>Feature sequence001 >Feature sequence002 >Feature sequence003 >Feature sequence004 >Feature sequence005 >Feature sequence006 50 472 gene locus_tag LOCUS_00010 50 472 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246208.1 protein_id gnl|my_center|LOCUS_00010 >Feature sequence007 >Feature sequence008 >Feature sequence009 3 164 gene locus_tag LOCUS_00020 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00020 >Feature sequence010 172 282 gene locus_tag LOCUS_r00010 172 282 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 308 383 gene locus_tag LOCUS_t00010 308 383 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 416 491 gene locus_tag LOCUS_t00020 416 491 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 529 604 gene locus_tag LOCUS_t00030 529 604 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 615 701 gene locus_tag LOCUS_t00040 615 701 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 707 781 gene locus_tag LOCUS_t00050 707 781 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 796 881 gene locus_tag LOCUS_t00060 796 881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 891 967 gene locus_tag LOCUS_t00070 891 967 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 983 1059 gene locus_tag LOCUS_t00080 983 1059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1065 1138 gene locus_tag LOCUS_t00090 1065 1138 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1158 1234 gene locus_tag LOCUS_t00100 1158 1234 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1237 1313 gene locus_tag LOCUS_t00110 1237 1313 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1320 1412 gene locus_tag LOCUS_t00120 1320 1412 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1430 1506 gene locus_tag LOCUS_t00130 1430 1506 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1571 1647 gene locus_tag LOCUS_t00140 1571 1647 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1660 1735 gene locus_tag LOCUS_t00150 1660 1735 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1757 1832 gene locus_tag LOCUS_t00160 1757 1832 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1842 1915 gene locus_tag LOCUS_t00170 1842 1915 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1931 2007 gene locus_tag LOCUS_t00180 1931 2007 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2018 2092 gene locus_tag LOCUS_t00190 2018 2092 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2096 2186 gene locus_tag LOCUS_t00200 2096 2186 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2217 2288 gene locus_tag LOCUS_t00210 2217 2288 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2522 4405 gene locus_tag LOCUS_00030 gene glgB 2522 4405 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_00030 4402 5544 gene locus_tag LOCUS_00040 4402 5544 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968049.1 protein_id gnl|my_center|LOCUS_00040 5567 6598 gene locus_tag LOCUS_00050 gene glgD 5567 6598 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398841.1 protein_id gnl|my_center|LOCUS_00050 6595 8049 gene locus_tag LOCUS_00060 gene glgA 6595 8049 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 protein_id gnl|my_center|LOCUS_00060 8036 10432 gene locus_tag LOCUS_00070 gene glgP 8036 10432 CDS product glycogen phosphorylase GlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399110.1 protein_id gnl|my_center|LOCUS_00070 10928 10461 gene locus_tag LOCUS_00080 10928 10461 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229024.1 protein_id gnl|my_center|LOCUS_00080 12081 11020 gene locus_tag LOCUS_00090 gene cotI 12081 11020 CDS product spore coat kinase CotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886600.1 protein_id gnl|my_center|LOCUS_00090 12283 13416 gene locus_tag LOCUS_00100 gene cotSA 12283 13416 CDS product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 protein_id gnl|my_center|LOCUS_00100 13431 14486 gene locus_tag LOCUS_00110 gene cotS 13431 14486 CDS product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229031.1 protein_id gnl|my_center|LOCUS_00110 14488 14910 gene locus_tag LOCUS_00120 14488 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399071.1 protein_id gnl|my_center|LOCUS_00120 16210 14987 gene locus_tag LOCUS_00130 16210 14987 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229035.1 protein_id gnl|my_center|LOCUS_00130 17163 16213 gene locus_tag LOCUS_00140 17163 16213 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_00140 18446 17160 gene locus_tag LOCUS_00150 18446 17160 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398478.1 protein_id gnl|my_center|LOCUS_00150 18618 19421 gene locus_tag LOCUS_00160 18618 19421 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229044.1 protein_id gnl|my_center|LOCUS_00160 20164 19445 gene locus_tag LOCUS_00170 20164 19445 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 protein_id gnl|my_center|LOCUS_00170 20411 21871 gene locus_tag LOCUS_00180 20411 21871 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 protein_id gnl|my_center|LOCUS_00180 21868 23610 gene locus_tag LOCUS_00190 gene menD 21868 23610 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_00190 23598 24446 gene locus_tag LOCUS_00200 gene menH 23598 24446 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398592.1 protein_id gnl|my_center|LOCUS_00200 24460 25278 gene locus_tag LOCUS_00210 gene menB 24460 25278 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_00210 25369 26829 gene locus_tag LOCUS_00220 25369 26829 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229056.1 protein_id gnl|my_center|LOCUS_00220 26826 27941 gene locus_tag LOCUS_00230 gene menC 26826 27941 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 protein_id gnl|my_center|LOCUS_00230 28222 29142 gene locus_tag LOCUS_00240 gene mntA 28222 29142 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_00240 29161 29913 gene locus_tag LOCUS_00250 gene mntB 29161 29913 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_00250 29919 31226 gene locus_tag LOCUS_00260 gene mntC 29919 31226 CDS product manganese ABC transporter permease MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229064.1 protein_id gnl|my_center|LOCUS_00260 31216 32103 gene locus_tag LOCUS_00270 gene mntD 31216 32103 CDS product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 protein_id gnl|my_center|LOCUS_00270 32280 32122 gene locus_tag LOCUS_00280 32280 32122 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229069.1 protein_id gnl|my_center|LOCUS_00280 33374 32334 gene locus_tag LOCUS_00290 33374 32334 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229071.1 protein_id gnl|my_center|LOCUS_00290 34748 33417 gene locus_tag LOCUS_00300 34748 33417 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399130.1 protein_id gnl|my_center|LOCUS_00300 34954 35202 gene locus_tag LOCUS_00310 34954 35202 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219346.1 protein_id gnl|my_center|LOCUS_00310 35321 35884 gene locus_tag LOCUS_00320 35321 35884 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229074.1 protein_id gnl|my_center|LOCUS_00320 36108 35881 gene locus_tag LOCUS_00330 gene yidD 36108 35881 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_00330 36236 36709 gene locus_tag LOCUS_00340 36236 36709 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219361.1 protein_id gnl|my_center|LOCUS_00340 36829 37269 gene locus_tag LOCUS_00350 36829 37269 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398648.1 protein_id gnl|my_center|LOCUS_00350 37403 37263 gene locus_tag LOCUS_00360 37403 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37535 37972 gene locus_tag LOCUS_00370 37535 37972 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_00370 38138 38542 gene locus_tag LOCUS_00380 38138 38542 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229085.1 protein_id gnl|my_center|LOCUS_00380 38754 39230 gene locus_tag LOCUS_00390 gene ytkD 38754 39230 CDS product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229087.1 protein_id gnl|my_center|LOCUS_00390 >Feature sequence011 >Feature sequence012 >Feature sequence013 >Feature sequence014 >Feature sequence015 >Feature sequence016 >Feature sequence017 >Feature sequence018 >Feature sequence019 >Feature sequence020 247 62 gene locus_tag LOCUS_00400 247 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 >Feature sequence021 101 28 gene locus_tag LOCUS_t00220 101 28 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 192 116 gene locus_tag LOCUS_t00230 192 116 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 413 183 gene locus_tag LOCUS_00410 413 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 525 1379 gene locus_tag LOCUS_00420 525 1379 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500360.1 protein_id gnl|my_center|LOCUS_00420 2519 1431 gene locus_tag LOCUS_00430 gene gmuG 2519 1431 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244107.1 protein_id gnl|my_center|LOCUS_00430 3485 2538 gene locus_tag LOCUS_00440 gene manA 3485 2538 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242491.1 protein_id gnl|my_center|LOCUS_00440 4381 3482 gene locus_tag LOCUS_00450 gene gmuE 4381 3482 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_00450 5123 4410 gene locus_tag LOCUS_00460 gene gmuR 5123 4410 CDS product transcriptional regulator GmuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234096.1 protein_id gnl|my_center|LOCUS_00460 6669 5272 gene locus_tag LOCUS_00470 gene gmuD 6669 5272 CDS product 6-phospho-beta-glucosidase GmuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243625.1 protein_id gnl|my_center|LOCUS_00470 8015 6687 gene locus_tag LOCUS_00480 gene celB 8015 6687 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244271.1 protein_id gnl|my_center|LOCUS_00480 8367 8035 gene locus_tag LOCUS_00490 8367 8035 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243550.1 protein_id gnl|my_center|LOCUS_00490 8678 8367 gene locus_tag LOCUS_00500 8678 8367 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242472.1 protein_id gnl|my_center|LOCUS_00500 9010 10176 gene locus_tag LOCUS_00510 gene pbuE 9010 10176 CDS product purine transporter PbuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234105.1 protein_id gnl|my_center|LOCUS_00510 10914 10348 gene locus_tag LOCUS_00520 10914 10348 CDS product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 protein_id gnl|my_center|LOCUS_00520 12100 11123 gene locus_tag LOCUS_00530 12100 11123 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 protein_id gnl|my_center|LOCUS_00530 12241 12660 gene locus_tag LOCUS_00540 12241 12660 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886425.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 12679 13164 gene locus_tag LOCUS_00550 12679 13164 CDS product YdhH/YoaO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234115.1 protein_id gnl|my_center|LOCUS_00550 13639 15027 gene locus_tag LOCUS_00560 gene phoB 13639 15027 CDS product alkaline phosphatase PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234119.1 protein_id gnl|my_center|LOCUS_00560 15093 15800 gene locus_tag LOCUS_00570 15093 15800 CDS product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244238.1 protein_id gnl|my_center|LOCUS_00570 16852 16909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16937 17358 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttccccggtagctcctgtcgctcc 19081 17897 gene locus_tag LOCUS_00580 19081 17897 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234124.1 protein_id gnl|my_center|LOCUS_00580 20502 19240 gene locus_tag LOCUS_00590 20502 19240 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234126.1 protein_id gnl|my_center|LOCUS_00590 21300 20626 gene locus_tag LOCUS_00600 21300 20626 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234129.1 protein_id gnl|my_center|LOCUS_00600 21549 22286 gene locus_tag LOCUS_00610 21549 22286 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234130.1 protein_id gnl|my_center|LOCUS_00610 23530 22322 gene locus_tag LOCUS_00620 23530 22322 CDS product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 protein_id gnl|my_center|LOCUS_00620 24049 23726 gene locus_tag LOCUS_00630 24049 23726 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 protein_id gnl|my_center|LOCUS_00630 24771 24046 gene locus_tag LOCUS_00640 24771 24046 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190726.1 protein_id gnl|my_center|LOCUS_00640 24890 25447 gene locus_tag LOCUS_00650 24890 25447 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 protein_id gnl|my_center|LOCUS_00650 25592 26026 gene locus_tag LOCUS_00660 25592 26026 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886424.1 protein_id gnl|my_center|LOCUS_00660 26042 26671 gene locus_tag LOCUS_00670 26042 26671 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 protein_id gnl|my_center|LOCUS_00670 29416 26759 gene locus_tag LOCUS_00680 29416 26759 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242658.1 protein_id gnl|my_center|LOCUS_00680 29871 29413 gene locus_tag LOCUS_00690 29871 29413 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242874.1 protein_id gnl|my_center|LOCUS_00690 30038 30556 gene locus_tag LOCUS_00700 gene dinB 30038 30556 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 protein_id gnl|my_center|LOCUS_00700 30731 32107 gene locus_tag LOCUS_00710 30731 32107 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234143.1 protein_id gnl|my_center|LOCUS_00710 32439 34067 gene locus_tag LOCUS_00720 gene vmlR 32439 34067 CDS product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 protein_id gnl|my_center|LOCUS_00720 34674 34114 gene locus_tag LOCUS_00730 34674 34114 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 protein_id gnl|my_center|LOCUS_00730 35874 34693 gene locus_tag LOCUS_00740 35874 34693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_00740 36945 36124 gene locus_tag LOCUS_00750 36945 36124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 37146 36961 gene locus_tag LOCUS_00760 37146 36961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00760 37809 37159 gene locus_tag LOCUS_00770 37809 37159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00770 38306 37986 gene locus_tag LOCUS_00780 38306 37986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 39396 38392 gene locus_tag LOCUS_00790 gene degA 39396 38392 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_00790 40515 39490 gene locus_tag LOCUS_00800 40515 39490 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104350.1 protein_id gnl|my_center|LOCUS_00800 40825 41196 gene locus_tag LOCUS_00810 40825 41196 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804825.1 protein_id gnl|my_center|LOCUS_00810 41680 41207 gene locus_tag LOCUS_00820 41680 41207 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234145.1 protein_id gnl|my_center|LOCUS_00820 42178 41834 gene locus_tag LOCUS_00830 42178 41834 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966666.1 protein_id gnl|my_center|LOCUS_00830 42774 42175 gene locus_tag LOCUS_00840 42774 42175 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234149.1 protein_id gnl|my_center|LOCUS_00840 43014 43286 gene locus_tag LOCUS_00850 43014 43286 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243854.1 protein_id gnl|my_center|LOCUS_00850 43300 43542 gene locus_tag LOCUS_00860 43300 43542 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234151.1 protein_id gnl|my_center|LOCUS_00860 43555 43986 gene locus_tag LOCUS_00870 gene cotP 43555 43986 CDS product spore coat protein CotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234154.1 protein_id gnl|my_center|LOCUS_00870 44174 44416 gene locus_tag LOCUS_00880 44174 44416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00880 45130 44492 gene locus_tag LOCUS_00890 45130 44492 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537542.1 protein_id gnl|my_center|LOCUS_00890 45473 45105 gene locus_tag LOCUS_00900 45473 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 46296 45661 gene locus_tag LOCUS_00910 gene paiB 46296 45661 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_00910 46443 47828 gene locus_tag LOCUS_00920 46443 47828 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_00920 48234 47896 gene locus_tag LOCUS_00930 48234 47896 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 protein_id gnl|my_center|LOCUS_00930 48808 48419 gene locus_tag LOCUS_00940 48808 48419 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234169.1 protein_id gnl|my_center|LOCUS_00940 49886 48948 gene locus_tag LOCUS_00950 49886 48948 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 protein_id gnl|my_center|LOCUS_00950 50533 49913 gene locus_tag LOCUS_00960 50533 49913 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244392.1 protein_id gnl|my_center|LOCUS_00960 