158852..159760) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 159855..160100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 160113..160445 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 160604..161074 product MarR family transcriptional regulator MdtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene mdtR CDS 161076..162692 product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene mdtP CDS complement(162729..163112) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(163131..163871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 164007..164894 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(164915..165202) product YusU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(165229..166050) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(166274..166711) product YusW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(166860..168668) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 168802..169656 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 169733..170194 product metalloregulation DNA-binding stress protein MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene mrgA CDS complement(170236..171612) product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene htrB CDS 171890..172567 product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene cssR CDS 172564..173919 product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene cssS CDS complement(173948..174112) product anti-adapter protein SpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene spxO CDS 174281..175156 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(175196..176584) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene fumC CDS complement(176651..176836) product YvzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244599.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 176953..178401 product spore germination receptor protein GerAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene gerAA CDS 178370..179467 product spore germination receptor protein GerAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene gerAB CDS 179464..180585 product spore germination receptor protein GerAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene gerAC CDS complement(180593..181228) product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene liaR CDS complement(181206..182288) product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene liaS CDS complement(182285..183010) product LiaRS two-component regulatory system accessory protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene liaF CDS complement(183044..183916) product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(184017..184697) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(184724..185104) product cell envelope stress-induced membrane anchor protein LiaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene liaI CDS complement(185266..186534) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(186710..187291) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(187313..188647) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(188644..189705) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(189668..190621) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 191021..191812 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(191850..192728) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(192797..194539) product two-component system sensor histidine kinase YvrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene yvrG CDS complement(194536..195249) product two-component system response regulator YvrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene yvrH CDS complement(195403..195639) product sigma-O factor regulator RsoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rsoA CDS complement(195636..196172) product RNA polymerase sigma factor SigO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene sigO CDS 196376..196531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 196651..197808 product oxalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene oxdC CDS complement(198313..199542) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(199535..200224) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(200208..201401) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(201573..202382) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(202398..203408) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(203408..204454) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 204659..205606 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 205664..205933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(205971..207380) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(207780..207920) product small acid-soluble spore protein SspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene sspJ CDS 208089..208571 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 208671..210524 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(210551..211480) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243439.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 211587..212369 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene modA CDS 212401..213033 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene modB CDS complement(213063..213893) product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene pgoN CDS 214116..214601 product stress response protein YvgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene yvgO CDS complement(214646..216658) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(216913..218628) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene cysI CDS complement(218654..220471) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(220642..222966) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene helD CDS complement(223159..223767) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(223953..224369) product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(224374..225042) product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene bdbD CDS complement(225163..227271) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(227431..229842) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene copA CDS complement(229926..230135) product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene copZ CDS complement(230210..230515) product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene csoR CDS 230641..231717 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene iolW CDS complement(231755..232390) product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene azoRB CDS complement(232550..234448) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(234554..235210) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002040907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(235218..236165) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(236286..237080) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 237532..237948 product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene arr CDS 238638..238838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 tmRNA complement(239411..239770) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(239946..240416) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene smpB CDS complement(240561..242900) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene rnr CDS complement(242919..243659) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(243791..244021) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene secG CDS 244172..244942 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(244983..245216) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 245368..245775 product transcriptional repressor RghR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene rghR CDS 245804..246223 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 246314..246640 product catDE operon transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene catR CDS complement(246850..248229) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(248220..248882) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(248900..249460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(249672..250427) product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(250424..251140) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(251154..251651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(252237..252407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(252482..253807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(253780..255624) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(255615..258707) product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(258926..259597) product choline ABC transporter permease OpuBD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene opuBD CDS complement(259614..260534) product choline ABC transporter substrate-binding lipoprotein OpuBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene opuBC CDS complement(260546..261199) product choline ABC transporter permease OpuBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene opuBB CDS complement(261214..262359) product choline ABC transporter ATP-binding protein OpuBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene opuBA CDS 262644..263177 product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 sequence063 source 1..38302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..1797 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1916..2314 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 2328..3359 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 3384..3638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244393.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(3651..4388) product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 4545..6533 product methyl-accepting chemotaxis protein McpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene mcpB CDS 6712..8697 product methyl-accepting chemotaxis protein TlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene tlpA CDS 8826..10811 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene mcpA CDS 10924..12912 product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene tlpB CDS 13049..15118 product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 15178..15954 product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene rhaR CDS 15959..17419 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene rhaB CDS 17434..17748 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rhaM CDS 17773..19047 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rhaA CDS complement(19089..20075) product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene iolU CDS 20256..21422 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 21514..22344 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 tRNA 22449..22521 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(22629..23114) product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene cdoA CDS 23575..25110 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243120.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 25270..26118 product exo-glucosaminidase LytG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene lytG CDS 26228..26491 product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(26527..27864) product Ktr system potassium transporter KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ktrB CDS complement(27871..28539) product potassium uptake protein KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene ktrA CDS complement(28907..29452) product biofilm-surface layer protein BslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene bslA CDS complement(29659..30201) product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene gbsR CDS 30396..31868 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene betB CDS 31884..33092 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene gbsB CDS 33180..33761 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(33767..34255) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 34425..34949 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 34970..36499 product flotillin lipid rafts scaffold protein FloT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene floT CDS 36524..37045 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(37087..37665) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene thiT sequence064 source 1..29788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 44..120 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 182..258 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 439..1416 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene thiL CDS 1431..1907 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene tsaE CDS 1888..2577 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene tsaB CDS 2587..3042 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rimI CDS 3035..4075 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene tsaD CDS complement(4303..6231) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 6357..6869 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene moaC CDS 6866..7513 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 7535..7708 product sec-independent protein translocase protein TatAY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene tatAY CDS 7724..8479 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene tatC CDS complement(8517..8708) product YdiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(8705..9439) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 9677..9961 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene groES CDS 10008..11633 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene groL CDS 12376..13371 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(13460..15949) product glucitol operon transcriptional regulator GutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene gutR CDS 16152..17213 product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene gutB CDS 17287..18678 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 18773..19735 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 19934..20617 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 20683..21708 product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 21708..22475 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242723.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 22505..23476 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(23524..24537) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 25151..26572 product myo-inositol transporter IolT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene iolT CDS complement(26621..27661) product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene bdhA CDS 28108..28476 product cell wall metabolism protein WalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene walM CDS 28542..29585 product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243172.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 sequence065 source 1..552974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 218..328 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 341..415 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 421..512 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 547..618 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 628..703 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 711..787 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 852..928 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 941..1016 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 1022..1095 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 1117..1201 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 1207..1280 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 1305..1380 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 1389..1463 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 1510..1584 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 1590..1660 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 1668..1756 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 1989..2072 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(2122..2898) product sporulation control protein Spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene spo0M CDS 3044..3241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(3306..3545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 3714..4367 product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 4673..6448 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene thiC CDS 6580..6759 product transcriptional regulator SenS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene senS CDS complement(6803..8254) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene katA CDS 8665..9432 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 9450..10448 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 10448..11275 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 11298..12434 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene ssuD CDS 12561..13067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 13182..13451 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene rpsN CDS complement(13469..13942) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(13944..14147) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 tRNA 14338..14411 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(14502..15125) product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245517.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 15208..16368 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene queG CDS 16454..17365 product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 17412..17885 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene trmL CDS 18009..18650 product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 18641..19354 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 19366..20073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 20422..22317 product serine/threonine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene prkA CDS 22497..23675 product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene yhbH CDS 23836..24300 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 24370..25002 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 25043..26641 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 26664..27194 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 27207..27581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 27722..28483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 28486..28851 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 28853..29551 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 29564..30481 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 30474..30968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 note possible pseudo, frameshifted CDS complement(31502..31705) product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224086.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene cspB CDS 32143..32973 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245726.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(32976..34055) product diguanylate cyclase DgcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene dgcK CDS 34226..35617 product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene tcyP CDS complement(35659..36096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245285.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 36251..36838 product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 36958..37926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(37858..38511) product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 38663..42247 product endonuclease YhcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene yhcR CDS 42244..42840 product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene srtA CDS complement(42871..43779) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 43968..44285 product YhcU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 44422..44844 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 44970..45632 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 45648..47189 product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 47301..48215 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 48375..49712 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 49743..50297 product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene glpP CDS 50490..51314 product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene glpF CDS 51333..52823 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene glpK CDS 52968..54632 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene glpD CDS 54765..56510 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene pgcA CDS 56662..57804 product two-component system sensor histidine kinase YhcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene yhcY CDS 57801..58448 product two-component system response regulator YhcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene yhcZ CDS 58445..58969 product FMN-dependent NADPH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene yhdA CDS complement(58984..59226) product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 59427..59750 product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(59794..61236) product peptidoglycan endopeptidase LytF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene lytF CDS complement(61389..61829) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene nsrR CDS complement(61942..63468) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 63634..65040 product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene spoVR CDS complement(65070..66446) product alkaline phosphatase PhoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene phoA CDS 66980..67993 product peptidoglycan endopeptidase LytE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene lytE CDS complement(68063..68938) product transcriptional regulator CitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene citR CDS 69047..70147 product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene citA CDS 70221..71090 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 71344..72741 product branched-chain amino acid transporter BcaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene bcaP CDS 72862..74217 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(74252..75661) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 75771..76199 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(76234..76524) product anti-sigma-M factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(76512..77585) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(77578..78069) product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene sigM CDS 78266..79261 product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene akrN CDS 79594..80193 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 80295..81422 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(81443..82342) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(82501..83835) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(83896..84441) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene cueR CDS 84484..85665 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 85956..87341 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(87355..87711) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene crcB CDS complement(87708..88103) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(88090..88821) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 89312..90427 product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene mscY CDS 90501..91244 product sirtuin NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene srtN CDS complement(91274..92122) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 92409..93257 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene dat CDS complement(93300..94661) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene nhaC CDS complement(94787..95287) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233299.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 95430..95714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 95738..97495 product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene bmrC CDS 97492..99513 product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene bmrD CDS complement(99558..100178) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(100649..100852) product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene sspB CDS complement(101060..101269) product YheE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(101433..102794) product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene yheD CDS complement(102784..103875) product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene spaC CDS 104142..105275 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 105369..105722 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(105766..107007) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 107323..108189 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 108302..109807 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(109825..111042) product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene khtU CDS complement(111050..111547) product K(+)/H(+) antiporter subunit KhtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene khtT CDS complement(111610..111927) product K(+)/H(+) antiporter modulator KhtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene khtS CDS 112113..112880 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(112901..113086) product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 113213..114109 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 114102..115361 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 115469..116692 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 116706..119597 product DNA repair/recombination ATPase SbcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene sbcE CDS 119671..120615 product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene yhaM CDS 120742..120954 product sporulation protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene yhaL CDS complement(120994..121848) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene prsA CDS complement(122648..123166) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 123374..123715 product YhaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(123712..124323) product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(124501..124857) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(125253..125771) product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene trpP CDS complement(125894..126973) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene serC CDS complement(127119..127556) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 128044..128787 product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene ecsA CDS 128780..130006 product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene ecsB CDS 130029..130739 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(130756..131946) product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene sndC CDS complement(132020..133408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(133490..133804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(133852..134352) product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene hmoB CDS 134474..136618 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 136740..137801 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene hemE CDS 137873..138805 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene hemH CDS 138820..140232 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene hemY CDS 140378..140953 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 141024..143351 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(143395..144372) product beta-ketoacyl-ACP synthase III FabHB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene fabHB CDS 144501..145277 product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 145691..146731 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 146744..147151 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(147189..148478) product glutamate/proton symporter GltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene gltT CDS 149040..149774 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 149787..150782 product lipoate--protein ligase LplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene lplJ CDS 150847..151491 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 151609..153150 product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene lcfB CDS complement(153190..153585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 153735..155015 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(155053..156198) product subtilisin AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene aprE CDS 156640..157089 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 157160..158152 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 158486..159457 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(159489..160070) product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene phoE CDS complement(160141..161235) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233154.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(161237..162676) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(162682..163242) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(163377..164675) product heme-based aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene hemAT CDS complement(164812..166341) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245031.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 166453..167310 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(167338..167571) product IDEAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 167864..168442 product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene comK CDS complement(168485..169384) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 169601..169870 product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(169913..171382) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(171379..171579) product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(171805..172167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 172323..172943 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 172945..173451 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene lepB CDS 173634..175127 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 175204..175731 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(175758..175952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(176307..177512) product glucose/mannose transporter GlcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene glcP CDS complement(177584..178636) product glucose-6-phosphate 3-dehydrogenase NdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene ntdC CDS complement(178654..179499) product kanosamine-6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene ntdB CDS complement(179471..180796) product 3-dehydro-glucose-6-phosphate--glutamate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene ntdA CDS 180902..181891 product NTD biosynthesis operon transcriptional regulator NtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene ntdR CDS complement(182444..183598) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(183706..184908) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 185022..186749 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(187231..187668) product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 187635..187850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 187852..191352 product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene addB CDS 191339..195043 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene addA CDS 195115..196290 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 196287..199679 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene sbcC CDS 199693..199995 product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene hlpB CDS complement(200032..200250) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(200676..200861) product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene gerPD CDS complement(200858..201475) product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(201498..201731) product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene gerPB CDS complement(201745..201966) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(202384..202554) product aspartyl-phosphate phosphatase YisI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene yisI CDS complement(202698..203621) product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 203775..204680 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 204796..205152 product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 205318..208002 product cell wall-associated protease WprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene wprA CDS complement(208034..208591) product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 208761..210605 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene asnB CDS complement(210814..211293) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 211857..212663 product farnesyl diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene farP CDS complement(212688..214055) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 214179..215042 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 215060..216073 product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene degA CDS 216281..217315 product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene iolX CDS complement(217373..217882) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(217932..218543) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 218667..220112 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(220119..220757) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 220961..221767 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(221794..222393) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene cysC CDS complement(222390..223559) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene sat CDS complement(223672..224385) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 224575..225261 product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 225258..226016 product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(226061..226690) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(226786..227901) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(227910..229178) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(229291..230148) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(230154..230603) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(230695..232533) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(232849..233340) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 233488..234336 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 234449..234739 product DUF3784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(234781..235632) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 235769..236611 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 236630..237085 product intracellular proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(237116..237313) product DUF3813 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(237570..238382) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene yitU CDS 238503..239270 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 239334..239642 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 239711..239881 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 239943..241373 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 241373..241912 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 242117..243154 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene argC CDS 243174..244394 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene argJ CDS 244409..245185 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene argB CDS 245182..246339 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 246410..247471 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 247464..250556 product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 250544..251488 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene argF CDS 251589..251768 product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(251814..251999) product DUF2929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 252250..252984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 253068..253625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 253716..254669 product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene med CDS 254684..254875 product ComG operon transcriptional repressor ComZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224559.