50988 51881 gene locus_tag LOCUS_00970 gene mneP 50988 51881 CDS product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 protein_id gnl|my_center|LOCUS_00970 52067 52879 gene locus_tag LOCUS_00980 52067 52879 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244218.1 protein_id gnl|my_center|LOCUS_00980 52970 53659 gene locus_tag LOCUS_00990 52970 53659 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242513.1 protein_id gnl|my_center|LOCUS_00990 54570 54124 gene locus_tag LOCUS_01000 gene rok 54570 54124 CDS product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 protein_id gnl|my_center|LOCUS_01000 56047 54725 gene locus_tag LOCUS_01010 gene brnQ 56047 54725 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246136.1 protein_id gnl|my_center|LOCUS_01010 56574 56239 gene locus_tag LOCUS_01020 56574 56239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 57270 56950 gene locus_tag LOCUS_01030 57270 56950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 59566 57395 gene locus_tag LOCUS_01040 59566 57395 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 protein_id gnl|my_center|LOCUS_01040 60322 59681 gene locus_tag LOCUS_01050 gene ydfI 60322 59681 CDS product two-component system response regulator YdfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244318.1 protein_id gnl|my_center|LOCUS_01050 61478 60315 gene locus_tag LOCUS_01060 gene ydfH 61478 60315 CDS product two-component system sensor histidine kinase YdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886422.1 protein_id gnl|my_center|LOCUS_01060 61809 61979 gene locus_tag LOCUS_01070 61809 61979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243880.1 protein_id gnl|my_center|LOCUS_01070 61982 62152 gene locus_tag LOCUS_01080 61982 62152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886421.1 protein_id gnl|my_center|LOCUS_01080 62241 62684 gene locus_tag LOCUS_01090 62241 62684 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242768.1 protein_id gnl|my_center|LOCUS_01090 63429 62749 gene locus_tag LOCUS_01100 63429 62749 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244115.1 protein_id gnl|my_center|LOCUS_01100 63519 64142 gene locus_tag LOCUS_01110 63519 64142 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 protein_id gnl|my_center|LOCUS_01110 65703 64255 gene locus_tag LOCUS_01120 65703 64255 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244019.1 protein_id gnl|my_center|LOCUS_01120 65837 66730 gene locus_tag LOCUS_01130 65837 66730 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244236.1 protein_id gnl|my_center|LOCUS_01130 66830 66970 gene locus_tag LOCUS_01140 66830 66970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 67924 67124 gene locus_tag LOCUS_01150 67924 67124 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886420.1 protein_id gnl|my_center|LOCUS_01150 68536 68117 gene locus_tag LOCUS_01160 68536 68117 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_01160 69859 68552 gene locus_tag LOCUS_01170 69859 68552 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_01170 70219 69872 gene locus_tag LOCUS_01180 gene aseR 70219 69872 CDS product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 protein_id gnl|my_center|LOCUS_01180 70415 70576 gene locus_tag LOCUS_01190 70415 70576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01190 71829 70957 gene locus_tag LOCUS_01200 71829 70957 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234217.1 protein_id gnl|my_center|LOCUS_01200 72354 72611 gene locus_tag LOCUS_01210 72354 72611 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243941.1 protein_id gnl|my_center|LOCUS_01210 72696 73268 gene locus_tag LOCUS_01220 72696 73268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 protein_id gnl|my_center|LOCUS_01220 73753 73328 gene locus_tag LOCUS_01230 73753 73328 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234221.1 protein_id gnl|my_center|LOCUS_01230 75542 74151 gene locus_tag LOCUS_01240 75542 74151 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 protein_id gnl|my_center|LOCUS_01240 75920 76558 gene locus_tag LOCUS_01250 75920 76558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 77098 76688 gene locus_tag LOCUS_01260 gene lrpA 77098 76688 CDS product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246601.1 protein_id gnl|my_center|LOCUS_01260 77356 78117 gene locus_tag LOCUS_01270 77356 78117 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 protein_id gnl|my_center|LOCUS_01270 78258 78479 gene locus_tag LOCUS_01280 78258 78479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 78680 78856 gene locus_tag LOCUS_01290 78680 78856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 78910 79584 gene locus_tag LOCUS_01300 78910 79584 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243990.1 protein_id gnl|my_center|LOCUS_01300 80393 79800 gene locus_tag LOCUS_01310 80393 79800 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_01310 81364 80981 gene locus_tag LOCUS_01320 81364 80981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886419.1 protein_id gnl|my_center|LOCUS_01320 81877 82749 gene locus_tag LOCUS_01330 81877 82749 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 protein_id gnl|my_center|LOCUS_01330 82921 82784 gene locus_tag LOCUS_01340 82921 82784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 83938 83153 gene locus_tag LOCUS_01350 83938 83153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 84556 85449 gene locus_tag LOCUS_01360 84556 85449 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_01360 85920 86381 gene locus_tag LOCUS_01370 85920 86381 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886417.1 protein_id gnl|my_center|LOCUS_01370 87332 87129 gene locus_tag LOCUS_01380 gene cspC 87332 87129 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234247.1 protein_id gnl|my_center|LOCUS_01380 88116 89144 gene locus_tag LOCUS_01390 88116 89144 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_01390 90389 89670 gene locus_tag LOCUS_01400 90389 89670 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087558.1 protein_id gnl|my_center|LOCUS_01400 91767 91051 gene locus_tag LOCUS_01410 91767 91051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 92452 91745 gene locus_tag LOCUS_01420 92452 91745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_01420 93412 92669 gene locus_tag LOCUS_01430 93412 92669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_01430 94540 93560 gene locus_tag LOCUS_01440 94540 93560 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_01440 96046 95204 gene locus_tag LOCUS_01450 96046 95204 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_01450 96529 96170 gene locus_tag LOCUS_01460 96529 96170 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 protein_id gnl|my_center|LOCUS_01460 97263 97129 gene locus_tag LOCUS_01470 97263 97129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 97872 97693 gene locus_tag LOCUS_01480 97872 97693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 98231 98148 gene locus_tag LOCUS_t00240 98231 98148 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 98394 98312 gene locus_tag LOCUS_t00250 98394 98312 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 98481 98406 gene locus_tag LOCUS_t00260 98481 98406 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 98583 98509 gene locus_tag LOCUS_t00270 98583 98509 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 98666 98595 gene locus_tag LOCUS_t00280 98666 98595 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 98786 98696 gene locus_tag LOCUS_t00290 98786 98696 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 98865 98791 gene locus_tag LOCUS_t00300 98865 98791 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 99440 98988 gene locus_tag LOCUS_01490 99440 98988 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246525.1 protein_id gnl|my_center|LOCUS_01490 101826 99667 gene locus_tag LOCUS_01500 101826 99667 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246556.1 protein_id gnl|my_center|LOCUS_01500 102532 101933 gene locus_tag LOCUS_01510 gene rsbX 102532 101933 CDS product phosphoserine phosphatase RsbX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246608.1 protein_id gnl|my_center|LOCUS_01510 103320 102532 gene locus_tag LOCUS_01520 gene sigB 103320 102532 CDS product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 protein_id gnl|my_center|LOCUS_01520 103768 103286 gene locus_tag LOCUS_01530 gene rsbW 103768 103286 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_01530 104094 103765 gene locus_tag LOCUS_01540 gene rsbV 104094 103765 CDS product anti-sigma factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234298.1 protein_id gnl|my_center|LOCUS_01540 105163 104156 gene locus_tag LOCUS_01550 gene rsbU 105163 104156 CDS product phosphoserine phosphatase RsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234295.1 protein_id gnl|my_center|LOCUS_01550 105576 105175 gene locus_tag LOCUS_01560 gene rsbT 105576 105175 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_01560 105945 105580 gene locus_tag LOCUS_01570 gene rsbS 105945 105580 CDS product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 protein_id gnl|my_center|LOCUS_01570 106774 105950 gene locus_tag LOCUS_01580 gene rsbRA 106774 105950 CDS product RsbT co-antagonist protein RsbRA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966610.1 protein_id gnl|my_center|LOCUS_01580 107242 106892 gene locus_tag LOCUS_01590 gene ndoA 107242 106892 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_01590 107528 107247 gene locus_tag LOCUS_01600 gene endB 107528 107247 CDS product type II toxin-antitoxin system antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225183.1 protein_id gnl|my_center|LOCUS_01600 108813 107644 gene locus_tag LOCUS_01610 gene alr 108813 107644 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234284.1 protein_id gnl|my_center|LOCUS_01610 109935 108928 gene locus_tag LOCUS_01620 109935 108928 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_01620 110474 110109 gene locus_tag LOCUS_01630 gene acpS 110474 110109 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234281.1 protein_id gnl|my_center|LOCUS_01630 110569 111168 gene locus_tag LOCUS_01640 110569 111168 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246687.1 protein_id gnl|my_center|LOCUS_01640 112646 111165 gene locus_tag LOCUS_01650 112646 111165 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966602.1 protein_id gnl|my_center|LOCUS_01650 113115 112636 gene locus_tag LOCUS_01660 113115 112636 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 protein_id gnl|my_center|LOCUS_01660 114771 113287 gene locus_tag LOCUS_01670 gene cshA 114771 113287 CDS product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246685.1 protein_id gnl|my_center|LOCUS_01670 116548 115175 gene locus_tag LOCUS_01680 116548 115175 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_01680 117708 116623 gene locus_tag LOCUS_01690 117708 116623 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 protein_id gnl|my_center|LOCUS_01690 117862 118182 gene locus_tag LOCUS_01700 117862 118182 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234326.1 protein_id gnl|my_center|LOCUS_01700 119069 118197 gene locus_tag LOCUS_01710 119069 118197 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234329.1 protein_id gnl|my_center|LOCUS_01710 119316 119480 gene locus_tag LOCUS_01720 119316 119480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 119467 119613 gene locus_tag LOCUS_01730 gene fbpB 119467 119613 CDS product Fur-regulated basic protein FbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886410.1 protein_id gnl|my_center|LOCUS_01730 120782 119637 gene locus_tag LOCUS_01740 120782 119637 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_01740 121247 120912 gene locus_tag LOCUS_01750 121247 120912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225151.1 protein_id gnl|my_center|LOCUS_01750 122109 121342 gene locus_tag LOCUS_01760 122109 121342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886409.1 protein_id gnl|my_center|LOCUS_01760 123028 122102 gene locus_tag LOCUS_01770 123028 122102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 protein_id gnl|my_center|LOCUS_01770 124358 123120 gene locus_tag LOCUS_01780 124358 123120 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 protein_id gnl|my_center|LOCUS_01780 125663 124611 gene locus_tag LOCUS_01790 125663 124611 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246523.1 protein_id gnl|my_center|LOCUS_01790 127078 125813 gene locus_tag LOCUS_01800 gene dctP 127078 125813 CDS product C4-dicarboxylate transporter DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246626.1 protein_id gnl|my_center|LOCUS_01800 127878 127198 gene locus_tag LOCUS_01810 gene dctR 127878 127198 CDS product two-component system response regulator DctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234347.1 protein_id gnl|my_center|LOCUS_01810 129475 127868 gene locus_tag LOCUS_01820 gene dctS 129475 127868 CDS product two-component system sensor histidine kinase DctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234348.1 protein_id gnl|my_center|LOCUS_01820 129545 130597 gene locus_tag LOCUS_01830 gene dctB 129545 130597 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein DctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234350.1 protein_id gnl|my_center|LOCUS_01830 130683 131504 gene locus_tag LOCUS_01840 130683 131504 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234352.1 protein_id gnl|my_center|LOCUS_01840 131900 131541 gene locus_tag LOCUS_01850 131900 131541 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246730.1 protein_id gnl|my_center|LOCUS_01850 132142 131894 gene locus_tag LOCUS_01860 132142 131894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01860 132735 132364 gene locus_tag LOCUS_01870 gene gsiB 132735 132364 CDS product glucose starvation-inducible protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246542.1 protein_id gnl|my_center|LOCUS_01870 133680 132862 gene locus_tag LOCUS_01880 133680 132862 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 protein_id gnl|my_center|LOCUS_01880 133798 134250 gene locus_tag LOCUS_01890 133798 134250 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246574.1 protein_id gnl|my_center|LOCUS_01890 134328 134585 gene locus_tag LOCUS_01900 134328 134585 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246519.1 protein_id gnl|my_center|LOCUS_01900 134816 136090 gene locus_tag LOCUS_01910 134816 136090 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234364.1 protein_id gnl|my_center|LOCUS_01910 136194 136460 gene locus_tag LOCUS_01920 136194 136460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966591.1 protein_id gnl|my_center|LOCUS_01920 138415 136691 gene locus_tag LOCUS_01930 138415 136691 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246569.1 protein_id gnl|my_center|LOCUS_01930 138931 138482 gene locus_tag LOCUS_01940 gene mutT 138931 138482 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246544.1 protein_id gnl|my_center|LOCUS_01940 140812 138989 gene locus_tag LOCUS_01950 gene kimA 140812 138989 CDS product potassium transporter KimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246693.1 protein_id gnl|my_center|LOCUS_01950 143395 141299 gene locus_tag LOCUS_01960 143395 141299 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246598.1 protein_id gnl|my_center|LOCUS_01960 144663 143401 gene locus_tag LOCUS_01970 144663 143401 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246697.1 protein_id gnl|my_center|LOCUS_01970 146386 144656 gene locus_tag LOCUS_01980 146386 144656 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886408.1 protein_id gnl|my_center|LOCUS_01980 147212 146376 gene locus_tag LOCUS_01990 gene epsK 147212 146376 CDS product cyclic-di-GMP receptor EpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246541.1 protein_id gnl|my_center|LOCUS_01990 148281 147193 gene locus_tag LOCUS_02000 148281 147193 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246551.1 protein_id gnl|my_center|LOCUS_02000 150670 148484 gene locus_tag LOCUS_02010 150670 148484 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 protein_id gnl|my_center|LOCUS_02010 151169 150735 gene locus_tag LOCUS_02020 gene lrpC 151169 150735 CDS product transcriptional regulator LrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246585.1 protein_id gnl|my_center|LOCUS_02020 151355 151645 gene locus_tag LOCUS_02030 151355 151645 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 protein_id gnl|my_center|LOCUS_02030 152499 151690 gene locus_tag LOCUS_02040 gene amj 152499 151690 CDS product lipid II flippase Amj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234394.1 protein_id gnl|my_center|LOCUS_02040 153427 153005 gene locus_tag LOCUS_02050 153427 153005 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234396.1 protein_id gnl|my_center|LOCUS_02050 154056 153505 gene locus_tag LOCUS_02060 154056 153505 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246691.1 protein_id gnl|my_center|LOCUS_02060 154648 154145 gene locus_tag LOCUS_02070 gene lyxE 154648 154145 CDS product D-lyxose ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234400.1 protein_id gnl|my_center|LOCUS_02070 155523 154663 gene locus_tag LOCUS_02080 155523 154663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246648.1 protein_id gnl|my_center|LOCUS_02080 155674 156270 gene locus_tag LOCUS_02090 155674 156270 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966584.1 protein_id gnl|my_center|LOCUS_02090 157799 156288 gene locus_tag LOCUS_02100 157799 156288 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246534.1 protein_id gnl|my_center|LOCUS_02100 160095 158011 gene locus_tag LOCUS_02110 gene mtlR 160095 158011 CDS product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 protein_id gnl|my_center|LOCUS_02110 161186 160284 gene locus_tag LOCUS_02120 161186 160284 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246655.1 protein_id gnl|my_center|LOCUS_02120 163293 161287 gene locus_tag LOCUS_02130 gene pbpC 163293 161287 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246590.1 protein_id gnl|my_center|LOCUS_02130 163445 163732 gene locus_tag LOCUS_02140 163445 163732 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 protein_id gnl|my_center|LOCUS_02140 163983 163738 gene locus_tag LOCUS_02150 163983 163738 CDS product YczI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003240256.1 protein_id gnl|my_center|LOCUS_02150 164798 164157 gene locus_tag LOCUS_02160 gene lipC 164798 164157 CDS product spore germination lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234415.1 protein_id gnl|my_center|LOCUS_02160 165614 164862 gene locus_tag LOCUS_02170 165614 164862 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 protein_id gnl|my_center|LOCUS_02170 166643 165630 gene locus_tag LOCUS_02180 gene pxpC 166643 165630 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 protein_id gnl|my_center|LOCUS_02180 167362 166640 gene locus_tag LOCUS_02190 gene pxpB 167362 166640 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_02190 168199 167408 gene locus_tag LOCUS_02200 168199 167408 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_02200 169419 168205 gene locus_tag LOCUS_02210 169419 168205 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_02210 170207 169434 gene locus_tag LOCUS_02220 gene pxpA 170207 169434 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_02220 171161 170412 gene locus_tag LOCUS_02230 171161 170412 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 protein_id gnl|my_center|LOCUS_02230 171294 171458 gene locus_tag LOCUS_02240 171294 171458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234425.1 protein_id gnl|my_center|LOCUS_02240 171885 171493 gene locus_tag LOCUS_02250 171885 171493 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246580.1 protein_id gnl|my_center|LOCUS_02250 171970 172578 gene locus_tag LOCUS_02260 171970 172578 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246621.1 protein_id gnl|my_center|LOCUS_02260 173089 172664 gene locus_tag LOCUS_02270 gene lepB 173089 172664 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234434.1 protein_id gnl|my_center|LOCUS_02270 173342 173100 gene locus_tag LOCUS_02280 173342 173100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 174419 173361 gene locus_tag LOCUS_02290 174419 173361 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234436.1 protein_id gnl|my_center|LOCUS_02290 175637 174516 gene locus_tag LOCUS_02300 175637 174516 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_02300 176070 175639 gene locus_tag LOCUS_02310 176070 175639 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 protein_id gnl|my_center|LOCUS_02310 177531 176095 gene locus_tag LOCUS_02320 177531 176095 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 protein_id gnl|my_center|LOCUS_02320 178057 177704 gene locus_tag LOCUS_02330 178057 177704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246726.1 protein_id gnl|my_center|LOCUS_02330 178222 178794 gene locus_tag LOCUS_02340 gene ycnK 178222 178794 CDS product copper uptake transcriptional regulator YcnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246724.1 protein_id gnl|my_center|LOCUS_02340 178826 180454 gene locus_tag LOCUS_02350 gene ycnJ 178826 180454 CDS product copper transporter YcnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246637.1 protein_id gnl|my_center|LOCUS_02350 180468 181088 gene locus_tag LOCUS_02360 180468 181088 CDS product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246657.1 protein_id gnl|my_center|LOCUS_02360 181916 181131 gene locus_tag LOCUS_02370 gene gdh 181916 181131 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246720.1 protein_id gnl|my_center|LOCUS_02370 182798 181935 gene locus_tag LOCUS_02380 gene glcU 182798 181935 CDS product glucose uptake protein GlcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234455.1 protein_id gnl|my_center|LOCUS_02380 184312 182924 gene locus_tag LOCUS_02390 gene gabD 184312 182924 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246615.1 protein_id gnl|my_center|LOCUS_02390 185691 184381 gene locus_tag LOCUS_02400 gene gabT 185691 184381 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234459.1 protein_id gnl|my_center|LOCUS_02400 185797 187236 gene locus_tag LOCUS_02410 gene gabR 185797 187236 CDS product transcriptional regulator GabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246571.1 protein_id gnl|my_center|LOCUS_02410 187552 187238 gene locus_tag LOCUS_02420 187552 187238 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234476.1 protein_id gnl|my_center|LOCUS_02420 187693 187980 gene locus_tag LOCUS_02430 187693 187980 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234477.1 protein_id gnl|my_center|LOCUS_02430 187997 188746 gene locus_tag LOCUS_02440 gene nfsA 187997 188746 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234479.1 protein_id gnl|my_center|LOCUS_02440 188909 189787 gene locus_tag LOCUS_02450 188909 189787 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246592.1 protein_id gnl|my_center|LOCUS_02450 189807 191231 gene locus_tag LOCUS_02460 189807 191231 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246604.1 protein_id gnl|my_center|LOCUS_02460 192234 191278 gene locus_tag LOCUS_02470 gene yclQ 192234 191278 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_02470 193014 192256 gene locus_tag LOCUS_02480 gene yclP 193014 192256 CDS product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 protein_id gnl|my_center|LOCUS_02480 193955 193008 gene locus_tag LOCUS_02490 gene yclO 193955 193008 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_02490 194898 193948 gene locus_tag LOCUS_02500 gene yclN 194898 193948 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_02500 195283 196647 gene locus_tag LOCUS_02510 195283 196647 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 protein_id gnl|my_center|LOCUS_02510 197124 197002 gene locus_tag LOCUS_02520 gene phrC 197124 197002 CDS product phosphatase RapC inhibitor PhrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224994.1 protein_id gnl|my_center|LOCUS_02520 198256 197108 gene locus_tag LOCUS_02530 gene rapC 198256 197108 CDS product response regulator aspartate phosphatase RapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246686.1 protein_id gnl|my_center|LOCUS_02530 199839 198418 gene locus_tag LOCUS_02540 gene yclK 199839 198418 CDS product two-component system sensor histidine kinase YclK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969263.1 protein_id gnl|my_center|LOCUS_02540 200509 199826 gene locus_tag LOCUS_02550 gene yclJ 200509 199826 CDS product two-component system response regulator YclJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246532.1 protein_id gnl|my_center|LOCUS_02550 200722 202176 gene locus_tag LOCUS_02560 200722 202176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234506.1 protein_id gnl|my_center|LOCUS_02560 202192 202872 gene locus_tag LOCUS_02570 202192 202872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234507.1 protein_id gnl|my_center|LOCUS_02570 204099 202975 gene locus_tag LOCUS_02580 gene gerKB 204099 202975 CDS product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 protein_id gnl|my_center|LOCUS_02580 205347 204124 gene locus_tag LOCUS_02590 gene gerKC 205347 204124 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 protein_id gnl|my_center|LOCUS_02590 206971 205337 gene locus_tag LOCUS_02600 gene gerKA 206971 205337 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_02600 207097 207318 gene locus_tag LOCUS_02610 207097 207318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246546.1 protein_id gnl|my_center|LOCUS_02610 209088 207334 gene locus_tag LOCUS_02620 209088 207334 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246729.1 protein_id gnl|my_center|LOCUS_02620 209368 210846 gene locus_tag LOCUS_02630 209368 210846 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_02630 211729 210884 gene locus_tag LOCUS_02640 211729 210884 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246662.1 protein_id gnl|my_center|LOCUS_02640 212243 211797 gene locus_tag LOCUS_02650 212243 211797 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969257.1 protein_id gnl|my_center|LOCUS_02650 212485 212258 gene locus_tag LOCUS_02660 gene bsdD 212485 212258 CDS product phenolic acid decarboxylase subunit BsdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886405.1 protein_id gnl|my_center|LOCUS_02660 213923 212502 gene locus_tag LOCUS_02670 gene bsdC 213923 212502 CDS product phenolic acid decarboxylase BsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246683.1 protein_id gnl|my_center|LOCUS_02670 214504 213926 gene locus_tag LOCUS_02680 214504 213926 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966530.1 protein_id gnl|my_center|LOCUS_02680 214630 215502 gene locus_tag LOCUS_02690 gene bsdA 214630 215502 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_02690 215618 216424 gene locus_tag LOCUS_02700 gene tcyA 215618 216424 CDS product cystine ABC transporter substrate-binding lipoprotein TcyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246699.1 protein_id gnl|my_center|LOCUS_02700 216411 217115 gene locus_tag LOCUS_02710 gene tcyB 216411 217115 CDS product cystine ABC transporter permease TcyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234541.1 protein_id gnl|my_center|LOCUS_02710 217129 217872 gene locus_tag LOCUS_02720 gene tcyC 217129 217872 CDS product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 protein_id gnl|my_center|LOCUS_02720 217994 218641 gene locus_tag LOCUS_02730 217994 218641 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246558.1 protein_id gnl|my_center|LOCUS_02730 218746 219420 gene locus_tag LOCUS_02740 218746 219420 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 protein_id gnl|my_center|LOCUS_02740 220749 219415 gene locus_tag LOCUS_02750 220749 219415 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246711.1 protein_id gnl|my_center|LOCUS_02750 220870 221808 gene locus_tag LOCUS_02760 220870 221808 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246664.1 protein_id gnl|my_center|LOCUS_02760 223660 222434 gene locus_tag LOCUS_02770 223660 222434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246562.1 protein_id gnl|my_center|LOCUS_02770 224364 223759 gene locus_tag LOCUS_02780 gene srfAD 224364 223759 CDS product surfactin biosynthesis thioesterase SrfAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234568.1 protein_id gnl|my_center|LOCUS_02780 228342 224515 gene locus_tag LOCUS_02790 gene srfAC 228342 224515 CDS product surfactin non-ribosomal peptide synthetase SrfAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234570.1 protein_id gnl|my_center|LOCUS_02790 239130 228379 gene locus_tag LOCUS_02800 gene srfAB 239130 228379 CDS product surfactin non-ribosomal peptide synthetase SrfAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886403.1 protein_id gnl|my_center|LOCUS_02800 249906 239143 gene locus_tag LOCUS_02810 gene srfAA 249906 239143 CDS product surfactin non-ribosomal peptide synthetase SrfAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886402.1 protein_id gnl|my_center|LOCUS_02810 250846 250484 gene locus_tag LOCUS_02820 gene hxlR 250846 250484 CDS product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 protein_id gnl|my_center|LOCUS_02820 251077 251709 gene locus_tag LOCUS_02830 gene hxlA 251077 251709 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 protein_id gnl|my_center|LOCUS_02830 251714 252271 gene locus_tag LOCUS_02840 gene hxlB 251714 252271 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_02840 252387 254108 gene locus_tag LOCUS_02850 gene tlpC 252387 254108 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_02850 254294 254731 gene locus_tag LOCUS_02860 gene nucA 254294 254731 CDS product DNA-entry nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246436.1 protein_id gnl|my_center|LOCUS_02860 254754 255152 gene locus_tag LOCUS_02870 gene nin 254754 255152 CDS product DNA-entry nuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246342.1 protein_id gnl|my_center|LOCUS_02870 256622 255189 gene locus_tag LOCUS_02880 gene bglC 256622 255189 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246242.1 protein_id gnl|my_center|LOCUS_02880 257423 256695 gene locus_tag LOCUS_02890 257423 256695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567993.1 protein_id gnl|my_center|LOCUS_02890 257784 257443 gene locus_tag LOCUS_02900 257784 257443 CDS product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986730.1 protein_id gnl|my_center|LOCUS_02900 258194 257772 gene locus_tag LOCUS_02910 258194 257772 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047763.1 protein_id gnl|my_center|LOCUS_02910 258661 258329 gene locus_tag LOCUS_02920 258661 258329 CDS product YckD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246247.1 protein_id gnl|my_center|LOCUS_02920 259199 258744 gene locus_tag LOCUS_02930 259199 258744 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246356.1 protein_id gnl|my_center|LOCUS_02930 259366 259196 gene locus_tag LOCUS_02940 259366 259196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 259614 260477 gene locus_tag LOCUS_02950 259614 260477 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966510.1 protein_id gnl|my_center|LOCUS_02950 260487 261167 gene locus_tag LOCUS_02960 260487 261167 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234624.1 protein_id gnl|my_center|LOCUS_02960 262409 261216 gene locus_tag LOCUS_02970 gene zinU 262409 261216 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_02970 263618 262446 gene locus_tag LOCUS_02980 263618 262446 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_02980 263902 263702 gene locus_tag LOCUS_02990 263902 263702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 264845 263931 gene locus_tag LOCUS_03000 gene folE2 264845 263931 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246378.1 protein_id gnl|my_center|LOCUS_03000 266166 264961 gene locus_tag LOCUS_03010 266166 264961 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_03010 266347 268671 gene locus_tag LOCUS_03020 gene nasB 266347 268671 CDS product assimilatory nitrate reductase electron transfer subunit NasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246389.1 protein_id gnl|my_center|LOCUS_03020 268668 270800 gene locus_tag LOCUS_03030 gene nasC 268668 270800 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_03030 270921 273338 gene locus_tag LOCUS_03040 gene nasD 270921 273338 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_03040 273371 273691 gene locus_tag LOCUS_03050 gene nirD 273371 273691 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 protein_id gnl|my_center|LOCUS_03050 273757 275202 gene locus_tag LOCUS_03060 gene cobA 273757 275202 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234641.1 protein_id gnl|my_center|LOCUS_03060 276243 275233 gene locus_tag LOCUS_03070 gene ffoR 276243 275233 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234643.1 protein_id gnl|my_center|LOCUS_03070 276406 277260 gene locus_tag LOCUS_03080 276406 277260 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 protein_id gnl|my_center|LOCUS_03080 277360 278244 gene locus_tag LOCUS_03090 277360 278244 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_03090 278249 279106 gene locus_tag LOCUS_03100 278249 279106 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234649.1 