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene comZ CDS complement(254905..255126) product spore coat protein YjzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene yjzB CDS 255298..256236 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene fabH CDS 256261..257502 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene fabF CDS 257578..258363 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 258554..259540 product oligopeptide ABC transporter ATP-binding protein AppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene appD CDS 259537..260526 product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene appF CDS 260614..262245 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 262321..263271 product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene appB CDS 263288..264199 product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene appC CDS 264405..265157 product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(265191..266183) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene trpS CDS 266927..268564 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene oppA CDS 268660..269595 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene oppB CDS 269599..270516 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene oppC CDS 270530..271597 product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene oppD CDS 271599..272516 product oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene oppF CDS 273027..273836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 274014..274592 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 274773..275168 product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245483.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene spx CDS complement(275211..275867) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 276143..276799 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene mecA CDS 278157..280169 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene pepF CDS complement(280207..280374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(280688..281587) product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene spxH CDS complement(281584..281982) product group 2 truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(282237..282974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(282989..283561) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 283685..284050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 284079..284714 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene yjbM CDS 284733..285533 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 285548..286447 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(286460..287194) product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene prpE CDS 287428..289272 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 289524..290231 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene tenA CDS 290209..290826 product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene tenI CDS 290810..291919 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene thiO CDS 291916..292119 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene thiS CDS 292122..292886 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene thiG CDS 292883..293893 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene thiF CDS 293912..294727 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene thiD CDS 294864..295640 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fabI CDS 295747..296430 product spore coat protein CotO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene cotO CDS complement(296522..296971) product spore coat protein CotZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene cotZ CDS complement(297099..297587) product spore coat protein CotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene cotY CDS complement(297738..298244) product spore coat protein CotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene cotX CDS complement(298333..298662) product spore coat protein CotW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene cotW CDS complement(298703..299089) product spore coat protein CotV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene cotV CDS 299245..299601 product sporulation protein YjcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene yjcA CDS 299882..300088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 300170..300328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 300461..300715 product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene spoVIF CDS complement(300788..302941) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 303186..303440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(303514..303936) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(303941..304456) product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(304493..305215) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 305553..306698 product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene metI CDS 306691..307863 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene metC CDS complement(307892..308110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 note possible pseudo, frameshifted CDS complement(308137..308436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 note possible pseudo, frameshifted CDS complement(308506..309696) product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 tRNA 309869..309943 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 310334..310771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(310817..311107) product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(311124..312497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 note possible pseudo, frameshifted CDS complement(312503..312985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 note possible pseudo, frameshifted CDS 313223..314350 product response regulator aspartate phosphatase RapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rapH CDS 314794..314973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 315315..315887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(315958..316296) product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 316911..317372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 note possible pseudo, frameshifted CDS 317369..318859 product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene manR note possible pseudo, frameshifted CDS 319008..320960 product PTS mannose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene manP CDS 320976..321923 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene manA CDS 322303..322587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(322824..323210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 note possible pseudo, frameshifted CDS complement(323485..323880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 324082..324564 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene ybaK CDS complement(324609..324803) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 325675..325869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(325893..326855) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene cyoE CDS complement(327006..327242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 327496..328896 product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene pdaC CDS complement(328943..329416) product YjfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(329546..329713) product YjfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 329841..330740 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(330749..331147) product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(331246..331821) product YjgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 331971..334928 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene fdhF CDS 334921..335481 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 335679..336317 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244850.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 336405..337022 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(337054..337332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 337723..338913 product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene yjiB CDS 338936..340114 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(340156..340344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 340519..341331 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(341377..342129) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene fetB CDS complement(342129..342881) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(343000..343974) product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 344106..344603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 344996..345418 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 345458..346636 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232765.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 346818..348257 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene uxaC CDS 348340..349719 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 349824..350837 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene allD CDS 350843..351862 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 351887..352966 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene uxuA CDS 352963..353799 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 353847..355115 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 355203..356204 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 356282..357724 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 357721..359214 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245409.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(359251..360015) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(360242..360706) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 360856..362127 product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene yjoB CDS 362278..363408 product response regulator aspartate phosphatase RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene rapA CDS 363398..363532 product phosphatase RapA inhibitor PhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene phrA CDS complement(363564..363818) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232731.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 363942..364895 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244876.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(364932..365309) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 365416..366018 product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 366093..366929 product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(366974..367570) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(367732..368073) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 368253..368432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 368419..369255 product phage-like element PBSX protein XkdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 369320..369955 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886492.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 369955..370122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 370207..370566 product phage-like element PBSX protein XkdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene xkdD CDS 370553..370759 product phage-like element PBSX protein XtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene xtrA CDS 370874..371383 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 371501..372295 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene xtmA CDS 372292..373593 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245584.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 373594..375084 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 375104..375931 product XkdF-like putative serine protease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 375956..376891 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232690.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 376913..377296 product DUF3199 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 377293..377649 product YqbH/XkdH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 377646..378131 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 378144..378584 product phage-like element PBSX protein XkdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232680.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 378588..378806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 378803..380203 product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 380205..380648 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232677.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 380739..381185 product phage-like element PBSX protein XkdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 381209..381367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 381368..386377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 386370..387029 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 387042..388022 product phage-like element PBSX protein XkdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 388022..388288 product DUF2577 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 388345..388770 product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 388763..389809 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 389793..390371 product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 390368..390640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 390643..393084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 393102..393428 product XkdW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 393425..393589 product XkdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 393634..394473 product phage-like element PBSX protein XepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene xepA CDS 394526..394795 product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 394808..395071 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 395084..395977 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(396238..396408) product three component toxin-antitoxin-antitoxin system antitoxin SpoIISB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene spoIISB CDS complement(396408..397154) product toxin-antitoxin-antitoxin system toxin SpoIISA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene spoIISA CDS complement(397264..398265) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(398278..398895) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(399172..400488) product serine/threonine exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244819.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene steT CDS 400871..401821 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 402076..404262 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 404274..405245 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(405741..407099) product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene htrA CDS 407272..408090 product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene proG CDS 408219..409043 product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene dppA CDS 409059..409985 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene dppB CDS 409991..410953 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene dppC CDS 410958..411965 product dipeptide ABC transporter ATP-binding subunit DppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene dppD CDS 411986..413617 product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene dppE CDS 413723..414664 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 414661..415761 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene ykfB CDS 415758..416648 product gamma-D-glutamyl-L-lysine dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene eepC CDS 416661..417650 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(417690..418736) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene pgl CDS complement(418824..419684) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 419802..420362 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 420600..421799 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene hmpA CDS complement(421872..422102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 422256..422987 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 423080..423607 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 423597..424112 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 424335..424673 product multidrug efflux SMR transporter subunit YkkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene ykkC CDS 424673..424990 product multidrug efflux SMR transporter subunit YkkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene ykkD CDS 425061..425963 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene purU CDS 426324..427421 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene proB CDS 427433..428680 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene proA CDS 428809..429234 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232574.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(429267..429710) product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ohrR CDS 429852..430262 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 430387..431490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(431496..431966) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene guaD CDS 432101..432727 product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(432766..435054) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene metE CDS complement(435469..436428) product serine protease Isp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene isp CDS 436651..437484 product RsbT co-antagonist RsbRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene rsbRB CDS complement(437517..438281) product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene thiX CDS complement(438256..439896) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(439883..440482) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(440484..441086) product HMP/thiamine ABC transporter substrate-binding protein ThiU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene thiU CDS 441398..442084 product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene ykoG CDS 442088..443452 product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene ykoH CDS 443449..444123 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 444215..444730 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 444814..444951 product transcriptional regulator SplA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 445458..446813 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene mgtE CDS complement(446856..447188) product MerR family transcriptional regulator TnrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene tnrA CDS 447382..447537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 447625..447807 product stress response protein YkoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene ykoL CDS 447944..448405 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232536.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(448446..449540) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 449539..450183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(450211..451023) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 451221..452915 product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 452928..453941 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(454084..455919) product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(455923..456807) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(456896..459298) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967094.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 459507..460142 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 460402..461196 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 461460..462215 product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene sigI CDS 462212..462382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 note possible pseudo, frameshifted CDS 462415..463392 product anti-sigma-I factor RsgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene rsgI note possible pseudo, frameshifted CDS complement(463403..463597) product acid-soluble spore protein SspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene sspD CDS complement(463729..464430) product transcriptional regulator HtpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene htpK CDS 464600..465496 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene htpX CDS 465671..467020 product Ktr system potassium transporter KtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene ktrD CDS 467176..467331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 467334..467504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(467546..468568) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 468821..471037 product sporulation two-component system sensor histidine kinase KinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene kinE CDS 471034..471531 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene ogt CDS 471621..471746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(471780..472841) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232498.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene mtnA CDS complement(472849..474042) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene mtnK CDS complement(474386..475165) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 475260..476453 product methionine-glutamine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene mtnE CDS 476680..477891 product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene mtnW CDS 477888..478595 product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene mtnX CDS 478553..479182 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 479197..479733 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene mtnD CDS complement(479777..480097) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 480300..480557 product aspartyl-phosphate phosphatase Spo0E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene spo0E CDS 480643..481074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(481102..482604) product sporulation kinase KinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene kinD CDS 482815..483252 product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene mhqR CDS complement(483291..484076) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene motB CDS complement(484048..484860) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene motA CDS complement(485250..487349) product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene clpE CDS 487716..488759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 489074..489733 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene queC CDS 489735..490175 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene queD CDS 490168..490899 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232460.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene queE CDS 490917..491414 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene queF CDS complement(491682..491813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 492046..492288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 492329..492619 product YkvR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(492740..492925) product YkvS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 493090..493284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 493583..494212 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232442.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 494330..495667 product sporulation protein YkvU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245552.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene ykvU CDS 495721..496215 product sporulation thiol-disulfide oxidoreductase StoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245444.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene stoA CDS 496200..496358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 496450..498363 product metal-transporting ATPase PfeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene pfeT CDS 498769..499863 product di/tri-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene papB CDS complement(499914..500039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 500144..501109 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244772.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 501193..502038 product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967114.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene glcT CDS 502268..504367 product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene ptsG CDS 504466..504732 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 504732..506444 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene ptsP CDS 506536..506775 product splAB operon transcriptional regulator SplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene splA CDS 506853..507881 product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene splB CDS complement(507895..508575) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 508712..510679 product methyl-accepting chemotaxis protein McpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245443.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene mcpC CDS 510823..511689 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(511730..512521) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 512859..514979 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 515144..516964 product sporulation kinase KinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245779.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene kinA CDS complement(516974..518155) product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(518357..518518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 518725..519636 product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene cheV CDS complement(519678..520142) product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(520268..521560) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245267.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(521636..522139) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(522188..523048) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 523190..523954 product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene fadH CDS 524018..525241 product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 525860..526099 product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 526208..526726 product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 526866..527057 product AbrB antirepressor AbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886502.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene abbA CDS 527196..527639 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 527786..528667 product transcriptional regulator CcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene ccpC CDS 528778..529254 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 529244..530137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 530153..530608 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 530714..531424 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene dapD CDS 531494..532618 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 532680..532925 product YkuS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(532961..533764) product small-conductance mechanosensitive channel protein MscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene mscT CDS 533821..534027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 534009..534551 product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene ahpA CDS 534621..535079 product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene ykuV CDS 535527..536114 product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene rok CDS complement(536154..537119) product spore protein Cse15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene cse15 CDS 537255..537854 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232376.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 537905..538924 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232375.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 538942..540234 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 540201..540716 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene mobB CDS 540716..541189 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 541182..541415 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene moaD CDS 541641..543398 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 543409..545223 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 545338..546033 product toxin SDP protection protein YknW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene yknW CDS 546038..547171 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 547172..547864 product ABC transporter ATP-binding protein YknY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene yknY CDS 547861..549054 product sporulation-delaying-protein transporter subunit SkiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene skiZ CDS 549334..550089 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245688.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 550086..550997 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene pfkB CDS 551012..552919 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 sequence066 source 1..4706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(3086..4632) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence067 source 1..23354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..725 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene lepB CDS complement(761..1030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 1212..2831 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 2893..3804 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(3835..5067) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(5177..5311) product protein YkpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(5413..6432) product cell shape-determining protein MreBH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene mreBH CDS 6701..6979 product transcriptional regulator AbhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene abhA CDS 7172..8458 product two-component sensor histidine kinase KinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232333.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene kinC CDS 8475..9302 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 9374..10039 product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene ktrC CDS 10197..11930 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene ade CDS complement(11966..13633) product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene rnjA CDS complement(13639..13848) product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene rnpZA CDS 14231..15004 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(15039..15593) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene def CDS complement(15703..15855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 16067..16738 product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 17161..18276 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene pdhA CDS 18280..19257 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene pdhB CDS 19373..20701 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene pdhC CDS 20706..22118 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene lpdA CDS complement(22164..22538) product peptidoglycan-associated lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene slp sequence068 source 1..584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989424.1:IS3 family transposase locus_tag LOCUS_18790 sequence069 source 1..636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence070 source 1..1085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(517..849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 note possible pseudo, frameshifted sequence071 source 1..384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence072 source 1..818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(95..170) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(178..254) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(281..357) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(390..464) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(526..598) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(601..675) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 sequence073 source 1..1128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 47..157 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA 183..258 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 263..338 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 376..451 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 458..540 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 581..655 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA 670..755 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA 765..841 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA 868..944 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 952..1027 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 sequence074 source 1..263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(53..128) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(140..216) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 sequence075 source 1..55528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(392..1891) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene lysS CDS complement(1983..2984) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene dusB CDS complement(2998..3216) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(3168..3671) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene folK CDS complement(3668..4030) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene folB CDS complement(4023..4880) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene folP CDS complement(4862..5746) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene pabC CDS complement(5743..6327) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene pabA CDS complement(6341..7750) product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(7915..8841) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene cysK CDS complement(8917..9810) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(9860..10735) product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene hslO CDS complement(10747..11523) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(11716..13629) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene ftsH CDS complement(13727..14269) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene hpt CDS complement(14266..15684) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene tilS CDS complement(15788..16804) product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene prkT CDS complement(16770..17507) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(17592..20075) product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene spoIIE tRNA complement(20272..20347) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(20356..20432) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 CDS complement(20601..20987) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(21068..21445) product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene divIC CDS complement(21463..22098) product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene yabQ CDS complement(22095..22397) product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene yabP CDS complement(22476..22736) product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(22739..24208) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene mazG CDS complement(24198..25796) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(25978..26514) product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene spoVT CDS complement(26650..30183) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene mfd CDS complement(30253..30483) product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene fin CDS complement(30543..31109) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene pth CDS complement(31216..31833) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(31918..32871) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(32894..34264) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene glmU CDS complement(34457..34750) product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene spoVG CDS complement(34946..35323) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(35320..36177) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218342.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene purR CDS complement(36233..37111) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene ispE CDS complement(37250..37435) product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218333.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(37594..37854) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(38065..38955) product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene prtG CDS complement(39099..39977) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene rsmA CDS complement(39970..40530) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rnmV CDS complement(40675..41898) product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(42144..42911) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(42990..44984) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226758.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene metG CDS 45485..45769 product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene abrB CDS complement(45818..46696) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene rsmI CDS complement(46671..46970) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(46957..47700) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(47759..48118) product replication initiation-control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218308.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene yabA CDS complement(48133..48960) product competence/sporulation regulator complex protein RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene ricT CDS complement(48963..49952) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene holB CDS complement(49964..50404) product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(50417..50746) product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene darA CDS complement(50821..51459) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene tmk CDS complement(51456..52898) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(52980..54137) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(54156..54770) product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(54903..55097) product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene csfB rRNA complement(55278..55388) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 sequence076 source 1..380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence077 source 1..225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence078 source 1..549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(167..250) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(331..413) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 sequence079 source 1..275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence080 source 1..220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence081 source 1..268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence082 source 1..262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence083 source 1..502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence084 source 1..252087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1023..1289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 1485..1658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 1861..2211 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(3005..3595) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(3567..4415) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(4597..4830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 note possible pseudo, frameshifted CDS 6107..6613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 note possible pseudo, internal stop codon, frameshifted CDS 6601..7095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 note possible pseudo, frameshifted CDS 7085..7357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 7615..8346 product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene bglS CDS complement(8990..9475) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 9679..11115 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(11371..11703) product chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene csaA CDS complement(11768..12487) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(12508..13008) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 note possible pseudo, frameshifted CDS complement(13205..13780) product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(13791..14141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 note possible pseudo, frameshifted CDS complement(14114..14491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 note possible pseudo, frameshifted CDS complement(14540..15022) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(15076..16014) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 16212..16757 product mother cell-specific sporulation protein Csk22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene csk22 CDS complement(16783..17103) product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene czrA CDS 17297..17974 product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(18066..18602) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(18740..19522) product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 19692..20189 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 20253..21230 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 21397..22455 product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene desE CDS 22579..23691 product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene desK CDS 23710..24309 product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene desR CDS complement(24344..25852) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(26117..26980) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(27227..29002) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene recQ CDS complement(29560..30186) product FMN-dependent NADH-azoreductase AzoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene azoJ CDS complement(30337..30828) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(31010..31354) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(31563..31766) product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 31997..33484 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene dhaS CDS 33584..35482 product sporulenol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene sqhC CDS 35472..36317 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(36350..37687) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 37918..38883 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(38933..40186) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene odhB CDS complement(40202..43036) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene sucA CDS complement(43264..45180) product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(45191..46081) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886530.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(46169..46759) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(46738..46938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(46853..48088) product D-gamma-glutamyl-meso-diaminopimelic acid endopeptidase CwlS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene cwlS CDS complement(48468..49685) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(49920..50534) product cyclic di-AMP synthase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene cdaS CDS 50810..52168 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 52184..53032 product RsbT co-antagonist RsbRC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene rsbRC CDS complement(53058..53723) product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene bshB2 CDS complement(53742..54092) product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(54089..54367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231211.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(54443..55339) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene rarD CDS 55438..55899 product spore germination protein GerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231207.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene gerT CDS complement(55933..56169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 56593..56982 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(57400..57738) product transcriptional regulator YodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399427.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene yodB CDS 57868..58476 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(58520..59122) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(59138..59959) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231191.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 60233..60433 product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 60433..61923 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(61958..63358) product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene ctpA CDS 63511..64212 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 64300..64551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(64634..65455) product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene ldcB CDS complement(65538..66239) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene deoD CDS 66442..66567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(66606..66920) product shape determination protein YodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene yodL CDS complement(66981..67592) product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene pgpB CDS complement(67673..67849) product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 67971..68114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231164.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(68111..68791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(68947..69171) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(69258..69536) product YokU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(69533..70948) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399420.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene ablA CDS complement(70978..71805) product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene ablB CDS complement(71783..73087) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(73102..73755) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399417.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(73740..74429) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(74436..75770) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(76093..76872) product spore maturation N-acetyltransferase CgeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene cgeE CDS complement(76901..78181) product spore maturation glycosyltransferase CgeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene cgeD CDS complement(78246..78551) product spore maturation protein CgeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene cgeC CDS 78757..79143 product spore crust protein CgeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene cgeA CDS 79150..80103 product spore maturation protein CgeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene cgeB CDS complement(80157..81305) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 81671..82696 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(82740..83174) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene msrB CDS complement(83175..83708) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene msrA CDS 83840..84265 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(84317..85654) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(85728..85922) product protein YpmT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene ypmT CDS complement(85935..86498) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(86508..87275) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(87353..87934) product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene scuA CDS complement(88087..88338) product DUF2535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(88425..89693) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene ilvA CDS 89942..90937 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 90958..91599 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(91632..92252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(92253..92759) product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene dfrA CDS complement(92756..93550) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(93634..94167) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(94185..94799) product YpjP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(95059..95844) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(95886..96320) product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene brxA CDS complement(96425..98101) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene ilvD CDS complement(98392..99525) product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(99585..100202) product Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230787.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene hdhQ CDS complement(100215..100697) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230784.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 101053..101958 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene metA CDS 102189..103337 product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 103581..103781 product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene cspD CDS complement(103833..104015) product transcriptional regulator DegR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene degR CDS 104170..104439 product DUF2564 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(104468..104650) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(104643..105323) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 105406..106095 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 106095..106550 product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 106534..106662 product small, acid-soluble spore protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene sspL CDS complement(106670..107560) product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene exnP CDS complement(107661..107804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230761.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(107882..108139) product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(108204..111785) product dynamin GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230755.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene dynA CDS complement(112120..112626) product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene bpsB CDS complement(112630..113727) product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene bpsA CDS complement(113800..115116) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene pbuX CDS complement(115113..115697) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230744.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene xpt CDS complement(116032..117537) product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene ypwA CDS complement(117650..118642) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene kdgT CDS complement(118686..119276) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene eda CDS complement(119278..120252) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene kdgK CDS complement(120290..121309) product pectin utilization transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene kdgR CDS 121532..122359 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230722.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene kduI CDS 122361..123125 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene kduD CDS complement(123168..125093) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(125197..125388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(125756..126913) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(127459..127755) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene gpsB CDS complement(127831..128376) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(129002..130252) product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene mrfB CDS complement(130266..132515) product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene mrfA CDS complement(132618..133124) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 133262..133681 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398640.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(133702..134070) product YppG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 134259..134447 product YppF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(134487..134858) product YppE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246080.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(134904..135149) product YppD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(135477..136433) product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398707.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 136480..137100 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene recU CDS 137122..139875 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(139949..140443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967579.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(140440..141099) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967580.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene nth CDS complement(141118..141816) product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene dnaD CDS complement(141911..143203) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene asnS CDS complement(143345..144526) product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene aspB CDS complement(144549..145034) product cell wall elongation/penicillin-binding protein regulator TseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene tseB CDS complement(145043..145213) product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(145355..148150) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene dinG CDS complement(148276..148659) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene panD CDS complement(148661..149521) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene panC CDS complement(149523..150356) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene panB CDS complement(150601..151578) product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(151563..152756) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230647.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(152761..153894) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230645.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene bshA CDS complement(153891..154601) product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene bshB1 CDS complement(154594..155007) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene mgsA CDS complement(155023..155826) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene dapB CDS complement(155838..156173) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 156313..157185 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(157222..158016) product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ypjB CDS complement(158085..158642) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(158789..159556) product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(159591..160265) product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene qcrB CDS complement(160267..160770) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(160916..161359) product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(161414..161953) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(162025..163296) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(163645..164931) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene aroA CDS complement(164943..166058) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(166107..167189) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene hisC CDS complement(167201..168004) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene trpA CDS complement(167997..169199) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene trpB CDS complement(169180..169827) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(169832..170584) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene trpC CDS complement(170577..171593) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene trpD CDS complement(171565..173112) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene trpE CDS complement(173328..173708) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene aroH CDS complement(173708..174796) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene aroB CDS complement(174796..175968) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene aroC CDS complement(176043..176813) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene cheR CDS complement(177053..177499) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene ndk CDS complement(177618..178664) product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene hepT CDS complement(178606..179307) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene menG CDS complement(179314..180069) product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene hepS CDS complement(180233..180460) product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene mtrB CDS complement(180482..181054) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene folE CDS complement(181242..181520) product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene hbs CDS complement(181895..183373) product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene spoIVA CDS complement(183562..184290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(184312..184515) product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(184854..185891) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene gpsA CDS complement(185909..187219) product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene engA CDS complement(187374..187568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(187565..188458) product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(188455..189054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 189132..189263 product YpzI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513900.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(189306..190355) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene fni CDS complement(190368..191516) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene rpsA CDS complement(191751..192425) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene cmk CDS complement(192504..192680) product YpfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230553.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(192726..193379) product cyclic di-GMP receptor DgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene dgrA CDS complement(193473..194825) product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230547.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene ypeB CDS complement(194861..195772) product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene sleB CDS complement(195925..196581) product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene prsW CDS complement(196699..197673) product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(197783..199057) product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene gudB CDS complement(199214..199798) product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(199958..200737) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(200821..201264) product YpbF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230531.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(201327..202079) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398603.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(202030..202617) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(202659..204149) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230528.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(204142..205200) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398594.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 205467..205715 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(205754..206323) product riboflavin transporter FmnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene fmnP CDS complement(206350..206613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 206817..208394 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398713.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene serA CDS complement(208438..209205) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene aroD CDS complement(209318..210421) product anti-sigma-X factor RsiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene rsiX CDS complement(210357..210941) product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene sigX CDS complement(211145..212914) product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene resE CDS complement(212911..213633) product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene resD CDS complement(213715..214890) product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene resC CDS complement(214910..216538) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene resB CDS complement(216535..217074) product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene resA CDS complement(217169..217903) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene rluB CDS complement(217995..218531) product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene spmB CDS complement(218536..219126) product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene spmA CDS complement(219114..220262) product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene dacB CDS complement(220387..220926) product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399065.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(220981..221574) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene scpB CDS complement(221564..222304) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene scpA CDS 222596..223120 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(223134..223508) product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene ribT CDS complement(223621..224085) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene ribH CDS complement(224118..225314) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(225329..225976) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene ribE CDS complement(225987..227072) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene ribD CDS complement(227468..227812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398735.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(228049..228603) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene lepB CDS 229021..229155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(229114..229320) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(229854..230285) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 230331..230519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 230542..231414 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(231444..232769) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene lysA CDS complement(232766..232966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(232870..234351) product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene spoVAF CDS complement(234296..234913) product stage V sporulation protein SpoVABEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230469.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene spoVAEA CDS complement(234921..235271) product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene spoVAE CDS complement(235273..236289) product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene spoVAD CDS complement(236302..236754) product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene spoVAC CDS complement(236767..237192) product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene spoVAB CDS complement(237182..237805) product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene spoVAA CDS complement(237929..238696) product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene sigF CDS complement(238708..239148) product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene spoIIAB CDS complement(239145..239498) product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene spoIIAA CDS complement(239594..240763) product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene dacF CDS complement(240923..241738) product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(241751..242935) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene deoB CDS complement(243098..243988) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene xerD CDS complement(243996..244223) product YqzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230440.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(244348..244797) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene fur CDS complement(244910..245554) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene spoIIM CDS complement(245656..245871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(245973..247292) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398731.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(247310..248716) product malate-H+/Na+-lactate antiporter MleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene mleN CDS complement(248859..250286) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene aspA CDS complement(250332..251321) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene ansA CDS 251503..251853 product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene ansR CDS complement(251862..252038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 sequence085 source 1..219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence086 source 1..411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence087 source 1..391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(159..389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 sequence088 source 1..219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence089 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 35..286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 sequence090 source 1..272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence091 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence092 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 note possible pseudo, frameshifted sequence093 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence094 source 1..345559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 329..676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 609..980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 973..1356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 1353..1730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 1734..2348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2397..2741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2744..2923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2936..6814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 6814..7653 product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 7665..9371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 9408..11303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 11319..11627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 11624..11794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 11807..13597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 13610..13981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 13981..14154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 14210..14422 product BhlA/UviB family holin-like peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 14435..14698 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232653.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 14756..15733 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(15800..16357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(16425..16562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(16728..16922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(17014..17577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(18030..18575) product DL-endopeptidase inhibitor IseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399558.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene iseA CDS 18862..20253 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 20386..21363 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene galM CDS 21396..22871 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene dacB CDS 23842..25044 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene fabD CDS 25065..36980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 37037..53134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 53232..61064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 61234..61626 product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231518.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 61781..63313 product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 63383..63550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 63820..64962 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 65005..66654 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 66664..67998 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 68013..68234 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 68249..69151 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ldeG CDS 69169..69951 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 69968..71497 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 71667..72866 product oligoribonuclease NrnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene nrnB CDS complement(72915..73079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 note possible pseudo, frameshifted CDS complement(73052..73255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 note possible pseudo, frameshifted CDS 73415..73735 product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 73853..74602 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 74792..75088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 75370..75594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 75557..75685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(75733..76320) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(76400..77290) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245127.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene galU CDS complement(77314..77742) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(78016..78279) product YnfE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(78354..79853) product endo-1,4-beta-glucanase EglS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene eglS CDS complement(80156..81499) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231542.