protein_id gnl|my_center|LOCUS_03100 280378 279143 gene locus_tag LOCUS_03110 gene putR 280378 279143 CDS product proline utilization transcriptional regulator PutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234651.1 protein_id gnl|my_center|LOCUS_03110 281946 280531 gene locus_tag LOCUS_03120 gene putP 281946 280531 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 protein_id gnl|my_center|LOCUS_03120 283624 282077 gene locus_tag LOCUS_03130 gene pruA 283624 282077 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_03130 284558 283641 gene locus_tag LOCUS_03140 gene putB 284558 283641 CDS product proline dehydrogenase PutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246421.1 protein_id gnl|my_center|LOCUS_03140 285522 284740 gene locus_tag LOCUS_03150 285522 284740 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_03150 286562 285606 gene locus_tag LOCUS_03160 gene cah 286562 285606 CDS product cephalosporin C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246400.1 protein_id gnl|my_center|LOCUS_03160 287608 286634 gene locus_tag LOCUS_03170 287608 286634 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_03170 287725 288486 gene locus_tag LOCUS_03180 287725 288486 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246488.1 protein_id gnl|my_center|LOCUS_03180 289076 288516 gene locus_tag LOCUS_03190 289076 288516 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246473.1 protein_id gnl|my_center|LOCUS_03190 289383 289976 gene locus_tag LOCUS_03200 gene tmrB 289383 289976 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_03200 291068 290250 gene locus_tag LOCUS_03210 gene nadE 291068 290250 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246440.1 protein_id gnl|my_center|LOCUS_03210 291797 291201 gene locus_tag LOCUS_03220 291797 291201 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246345.1 protein_id gnl|my_center|LOCUS_03220 291921 293267 gene locus_tag LOCUS_03230 291921 293267 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246486.1 protein_id gnl|my_center|LOCUS_03230 294030 293269 gene locus_tag LOCUS_03240 294030 293269 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246374.1 protein_id gnl|my_center|LOCUS_03240 294729 294100 gene locus_tag LOCUS_03250 294729 294100 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246469.1 protein_id gnl|my_center|LOCUS_03250 295268 294804 gene locus_tag LOCUS_03260 295268 294804 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_03260 295381 296922 gene locus_tag LOCUS_03270 gene bmr3 295381 296922 CDS product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 protein_id gnl|my_center|LOCUS_03270 298587 296962 gene locus_tag LOCUS_03280 298587 296962 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 protein_id gnl|my_center|LOCUS_03280 299584 298619 gene locus_tag LOCUS_03290 299584 298619 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234685.1 protein_id gnl|my_center|LOCUS_03290 301737 299758 gene locus_tag LOCUS_03300 gene amyE 301737 299758 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234692.1 protein_id gnl|my_center|LOCUS_03300 302478 301990 gene locus_tag LOCUS_03310 302478 301990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246445.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03310 304027 302594 gene locus_tag LOCUS_03320 304027 302594 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_03320 304177 305328 gene locus_tag LOCUS_03330 304177 305328 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246319.1 protein_id gnl|my_center|LOCUS_03330 306247 305366 gene locus_tag LOCUS_03340 gene opuAC 306247 305366 CDS product glycine/proline betaine ABC transporter substrate-binding protein OpuAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246462.1 protein_id gnl|my_center|LOCUS_03340 307095 306247 gene locus_tag LOCUS_03350 gene opuAB 307095 306247 CDS product glycine/proline betaine ABC transporter permease subunit OpuAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234703.1 protein_id gnl|my_center|LOCUS_03350 308350 307097 gene locus_tag LOCUS_03360 gene opuAA 308350 307097 CDS product glycine/proline betaine ABC transporter ATP-binding protein OpuAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246301.1 protein_id gnl|my_center|LOCUS_03360 308638 308877 gene locus_tag LOCUS_03370 308638 308877 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886398.1 protein_id gnl|my_center|LOCUS_03370 310353 309151 gene locus_tag LOCUS_03380 gene niaP 310353 309151 CDS product niacin permease NiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246397.1 protein_id gnl|my_center|LOCUS_03380 311567 310476 gene locus_tag LOCUS_03390 311567 310476 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234715.1 protein_id gnl|my_center|LOCUS_03390 313196 311583 gene locus_tag LOCUS_03400 313196 311583 CDS product YceG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246317.1 protein_id gnl|my_center|LOCUS_03400 314053 313280 gene locus_tag LOCUS_03410 314053 313280 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246458.1 protein_id gnl|my_center|LOCUS_03410 314683 314105 gene locus_tag LOCUS_03420 314683 314105 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 protein_id gnl|my_center|LOCUS_03420 315299 314718 gene locus_tag LOCUS_03430 315299 314718 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234723.1 protein_id gnl|my_center|LOCUS_03430 315920 315321 gene locus_tag LOCUS_03440 315920 315321 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_03440 316257 317198 gene locus_tag LOCUS_03450 316257 317198 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 protein_id gnl|my_center|LOCUS_03450 318078 317236 gene locus_tag LOCUS_03460 gene znuB 318078 317236 CDS product zinc ABC transporter permease ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246340.1 protein_id gnl|my_center|LOCUS_03460 318731 318036 gene locus_tag LOCUS_03470 gene znuC 318731 318036 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234730.1 protein_id gnl|my_center|LOCUS_03470 319754 318786 gene locus_tag LOCUS_03480 319754 318786 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234733.1 protein_id gnl|my_center|LOCUS_03480 321628 319937 gene locus_tag LOCUS_03490 321628 319937 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234736.1 protein_id gnl|my_center|LOCUS_03490 322429 321653 gene locus_tag LOCUS_03500 322429 321653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246415.1 protein_id gnl|my_center|LOCUS_03500 323660 322539 gene locus_tag LOCUS_03510 gene rapJ 323660 322539 CDS product response regulator aspartate phosphatase RapJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246478.1 protein_id gnl|my_center|LOCUS_03510 323781 324284 gene locus_tag LOCUS_03520 gene cwlK 323781 324284 CDS product peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966473.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence022 >Feature sequence023 >Feature sequence024 258 70 gene locus_tag LOCUS_03530 258 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03530 >Feature sequence025 >Feature sequence026 >Feature sequence027 >Feature sequence028 >Feature sequence029 406 185 gene locus_tag LOCUS_03540 406 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence030 >Feature sequence031 >Feature sequence032 161 271 gene locus_tag LOCUS_r00020 161 271 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 409 546 gene locus_tag LOCUS_03550 409 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 506 916 gene locus_tag LOCUS_03560 506 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1188 2624 gene locus_tag LOCUS_03570 1188 2624 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 protein_id gnl|my_center|LOCUS_03570 2732 3691 gene locus_tag LOCUS_03580 2732 3691 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_03580 4457 3708 gene locus_tag LOCUS_03590 4457 3708 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234982.1 protein_id gnl|my_center|LOCUS_03590 5464 4454 gene locus_tag LOCUS_03600 gene feuC 5464 4454 CDS product iron ABC transporter permease FeuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234980.1 protein_id gnl|my_center|LOCUS_03600 6461 5457 gene locus_tag LOCUS_03610 6461 5457 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234979.1 protein_id gnl|my_center|LOCUS_03610 7433 6480 gene locus_tag LOCUS_03620 gene feuA 7433 6480 CDS product iron ABC transporter substrate-binding protein FeuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234978.1 protein_id gnl|my_center|LOCUS_03620 9113 7524 gene locus_tag LOCUS_03630 gene btr 9113 7524 CDS product bacillibactin transport transcriptional regulator Btr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234977.1 protein_id gnl|my_center|LOCUS_03630 10548 9304 gene locus_tag LOCUS_03640 10548 9304 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_03640 12490 10562 gene locus_tag LOCUS_03650 gene nagZ 12490 10562 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234975.1 protein_id gnl|my_center|LOCUS_03650 13843 12518 gene locus_tag LOCUS_03660 gene amiE 13843 12518 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234970.1 protein_id gnl|my_center|LOCUS_03660 15266 13899 gene locus_tag LOCUS_03670 15266 13899 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234968.1 protein_id gnl|my_center|LOCUS_03670 16143 15292 gene locus_tag LOCUS_03680 16143 15292 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234966.1 protein_id gnl|my_center|LOCUS_03680 17074 16157 gene locus_tag LOCUS_03690 gene murQ 17074 16157 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246253.1 protein_id gnl|my_center|LOCUS_03690 17666 17184 gene locus_tag LOCUS_03700 17666 17184 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234962.1 protein_id gnl|my_center|LOCUS_03700 18134 17679 gene locus_tag LOCUS_03710 18134 17679 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 protein_id gnl|my_center|LOCUS_03710 18315 18389 gene locus_tag LOCUS_t00310 18315 18389 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 18393 18468 gene locus_tag LOCUS_t00320 18393 18468 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18473 18546 gene locus_tag LOCUS_t00330 18473 18546 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18567 18651 gene locus_tag LOCUS_t00340 18567 18651 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 18658 18732 gene locus_tag LOCUS_t00350 18658 18732 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18959 19522 gene locus_tag LOCUS_03720 gene sigW 18959 19522 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_03720 19536 20162 gene locus_tag LOCUS_03730 gene rsiW 19536 20162 CDS product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 protein_id gnl|my_center|LOCUS_03730 20329 21150 gene locus_tag LOCUS_03740 gene cdaA 20329 21150 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_03740 21143 22597 gene locus_tag LOCUS_03750 gene cdaR 21143 22597 CDS product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 protein_id gnl|my_center|LOCUS_03750 22616 23962 gene locus_tag LOCUS_03760 gene glmM 22616 23962 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_03760 24394 26196 gene locus_tag LOCUS_03770 gene glmS 24394 26196 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234943.1 protein_id gnl|my_center|LOCUS_03770 26971 28488 gene locus_tag LOCUS_03780 26971 28488 CDS product NADH dehydrogenase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234919.1 protein_id gnl|my_center|LOCUS_03780 28500 31121 gene locus_tag LOCUS_03790 28500 31121 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234917.1 protein_id gnl|my_center|LOCUS_03790 31194 31712 gene locus_tag LOCUS_03800 31194 31712 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246329.1 protein_id gnl|my_center|LOCUS_03800 31793 32083 gene locus_tag LOCUS_03810 31793 32083 CDS product DUF6407 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234913.1 protein_id gnl|my_center|LOCUS_03810 32139 32513 gene locus_tag LOCUS_03820 32139 32513 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246482.1 protein_id gnl|my_center|LOCUS_03820 33202 34179 gene locus_tag LOCUS_03830 33202 34179 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234896.1 protein_id gnl|my_center|LOCUS_03830 34181 34852 gene locus_tag LOCUS_03840 gene ybdJ 34181 34852 CDS product two-component system response regulator YbdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234895.1 protein_id gnl|my_center|LOCUS_03840 34930 35841 gene locus_tag LOCUS_03850 gene ybdK 34930 35841 CDS product two-component system sensor histidine kinase YbdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886392.1 protein_id gnl|my_center|LOCUS_03850 36957 36067 gene locus_tag LOCUS_03860 36957 36067 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 protein_id gnl|my_center|LOCUS_03860 37112 38413 gene locus_tag LOCUS_03870 gene thrC 37112 38413 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_03870 38534 39676 gene locus_tag LOCUS_03880 38534 39676 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238677.1 protein_id gnl|my_center|LOCUS_03880 40648 40884 gene locus_tag LOCUS_03890 40648 40884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 40920 41423 gene locus_tag LOCUS_03900 gene comD 40920 41423 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 protein_id gnl|my_center|LOCUS_03900 41435 41995 gene locus_tag LOCUS_03910 41435 41995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 41992 43005 gene locus_tag LOCUS_03920 41992 43005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 43002 43892 gene locus_tag LOCUS_03930 43002 43892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 43915 45003 gene locus_tag LOCUS_03940 43915 45003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 45039 45437 gene locus_tag LOCUS_03950 45039 45437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 45479 46618 gene locus_tag LOCUS_03960 45479 46618 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_03960 46611 46868 gene locus_tag LOCUS_03970 46611 46868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 46884 47531 gene locus_tag LOCUS_03980 46884 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 47548 48789 gene locus_tag LOCUS_03990 47548 48789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 48899 49066 gene locus_tag LOCUS_04000 48899 49066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 49879 49109 gene locus_tag LOCUS_04010 49879 49109 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234892.1 protein_id gnl|my_center|LOCUS_04010 50857 50003 gene locus_tag LOCUS_04020 50857 50003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246309.1 protein_id gnl|my_center|LOCUS_04020 50993 52177 gene locus_tag LOCUS_04030 50993 52177 CDS product DUF4885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246341.1 protein_id gnl|my_center|LOCUS_04030 52494 53882 gene locus_tag LOCUS_04040 52494 53882 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246273.1 protein_id gnl|my_center|LOCUS_04040 53995 54243 gene locus_tag LOCUS_04050 gene csgA 53995 54243 CDS product sigma-G-dependent sporulation-specific acid-soluble spore protein CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234887.1 protein_id gnl|my_center|LOCUS_04050 54258 54449 gene locus_tag LOCUS_04060 54258 54449 CDS product DUF5370 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234886.1 protein_id gnl|my_center|LOCUS_04060 55282 54479 gene locus_tag LOCUS_04070 gene blaOXA 55282 54479 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 protein_id gnl|my_center|LOCUS_04070 55456 56709 gene locus_tag LOCUS_04080 gene cypC 55456 56709 CDS product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 protein_id gnl|my_center|LOCUS_04080 57010 56750 gene locus_tag LOCUS_04090 57010 56750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234883.1 protein_id gnl|my_center|LOCUS_04090 57383 59011 gene locus_tag LOCUS_04100 57383 59011 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456278.1 protein_id gnl|my_center|LOCUS_04100 59927 59037 gene locus_tag LOCUS_04110 59927 59037 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 protein_id gnl|my_center|LOCUS_04110 61360 60026 gene locus_tag LOCUS_04120 gene glpT 61360 60026 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_04120 61649 61903 gene locus_tag LOCUS_04130 61649 61903 CDS product YbeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234879.1 protein_id gnl|my_center|LOCUS_04130 61995 62912 gene locus_tag LOCUS_04140 61995 62912 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246419.1 protein_id gnl|my_center|LOCUS_04140 62864 64162 gene locus_tag LOCUS_04150 62864 64162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 protein_id gnl|my_center|LOCUS_04150 64620 64195 gene locus_tag LOCUS_04160 64620 64195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010331443.1 