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 81995..82348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014113949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 82374..82499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(82547..84967) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene parC CDS complement(84970..86937) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene parE CDS complement(87333..87740) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245606.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 87909..88490 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene plsY CDS 88570..88857 product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(88888..89187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(89203..89619) product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(89703..89954) product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene tlp CDS complement(89991..90137) product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene sspN CDS complement(90202..90327) product FbpB family small basic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(90407..90919) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(90992..93721) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene acnA CDS 93929..94093 product acid-soluble spore protein SspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene sspO CDS 94125..94271 product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 94370..94744 product outer spore coat protein CotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene cotM CDS 94976..95404 product DynA interaction protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene yneK CDS complement(95435..95917) product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(96008..96367) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(96456..97163) product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231585.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene ccdA CDS 97365..97556 product aspartyl-phosphate phosphatase YnzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886518.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene ynzD CDS complement(97630..97848) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(97934..98380) product sporulation inhibitor of replication protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231591.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene sirA CDS complement(98535..100538) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene tkt CDS complement(100707..100940) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(101004..101657) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231596.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(101676..101987) product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene yneA CDS 102143..102760 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene lexA CDS complement(103150..103578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(103654..104076) product FosM family fosfomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231604.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene fosM CDS 104274..104726 product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231606.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 note possible pseudo, internal stop codon, frameshifted CDS complement(104749..105507) product gamma-polyglutamate hydrolase PghL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene pghL CDS complement(105738..106049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231610.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(106155..107786) product YndJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231612.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(107780..108400) product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244960.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(108405..109211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(109377..109688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(109685..110881) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(111045..111233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231626.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(111255..111515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 111670..112104 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231627.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(112165..112566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 113169..113369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 114142..114861 product YrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023592782.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(115071..115910) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(116049..116225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(116177..116320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(116396..116554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 116730..116951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 117264..117437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(117562..117996) product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene dutA CDS complement(118027..118488) product DUF2691 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 118968..120152 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene alr CDS complement(120274..121575) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 122311..122754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 note possible pseudo, internal stop codon, frameshifted CDS complement(123188..123886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(124234..125733) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene xylB CDS complement(125905..127242) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene xylA CDS 127501..128655 product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(128824..130425) product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245202.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene xynB CDS complement(130468..131859) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245259.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(132837..133322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(133663..133815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 note possible pseudo, internal stop codon, frameshifted CDS complement(133863..134024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 note possible pseudo, internal stop codon, frameshifted CDS complement(134342..135181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(135622..136956) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene glnA CDS complement(137015..137422) product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene glnR CDS complement(137532..138797) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(138815..140182) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene hflX CDS complement(140211..141176) product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene spoVK CDS complement(141210..141413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 141975..142742 product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene cwlC CDS complement(142806..143426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(143475..144464) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231754.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene nrdF CDS complement(144482..146584) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene nrdE CDS complement(146544..146936) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene nrdI CDS complement(147180..147410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(147492..147764) product YmzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(147960..148181) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221097.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene hfq CDS complement(148221..149165) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene miaA CDS complement(149265..149669) product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 149768..150016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 150159..150476 product multidrug efflux SMR transporter subunit EbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene ebrA CDS 150490..150843 product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene ebrB CDS complement(150855..151307) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(151382..152089) product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 152818..154146 product serine protease AprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967303.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene aprX CDS 154249..155073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 155152..155508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245436.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 155745..156962 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(157005..164636) product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(164651..181195) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(181185..193967) product polyketide synthase PksM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene pksM CDS complement(193983..207653) product polyketide synthase PksL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886513.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene pksL CDS complement(207655..222795) product polyketide synthase PksJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene pksJ CDS complement(222841..223590) product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(223630..224400) product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(224397..225659) product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene pksG CDS complement(225660..226907) product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene pksF CDS complement(226885..227133) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(227220..229502) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene fabD CDS complement(229499..230473) product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231814.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(230674..230823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(230978..231844) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231821.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene fabD CDS complement(232222..232899) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(233088..233705) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 233826..234383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 234529..234984 product regulatory YrvL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(235001..235753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(236191..238077) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene mutL CDS complement(238094..240670) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene mutS CDS complement(240803..241348) product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene cotE CDS complement(241608..242039) product regulatory iron-sulfur-containing complex subunit RicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene ricA CDS complement(242041..243570) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene miaB CDS complement(243715..244893) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(244907..245950) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene tdh CDS complement(246216..246476) product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene spoVS CDS complement(246675..247469) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene ymdB CDS complement(247539..249101) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene rny CDS complement(249377..250552) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(250722..251768) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene recA CDS complement(251941..253191) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231847.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(253209..253790) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene pgsA CDS complement(253841..254755) product cell shape determination protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene rodZ CDS complement(254774..255565) product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(255695..255952) product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245199.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(256033..256761) product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene efpI CDS complement(256814..258100) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(258097..259377) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(259629..260840) product bacillibactin exporter BcbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886509.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene bcbE CDS complement(260978..261703) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(261847..264210) product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene spoIIIE CDS complement(264340..264552) product TepA modulator TepJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231871.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene tepJ CDS complement(264549..265286) product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene tepA CDS complement(265403..267070) product ribonuclease J2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene rnjB CDS complement(267249..268121) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene dapA CDS complement(268152..269366) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene dapG CDS complement(269458..270498) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene asd CDS complement(270624..271226) product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244650.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene dpaB CDS complement(271229..272122) product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene dpaA CDS complement(272315..272572) product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231890.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(272651..273880) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(273920..274879) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(274997..277114) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene pnp CDS complement(277287..277556) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene rpsO CDS complement(277713..278663) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene ribF CDS complement(278682..279611) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene truB CDS complement(279694..280047) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene rbfA CDS complement(280339..282486) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene infB CDS complement(282506..282808) product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(282810..283085) product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene rulR CDS complement(283099..284217) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene nusA CDS complement(284252..284722) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene rimP CDS complement(285052..289416) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(289474..291168) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene proS CDS complement(291201..292463) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene rseP CDS complement(292476..293627) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene dxr CDS complement(293689..294489) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene cdsA CDS complement(294502..295284) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(295415..295972) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene frr CDS complement(295974..296696) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene pyrH CDS complement(296842..297723) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene tsf CDS complement(297825..298565) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene rpsB CDS complement(298709..299212) product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene swrB CDS complement(299241..300005) product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene sigD CDS complement(300028..300528) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene cheD CDS complement(300525..301154) product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene cheC CDS complement(301173..301643) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231938.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene cheW CDS complement(301665..303680) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene cheA CDS complement(303686..304756) product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene cheB CDS complement(304758..305648) product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene flhG CDS complement(305645..306745) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene flhF CDS complement(306745..308778) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene flhA CDS complement(308811..309893) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene flhB CDS complement(309893..310477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(310680..310949) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene fliQ CDS complement(310964..311629) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene fliP CDS complement(311622..312281) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene fliZ CDS complement(312296..312658) product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene cheY CDS complement(312684..313823) product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene fliY CDS complement(313813..314811) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene fliM CDS complement(314845..315270) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene fliL CDS complement(315267..315482) product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene swrD CDS complement(315522..316316) product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene flgG CDS complement(316338..316760) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene flgD CDS complement(316757..318220) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(318232..318846) product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231975.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(318858..319301) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231977.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene fliJ CDS complement(319304..320620) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene fliI CDS complement(320617..321369) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene fliH CDS complement(321362..322378) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene fliG CDS complement(322391..324001) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene fliF CDS complement(324047..324373) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene fliE CDS complement(324379..324831) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene flgC CDS complement(324831..325220) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene flgB CDS complement(325601..326380) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene codY CDS complement(326420..326677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 note possible pseudo, frameshifted CDS complement(326652..327812) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene hslU note possible pseudo, frameshifted CDS complement(327829..328374) product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene clpQ CDS complement(328387..329301) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene xerC CDS complement(329369..330676) product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene trmFO CDS complement(330752..332827) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene topA CDS complement(333014..333907) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245871.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene dprA CDS complement(333968..334870) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene sucD CDS complement(334899..336056) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene sucC CDS complement(336230..336511) product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232001.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(336508..338238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(338267..339034) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene rnhB CDS complement(339105..339953) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene ylqF CDS complement(340098..340445) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene rplS CDS complement(340585..341316) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967234.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene trmD CDS complement(341313..341837) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene rimM CDS complement(341842..342228) product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(342350..342595) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232017.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(342595..342867) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene rpsP CDS complement(342973..344313) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene ffh CDS complement(344327..344659) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 344838..345323 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245834.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 sequence095 source 1..280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence096 source 1..293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence097 source 1..412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence098 source 1..276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence099 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 note possible pseudo, internal stop codon sequence100 source 1..275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence101 source 1..301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence102 source 1..551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence103 source 1..372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence104 source 1..556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..499 product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 note possible pseudo, internal stop codon sequence105 source 1..315052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..846) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(821..1603) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(1616..2620) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245977.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 2770..3543 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 3595..3837 product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398611.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(3876..5459) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene pckA CDS 5964..7166 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene metK CDS 7315..9213 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene asnB CDS 9353..10744 product alanine permease AlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene alaP CDS complement(11004..11519) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399093.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 11568..12347 product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene ytpA CDS 12368..13474 product tetraprenyl-beta-curcumene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene tbcS CDS complement(13464..14048) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(14045..15016) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 15178..15450 product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229117.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 15777..16169 product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene ytrA CDS 16162..17040 product ABC transporter ATP-binding protein YtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398506.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene ytrB CDS 17034..18020 product ABC transporter permease YtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene ytrC CDS 18050..19027 product ABC transporter permease YtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398887.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene ytrD CDS 19042..19737 product ABC transporter ATP-binding protein YtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene ytrE CDS 19727..21037 product ABC transporter permease YtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene ytrF CDS 21135..21830 product two-component response regulator BceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399109.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene bceR CDS 21823..22827 product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene bceS CDS 22929..23690 product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene bceA CDS 23680..25620 product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene bceB CDS complement(25657..26403) product LMBR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 26593..27786 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(27818..28603) product blue-light photoreceptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399022.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 29003..29332 product DUF4257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246114.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 29760..32174 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene leuS CDS 32289..32600 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(32623..33921) product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene melA CDS complement(33941..34771) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(34768..35679) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(35676..36953) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(36987..38021) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 38239..39138 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 39423..39728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 39928..40704 product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene bioW CDS 40694..42040 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398913.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene bioA CDS 42030..43199 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene bioF CDS 43196..43891 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene bioD CDS 43894..44901 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene bioB CDS 44968..46155 product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene bioI CDS 46233..46994 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 47182..48063 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 48087..49589 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(49630..51945) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 52161..53126 product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene rmgP CDS 53143..54255 product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene rmgQ CDS 54333..54755 product rhamnogalaturonan transport/degradation protein RmgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886596.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene rmgS CDS 54767..56053 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 56075..56743 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 56811..56993 product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(57031..58566) product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene opuD CDS complement(58756..59973) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 60221..61855 product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene murJ CDS 61924..62643 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(62764..62985) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 63275..63985 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 63982..65139 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(65178..66476) product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene pbuO CDS 66573..67964 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene pepV CDS complement(67997..68881) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene cysK CDS 69082..69633 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene thpR CDS 69659..70573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 70622..71551 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229243.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 71576..73732 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229246.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene pulA CDS 73911..74708 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886595.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(74709..74987) product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237926.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 75192..75833 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene trmB CDS 75900..76745 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 76828..78528 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(78582..78899) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229259.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 79058..80131 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229261.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(80188..80634) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 80868..81191 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 81206..82015 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 82031..82636 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 82797..85673 product DNA translocase SftA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene sftA CDS 85922..87220 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229274.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene murC CDS 87382..87804 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 87835..88290 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398549.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 88314..88640 product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229280.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene ytxJ CDS 88876..89952 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 90228..91232 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene ccpA CDS 91296..92114 product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398692.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene motP CDS 92104..92814 product flagellar motor protein MotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229290.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene motS CDS complement(92843..94009) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(94006..94650) product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(94677..95309) product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene acuA CDS 95469..97187 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene acsA CDS 97529..98797 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene tyrS CDS 98928..99056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(99078..99680) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene rpsD CDS 99975..101714 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(101752..102243) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229311.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 102370..102993 product transcriptional regulator RefZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene refZ CDS complement(102986..103795) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene hisJ CDS 103992..105695 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229320.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene ezrA CDS complement(105794..107134) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene brnQ CDS 107336..108481 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 108485..109690 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229326.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene thiI CDS 109782..109991 product alpha type acid-soluble spore protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene sspA CDS 110171..111760 product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 111780..113369 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(113403..114206) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 114393..115400 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene sppA CDS 115413..115907 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 115982..116662 product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 116676..117131 product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene ytfJ CDS 117240..117743 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene tpx CDS 117803..118789 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 119136..120323 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 120409..120921 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 121092..122303 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 122300..123685 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene argH CDS 123750..123881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399018.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 124007..124774 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 124837..125520 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 125641..126960 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398641.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(126980..127282) product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 127413..128354 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene nrnA CDS complement(128372..128563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229407.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(128665..129168) product sporulation membrane protein YtrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229408.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene ytrI CDS complement(129165..129506) product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene ytrH CDS 129646..132993 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene dnaE CDS 133130..134362 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene maeB CDS 134696..135568 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene accD CDS 135553..136530 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene accA CDS 136714..137673 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene pfkA CDS 137715..139472 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene pyk CDS 139567..139950 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene fxsA CDS complement(139983..141098) product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399115.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene ytvI CDS 141195..141659 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 141992..143110 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene citZ CDS 143275..144546 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene icd CDS 144590..145528 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene mdh CDS 145740..146462 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene phoP CDS 146455..148194 product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene phoR CDS 148436..151078 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene polA CDS 151101..151931 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene mutM CDS 152098..152730 product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene ytaF CDS 152746..153339 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene coaE CDS complement(153376..154218) product aldo/keto reductase YtbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229455.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene ytbE CDS complement(154242..155432) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 155616..155996 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 156201..157223 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 157462..157842 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene speD CDS 158116..158574 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene nrdR CDS 158689..160110 product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene dnaB CDS 160138..161073 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene dnaI CDS 161107..161748 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229468.