protein_id gnl|my_center|LOCUS_04160 65593 64682 gene locus_tag LOCUS_04170 65593 64682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246251.1 protein_id gnl|my_center|LOCUS_04170 66680 65754 gene locus_tag LOCUS_04180 66680 65754 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_04180 67504 66677 gene locus_tag LOCUS_04190 67504 66677 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246321.1 protein_id gnl|my_center|LOCUS_04190 67735 68889 gene locus_tag LOCUS_04200 gene purT 67735 68889 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 protein_id gnl|my_center|LOCUS_04200 69031 69969 gene locus_tag LOCUS_04210 gene mpr 69031 69969 CDS product extracellular metalloprotease Mpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246370.1 protein_id gnl|my_center|LOCUS_04210 69932 70330 gene locus_tag LOCUS_04220 69932 70330 CDS product YbfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246434.1 protein_id gnl|my_center|LOCUS_04220 70503 71387 gene locus_tag LOCUS_04230 gene cesB 70503 71387 CDS product enantioselective carboxylesterase CesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246261.1 protein_id gnl|my_center|LOCUS_04230 71586 72119 gene locus_tag LOCUS_04240 gene pssA 71586 72119 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966430.1 protein_id gnl|my_center|LOCUS_04240 72110 72598 gene locus_tag LOCUS_04250 72110 72598 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234861.1 protein_id gnl|my_center|LOCUS_04250 72591 73400 gene locus_tag LOCUS_04260 72591 73400 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246344.1 protein_id gnl|my_center|LOCUS_04260 73437 73715 gene locus_tag LOCUS_04270 73437 73715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246354.1 protein_id gnl|my_center|LOCUS_04270 73819 75159 gene locus_tag LOCUS_04280 73819 75159 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246404.1 protein_id gnl|my_center|LOCUS_04280 75412 76380 gene locus_tag LOCUS_04290 75412 76380 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246287.1 protein_id gnl|my_center|LOCUS_04290 77660 76416 gene locus_tag LOCUS_04300 gene gltP 77660 76416 CDS product glutamate-aspartate/proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234847.1 protein_id gnl|my_center|LOCUS_04300 78843 77803 gene locus_tag LOCUS_04310 78843 77803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 79697 78867 gene locus_tag LOCUS_04320 79697 78867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04320 80467 79718 gene locus_tag LOCUS_04330 gene nagB 80467 79718 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 protein_id gnl|my_center|LOCUS_04330 80686 81393 gene locus_tag LOCUS_04340 gene gamR 80686 81393 CDS product transcriptional regulator GamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234841.1 protein_id gnl|my_center|LOCUS_04340 81428 81703 gene locus_tag LOCUS_04350 81428 81703 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234840.1 protein_id gnl|my_center|LOCUS_04350 81784 82986 gene locus_tag LOCUS_04360 81784 82986 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_04360 84368 83022 gene locus_tag LOCUS_04370 gene mmuP 84368 83022 CDS product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966441.1 protein_id gnl|my_center|LOCUS_04370 85502 84555 gene locus_tag LOCUS_04380 gene mmuM 85502 84555 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_04380 87063 85627 gene locus_tag LOCUS_04390 87063 85627 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246395.1 protein_id gnl|my_center|LOCUS_04390 88068 87085 gene locus_tag LOCUS_04400 88068 87085 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234829.1 protein_id gnl|my_center|LOCUS_04400 88312 89601 gene locus_tag LOCUS_04410 gene glnK 88312 89601 CDS product two-component system sensor histidine kinase GlnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886394.1 protein_id gnl|my_center|LOCUS_04410 89612 90556 gene locus_tag LOCUS_04420 gene glnL 89612 90556 CDS product glutamine utilization two-component system response regulator GlnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234824.1 protein_id gnl|my_center|LOCUS_04420 90623 90769 gene locus_tag LOCUS_04430 90623 90769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 90785 91711 gene locus_tag LOCUS_04440 gene kdgD 90785 91711 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246372.1 protein_id gnl|my_center|LOCUS_04440 91741 93207 gene locus_tag LOCUS_04450 91741 93207 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_04450 93292 94659 gene locus_tag LOCUS_04460 gene gudP 93292 94659 CDS product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 protein_id gnl|my_center|LOCUS_04460 94696 96063 gene locus_tag LOCUS_04470 gene gudD 94696 96063 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234816.1 protein_id gnl|my_center|LOCUS_04470 96133 96834 gene locus_tag LOCUS_04480 96133 96834 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246338.1 protein_id gnl|my_center|LOCUS_04480 96927 98459 gene locus_tag LOCUS_04490 gene garD 96927 98459 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_04490 98736 99656 gene locus_tag LOCUS_04500 gene mphK 98736 99656 CDS product macrolide 2'-phosphotransferase MphK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246254.1 protein_id gnl|my_center|LOCUS_04500 100449 101129 gene locus_tag LOCUS_04510 gene ycbL 100449 101129 CDS product two-component system response regulator YcbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966453.1 protein_id gnl|my_center|LOCUS_04510 101131 102066 gene locus_tag LOCUS_04520 gene ycbM 101131 102066 CDS product two-component system sensor histidine kinase YcbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246497.1 protein_id gnl|my_center|LOCUS_04520 102161 103084 gene locus_tag LOCUS_04530 102161 103084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246292.1 protein_id gnl|my_center|LOCUS_04530 103100 103789 gene locus_tag LOCUS_04540 103100 103789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886395.1 protein_id gnl|my_center|LOCUS_04540 104229 103843 gene locus_tag LOCUS_04550 104229 103843 CDS product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246313.1 protein_id gnl|my_center|LOCUS_04550 104344 105579 gene locus_tag LOCUS_04560 104344 105579 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_04560 105662 106090 gene locus_tag LOCUS_04570 gene cwlJ 105662 106090 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 protein_id gnl|my_center|LOCUS_04570 106196 106927 gene locus_tag LOCUS_04580 106196 106927 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246379.1 protein_id gnl|my_center|LOCUS_04580 107202 108953 gene locus_tag LOCUS_04590 gene phoD 107202 108953 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_04590 108967 109179 gene locus_tag LOCUS_04600 gene tatAD 108967 109179 CDS product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 protein_id gnl|my_center|LOCUS_04600 109241 109966 gene locus_tag LOCUS_04610 gene tatC 109241 109966 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246495.1 protein_id gnl|my_center|LOCUS_04610 110610 109963 gene locus_tag LOCUS_04620 gene pcp 110610 109963 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246307.1 protein_id gnl|my_center|LOCUS_04620 110690 111802 gene locus_tag LOCUS_04630 110690 111802 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_04630 113278 111845 gene locus_tag LOCUS_04640 gene lmr(B) 113278 111845 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_04640 113894 113328 gene locus_tag LOCUS_04650 gene lmrA 113894 113328 CDS product transcriptional regulator LmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246449.1 protein_id gnl|my_center|LOCUS_04650 114688 115326 gene locus_tag LOCUS_04660 gene lipA 114688 115326 CDS product lipase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246250.1 protein_id gnl|my_center|LOCUS_04660 115747 115364 gene locus_tag LOCUS_04670 115747 115364 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966469.1 protein_id gnl|my_center|LOCUS_04670 115982 117058 gene locus_tag LOCUS_04680 115982 117058 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246276.1 protein_id gnl|my_center|LOCUS_04680 117310 117098 gene locus_tag LOCUS_04690 117310 117098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 117325 117576 gene locus_tag LOCUS_04700 117325 117576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 117712 118644 gene locus_tag LOCUS_04710 117712 118644 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246289.1 protein_id gnl|my_center|LOCUS_04710 119748 118684 gene locus_tag LOCUS_04720 119748 118684 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234750.1 protein_id gnl|my_center|LOCUS_04720 120095 121492 gene locus_tag LOCUS_04730 120095 121492 CDS product DUF4901 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246352.1 protein_id gnl|my_center|LOCUS_04730 121678 122583 gene locus_tag LOCUS_04740 121678 122583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence033 >Feature sequence034 >Feature sequence035 99 362 gene locus_tag LOCUS_04750 99 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence036 >Feature sequence037 >Feature sequence038 28 162 gene locus_tag LOCUS_04760 28 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence039 >Feature sequence040 >Feature sequence041 >Feature sequence042 >Feature sequence043 >Feature sequence044 >Feature sequence045 >Feature sequence046 >Feature sequence047 >Feature sequence048 >Feature sequence049 >Feature sequence050 >Feature sequence051 208 98 gene locus_tag LOCUS_r00030 208 98 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence052 >Feature sequence053 258 339 gene locus_tag LOCUS_t00360 258 339 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 1128 139 gene locus_tag LOCUS_04770 gene ftsY 1128 139 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 protein_id gnl|my_center|LOCUS_04770 4708 1148 gene locus_tag LOCUS_04780 gene smc 4708 1148 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_04780 5559 4810 gene locus_tag LOCUS_04790 gene rncS 5559 4810 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_04790 5932 5699 gene locus_tag LOCUS_04800 gene acpP 5932 5699 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_04800 6756 6016 gene locus_tag LOCUS_04810 gene fabG 6756 6016 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_04810 7702 6749 gene locus_tag LOCUS_04820 gene fabD 7702 6749 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_04820 8722 7721 gene locus_tag LOCUS_04830 gene plsX 8722 7721 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 protein_id gnl|my_center|LOCUS_04830 9302 8736 gene locus_tag LOCUS_04840 gene fapR 9302 8736 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 protein_id gnl|my_center|LOCUS_04840 11459 9411 gene locus_tag LOCUS_04850 gene recG 11459 9411 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244692.1 protein_id gnl|my_center|LOCUS_04850 12339 11437 gene locus_tag LOCUS_04860 gene sdaAA 12339 11437 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 protein_id gnl|my_center|LOCUS_04860 13025 12363 gene locus_tag LOCUS_04870 gene sdaAB 13025 12363 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 protein_id gnl|my_center|LOCUS_04870 14825 13164 gene locus_tag LOCUS_04880 14825 13164 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_04880 15203 14841 gene locus_tag LOCUS_04890 15203 14841 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_04890 15482 15670 gene locus_tag LOCUS_04900 gene rpmB 15482 15670 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 protein_id gnl|my_center|LOCUS_04900 15892 15743 gene locus_tag LOCUS_04910 15892 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 16538 15894 gene locus_tag LOCUS_04920 16538 15894 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245470.1 protein_id gnl|my_center|LOCUS_04920 17261 16608 gene locus_tag LOCUS_04930 gene rpe 17261 16608 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_04930 18162 17266 gene locus_tag LOCUS_04940 gene rsgA 18162 17266 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_04940 20123 18177 gene locus_tag LOCUS_04950 gene prkC 20123 18177 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_04950 20881 20117 gene locus_tag LOCUS_04960 gene prpC 20881 20117 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_04960 21979 20888 gene locus_tag LOCUS_04970 gene rlmN 21979 20888 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_04970 23325 21982 gene locus_tag LOCUS_04980 gene rsmB 23325 21982 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_04980 24265 23312 gene locus_tag LOCUS_04990 gene fmt 24265 23312 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_04990 24752 24270 gene locus_tag LOCUS_05000 gene def 24752 24270 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232077.1 protein_id gnl|my_center|LOCUS_05000 27196 24779 gene locus_tag LOCUS_05010 gene priA 27196 24779 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_05010 28413 27193 gene locus_tag LOCUS_05020 gene coaBC 28413 27193 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_05020 28698 28495 gene locus_tag LOCUS_05030 gene rpoZ 28698 28495 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 protein_id gnl|my_center|LOCUS_05030 29340 28702 gene locus_tag LOCUS_05040 gene gmk 29340 28702 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 protein_id gnl|my_center|LOCUS_05040 29593 29324 gene locus_tag LOCUS_05050 gene remA 29593 29324 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_05050 30545 29670 gene locus_tag LOCUS_05060 30545 29670 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967215.1 protein_id gnl|my_center|LOCUS_05060 33300 30628 gene locus_tag LOCUS_05070 33300 30628 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232087.1 protein_id gnl|my_center|LOCUS_05070 33422 35134 gene locus_tag LOCUS_05080 gene rqcH 33422 35134 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_05080 35660 35172 gene locus_tag LOCUS_05090 gene sirC 35660 35172 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232091.1 protein_id gnl|my_center|LOCUS_05090 36426 35641 gene locus_tag LOCUS_05100 gene sirB 36426 35641 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232093.1 protein_id gnl|my_center|LOCUS_05100 37202 36429 gene locus_tag LOCUS_05110 gene cobA 37202 36429 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232095.1 protein_id gnl|my_center|LOCUS_05110 37894 37301 gene locus_tag LOCUS_05120 gene cysC 37894 37301 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232097.1 protein_id gnl|my_center|LOCUS_05120 39055 37907 gene locus_tag LOCUS_05130 gene sat 39055 37907 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_05130 40168 39104 gene locus_tag LOCUS_05140 gene cysP 40168 39104 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 protein_id gnl|my_center|LOCUS_05140 40881 40180 gene locus_tag LOCUS_05150 40881 40180 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 protein_id gnl|my_center|LOCUS_05150 41925 41293 gene locus_tag LOCUS_05160 gene pyrE 41925 41293 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_05160 42641 41922 gene locus_tag LOCUS_05170 gene pyrF 42641 41922 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232107.1 protein_id gnl|my_center|LOCUS_05170 43545 42610 gene locus_tag LOCUS_05180 43545 42610 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_05180 44315 43545 gene locus_tag LOCUS_05190 gene pyrK 44315 43545 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_05190 47527 44312 gene locus_tag LOCUS_05200 gene carB 47527 44312 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_05200 48606 47512 gene locus_tag LOCUS_05210 48606 47512 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_05210 49889 48603 gene locus_tag LOCUS_05220 49889 48603 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 protein_id gnl|my_center|LOCUS_05220 50787 49873 gene locus_tag LOCUS_05230 50787 49873 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 protein_id gnl|my_center|LOCUS_05230 52239 50932 gene locus_tag LOCUS_05240 gene pyrP 52239 50932 CDS product uracil permease PyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221479.1 protein_id gnl|my_center|LOCUS_05240 52959 52414 gene locus_tag LOCUS_05250 gene pyrR 52959 52414 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 protein_id gnl|my_center|LOCUS_05250 54052 53141 gene locus_tag LOCUS_05260 54052 53141 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_05260 54518 54054 gene locus_tag LOCUS_05270 gene lspA 54518 54054 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 protein_id gnl|my_center|LOCUS_05270 54995 54621 gene locus_tag LOCUS_05280 gene ylyA 54995 54621 CDS product sporulation-related RNA polymerase-binding protein YlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245479.1 