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 161827..162672 product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229471.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene ytxC CDS 163072..165003 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene thrS CDS complement(165044..165826) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 165993..167774 product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229477.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene lytS CDS 167752..168477 product two-component system response regulator LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229479.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene lytT CDS 168611..169051 product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399155.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene lrgA CDS 169072..169767 product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229482.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene lrgB CDS complement(169799..170458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229484.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 170573..170776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 171113..171616 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene infC CDS 171629..171829 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene rpmI CDS 171861..172220 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene rplT CDS 172276..172545 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(172562..172954) product sigma W pathway protein YsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229493.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene ysdB CDS 173138..174223 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 174418..175392 product arabinan endo-1,5-alpha-L-arabinosidase AbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene abnA CDS 175576..177066 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene araA CDS 177082..178767 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene araB CDS 178781..179470 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229501.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene araD CDS 179457..180266 product sugar-phosphatase AraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene araL CDS 180263..181447 product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene egsA CDS 181478..182779 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 182815..183756 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 183757..184602 product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene araQ CDS 184621..186123 product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene abfA CDS 186277..186603 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 186600..187154 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032393.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 187151..188041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 188153..189949 product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene cstA CDS 189983..190363 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(190400..191734) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(191731..193143) product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene glcD CDS complement(193666..194526) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(195055..195270) product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene sspI CDS 195389..196135 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 196488..197522 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene pheS CDS 197538..199952 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene pheT CDS complement(199988..200929) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245949.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene rnhC CDS 201062..201319 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene zapA CDS 201326..201859 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 201931..203643 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229538.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene polX CDS 203664..206021 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 206036..206440 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 206628..208310 product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene lcfA CDS 208428..209012 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene fadR CDS 209027..209803 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 209818..210591 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398765.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene etfB CDS 210627..211604 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene etfA CDS complement(211587..211739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 211818..213305 product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene abfB CDS 213633..213947 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene trxA CDS 214083..215855 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene uvrC CDS 216225..217454 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(217498..217944) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222508.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 218236..218844 product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene sdhC CDS 218878..220644 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene sdhA CDS 220641..221402 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene sdhB CDS 221462..221905 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 222021..222245 product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene gerE CDS 222490..222930 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 222941..223756 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886589.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene racE CDS 223872..224972 product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene gerM CDS 225083..225820 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 225842..226429 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 226445..226954 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 tRNA 227083..227158 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 CDS complement(227222..228046) product YsnF/AvaK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229586.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 228268..229578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(229719..230174) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(230374..230697) product inner spore coat protein CotQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398743.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene cotQ CDS 231514..233238 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene ilvB CDS 233235..233753 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene ilvN CDS 233777..234805 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene ilvC CDS 234792..236348 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 236369..237466 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene leuB CDS 237517..238935 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene leuC CDS 238948..239547 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene leuD CDS 239664..240668 product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene ddcA CDS 240896..242170 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene tig CDS 242442..243704 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene clpX CDS 243858..245516 product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398923.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene lonB CDS 245697..248021 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene lon CDS 248018..248605 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene yihA CDS complement(248629..249126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 249356..250723 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene hemA CDS 250842..251561 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 251598..252539 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene hemC CDS 252529..253317 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene hemD CDS 253314..254288 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene hemB CDS 254318..255610 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene hemL CDS 255744..257954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 257987..259012 product spore coat protein CotN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399056.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene cotN CDS complement(259031..259222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222590.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 259672..262314 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene valS CDS 262375..263667 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 264014..264550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 264684..265682 product stage II sporulation protein SpoIIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene spoIIB CDS 265834..266403 product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 266440..267135 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene radC CDS 267227..268240 product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene mreB CDS 268271..269143 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967915.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene mreC CDS 269140..269658 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene mreD CDS 269711..270391 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398901.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene minC CDS 270393..271199 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene minD CDS 271348..272139 product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene spoIVFA CDS 272132..272998 product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398649.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene spoIVFB CDS 273145..273453 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene rplU CDS 273456..273797 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229669.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 273810..274094 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene rpmA CDS 274414..274992 product sporulation initiation phosphotransferase Sop0B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399131.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene spo0B CDS 275026..276312 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene obgE CDS 276370..276813 product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene thrR CDS 276830..277684 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398512.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene pheA CDS complement(277707..278249) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398582.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(278209..279396) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398844.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene nifS CDS 279500..281095 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene nadB CDS 281049..281918 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene nadC CDS 281905..283011 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene nadA CDS 283127..284287 product spore coat assembly protein SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229695.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene safA CDS 284436..285035 product spore germination protein SgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene sgpA CDS 285137..285859 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398802.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(285900..287354) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 287628..287750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(287796..288443) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 288680..289774 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene iolG CDS 289787..291094 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246197.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 291142..291654 product sporulation cell-cell signaling protein BofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene bofC CDS 291793..292398 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene ruvA CDS 292409..293413 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene ruvB CDS 293406..293606 product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222669.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 293636..294664 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene queA CDS 294691..295836 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene tgt CDS 295877..296143 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene yajC CDS complement(296200..296589) product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 296787..297443 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(297447..299003) product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene spoVB CDS 299120..299416 product post-transcriptional regulator ComN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398498.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene comN CDS 299455..301668 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene secDF CDS 301826..302323 product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 302400..302732 product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 302799..305159 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene recJ CDS 305165..305677 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 305846..308050 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene relA CDS 308063..308503 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene dtd CDS complement(308528..310081) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399040.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 310214..310384 product YrzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399157.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 310381..310590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 310766..312040 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene hisS CDS 312054..313832 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene aspS CDS 314169..314933 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 sequence106 source 1..338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence107 source 1..325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 sequence108 source 1..206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence109 source 1..207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence110 source 1..320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence111 source 1..509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence112 source 1..247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence113 source 1..270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence114 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence115 source 1..768244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..710) product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244403.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene opuCD CDS complement(728..1645) product osmoprotectant ABC transporter substrate-binding lipoprotein OpuCC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228350.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene opuCC CDS complement(1659..2312) product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228349.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene opuCB CDS complement(2335..3474) product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene opuCA CDS 3738..4295 product opuC operon transcriptional regulator OpcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244093.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene opcR CDS 4308..4637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 4822..5520 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228340.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(5558..7363) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 7495..7956 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(7999..9291) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene eno CDS complement(9320..10855) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene gpmI CDS complement(10848..11609) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene tpiA CDS complement(11640..12824) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(13133..14140) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene gap CDS complement(14187..15209) product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene cggR CDS complement(15510..16904) product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene araE CDS 17108..18196 product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene araR CDS complement(18245..19255) product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(19746..21089) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228313.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(21490..22524) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228311.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(22631..23353) product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene lutC CDS complement(23353..24792) product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene lutB CDS complement(24819..25535) product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene lutA CDS complement(25710..26327) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(26324..26653) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(26773..27375) product two-component system response regulator YvfU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228302.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene yvfU CDS complement(27392..28507) product two-component system sensor histidine kinase YvfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228300.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene yvfT CDS complement(28511..29248) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228297.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(29249..30154) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228295.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 30439..31248 product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene rsbQ CDS 31283..32494 product phosphoserine phosphatase RsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene rsbP CDS complement(32535..33431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 note possible pseudo, frameshifted CDS complement(33566..33826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 note possible pseudo, frameshifted CDS complement(33907..35967) product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene ganA CDS complement(35988..36839) product arabinogalactan oligomer ABC transporter permease GanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228283.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene ganQ CDS complement(36843..38099) product arabinogalactan oligomer ABC transporter permease GanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243623.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene ganP CDS complement(38139..39404) product arabinogalactan oligomer ABC transporter substrate-binding protein GanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene ganS CDS complement(39546..40538) product galactan degradation operon transcriptional regulator GanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene ganR CDS complement(40720..41442) product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene lutR CDS 41670..43361 product L-lactate permease LutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228275.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene lutP CDS complement(43388..44698) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene rpoN CDS 44777..44995 product protein YvfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219905.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene yvfG CDS complement(45006..45971) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(45950..47116) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(47133..47771) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(47768..48376) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(48373..49821) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(49887..50921) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(50918..51994) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(51999..53033) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(53058..54161) product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene epsG CDS complement(54165..55313) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(55306..56142) product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene epsE CDS complement(56139..57284) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(57296..59116) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244548.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(59352..60035) product protein tyrosine kinase EpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228249.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene epsB CDS complement(60041..60745) product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228247.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 60991..61449 product transcriptional regulator SlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242589.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene slrR CDS 61524..62993 product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene pnbA CDS 62996..63187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(63214..63699) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243190.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene padC CDS complement(63721..64176) product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084993485.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(64303..64986) product broad specificity amino-acid racemase RacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene racX CDS complement(65002..66357) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 67113..68534 product levansucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022105.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene sacB CDS 68611..70161 product 2,6-beta-fructan 6-levanbiohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene levB CDS 70269..71831 product aspartate/proton symporter AspP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene aspP CDS 71926..72510 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 72591..72926 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 72926..73240 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228222.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(73282..73794) product DUF3231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243249.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 tRNA complement(73945..74025) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 CDS 74295..74891 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene clpP CDS complement(74926..75501) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 75619..75939 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242570.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(75966..77567) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(77586..78170) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 78576..79550 product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(79586..81520) product lantibiotic ABC transporter permease PsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243432.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene psdB CDS complement(81495..82274) product lantibiotic ABC transporter ATP-binding protein PsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228167.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene psdA CDS complement(82357..83427) product two-component sensor histidine kinase PsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene psdS CDS complement(83421..84134) product two-component system response regulator PsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene psdR CDS 84281..84490 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243327.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(84526..85281) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(85290..85547) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(85571..86521) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene whiA CDS complement(86543..87496) product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene mgfK CDS complement(87498..88385) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene rapZ CDS complement(88410..88856) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886622.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(89207..90157) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene trxB CDS complement(90376..91785) product peptidoglycan DL-endopeptidase CwlO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene cwlO CDS complement(92166..93620) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242799.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(93745..95514) product multidrug resistance ABC transporter ATP-binding protein/permease BmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243345.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene bmrA CDS complement(95679..96038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(96053..97939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242583.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(97929..98582) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244157.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(98895..99518) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene hisIE CDS complement(99515..100273) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene hisF CDS complement(100270..101007) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene hisA CDS complement(101004..101642) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene hisH CDS complement(101643..102227) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene hisB CDS complement(102224..103507) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene hisD CDS complement(103504..104145) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene hisG CDS complement(104138..105316) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 105563..106306 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243552.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 106561..107226 product pectate/pectin lyase PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242578.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene pelC CDS complement(107249..107767) product heptaprenylglyceryl phosphate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244270.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene hprF CDS complement(107771..108421) product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene ppaX CDS complement(108418..109356) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(109380..110189) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene lgt CDS complement(110203..111135) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene hprK CDS 111317..112507 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene nagA CDS 112504..113232 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene nagB CDS 113250..113981 product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene nagR CDS complement(114000..117869) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 118034..118507 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228083.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(118548..119765) product pulcherriminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244436.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene cypX CDS complement(119780..120526) product cyclo(L-leucyl-L-leucyl) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242712.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene pchC CDS 120966..121475 product pulcherriminic acid biosynthesis transcriptional regulator PchR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228073.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene pchR CDS 121497..122708 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228068.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(122738..123097) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(123099..123296) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228065.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(123301..124398) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228061.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(124423..124749) product protein YvlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244375.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene yvlA CDS 124968..125198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(125242..128115) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene uvrA CDS complement(128123..130108) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene uvrB CDS complement(130293..130523) product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228053.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 131493..133988 product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 134065..134628 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244088.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 134663..135997 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242625.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(136045..137241) product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene minJ CDS complement(137320..137673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(138056..139498) product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene ctpB CDS complement(139835..140734) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene ftsX CDS complement(140718..141404) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene ftsE CDS complement(141639..141989) product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242725.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene cccB CDS complement(142026..142871) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242677.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(143039..144022) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene prfB CDS complement(144210..146735) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene secA CDS complement(146904..147473) product ribosome hibernation promotion factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228031.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene hpf CDS complement(147494..147712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(148051..148392) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene fliT CDS complement(148389..148790) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene fliS CDS complement(148812..150308) product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(150326..150655) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968250.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene flaG CDS complement(150885..151712) product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene hag CDS complement(151857..152081) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene csrA CDS complement(152075..152506) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene fliW CDS complement(152527..153102) product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(153149..154045) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene flgL CDS complement(154055..155578) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene flgK CDS complement(155597..156079) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene flgN CDS complement(156095..156361) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227997.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene flgM CDS complement(156442..156861) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(156934..157413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(157620..157916) product late competence protein ComFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene comFB CDS complement(157985..159370) product ATP-dependent helicase ComFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243962.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene comFA CDS complement(159475..160320) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(160418..161107) product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene degU CDS complement(161190..162347) product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene degS CDS 162563..163216 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 163216..164340 product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene tagV CDS complement(164414..165490) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(165635..166834) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(166857..167615) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(167639..168319) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243110.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(168348..169814) product teichuronic acid biosynthesis protein TuaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886625.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene tuaE CDS complement(169898..171292) product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene tuaD CDS complement(171345..172514) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242807.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(172511..173965) product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(174018..174677) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(174912..176816) product poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene tarS CDS complement(177035..178522) product N-acetylmuramoyl-L-alanine amidase LytC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene lytC CDS complement(178610..180763) product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(180791..181114) product membrane-bound protein LytA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242772.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene lytA CDS 181327..182247 product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene lytR CDS complement(182288..183430) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene wecB CDS complement(183453..185354) product poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene tarS CDS complement(185432..186952) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727141.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(186987..188354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 188696..189574 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227944.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene galU CDS complement(189613..191196) product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene tagH CDS complement(191216..192043) product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene tagG CDS complement(192260..194287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(194312..195088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(195085..197769) product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene ggaB CDS complement(197810..199156) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(199187..200371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(200475..200864) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227921.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene tagD CDS 201373..202146 product N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D- mannosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene tagA CDS 202242..203393 product teichoic acid glycerol-phosphate primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968271.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene tagB CDS 203482..204195 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 204192..205217 product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 205221..206390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 206397..208268 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645039.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(208307..210949) product beta-N-acetylglucosaminidase LytD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243594.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene lytD CDS complement(211077..212027) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244253.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene manA CDS 212294..213745 product spore germination protein GerBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243291.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene gerBA CDS 213751..214857 product spore germination protein GerBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244581.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene gerBB CDS 214854..215987 product spore germination protein GerBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242990.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene gerBC CDS complement(216024..217397) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 217735..218703 product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene tagT CDS 218861..219721 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YwtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244395.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene ywtE CDS complement(219756..220997) product gamma-DL-glutamyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene pgdS CDS complement(221138..221305) product extrachromosomal elements maintenance protein EdmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227896.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene edmS CDS complement(221320..222462) product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene pgsA CDS complement(222481..222930) product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227889.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene pgsC CDS complement(222945..224126) product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 gene pgsB CDS 224908..225897 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968279.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 225890..226771 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene rbsK CDS 226768..227163 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene rbsD CDS 227179..228660 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene rbsA CDS 228662..229630 product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene rbsC CDS 229644..230561 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene rbsB CDS 230671..231207 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243596.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 231362..231658 product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243460.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(231699..232226) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(232325..233092) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244457.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene budA CDS complement(233154..234866) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244057.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene alsS CDS 235026..235913 product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227859.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene alsR CDS complement(235952..237043) product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227854.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene cotH CDS 237185..237625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 237796..238413 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227852.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 238576..238911 product DUF4181 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(238916..240493) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene ggt CDS 240708..241184 product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene chrS CDS 241198..241791 product chromate efflux transporter subunit ChrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene chrB CDS 241788..242324 product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene chrA CDS complement(242351..242572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243378.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(242569..243114) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242945.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 243237..244118 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(244179..246464) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 246622..247488 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(247520..248236) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243213.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(248293..248784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(248997..249650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(249727..250278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(250861..251412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(251417..253318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(253337..253597) product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(253607..254029) product DUF5082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(254096..254359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(254401..255723) product UDP-glucose 6-dehydrogenase UglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243223.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene uglF CDS complement(255919..256683) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(256733..257449) product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene ptkA CDS complement(257439..258185) product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene tkmA CDS complement(258420..258563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242876.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 258767..260377 product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227806.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 260364..263132 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227803.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(263261..264118) product phosphatase YwpJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242946.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene ywpJ CDS complement(264124..264900) product transcriptional regulator GlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244075.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene glcR CDS complement(265125..265466) product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene ssbB CDS complement(265543..265926) product DynA interaction protein YwpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227796.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene ywpG CDS 266091..266513 product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227794.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(266646..267284) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(267381..273323) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(273644..274720) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 274894..277974 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(278014..278406) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene mscL CDS complement(278482..278907) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene fabZ CDS 279099..280163 product aspartate phosphatase RapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227782.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene rapD CDS complement(280184..280993) product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene flhP CDS complement(281027..281878) product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene flhO CDS complement(282001..283002) product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene mbl CDS complement(283181..283462) product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene spoIIID CDS 283811..284224 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227771.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 284246..285436 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(285532..286938) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(287045..288511) product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243156.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene pucI CDS complement(288692..289996) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243939.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(290050..290619) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227761.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(290804..291265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244424.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 291536..292750 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene amtB CDS 292762..293112 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221829.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 293290..293871 product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene bcrC CDS complement(293897..294334) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227753.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(294445..295317) product stage II sporulation protein spoIIQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene spoIIQ CDS 295452..295949 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886629.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 295946..296455 product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227749.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 296686..298476 product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627530.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(298583..299017) product DUF5392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 299261..300709 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene cls CDS complement(300731..301504) product transcriptional activator Mta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242936.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene mta CDS 301650..302039 product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227738.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(302074..302715) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(302784..303185) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227734.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(303319..305028) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene ureC CDS complement(305025..305399) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene ureB CDS complement(305396..305713) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene ureA CDS complement(305813..306514) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene urtE CDS complement(306511..307260) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene urtD CDS complement(307235..308305) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene urtC CDS complement(308317..309219) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene urtB CDS complement(309252..310508) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene urtA CDS complement(310717..310905) product stress response protein CsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227718.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene csbD CDS complement(310977..311456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(311627..312760) product response regulator aspartate phosphatase RapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene rapB CDS complement(312957..313982) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene moaA CDS complement(313998..314786) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene fdhD CDS complement(314886..315047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(315143..315817) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243553.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(316139..316822) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(317209..318240) product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene spoIID CDS complement(318436..319746) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene murA CDS complement(319780..320520) product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(320655..320885) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 321063..321536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243900.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(321571..321969) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(321993..323414) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227686.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene atpD CDS complement(323440..324303) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene atpG CDS complement(324380..325888) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene atpA CDS complement(325905..326450) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(326447..326959) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene atpF CDS complement(327122..327334) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene atpE CDS complement(327380..328114) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene atpB CDS complement(328122..328508) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243159.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene atpI CDS complement(328925..329554) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene upp CDS complement(329689..330936) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene glyA CDS complement(331142..331684) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(331697..332146) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene rpiB CDS complement(332302..332754) product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene prpB CDS complement(332832..333389) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(333467..334507) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227659.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(334665..335108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(335175..335849) product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene spoIIR CDS 335990..336352 product UPF0715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(336371..336655) product DUF5316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244050.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(336717..337583) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene prmC CDS complement(337585..338655) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene prfA CDS 338784..339167 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 339289..339843 product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227642.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene racA CDS complement(339878..340834) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242497.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(340916..342613) product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227639.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene malS CDS complement(342902..343489) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(343578..343778) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene rpmE CDS complement(343897..345180) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene rho CDS complement(345583..346548) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242962.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene glpX CDS complement(346579..347868) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(348247..348885) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene fsa CDS complement(349004..349861) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(350041..350412) product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene spo0F CDS 350581..351102 product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242809.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(351185..352792) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene pyrG CDS complement(353032..353553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(353736..354875) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene acdA CDS complement(354872..356989) product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 357144..358343 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227602.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene cls CDS 358356..359318 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene uvsE CDS 359399..359671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(359721..360245) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227595.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(360255..361898) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(362068..363570) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242612.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene cls CDS complement(363672..364301) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(364473..365144) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242665.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene narI CDS complement(365141..365695) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene narJ CDS complement(365721..367184) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene narH CDS complement(367174..370860) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(371078..371554) product Crp/Fnr family transcriptional regulator ArfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243032.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene arfM CDS 371737..372417 product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(372450..373166) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene fnr CDS complement(373264..374451) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene narK CDS complement(374586..376256) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene argS CDS complement(376253..376681) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 376995..377126 product subtilosin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222002.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene sboA CDS 377271..378617 product subtilosin maturase AlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene albA CDS 378630..378791 product antilisterial bacteriocin subtilosin biosynthesis protein AlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222006.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene albB CDS 378788..379507 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 379500..380810 product antilisterial bacteriocin subtilosin biosynthesis protein AlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243158.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene albD CDS 380776..381960 product antilisterial bacteriocin subtilosin biosynthesis protein AlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886633.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene albE CDS 381965..383248 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242974.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 383245..383946 product antilisterial bacteriocin subtilosin biosynthesis protein AlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene albG CDS complement(384083..385438) product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227552.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 385665..386810 product response regulator aspartate phosphatase RapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene rapF CDS 386794..386913 product phosphatase RapF inhibitor PhrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968329.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene phrF CDS complement(387066..387938) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene speB CDS complement(387999..388829) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene speE CDS 389031..391106 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(391427..391945) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(391958..392617) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 392726..392914 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(392958..393377) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242889.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(393497..395413) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene thrS CDS complement(396316..396816) product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(396852..398153) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(398315..398539) product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 398754..399539 product prespore-specific transcription regulator RsfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene rsfA CDS complement(399683..400573) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(400742..401587) product octanoyl-[GcvH]:protein N-octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227511.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene ywfL CDS complement(401635..402534) product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene cysL CDS complement(402681..403652) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene pta CDS 403922..404686 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 404819..405598 product NADPH-dependent reductase BacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244095.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene bacG CDS complement(405613..406812) product transaminase BacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242568.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene bacF CDS complement(406813..407997) product bacilysin exporter BacE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene bacE CDS complement(407994..409412) product alanine--anticapsin ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene bacD CDS complement(409431..410192) product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene bacC CDS complement(410195..410902) product 3-((4R)-4-hydroxycyclohexa-1,5-dien-1-yl)-2-oxopropanoate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 gene bacB CDS complement(410892..411506) product prephenate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968341.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene bacA CDS complement(411659..412897) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242790.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(413114..414526) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244348.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(414526..416226) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(416299..417846) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene pruA CDS complement(418085..419359) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene rocG CDS complement(419533..419997) product biofilm-surface layer protein BslB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242493.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene bslB CDS complement(420322..420777) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(420770..421621) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene rfbD CDS complement(421635..422585) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244201.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene rfbB CDS complement(422582..423322) product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243368.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(423347..424366) product PseG/SpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244190.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(424369..425091) product spore coat polysaccharide biosynthesis protein SpsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243421.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(425084..426205) product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243135.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(426205..427074) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243179.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(427075..428244) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(428265..429689) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243510.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(429694..430464) product spore coat dTDP-glycosyltransferase SpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244383.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene spsA CDS 430784..431329 product spore coat protein GerQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227448.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene gerQ CDS complement(431373..431744) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(431806..433137) product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886635.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(433147..433464) product YwdI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243806.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 433632..435002 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227441.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(435028..435705) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(435719..436525) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242519.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(436615..437148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968358.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(437196..437831) product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227434.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(437824..438162) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 438306..439121 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(439210..439458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243437.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(439551..440990) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene sacA CDS complement(440987..442372) product PTS system sucrose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene scrA CDS 442673..443443 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243563.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(443482..444312) product sac operon transcriptional antiterminator SacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243088.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene sacT CDS complement(444352..444654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222155.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 445183..447603 product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene vpr CDS complement(447641..448642) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244349.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(448818..449567) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244098.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene nfsA CDS complement(449673..450857) product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227413.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene rodA CDS complement(451186..451488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 note possible pseudo, internal stop codon, frameshifted CDS complement(451493..451639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(451745..452167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 note possible pseudo, internal stop codon, frameshifted CDS 452440..452700 product spore morphogenesis/germination protein YwcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227411.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene ywcE CDS complement(452941..453315) product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene qoxD CDS complement(453317..453931) product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227409.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene qoxC CDS complement(453945..455894) product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene qoxB CDS complement(455922..456878) product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886637.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene qoxA CDS 457401..457646 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968363.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(457716..459257) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene galT CDS complement(459261..460433) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227400.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(460518..460922) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(460919..461590) product transcriptional regulator SlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene slrC CDS 461943..462101 product transcriptional regulator SlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243648.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene slrA CDS 462541..462849 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227392.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 462846..464387 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227390.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(464420..465019) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(465108..466358) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243445.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene efeB CDS complement(466377..466715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(466871..467533) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene thiE CDS complement(467530..468348) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244274.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene thiM CDS complement(468356..469261) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 469367..469753 product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227375.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 469735..470412 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(470467..471117) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(471819..472091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(472519..473316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(473382..473813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 474221..475423 product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 475457..475654 product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(475689..476876) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244593.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 476998..477378 product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene glxA CDS complement(477416..478093) product DUF2711 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242887.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(478174..479496) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene celB CDS 479720..481657 product minor protease Epr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243950.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene epr CDS 482101..483480 product SacY negative regulator SacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene sacX CDS 483534..484376 product transcription antiterminator SacY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244589.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene sacY CDS complement(484429..485289) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(485400..486113) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 486264..486779 product tyrZ transcriptional regulator YwaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243598.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene ywaE CDS 487031..488269 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886638.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene tyrS CDS 488424..489791 product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 gene ywaD CDS complement(489818..490450) product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene ywaC CDS complement(490690..491202) product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(491556..492491) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968370.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 493087..494601 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene dltA CDS 494598..495785 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene dltB CDS 495802..496038 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene dltC CDS 496038..497216 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227323.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene dltD CDS 497304..498062 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 498204..499295 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(499329..500657) product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene licH CDS complement(500654..500917) product PTS lichenan transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene licA CDS complement(501005..502363) product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene licC CDS complement(502379..502687) product PTS lichenan transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218755.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene licB CDS complement(502811..504736) product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene licR CDS complement(505075..505665) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227303.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 505794..507437 product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene katX CDS 507539..508741 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(508738..509514) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243335.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(509511..510398) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244494.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(510405..510593) product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227293.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(510590..510796) product sigma Y negative regulator YxlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242917.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene yxlD CDS complement(510793..511113) product YxlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227289.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(511106..511642) product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene sigY CDS 511854..513224 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244111.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(513238..514068) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(514155..515882) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244401.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene cydC CDS complement(515879..517582) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244017.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene cydD CDS complement(517582..518598) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244559.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene cydB CDS complement(518582..519988) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243795.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene cydA CDS 520545..521897 product citrate/malate transporter CimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene cimH CDS 522022..523509 product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886639.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 523768..523968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(523982..524821) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244194.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(525092..525442) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232839.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(525657..526385) product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(526491..527588) product maltodextrin ABC transporter ATP-binding protein MsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242648.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene msmX CDS complement(527708..528601) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242549.