protein_id gnl|my_center|LOCUS_05280 57906 55141 gene locus_tag LOCUS_05290 gene ileS 57906 55141 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245512.1 protein_id gnl|my_center|LOCUS_05290 58742 58248 gene locus_tag LOCUS_05300 gene divIVA 58742 58248 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 protein_id gnl|my_center|LOCUS_05300 59609 58836 gene locus_tag LOCUS_05310 59609 58836 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_05310 59942 59670 gene locus_tag LOCUS_05320 59942 59670 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 protein_id gnl|my_center|LOCUS_05320 60368 59949 gene locus_tag LOCUS_05330 gene sepF 60368 59949 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_05330 61092 60400 gene locus_tag LOCUS_05340 61092 60400 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_05340 61935 61099 gene locus_tag LOCUS_05350 gene pgeF 61935 61099 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_05350 62342 62097 gene locus_tag LOCUS_05360 62342 62097 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_05360 63705 62425 gene locus_tag LOCUS_05370 gene ylmB 63705 62425 CDS product N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244730.1 protein_id gnl|my_center|LOCUS_05370 64702 63908 gene locus_tag LOCUS_05380 64702 63908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_05380 65638 64856 gene locus_tag LOCUS_05390 gene sigG 65638 64856 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_05390 66497 65778 gene locus_tag LOCUS_05400 gene sigE 66497 65778 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_05400 67513 66560 gene locus_tag LOCUS_05410 gene spoIIGA 67513 66560 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 protein_id gnl|my_center|LOCUS_05410 71982 67681 gene locus_tag LOCUS_05420 71982 67681 CDS product bacillopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245629.1 protein_id gnl|my_center|LOCUS_05420 73430 72282 gene locus_tag LOCUS_05430 gene ftsZ 73430 72282 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 protein_id gnl|my_center|LOCUS_05430 74788 73466 gene locus_tag LOCUS_05440 gene ftsA 74788 73466 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967186.1 protein_id gnl|my_center|LOCUS_05440 75328 74963 gene locus_tag LOCUS_05450 75328 74963 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238683.1 protein_id gnl|my_center|LOCUS_05450 76053 75346 gene locus_tag LOCUS_05460 76053 75346 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967184.1 protein_id gnl|my_center|LOCUS_05460 76771 76076 gene locus_tag LOCUS_05470 76771 76076 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245024.1 protein_id gnl|my_center|LOCUS_05470 77559 76768 gene locus_tag LOCUS_05480 gene divIB 77559 76768 CDS product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232178.1 protein_id gnl|my_center|LOCUS_05480 78601 77690 gene locus_tag LOCUS_05490 gene murB 78601 77690 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_05490 79724 78633 gene locus_tag LOCUS_05500 gene murG 79724 78633 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_05500 80944 79844 gene locus_tag LOCUS_05510 gene spoVE 80944 79844 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_05510 82360 81005 gene locus_tag LOCUS_05520 gene murD 82360 81005 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232189.1 protein_id gnl|my_center|LOCUS_05520 83335 82361 gene locus_tag LOCUS_05530 gene mraY 83335 82361 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_05530 84931 83447 gene locus_tag LOCUS_05540 84931 83447 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_05540 87048 85108 gene locus_tag LOCUS_05550 87048 85108 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_05550 89302 87182 gene locus_tag LOCUS_05560 gene pbpB 89302 87182 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_05560 89682 89329 gene locus_tag LOCUS_05570 gene ftsL 89682 89329 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232200.1 protein_id gnl|my_center|LOCUS_05570 90656 89721 gene locus_tag LOCUS_05580 gene rsmH 90656 89721 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_05580 91172 90726 gene locus_tag LOCUS_05590 gene mraZ 91172 90726 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_05590 92902 91283 gene locus_tag LOCUS_05600 gene bshC 92902 91283 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245571.1 protein_id gnl|my_center|LOCUS_05600 93869 92973 gene locus_tag LOCUS_05610 93869 92973 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232206.1 protein_id gnl|my_center|LOCUS_05610 94029 94511 gene locus_tag LOCUS_05620 94029 94511 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244940.1 protein_id gnl|my_center|LOCUS_05620 95149 94568 gene locus_tag LOCUS_05630 gene gerR 95149 94568 CDS product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 protein_id gnl|my_center|LOCUS_05630 95474 95295 gene locus_tag LOCUS_05640 gene rpmF 95474 95295 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154457.1 protein_id gnl|my_center|LOCUS_05640 96014 95496 gene locus_tag LOCUS_05650 96014 95496 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232214.1 protein_id gnl|my_center|LOCUS_05650 96224 97471 gene locus_tag LOCUS_05660 96224 97471 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_05660 98513 97488 gene locus_tag LOCUS_05670 gene ddcP 98513 97488 CDS product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 protein_id gnl|my_center|LOCUS_05670 99297 98515 gene locus_tag LOCUS_05680 99297 98515 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_05680 99478 100704 gene locus_tag LOCUS_05690 gene spoVV 99478 100704 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_05690 101200 100715 gene locus_tag LOCUS_05700 gene coaD 101200 100715 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 protein_id gnl|my_center|LOCUS_05700 101759 101205 gene locus_tag LOCUS_05710 gene rsmD 101759 101205 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232227.1 protein_id gnl|my_center|LOCUS_05710 102351 102079 gene locus_tag LOCUS_05720 102351 102079 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967171.1 protein_id gnl|my_center|LOCUS_05720 102855 102406 gene locus_tag LOCUS_05730 gene ricF 102855 102406 CDS product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 protein_id gnl|my_center|LOCUS_05730 103214 102975 gene locus_tag LOCUS_05740 103214 102975 CDS product YlbE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232231.1 protein_id gnl|my_center|LOCUS_05740 103627 103229 gene locus_tag LOCUS_05750 103627 103229 CDS product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232233.1 protein_id gnl|my_center|LOCUS_05750 104926 103886 gene locus_tag LOCUS_05760 104926 103886 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 protein_id gnl|my_center|LOCUS_05760 105457 105011 gene locus_tag LOCUS_05770 105457 105011 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221362.1 protein_id gnl|my_center|LOCUS_05770 105600 105959 gene locus_tag LOCUS_05780 105600 105959 CDS product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232238.1 protein_id gnl|my_center|LOCUS_05780 106884 105991 gene locus_tag LOCUS_05790 gene ctaG 106884 105991 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244967.1 protein_id gnl|my_center|LOCUS_05790 107243 106911 gene locus_tag LOCUS_05800 gene ctaF 107243 106911 CDS product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232242.1 protein_id gnl|my_center|LOCUS_05800 107869 107246 gene locus_tag LOCUS_05810 gene ctaE 107869 107246 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232244.1 protein_id gnl|my_center|LOCUS_05810 109737 107869 gene locus_tag LOCUS_05820 gene ctaD 109737 107869 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232245.1 protein_id gnl|my_center|LOCUS_05820 110840 109770 gene locus_tag LOCUS_05830 gene coxB 110840 109770 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 protein_id gnl|my_center|LOCUS_05830 111998 111081 gene locus_tag LOCUS_05840 gene cyoE 111998 111081 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232250.1 protein_id gnl|my_center|LOCUS_05840 112353 113273 gene locus_tag LOCUS_05850 gene ctaA 112353 113273 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_05850 117160 113714 gene locus_tag LOCUS_05860 gene pyc 117160 113714 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244778.1 protein_id gnl|my_center|LOCUS_05860 118446 117235 gene locus_tag LOCUS_05870 gene ftsW 118446 117235 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 protein_id gnl|my_center|LOCUS_05870 118927 118646 gene locus_tag LOCUS_05880 118927 118646 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 protein_id gnl|my_center|LOCUS_05880 119954 119025 gene locus_tag LOCUS_05890 gene glsA 119954 119025 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245206.1 protein_id gnl|my_center|LOCUS_05890 120057 120542 gene locus_tag LOCUS_05900 120057 120542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245279.1 protein_id gnl|my_center|LOCUS_05900 121873 120545 gene locus_tag LOCUS_05910 121873 120545 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245272.1 protein_id gnl|my_center|LOCUS_05910 122029 122658 gene locus_tag LOCUS_05920 122029 122658 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 protein_id gnl|my_center|LOCUS_05920 122744 122950 gene locus_tag LOCUS_05930 122744 122950 CDS product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232271.1 protein_id gnl|my_center|LOCUS_05930 123326 123009 gene locus_tag LOCUS_05940 123326 123009 CDS product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232274.1 protein_id gnl|my_center|LOCUS_05940 125220 123382 gene locus_tag LOCUS_05950 gene typA 125220 123382 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_05950 125333 125521 gene locus_tag LOCUS_05960 125333 125521 CDS product YlaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245500.1 protein_id gnl|my_center|LOCUS_05960 125795 126406 gene locus_tag LOCUS_05970 125795 126406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232282.1 protein_id gnl|my_center|LOCUS_05970 126739 126446 gene locus_tag LOCUS_05980 gene sigQ 126739 126446 CDS product anti-SigP sigma factor SigQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232283.1 protein_id gnl|my_center|LOCUS_05980 127257 126736 gene locus_tag LOCUS_05990 gene ylaC 127257 126736 CDS product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 protein_id gnl|my_center|LOCUS_05990 127526 127257 gene locus_tag LOCUS_06000 127526 127257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232287.1 protein_id gnl|my_center|LOCUS_06000 129453 127516 gene locus_tag LOCUS_06010 129453 127516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886503.1 protein_id gnl|my_center|LOCUS_06010 129741 131306 gene locus_tag LOCUS_06020 gene nprE 129741 131306 CDS product neutral metalloprotease NprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245026.1 protein_id gnl|my_center|LOCUS_06020 131738 132652 gene locus_tag LOCUS_06030 131738 132652 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245561.1 protein_id gnl|my_center|LOCUS_06030 133157 132729 gene locus_tag LOCUS_06040 133157 132729 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232296.1 protein_id gnl|my_center|LOCUS_06040 133980 133183 gene locus_tag LOCUS_06050 gene suhB 133980 133183 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 protein_id gnl|my_center|LOCUS_06050 134306 134118 gene locus_tag LOCUS_06060 134306 134118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967148.1 protein_id gnl|my_center|LOCUS_06060 134546 135184 gene locus_tag LOCUS_06070 134546 135184 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_06070 135483 135217 gene locus_tag LOCUS_06080 135483 135217 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245382.1 protein_id gnl|my_center|LOCUS_06080 135668 137140 gene locus_tag LOCUS_06090 gene speA 135668 137140 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence055 120 192 gene locus_tag LOCUS_t00370 120 192 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 >Feature sequence057 >Feature sequence058 >Feature sequence059 >Feature sequence060 783 574 gene locus_tag LOCUS_06100 783 574 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234008.1 protein_id gnl|my_center|LOCUS_06100 1681 866 gene locus_tag LOCUS_06110 1681 866 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 protein_id gnl|my_center|LOCUS_06110 2684 1695 gene locus_tag LOCUS_06120 2684 1695 CDS product DUF4003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243701.1 protein_id gnl|my_center|LOCUS_06120 4324 2783 gene locus_tag LOCUS_06130 gene cotA 4324 2783 CDS product outer spore coat copper-dependent laccase CotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243170.1 protein_id gnl|my_center|LOCUS_06130 5885 4476 gene locus_tag LOCUS_06140 gene gabP 5885 4476 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233998.1 protein_id gnl|my_center|LOCUS_06140 6299 7171 gene locus_tag LOCUS_06150 gene mneS 6299 7171 CDS product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 protein_id gnl|my_center|LOCUS_06150 7323 8285 gene locus_tag LOCUS_06160 7323 8285 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_06160 8297 9481 gene locus_tag LOCUS_06170 8297 9481 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243539.1 protein_id gnl|my_center|LOCUS_06170 9497 11716 gene locus_tag LOCUS_06180 9497 11716 CDS product DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242683.1 protein_id gnl|my_center|LOCUS_06180 11871 13421 gene locus_tag LOCUS_06190 gene guaA 11871 13421 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244399.1 protein_id gnl|my_center|LOCUS_06190 13802 15124 gene locus_tag LOCUS_06200 gene pbuG 13802 15124 CDS product hypoxanthine/guanine permease PbuG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243780.1 protein_id gnl|my_center|LOCUS_06200 15335 16138 gene locus_tag LOCUS_06210 15335 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242783.1 protein_id gnl|my_center|LOCUS_06210 16297 16464 gene locus_tag LOCUS_06220 16297 16464 CDS product Fur-regulated basic protein FbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244066.1 protein_id gnl|my_center|LOCUS_06220 16679 17233 gene locus_tag LOCUS_06230 16679 17233 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966729.1 protein_id gnl|my_center|LOCUS_06230 17233 17430 gene locus_tag LOCUS_06240 17233 17430 CDS product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219403.1 protein_id gnl|my_center|LOCUS_06240 17752 18240 gene locus_tag LOCUS_06250 gene purE 17752 18240 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 protein_id gnl|my_center|LOCUS_06250 18224 19375 gene locus_tag LOCUS_06260 gene purK 18224 19375 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966735.1 protein_id gnl|my_center|LOCUS_06260 19372 20667 gene locus_tag LOCUS_06270 gene purB 19372 20667 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_06270 20742 21467 gene locus_tag LOCUS_06280 20742 21467 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242871.1 protein_id gnl|my_center|LOCUS_06280 21460 21714 gene locus_tag LOCUS_06290 gene purS 21460 21714 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_06290 21711 22394 gene locus_tag LOCUS_06300 gene purQ 21711 22394 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 protein_id gnl|my_center|LOCUS_06300 22378 24606 gene locus_tag LOCUS_06310 gene purL 22378 24606 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 protein_id gnl|my_center|LOCUS_06310 24582 26012 gene locus_tag LOCUS_06320 gene purF 24582 26012 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_06320 26113 27153 gene locus_tag LOCUS_06330 gene purM 26113 27153 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 protein_id gnl|my_center|LOCUS_06330 27150 27737 gene locus_tag LOCUS_06340 gene purN 27150 27737 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 protein_id gnl|my_center|LOCUS_06340 27734 29272 gene locus_tag LOCUS_06350 gene purH 27734 29272 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_06350 29288 30556 gene locus_tag LOCUS_06360 gene purD 29288 30556 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 protein_id gnl|my_center|LOCUS_06360 31018 30596 gene locus_tag LOCUS_06370 31018 30596 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242890.1 protein_id gnl|my_center|LOCUS_06370 31165 32436 gene locus_tag LOCUS_06380 31165 32436 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242474.1 protein_id gnl|my_center|LOCUS_06380 32684 32451 gene locus_tag LOCUS_06390 32684 32451 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233931.1 protein_id gnl|my_center|LOCUS_06390 32814 34556 gene locus_tag LOCUS_06400 32814 34556 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233929.1 protein_id gnl|my_center|LOCUS_06400 34583 35578 gene locus_tag LOCUS_06410 34583 35578 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_06410 35581 35895 gene locus_tag LOCUS_06420 35581 35895 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_06420 37510 35933 gene locus_tag LOCUS_06430 37510 35933 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233925.1 protein_id gnl|my_center|LOCUS_06430 37756 38442 gene locus_tag LOCUS_06440 37756 38442 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233922.1 protein_id gnl|my_center|LOCUS_06440 38504 40723 gene locus_tag LOCUS_06450 gene pcrA 38504 40723 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_06450 40747 42753 gene locus_tag LOCUS_06460 gene ligA 40747 42753 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_06460 42769 43959 gene locus_tag LOCUS_06470 42769 43959 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 protein_id gnl|my_center|LOCUS_06470 43919 44140 gene locus_tag LOCUS_06480 43919 44140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 44143 45144 gene locus_tag LOCUS_06490 44143 45144 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886430.1 protein_id gnl|my_center|LOCUS_06490 45873 45181 gene locus_tag LOCUS_06500 45873 45181 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886431.1 protein_id gnl|my_center|LOCUS_06500 47463 45985 gene locus_tag LOCUS_06510 gene opuE 47463 45985 CDS product proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242814.1 protein_id gnl|my_center|LOCUS_06510 47878 48168 gene locus_tag LOCUS_06520 gene gatC 47878 48168 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_06520 48184 49641 gene locus_tag LOCUS_06530 gene gatA 48184 49641 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 protein_id gnl|my_center|LOCUS_06530 49655 51085 gene locus_tag LOCUS_06540 gene gatB 49655 51085 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_06540 51965 51120 gene locus_tag LOCUS_06550 51965 51120 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243222.1 protein_id gnl|my_center|LOCUS_06550 52097 55255 gene locus_tag LOCUS_06560 gene srfP 52097 55255 CDS product surfactin resistance protein SrfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242663.1 protein_id gnl|my_center|LOCUS_06560 55408 56319 gene locus_tag LOCUS_06570 55408 56319 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_06570 56376 57755 gene locus_tag LOCUS_06580 gene rlmD 56376 57755 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_06580 58534 58656 gene locus_tag LOCUS_06590 58534 58656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 58746 60758 gene locus_tag LOCUS_06600 58746 60758 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_06600 60755 62056 gene locus_tag LOCUS_06610 60755 62056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 62063 65053 gene locus_tag LOCUS_06620 62063 65053 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_06620 65144 65788 gene locus_tag LOCUS_06630 65144 65788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 66325 65870 gene locus_tag LOCUS_06640 66325 65870 CDS product TIGR01741 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886434.1 protein_id gnl|my_center|LOCUS_06640 66824 66339 gene locus_tag LOCUS_06650 66824 66339 CDS product TIGR01741 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886434.1 protein_id gnl|my_center|LOCUS_06650 68838 66829 gene locus_tag LOCUS_06660 gene yeeF 68838 66829 CDS product LXG family T7SS effector deoxyribonuclease toxin YeeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242909.1 protein_id gnl|my_center|LOCUS_06660 68942 70039 gene locus_tag LOCUS_06670 68942 70039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243884.1 protein_id gnl|my_center|LOCUS_06670 70183 71325 gene locus_tag LOCUS_06680 gene rapH 70183 71325 CDS product response regulator aspartate phosphatase RapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243267.1 protein_id gnl|my_center|LOCUS_06680 71315 71491 gene locus_tag LOCUS_06690 gene phrH 71315 71491 CDS product phosphatase RapH inhibitor PhrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242557.1 protein_id gnl|my_center|LOCUS_06690 71651 72370 gene locus_tag LOCUS_06700 71651 72370 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 protein_id gnl|my_center|LOCUS_06700 72506 72961 gene locus_tag LOCUS_06710 72506 72961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 73063 73647 gene locus_tag LOCUS_06720 73063 73647 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 protein_id gnl|my_center|LOCUS_06720 73725 74168 gene locus_tag LOCUS_06730 73725 74168 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233857.1 protein_id gnl|my_center|LOCUS_06730 74165 75013 gene locus_tag LOCUS_06740 74165 75013 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243852.1 protein_id gnl|my_center|LOCUS_06740 76055 75072 gene locus_tag LOCUS_06750 gene tsdA 76055 75072 CDS product gamma-resorcylate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972381.1 protein_id gnl|my_center|LOCUS_06750 76305 76934 gene locus_tag LOCUS_06760 76305 76934 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 protein_id gnl|my_center|LOCUS_06760 77008 77256 gene locus_tag LOCUS_06770 gene cotJA 77008 77256 CDS product spore coat-associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219489.1 protein_id gnl|my_center|LOCUS_06770 77240 77503 gene locus_tag LOCUS_06780 gene cotJB 77240 77503 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219491.1 protein_id gnl|my_center|LOCUS_06780 77518 78087 gene locus_tag LOCUS_06790 gene cotJC 77518 78087 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_06790 78212 78754 gene locus_tag LOCUS_06800 78212 78754 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244053.1 protein_id gnl|my_center|LOCUS_06800 78917 79081 gene locus_tag LOCUS_06810 78917 79081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06810 79202 79825 gene locus_tag LOCUS_06820 79202 79825 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886435.1 protein_id gnl|my_center|LOCUS_06820 79993 81555 gene locus_tag LOCUS_06830 gene yesM 79993 81555 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_06830 81555 82661 gene locus_tag LOCUS_06840 gene yesN 81555 82661 CDS product two-component system response regulator YesN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244566.1 protein_id gnl|my_center|LOCUS_06840 82765 84048 gene locus_tag LOCUS_06850 82765 84048 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_06850 84069 84974 gene locus_tag LOCUS_06860 84069 84974 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_06860 84978 85868 gene locus_tag LOCUS_06870 84978 85868 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_06870 85884 86918 gene locus_tag LOCUS_06880 gene yesR 85884 86918 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_06880 86941 89226 gene locus_tag LOCUS_06890 gene yesS 86941 89226 CDS product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 protein_id gnl|my_center|LOCUS_06890 89243 89938 gene locus_tag LOCUS_06900 gene rhgT 89243 89938 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233825.1 protein_id gnl|my_center|LOCUS_06900 89931 90593 gene locus_tag LOCUS_06910 89931 90593 CDS product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 protein_id gnl|my_center|LOCUS_06910 90590 91216 gene locus_tag LOCUS_06920 90590 91216 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233820.1 protein_id gnl|my_center|LOCUS_06920 91355 93199 gene locus_tag LOCUS_06930 gene rhgW 91355 93199 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_06930 93276 95084 gene locus_tag LOCUS_06940 gene rhgX 93276 95084 CDS product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 protein_id gnl|my_center|LOCUS_06940 95247 95900 gene locus_tag LOCUS_06950 95247 95900 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244014.1 protein_id gnl|my_center|LOCUS_06950 95906 97900 gene locus_tag LOCUS_06960 gene yesZ 95906 97900 CDS product beta-galactosidase YesZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242572.1 protein_id gnl|my_center|LOCUS_06960 97945 100518 gene locus_tag LOCUS_06970 97945 100518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 protein_id gnl|my_center|LOCUS_06970 100608 102149 gene locus_tag LOCUS_06980 100608 102149 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_06980 102204 103160 gene locus_tag LOCUS_06990 102204 103160 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_06990 103174 104061 gene locus_tag LOCUS_07000 103174 104061 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_07000 104070 105413 gene locus_tag LOCUS_07010 gene lplD 104070 105413 CDS product alpha-galacturonidase LplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244472.1 protein_id gnl|my_center|LOCUS_07010 105489 106184 gene locus_tag LOCUS_07020 105489 106184 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 protein_id gnl|my_center|LOCUS_07020 106544 106221 gene locus_tag LOCUS_07030 gene hmoA 106544 106221 CDS product heme-degrading oxygenase HmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243958.1 protein_id gnl|my_center|LOCUS_07030 107006 106644 gene locus_tag LOCUS_07040 107006 106644 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233803.1 protein_id gnl|my_center|LOCUS_07040 107745 107101 gene locus_tag LOCUS_07050 107745 107101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 107942 108814 gene locus_tag LOCUS_07060 gene rsbRD 107942 108814 CDS product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 protein_id gnl|my_center|LOCUS_07060 108971 109138 gene locus_tag LOCUS_07070 108971 109138 CDS product YezD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244522.1 protein_id gnl|my_center|LOCUS_07070 109246 109890 gene locus_tag LOCUS_07080 109246 109890 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244397.1 protein_id gnl|my_center|LOCUS_07080 110512 110009 gene locus_tag LOCUS_07090 gene yetL 110512 110009 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_07090 110671 111780 gene locus_tag LOCUS_07100 110671 111780 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243182.1 protein_id gnl|my_center|LOCUS_07100 112885 111815 gene locus_tag LOCUS_07110 112885 111815 CDS product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 protein_id gnl|my_center|LOCUS_07110 113035 116220 gene locus_tag LOCUS_07120 gene cypD 113035 116220 CDS product bifunctional P-450/NADPH--P450 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242884.1 protein_id gnl|my_center|LOCUS_07120 116629 118572 gene locus_tag LOCUS_07130 gene ltaS1 116629 118572 CDS product lipoteichoic acid synthase LtaS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243930.1 protein_id gnl|my_center|LOCUS_07130 118809 119573 gene locus_tag LOCUS_07140 118809 119573 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244408.1 protein_id gnl|my_center|LOCUS_07140 119646 120548 gene locus_tag LOCUS_07150 119646 120548 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_07150 120566 121483 gene locus_tag LOCUS_07160 120566 121483 CDS product putative nucleotide-diphospho-sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243130.1 protein_id gnl|my_center|LOCUS_07160 121511 122674 gene locus_tag LOCUS_07170 121511 122674 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233779.1 protein_id gnl|my_center|LOCUS_07170 122689 123624 gene locus_tag LOCUS_07180 122689 123624 CDS product putative nucleotide-diphospho-sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966783.1 protein_id gnl|my_center|LOCUS_07180 124885 123656 gene locus_tag LOCUS_07190 124885 123656 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243467.1 protein_id gnl|my_center|LOCUS_07190 125704 124997 gene locus_tag LOCUS_07200 125704 124997 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_07200 127181 125796 gene locus_tag LOCUS_07210 127181 125796 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242995.1 protein_id gnl|my_center|LOCUS_07210 127430 128887 gene locus_tag LOCUS_07220 gene yfmT 127430 128887 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244104.1 protein_id gnl|my_center|LOCUS_07220 128907 129761 gene locus_tag LOCUS_07230 128907 129761 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233767.1 protein_id gnl|my_center|LOCUS_07230 129895 131784 gene locus_tag LOCUS_07240 129895 131784 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244423.1 protein_id gnl|my_center|LOCUS_07240 131908 132354 gene locus_tag LOCUS_07250 131908 132354 CDS product YfmQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243426.1 protein_id gnl|my_center|LOCUS_07250 132478 132900 gene locus_tag LOCUS_07260 132478 132900 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 protein_id gnl|my_center|LOCUS_07260 132965 134155 gene locus_tag LOCUS_07270 132965 134155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233759.1 protein_id gnl|my_center|LOCUS_07270 134483 134677 gene locus_tag LOCUS_07280 134483 134677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 136313 134757 gene locus_tag LOCUS_07290 136313 134757 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_07290 136261 136476 gene locus_tag LOCUS_07300 136261 136476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 136488 137618 gene locus_tag LOCUS_07310 136488 137618 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233750.1 protein_id gnl|my_center|LOCUS_07310 137688 138134 gene locus_tag LOCUS_07320 137688 138134 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243349.1 protein_id gnl|my_center|LOCUS_07320 139206 138187 gene locus_tag LOCUS_07330 139206 138187 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_07330 140111 139314 gene locus_tag LOCUS_07340 gene yfmF 140111 139314 CDS product Fe(3+)-citrate ABC transporter ATP-binding protein YfmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233737.1 protein_id gnl|my_center|LOCUS_07340 141125 140124 gene locus_tag LOCUS_07350 gene yfmE 141125 140124 CDS product Fe(3+)-citrate ABC transporter permease YfmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243506.1 protein_id gnl|my_center|LOCUS_07350 142123 141122 gene locus_tag LOCUS_07360 gene fecD 142123 141122 CDS product Fe(3+) dicitrate ABC transporter permease FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243835.1 protein_id gnl|my_center|LOCUS_07360 143143 142196 gene locus_tag LOCUS_07370 gene yfmC 143143 142196 CDS product Fe(3+)-citrate ABC transporter substrate-binding protein YfmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243996.1 protein_id gnl|my_center|LOCUS_07370 143621 143253 gene locus_tag LOCUS_07380 143621 143253 CDS product YfmB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233730.1 protein_id gnl|my_center|LOCUS_07380 143865 144212 gene locus_tag LOCUS_07390 143865 144212 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 protein_id gnl|my_center|LOCUS_07390 144407 145669 gene locus_tag LOCUS_07400 144407 145669 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244025.1 protein_id gnl|my_center|LOCUS_07400 145797 147230 gene locus_tag LOCUS_07410 145797 147230 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_07410 147413 148999 gene locus_tag LOCUS_07420 gene yflR 147413 148999 CDS product two-component sensor histidine kinase CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242967.1 protein_id gnl|my_center|LOCUS_07420 149013 149693 gene locus_tag LOCUS_07430 gene citT 149013 149693 CDS product two-component response regulator CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242754.1 protein_id gnl|my_center|LOCUS_07430 149696 150655 gene locus_tag LOCUS_07440 149696 150655 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242528.1 protein_id gnl|my_center|LOCUS_07440 150847 152148 gene locus_tag LOCUS_07450 gene citM 150847 152148 CDS product citrate transporter CitM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242978.1 protein_id gnl|my_center|LOCUS_07450 152204 152998 gene locus_tag LOCUS_07460 152204 152998 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966790.1 protein_id gnl|my_center|LOCUS_07460 153118 154209 gene locus_tag LOCUS_07470 gene nosA 153118 154209 CDS product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 protein_id gnl|my_center|LOCUS_07470 154475 154200 gene locus_tag LOCUS_07480 154475 154200 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 protein_id gnl|my_center|LOCUS_07480 154540 155205 gene locus_tag LOCUS_07490 154540 155205 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243175.1 protein_id gnl|my_center|LOCUS_07490 155384 155253 gene locus_tag LOCUS_07500 155384 155253 CDS product YflJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233704.1 protein_id gnl|my_center|LOCUS_07500 155712 155557 gene locus_tag LOCUS_07510 155712 155557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244572.1 protein_id gnl|my_center|LOCUS_07510 156136 155822 gene locus_tag LOCUS_07520 156136 155822 