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 528787..530244 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243062.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(530284..531120) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242615.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 531580..532218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(532294..533313) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene galE CDS 533832..535064 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene pepT CDS 535169..535294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 535681..535851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 536027..536515 product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 536772..537905 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244296.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 538058..538252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 538158..539294 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244221.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(539346..540119) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244042.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(540136..540792) product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243049.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(540789..541505) product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(541529..542947) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243205.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(543098..543658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 544573..545766 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227216.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(545811..546482) product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810357.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(546625..546915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(546965..549025) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 549221..550501 product citrate transporter CitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227205.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene citH CDS 550600..551184 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886423.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(551222..552328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(552425..553846) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(553867..555699) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(556014..556847) product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene licT CDS complement(556942..557622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886641.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 557828..559114 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(559133..560572) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243023.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene dbpA CDS complement(560654..561802) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 561967..562302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 562305..562862 product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986155.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(562881..563318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(563920..564270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(564288..564740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243382.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(564756..565052) product YxiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(565045..565374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(565401..565883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(565914..566672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(566698..567183) product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(567203..567778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227178.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(567802..568014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 note possible pseudo, frameshifted CDS complement(568079..568948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(569121..569498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(569645..570076) product immunity protein WapI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227169.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene wapI CDS complement(570224..570685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227174.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(570687..570932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(571199..571504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 note possible pseudo, internal stop codon, frameshifted CDS complement(571646..572014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 note possible pseudo, frameshifted CDS complement(572069..572917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(572970..579986) product tRNA nuclease WapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243665.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene wapA CDS complement(580156..581094) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227165.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(581261..581506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 note possible pseudo, internal stop codon, frameshifted CDS complement(581612..581875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 note possible pseudo, internal stop codon CDS 582285..583049 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(583293..583739) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(583843..585252) product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene bglH CDS complement(585274..587112) product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene bglP CDS complement(587505..587804) product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242733.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(587946..588209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(588356..588742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(588795..589022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963460.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(589033..589482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(589643..589975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048526177.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(589997..591601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(591621..591890) product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(591902..592267) product DUF5082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968400.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(592576..593994) product arabinan endo-1,5-alpha-L-arabinosidase AbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244268.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene abnB CDS complement(594068..595057) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 595300..595746 product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243875.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene hutP CDS 595859..597385 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene hutH CDS 597382..599040 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243634.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene hutU CDS 599053..600318 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene hutI CDS 600311..601267 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene hutG CDS 601346..602773 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227134.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(602816..604117) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(604147..605328) product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244143.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene nupC CDS complement(605423..606094) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244069.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene deoC CDS complement(606200..607141) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene deoR CDS complement(607277..608107) product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243667.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(608172..609281) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243423.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene eutH CDS complement(609351..610688) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(610685..611827) product N-acetyl-sulfur-metabolite deacetylase SndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243840.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene sndB CDS complement(611844..612593) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(612606..613280) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(613303..614097) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(614122..614619) product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene snaB CDS complement(614633..615958) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(616336..617322) product penicillin V amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243495.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene yxeI CDS complement(617730..618542) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene yidA CDS complement(618582..619142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242636.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(619162..619557) product YxeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244165.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 619658..620023 product inner spore coat protein CotNE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227093.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene cotNE CDS 620274..620627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(620670..621068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 621245..622210 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243725.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(622251..622598) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227084.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(622611..624479) product ABC transporter permease YxdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244410.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene yxdM CDS complement(624454..625227) product ABC transporter ATP-binding protein YxdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243557.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene yxdL CDS complement(625373..626350) product two-component system sensor histidine kinase YxdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243885.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene yxdK CDS complement(626347..627036) product two-component system response regulator YxdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene yxdJ CDS complement(627145..628017) product 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242766.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene iolJ CDS complement(628038..628874) product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene iolI CDS complement(628961..629830) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243149.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(629852..630886) product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene iolG CDS complement(630909..632225) product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene iolF CDS complement(632240..633133) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227062.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene iolE CDS complement(633150..635063) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242642.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene iolD CDS complement(635096..636073) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene iolC CDS complement(636097..636912) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243247.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene iolB CDS complement(636987..638450) product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243682.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene iolA CDS 638868..639623 product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene iolR CDS 639677..640609 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243075.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(641112..641240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 641404..641589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 641593..641901 product YxcD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 642107..643492 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244055.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(643532..645412) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene htpG CDS complement(645607..645843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 645959..646780 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244072.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 646999..647166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(647801..648940) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243187.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 649083..650420 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243415.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(650778..651203) product DUF5391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242533.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 651455..651910 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242940.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(651940..653148) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(653255..654268) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243000.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene qdoI CDS complement(654360..654935) product transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227022.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene yxaF CDS 655065..656129 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(656186..656617) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243994.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 656845..657249 product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968420.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 657219..657911 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227015.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 658112..659689 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(659727..660758) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(660850..661998) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 662194..662925 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene gntR CDS 662918..664459 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968422.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene gntK CDS 664488..665834 product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243139.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene gntP CDS 665858..667264 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243876.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene gnd CDS 667784..668347 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243686.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene ahpC CDS 668361..669890 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243077.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene ahpF CDS complement(670002..671354) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(671645..673084) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene bglA CDS complement(673098..674966) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 675121..675831 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(675963..676133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 676294..678219 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243329.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene fbp CDS 678298..678459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(679072..680538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(680933..681598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(681601..683376) product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(683366..686707) product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene drmA CDS complement(686723..689062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(689092..689571) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene rlmH CDS complement(689652..689822) product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219122.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 690007..690282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 note possible pseudo, frameshifted CDS complement(690504..690674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244248.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 690822..691118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(691190..692347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243905.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(692358..693095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243470.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(693251..693721) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243975.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 693832..694929 product response regulator aspartate phosphatase RapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243386.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene rapG CDS complement(695082..695972) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene rocF CDS complement(696046..697449) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(697674..698879) product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene rocD CDS 699120..700505 product arginine utilization regulatory protein RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244510.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene rocR CDS complement(700447..700749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(700894..702102) product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene htrC CDS complement(702187..702981) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(703004..703846) product WalRK two-component regulatory system regulator WalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene walI CDS complement(703833..705209) product WalRK two-component regulatory system regulator WalH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene walH CDS complement(705190..707025) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene walK CDS complement(707033..707743) product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene walR tRNA complement(708123..708196) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(708232..708308) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA complement(708391..708462) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(708472..708547) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 CDS complement(708768..710060) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene purA CDS complement(710266..710685) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(710802..712166) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene dnaB CDS 712336..712536 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226922.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(712581..712784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244312.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 712905..713048 product YycC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242786.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 713121..714329 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226917.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 714446..716536 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242651.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(716573..717022) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene rplI CDS complement(717019..718998) product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene gdpP CDS complement(719035..719964) product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243969.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(720190..720339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226909.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 720484..720966 product spore coat protein CotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243364.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene cotF CDS complement(720996..721373) product transcriptional regulator HypR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242487.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene hypR CDS 721579..722508 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(722744..723190) product DUF6376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 723648..724937 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 725209..725364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 725389..725571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(725712..726512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244492.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(726619..727578) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243239.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 728006..728884 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 728899..729342 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226881.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 729425..729904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243923.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(730020..730682) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226877.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 730788..731078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 note possible pseudo, frameshifted CDS 731244..732161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231350.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(732250..732702) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226875.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 732823..733269 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243577.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 733266..733856 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 734145..736214 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(736211..737110) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244361.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 737337..738692 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243011.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(738725..739279) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242928.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(739297..739677) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(739733..740668) product transcriptional regulator CcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene ccpB CDS complement(740727..741485) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243194.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene xth CDS complement(741546..741785) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene rpsR CDS complement(741829..742347) product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219228.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene ssbA CDS complement(742388..742675) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene rpsF CDS complement(742786..743886) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene ychF CDS complement(744013..746016) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244290.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(746067..746273) product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(746367..747380) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 747799..748416 product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene yyaC CDS complement(748456..749304) product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene spo0J CDS complement(749297..750058) product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 gene soj CDS 750302..750742 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244005.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(750792..751643) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 gene noc CDS complement(751765..752484) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene rsmG CDS complement(752498..754384) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene mnmG CDS complement(754405..755784) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene mnmE CDS complement(756096..756722) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(756719..757480) product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene spoIIIJ CDS complement(757649..757999) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene rnpA CDS complement(758151..758285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(758476..758697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 758905..760245 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene dnaA CDS 760433..761569 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene dnaN CDS 761701..761916 product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene rlbA CDS 761932..763044 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene recF CDS 763067..763312 product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene remB CDS 763361..765283 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene gyrB CDS 765500..767965 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene gyrA CDS 767940..768107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 sequence116 source 1..292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence117 source 1..244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence118 source 1..213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence119 source 1..391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(190..390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 sequence120 source 1..250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence121 source 1..299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence122 source 1..374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence123 source 1..369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence124 source 1..203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence125 source 1..261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..59867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..1047 product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene pdaB CDS complement(1048..1644) product KinB-signaling pathway activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399693.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene kbaA CDS 1754..2311 product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235126.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene gerD CDS complement(2346..3404) product iron-sulfur carrier protein/transcriptional regulator SalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235124.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene salA CDS complement(3500..4213) product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene cwlD CDS complement(4273..4716) product YbaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235118.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(4913..5680) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399665.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 5924..6058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(6164..6556) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene rpsI CDS complement(6577..7014) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241966.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene rplM CDS complement(7176..7919) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene truA CDS complement(7929..8726) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(8723..9592) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886389.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(9568..10413) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(10544..10906) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene rplQ CDS complement(10984..11928) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(12105..12500) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene rpsK CDS complement(12521..12886) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene rpsM CDS complement(13056..13274) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene infA CDS complement(13585..14331) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene map CDS complement(14328..14981) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(15036..16331) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399662.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene secY CDS complement(16333..16773) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene rplO CDS complement(16804..16983) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene rpmD CDS complement(16997..17503) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene rpsE CDS complement(17522..17884) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene rplR CDS complement(17917..18456) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene rplF CDS complement(18486..18884) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene rpsH CDS complement(18916..19101) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene rpsN CDS complement(19124..19663) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene rplE CDS complement(19690..20001) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene rplX CDS complement(20038..20406) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225805.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene rplN CDS complement(20447..20710) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene rpsQ CDS complement(20733..20933) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene rpmC CDS complement(20923..21357) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene rplP CDS complement(21359..22015) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rpsC CDS complement(22019..22360) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene rplV CDS complement(22377..22655) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156472.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene rpsS CDS complement(22713..23546) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene rplB CDS complement(23578..23865) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene rplW CDS complement(23865..24488) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene rplD CDS complement(24516..25145) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene rplC CDS complement(25185..25493) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene rpsJ CDS complement(25731..26687) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235060.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(26788..27978) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 gene tuf CDS complement(28098..30176) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene fusA CDS complement(30229..30699) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene rpsG CDS complement(30741..31157) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene rpsL CDS complement(31271..31519) product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(31695..35294) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene rpoC CDS complement(35356..38937) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene rpoB CDS complement(39185..39790) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235045.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(39880..40251) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156436.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene rplL CDS complement(40295..40795) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene rplJ CDS complement(41048..41746) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene rplA CDS complement(41841..42266) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene rplK CDS complement(42434..42967) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene nusG CDS complement(43147..43326) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene secE CDS complement(43602..44258) product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene sigH CDS complement(44321..44833) product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene rae1 CDS complement(44840..45589) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene rlmB CDS complement(45573..46004) product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(46008..47408) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene cysS CDS complement(47405..48058) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225749.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene cysE CDS complement(48362..49813) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene gltX CDS complement(49904..50380) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene ispF CDS complement(50373..51071) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene ispD CDS complement(51086..52186) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(52300..53382) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene disA CDS complement(53386..54666) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene radA CDS complement(54854..57286) product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene clpC CDS complement(57283..58374) product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(58374..58931) product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene mcsA CDS complement(58945..59409) product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene ctsR rRNA complement(59658..59768) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 sequence127 source 1..332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence128 source 1..291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence129 source 1..351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence130 source 1..294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence131 source 1..278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence132 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence133 source 1..297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence134 source 1..271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence135 source 1..273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence136 source 1..529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence137 source 1..294309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1034..1591) product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene nudF CDS 1665..1787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 1851..2771 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(2803..3027) product YqkE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886561.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 3191..4108 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(4147..5286) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene ftsW CDS complement(5289..6446) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene rodA CDS complement(6462..7106) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123715.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(7574..7813) product YqkC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230411.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(7827..8150) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(8147..9178) product bifunctional GNAT family N-acetyltransferase/GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398771.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(9175..9513) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(9526..9996) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(10186..10524) product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398477.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(10521..11756) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 11926..12132 product YqzH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398642.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(12158..12439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 12649..13881 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398495.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 13933..14118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(14087..14473) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398989.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(14478..15437) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245966.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene coaA CDS complement(15509..16855) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399082.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene dsdA CDS complement(16933..17712) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398795.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(17718..18677) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 19080..19916 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398788.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene proC CDS complement(19966..21600) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398867.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 21774..22790 product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230377.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene namA CDS 22900..23661 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230373.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(23724..24389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 note possible pseudo, frameshifted CDS complement(24573..24905) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017149794.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(25007..25156) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene rpmG CDS complement(25236..26159) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene rnz CDS 26385..27854 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene zwf CDS complement(27986..29395) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene gndA CDS complement(29506..30750) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 30814..31110 product membrane protein insertion/folding monitor MifM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene mifM CDS 31141..31968 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230359.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 32133..32861 product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(32910..34025) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(34043..35572) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886564.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(35559..35981) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399095.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene mce CDS complement(36184..36714) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398604.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(36766..37734) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(37807..38529) product arginine ABC transporter ATP-binding protein ArtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398740.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene artR CDS complement(38522..39181) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230340.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene artQ CDS complement(39260..40027) product arginine ABC transporter substrate-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398706.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene artP CDS complement(40295..40732) product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene brxB CDS 40891..41775 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230330.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 41857..43026 product multidrug efflux MFS transporter Bmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230328.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene bmr CDS 43099..43935 product multidrug efflux transcriptional regulator BmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230325.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene bmrR CDS complement(43996..45273) product branched-chain alpha-keto dehydrogenase complex dihydrolipoyllysine-residue (2-methylpropanoyl)transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230323.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene bfmBB CDS complement(45295..46278) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398638.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene bfmBAB CDS complement(46292..47284) product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene bfmBAA CDS complement(47306..48730) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene lpdA CDS complement(48752..49837) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene buk CDS complement(49862..50956) product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene bcd CDS complement(50968..51867) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398694.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene yqiS CDS complement(51993..54068) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398669.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 54221..54457 product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230304.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(54500..55405) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398772.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene prpB CDS complement(55425..56843) product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398686.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(56865..57983) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230298.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene mmgD CDS complement(58016..59155) product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(59182..60045) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230294.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(60069..61250) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230291.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(61378..62109) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(62189..62809) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886565.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(62829..63125) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230284.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 63452..63586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 63659..64777 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(65318..66121) product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene spo0A CDS complement(66398..67678) product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene spoIVB CDS complement(67852..69582) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene recN CDS complement(69618..70067) product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene argR CDS complement(70164..71009) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(71006..72907) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene dxs CDS complement(73088..73978) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(73968..74222) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(74219..75565) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene xseA CDS complement(75704..76555) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene folD CDS complement(76567..76962) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene nusB CDS complement(77227..77634) product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene yqhY CDS complement(77655..79007) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene accC CDS complement(79019..79501) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene accB CDS complement(79658..80314) product stage III sporulation ratchet engulfment protein SpoIIIAH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230250.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene spoIIIAH CDS complement(80315..81004) product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene spoIIIAG CDS complement(80997..81617) product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230233.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene spoIIIAF CDS complement(81631..82830) product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene spoIIIAE CDS complement(82849..83250) product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene spoIIIAD CDS complement(83257..83463) product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene spoIIIAC CDS complement(83486..84001) product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene spoIIIAB CDS complement(83995..84918) product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene spoIIIAA CDS complement(84994..85275) product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(85425..85982) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene efp CDS complement(86007..87068) product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene papA CDS complement(87071..87511) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene aroQ CDS complement(87599..88132) product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 88361..89317 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967716.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 89357..89752 product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226367.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(89749..90624) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(90749..91177) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene mntR CDS complement(91277..92113) product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene lipM CDS 92304..92684 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398485.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(92722..94188) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene gcvPB CDS complement(94181..95527) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene gcvPA CDS complement(95557..96645) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene gcvT CDS 97088..98761 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 98782..99576 product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230200.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 99762..99935 product anti-repressor SinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230187.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 99969..100304 product transcriptional regulator SinR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226345.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene sinR CDS complement(100398..101183) product biofilm matrix protein TasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398632.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene tasA CDS complement(101247..101831) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(101803..102564) product amyloid fiber anchoring/assembly protein TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399106.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene tapA CDS 102836..103159 product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246051.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(103201..103380) product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230176.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(103452..103826) product ComG operon protein ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230170.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene comGG CDS complement(103827..104186) product ComG operon protein ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230168.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene comGF CDS complement(104236..104583) product ComG operon protein 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230165.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene comGE CDS complement(104567..104998) product comG operon protein ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398628.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene comGD CDS complement(104988..105284) product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene comGC CDS complement(105298..106335) product comG operon protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246116.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene comGB CDS complement(106322..107392) product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene comGA CDS complement(107605..108021) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(108078..109031) product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399136.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene corA CDS 109175..110503 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967730.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(110555..111394) product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene rsbRD tRNA 111483..111553 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 CDS complement(111620..111997) product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene mgsR CDS 112230..112475 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(112515..113150) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 113308..113481 product DUF2759 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230141.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(113513..113827) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(113830..114885) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230137.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(114957..116081) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(116167..118080) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(118196..119248) product glucose kinase GlcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene glcK CDS complement(119179..119388) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399107.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(119504..121024) product rhomboid protease YqgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230128.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene yqgP CDS complement(121113..121286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230126.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(121353..121916) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230122.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(122002..122151) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153056.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene rpmG CDS complement(122235..123314) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967743.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(123311..123790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967744.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 123961..124314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245993.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 124311..124775 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230109.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(124807..125589) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene pstB CDS complement(125600..126409) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967747.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene pstB CDS complement(126431..127315) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230103.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene pstA CDS complement(127315..128244) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene pstC CDS complement(128313..129215) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398774.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(129370..131520) product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene pbpA CDS complement(131635..132927) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(133034..133642) product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene sodA CDS complement(133821..134303) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 134414..135175 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230089.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 135270..135569 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 135697..136824 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene ispG CDS complement(136850..137233) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 137373..137954 product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(138000..138437) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene zur CDS complement(138574..139455) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230077.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 139571..139825 product DUF2624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(139852..140742) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(140755..142071) product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene cshB CDS 142240..142962 product YqfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246095.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 143085..144029 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(144052..145173) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399125.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(145166..145816) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166854628.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene trmK CDS complement(146071..146433) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene cccA CDS complement(146760..147875) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene rpoD CDS complement(148075..149895) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene dnaG CDS complement(149929..150423) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(150675..151487) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(151513..152154) product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene ccpN CDS complement(152285..154324) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene glyS CDS complement(154317..155204) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene glyQ CDS complement(155501..156268) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene recO CDS complement(156305..156448) product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(156593..157498) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene era CDS complement(157479..157889) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(158010..158381) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(158362..158835) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene ybeY CDS complement(158836..160902) product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene pgpH CDS complement(160916..161050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(161050..162009) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(162006..163202) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene yqfD CDS complement(163221..163502) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene yqfC CDS complement(163559..163975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230029.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(164000..164995) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene floA CDS complement(165017..166330) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(166461..166907) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(166922..167095) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152957.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene rpsU CDS 167268..168191 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230019.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(168228..169583) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene mtaB CDS complement(169583..170353) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(170376..171311) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene prmA CDS complement(171336..172463) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene dnaJ CDS complement(172661..174496) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene dnaK CDS complement(174520..175083) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene grpE CDS complement(175155..176186) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene hrcA CDS complement(176267..177406) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene hemW CDS complement(177462..179297) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene lepA CDS complement(179431..179769) product YqxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399162.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(179786..180991) product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene spoIIP CDS complement(181054..182160) product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene gpr CDS 182237..182377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 182364..182630 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene rpsT CDS complement(182645..183688) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene holA CDS 183918..184052 product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(184093..184917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(186427..186996) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229978.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(187063..187680) product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene comEA CDS 187764..188585 product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398597.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene comER CDS complement(188651..189394) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS complement(189391..189747) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene rsfS CDS complement(189765..190325) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene yqeK CDS complement(190315..190884) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(190896..191186) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene yhbY CDS complement(191180..192022) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229967.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene aroE CDS complement(192041..193141) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene yqeH CDS complement(193145..193663) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(194467..195198) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229964.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(195449..196201) product N-acetylmuramoyl-L-alanine amidase CwlH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229963.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene cwlH CDS 196396..197022 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229962.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(197041..197934) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229961.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene gnd CDS 198239..198961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(198994..199404) product sporulation-specific Dnase NucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967785.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene nucB CDS 199600..200328 product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene sigK CDS complement(200470..200718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(200936..202324) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 gene fumC CDS 202479..203369 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(203732..204007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 204463..204912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(205047..205217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886576.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(205575..206534) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(206642..207067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(207687..208421) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246762.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 208647..209006 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 209399..210139 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene nfsA CDS complement(210371..211282) product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene cmrA CDS 211411..211659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 211646..212434 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 213177..213635 product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229879.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene bltD CDS complement(213807..214661) product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene bltR CDS 214789..215991 product multidrug efflux MFS transporter Blt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229880.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene blt CDS 216134..216595 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966430.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene pssA note possible pseudo, frameshifted CDS 216586..216861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 note possible pseudo, frameshifted CDS 217244..217972 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(218084..218230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(218539..218760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(218830..220167) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(220381..221139) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(221165..222115) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(222112..222948) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(223601..224074) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(224088..224516) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096713.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(224597..224911) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(225812..226030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(226757..227089) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906360.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(227476..229224) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(229603..230358) product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(230666..231022) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398671.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(231074..231433) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399021.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 231837..232082 product spore coat protein F-like protein YraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229845.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 232100..232468 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967868.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 232487..233623 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229843.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 233642..233839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229842.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 233855..234154 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246006.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(234286..234564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(234599..235579) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 235746..236648 product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene cmrA CDS complement(236802..237209) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(237310..237714) product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene adhR CDS 237902..238573 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 238759..239808 product formaldehyde dehydrogenase AdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229837.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene adhA CDS 239957..240466 product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene yraA CDS complement(240507..242543) product levanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398804.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene sacC CDS complement(242703..243530) product PTS fructose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229834.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene levG CDS complement(243552..244355) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229833.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene levF CDS complement(244372..244860) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399158.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene levE CDS complement(244860..245300) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246144.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene levD CDS complement(245490..248297) product transcriptional regulator LevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229830.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene levR CDS complement(248692..249318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(249437..249964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 250185..251573 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886581.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(251734..252366) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 252518..253345 product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398526.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 253537..254037 product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene sigV CDS 254037..254894 product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene rsiV CDS 255007..256926 product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398729.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene oatA CDS 257048..257344 product YrhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(257588..260752) product bifunctional cytochrome P450/NADPH--P450 reductase CypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246174.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene cypB CDS complement(260770..261354) product transcriptional regulator FatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967878.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene fatR CDS complement(261575..262114) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398716.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(262617..262766) product YrzI family small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(262916..263089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(263157..263957) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229815.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(264221..264589) product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398508.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 264897..267845 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886582.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene fdhF CDS 267864..268346 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246168.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(268383..268613) product YrhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237358.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(268696..269835) product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(269837..270760) product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229809.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(270824..271519) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene mtnN CDS complement(271542..272183) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229807.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 272375..272578 product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967883.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(272615..273313) product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246156.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(273378..275132) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(275186..275659) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene greA CDS complement(275910..276545) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene udk CDS complement(276551..277819) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(277838..278767) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(278773..279426) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(279578..280660) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene mltG CDS complement(280796..281077) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(281095..281511) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene ruvX CDS complement(281519..281785) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(281870..284506) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene alaS CDS complement(284840..285901) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(286152..286343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(286355..286879) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886583.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(286936..289332) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(289358..290008) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886584.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(290064..291188) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398509.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene mnmA CDS complement(291207..292349) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246057.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(292368..292784) product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene cymR CDS 292986..294251 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 sequence138 source 1..239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence139 source 1..231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence140 source 1..283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence141 source 1..229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence142 source 1..249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence143 source 1..583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence144 source 1..326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence145 source 1..254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence146 source 1..562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence147 source 1..280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence148 source 1..15798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..582) product sigma-K factor-processing regulator BofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225421.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene bofA CDS complement(649..873) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242387.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(891..1487) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene recR CDS complement(1502..1825) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(1849..3540) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene dnaX CDS complement(4016..4501) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene tadA CDS 4587..5132 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247139.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 5202..6485 product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 6584..7207 product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247138.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene dgk CDS 7204..7857 product deoxyadenosine/deoxycytidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226792.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene dck tRNA complement(7969..8061) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 CDS complement(8196..9473) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene serS CDS complement(9794..10384) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226797.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene pdxT CDS complement(10406..11290) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene pdxS CDS complement(11487..12818) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene dacA CDS complement(12971..14437) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene guaB CDS 14519..15505 product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247147.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 rRNA complement(15548..15658) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090