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242951.1 protein_id gnl|my_center|LOCUS_07520 156966 156217 gene locus_tag LOCUS_07530 gene map 156966 156217 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_07530 157137 158495 gene locus_tag LOCUS_07540 gene nagE 157137 158495 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243372.1 protein_id gnl|my_center|LOCUS_07540 160478 158529 gene locus_tag LOCUS_07550 gene ltaS 160478 158529 CDS product lipoteichoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233694.1 protein_id gnl|my_center|LOCUS_07550 160736 161128 gene locus_tag LOCUS_07560 160736 161128 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233692.1 protein_id gnl|my_center|LOCUS_07560 161256 162671 gene locus_tag LOCUS_07570 161256 162671 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243631.1 protein_id gnl|my_center|LOCUS_07570 163744 162668 gene locus_tag LOCUS_07580 163744 162668 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243872.1 protein_id gnl|my_center|LOCUS_07580 163968 163768 gene locus_tag LOCUS_07590 163968 163768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233686.1 protein_id gnl|my_center|LOCUS_07590 165138 163984 gene locus_tag LOCUS_07600 165138 163984 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_07600 166660 165119 gene locus_tag LOCUS_07610 166660 165119 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_07610 166856 168268 gene locus_tag LOCUS_07620 gene treP 166856 168268 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233682.1 protein_id gnl|my_center|LOCUS_07620 168340 170028 gene locus_tag LOCUS_07630 gene treC 168340 170028 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244272.1 protein_id gnl|my_center|LOCUS_07630 170049 170765 gene locus_tag LOCUS_07640 gene treR 170049 170765 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233679.1 protein_id gnl|my_center|LOCUS_07640 170904 171569 gene locus_tag LOCUS_07650 170904 171569 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 protein_id gnl|my_center|LOCUS_07650 175986 171607 gene locus_tag LOCUS_07660 175986 171607 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886443.1 protein_id gnl|my_center|LOCUS_07660 176230 176748 gene locus_tag LOCUS_07670 gene yfkM 176230 176748 CDS product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 protein_id gnl|my_center|LOCUS_07670 177985 176786 gene locus_tag LOCUS_07680 177985 176786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243812.1 protein_id gnl|my_center|LOCUS_07680 178416 178201 gene locus_tag LOCUS_07690 178416 178201 CDS product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243712.1 protein_id gnl|my_center|LOCUS_07690 178620 179090 gene locus_tag LOCUS_07700 gene yfkJ 178620 179090 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 protein_id gnl|my_center|LOCUS_07700 179108 179428 gene locus_tag LOCUS_07710 179108 179428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242981.1 protein_id gnl|my_center|LOCUS_07710 179452 180279 gene locus_tag LOCUS_07720 179452 180279 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_07720 181653 180478 gene locus_tag LOCUS_07730 181653 180478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966795.1 protein_id gnl|my_center|LOCUS_07730 181820 182875 gene locus_tag LOCUS_07740 gene cax 181820 182875 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242902.1 protein_id gnl|my_center|LOCUS_07740 182949 183740 gene locus_tag LOCUS_07750 182949 183740 CDS product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 protein_id gnl|my_center|LOCUS_07750 184615 183779 gene locus_tag LOCUS_07760 gene mscC 184615 183779 CDS product mechanosensitive ion channel protein MscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886444.1 protein_id gnl|my_center|LOCUS_07760 185743 184622 gene locus_tag LOCUS_07770 gene yfkAB 185743 184622 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 protein_id gnl|my_center|LOCUS_07770 185889 186074 gene locus_tag LOCUS_07780 185889 186074 CDS product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223132.1 protein_id gnl|my_center|LOCUS_07780 186176 186967 gene locus_tag LOCUS_07790 gene pdaA 186176 186967 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 protein_id gnl|my_center|LOCUS_07790 187865 187005 gene locus_tag LOCUS_07800 187865 187005 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243106.1 protein_id gnl|my_center|LOCUS_07800 188925 187966 gene locus_tag LOCUS_07810 gene corA 188925 187966 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 protein_id gnl|my_center|LOCUS_07810 189042 189905 gene locus_tag LOCUS_07820 189042 189905 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233646.1 protein_id gnl|my_center|LOCUS_07820 190936 189938 gene locus_tag LOCUS_07830 190936 189938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 191126 192526 gene locus_tag LOCUS_07840 gene rlmD 191126 192526 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 protein_id gnl|my_center|LOCUS_07840 192871 193875 gene locus_tag LOCUS_07850 192871 193875 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 protein_id gnl|my_center|LOCUS_07850 194148 194699 gene locus_tag LOCUS_07860 194148 194699 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 protein_id gnl|my_center|LOCUS_07860 194867 195319 gene locus_tag LOCUS_07870 194867 195319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233638.1 protein_id gnl|my_center|LOCUS_07870 195349 196038 gene locus_tag LOCUS_07880 195349 196038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243897.1 protein_id gnl|my_center|LOCUS_07880 196267 197268 gene locus_tag LOCUS_07890 gene acoA 196267 197268 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242898.1 protein_id gnl|my_center|LOCUS_07890 197270 198298 gene locus_tag LOCUS_07900 gene acoB 197270 198298 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243124.1 protein_id gnl|my_center|LOCUS_07900 198312 199508 gene locus_tag LOCUS_07910 gene acoC 198312 199508 CDS product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 protein_id gnl|my_center|LOCUS_07910 199528 200904 gene locus_tag LOCUS_07920 gene acoL 199528 200904 CDS product acetoin dehydrogenase complex dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243007.1 protein_id gnl|my_center|LOCUS_07920 201022 202839 gene locus_tag LOCUS_07930 gene acoR 201022 202839 CDS product acetoin dehydrogenase operon transcriptional activator AcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244100.1 protein_id gnl|my_center|LOCUS_07930 202892 203071 gene locus_tag LOCUS_07940 202892 203071 CDS product small acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244276.1 protein_id gnl|my_center|LOCUS_07940 203433 203107 gene locus_tag LOCUS_07950 203433 203107 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 protein_id gnl|my_center|LOCUS_07950 204043 203486 gene locus_tag LOCUS_07960 204043 203486 CDS product DUF5381 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886446.1 protein_id gnl|my_center|LOCUS_07960 204834 204067 gene locus_tag LOCUS_07970 204834 204067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243767.1 protein_id gnl|my_center|LOCUS_07970 206069 204846 gene locus_tag LOCUS_07980 206069 204846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243998.1 protein_id gnl|my_center|LOCUS_07980 206389 206075 gene locus_tag LOCUS_07990 206389 206075 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243177.1 protein_id gnl|my_center|LOCUS_07990 206725 208074 gene locus_tag LOCUS_08000 gene glvA 206725 208074 CDS product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244008.1 protein_id gnl|my_center|LOCUS_08000 208139 208903 gene locus_tag LOCUS_08010 gene glvR 208139 208903 CDS product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 protein_id gnl|my_center|LOCUS_08010 208918 210501 gene locus_tag LOCUS_08020 gene malP 208918 210501 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_08020 210607 212325 gene locus_tag LOCUS_08030 210607 212325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 protein_id gnl|my_center|LOCUS_08030 212319 214133 gene locus_tag LOCUS_08040 212319 214133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_08040 214287 214691 gene locus_tag LOCUS_08050 gene catD 214287 214691 CDS product DoxX family oxidoreductase CatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244204.1 protein_id gnl|my_center|LOCUS_08050 214709 215566 gene locus_tag LOCUS_08060 gene catE 214709 215566 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_08060 215670 216887 gene locus_tag LOCUS_08070 gene lnrJ 215670 216887 CDS product two-component system sensor histidine kinase LnrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966811.1 protein_id gnl|my_center|LOCUS_08070 216884 217546 gene locus_tag LOCUS_08080 gene lnrK 216884 217546 CDS product two-component system response regulator LnrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242530.1 protein_id gnl|my_center|LOCUS_08080 217690 218625 gene locus_tag LOCUS_08090 gene lnrL 217690 218625 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_08090 218638 219828 gene locus_tag LOCUS_08100 gene lnrM 218638 219828 CDS product linearmycin resistance permease LnrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242483.1 protein_id gnl|my_center|LOCUS_08100 219843 221000 gene locus_tag LOCUS_08110 gene lnrN 219843 221000 CDS product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 protein_id gnl|my_center|LOCUS_08110 221635 221036 gene locus_tag LOCUS_08120 221635 221036 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 protein_id gnl|my_center|LOCUS_08120 222232 221684 gene locus_tag LOCUS_08130 gene padR 222232 221684 CDS product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 protein_id gnl|my_center|LOCUS_08130 222506 223138 gene locus_tag LOCUS_08140 gene estB 222506 223138 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243184.1 protein_id gnl|my_center|LOCUS_08140 223357 224445 gene locus_tag LOCUS_08150 223357 224445 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242504.1 protein_id gnl|my_center|LOCUS_08150 224579 225115 gene locus_tag LOCUS_08160 gene bstA 224579 225115 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_08160 226668 225112 gene locus_tag LOCUS_08170 226668 225112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243108.1 protein_id gnl|my_center|LOCUS_08170 227262 226780 gene locus_tag LOCUS_08180 227262 226780 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244538.1 protein_id gnl|my_center|LOCUS_08180 227435 230005 gene locus_tag LOCUS_08190 gene mprF 227435 230005 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242495.1 protein_id gnl|my_center|LOCUS_08190 231000 230023 gene locus_tag LOCUS_08200 231000 230023 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242746.1 protein_id gnl|my_center|LOCUS_08200 231131 232132 gene locus_tag LOCUS_08210 231131 232132 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 protein_id gnl|my_center|LOCUS_08210 232129 233160 gene locus_tag LOCUS_08220 232129 233160 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243057.1 protein_id gnl|my_center|LOCUS_08220 233274 233648 gene locus_tag LOCUS_08230 233274 233648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 233620 234081 gene locus_tag LOCUS_08240 233620 234081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 234168 234752 gene locus_tag LOCUS_08250 234168 234752 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_08250 234982 234791 gene locus_tag LOCUS_08260 234982 234791 CDS product YfhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233561.1 protein_id gnl|my_center|LOCUS_08260 236125 235214 gene locus_tag LOCUS_08270 236125 235214 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244332.1 protein_id gnl|my_center|LOCUS_08270 236214 237005 gene locus_tag LOCUS_08280 gene recX 236214 237005 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 protein_id gnl|my_center|LOCUS_08280 237014 237334 gene locus_tag LOCUS_08290 237014 237334 CDS product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 protein_id gnl|my_center|LOCUS_08290 237472 238665 gene locus_tag LOCUS_08300 237472 238665 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243500.1 protein_id gnl|my_center|LOCUS_08300 238851 238699 gene locus_tag LOCUS_08310 238851 238699 CDS product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223241.1 protein_id gnl|my_center|LOCUS_08310 238976 239245 gene locus_tag LOCUS_08320 238976 239245 CDS product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243789.1 protein_id gnl|my_center|LOCUS_08320 239389 239907 gene locus_tag LOCUS_08330 239389 239907 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243363.1 protein_id gnl|my_center|LOCUS_08330 239993 240325 gene locus_tag LOCUS_08340 gene spdL 239993 240325 CDS product SdpC immunity protein SpdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242803.1 protein_id gnl|my_center|LOCUS_08340 240312 241172 gene locus_tag LOCUS_08350 gene ephM 240312 241172 CDS product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 protein_id gnl|my_center|LOCUS_08350 241397 242386 gene locus_tag LOCUS_08360 241397 242386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244113.1 protein_id gnl|my_center|LOCUS_08360 242459 245041 gene locus_tag LOCUS_08370 242459 245041 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242872.1 protein_id gnl|my_center|LOCUS_08370 246021 245038 gene locus_tag LOCUS_08380 246021 245038 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 protein_id gnl|my_center|LOCUS_08380 246238 247347 gene locus_tag LOCUS_08390 gene mutY 246238 247347 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_08390 247578 247354 gene locus_tag LOCUS_08400 247578 247354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233542.1 protein_id gnl|my_center|LOCUS_08400 247660 248412 gene locus_tag LOCUS_08410 gene fabL 247660 248412 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_08410 248481 248738 gene locus_tag LOCUS_08420 gene sspE 248481 248738 CDS product gamma type acid-soluble spore protein SspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233541.1 protein_id gnl|my_center|LOCUS_08420 248912 249172 gene locus_tag LOCUS_08430 248912 249172 CDS product YgaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968853.1 protein_id gnl|my_center|LOCUS_08430 249316 249846 gene locus_tag LOCUS_08440 249316 249846 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_08440 249933 251675 gene locus_tag LOCUS_08450 249933 251675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966836.1 protein_id gnl|my_center|LOCUS_08450 252860 251751 gene locus_tag LOCUS_08460 252860 251751 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233537.1 protein_id gnl|my_center|LOCUS_08460 254320 253031 gene locus_tag LOCUS_08470 254320 253031 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 protein_id gnl|my_center|LOCUS_08470 254473 254946 gene locus_tag LOCUS_08480 gene bcp 254473 254946 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 protein_id gnl|my_center|LOCUS_08480 255079 255516 gene locus_tag LOCUS_08490 gene perR 255079 255516 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_08490 255904 255551 gene locus_tag LOCUS_08500 255904 255551 CDS product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243536.1 protein_id gnl|my_center|LOCUS_08500 256113 256997 gene locus_tag LOCUS_08510 256113 256997 CDS product nucleotidyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243727.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence061 497 180 gene locus_tag LOCUS_08520 497 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1702 509 gene locus_tag LOCUS_08530 1702 509 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905933.1 protein_id gnl|my_center|LOCUS_08530 2365 1739 gene locus_tag LOCUS_08540 2365 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3602 2355 gene locus_tag LOCUS_08550 3602 2355 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_08550 3826 3608 gene locus_tag LOCUS_08560 3826 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5548 3839 gene locus_tag LOCUS_08570 5548 3839 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127897.1 protein_id gnl|my_center|LOCUS_08570 6081 5548 gene locus_tag LOCUS_08580 6081 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6494 6153 gene locus_tag LOCUS_08590 6494 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7699 6944 gene locus_tag LOCUS_08600 7699 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8100 7762 gene locus_tag LOCUS_08610 8100 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8989 8294 gene locus_tag LOCUS_08620 8989 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9821 9279 gene locus_tag LOCUS_08630 9821 9279 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 protein_id gnl|my_center|LOCUS_08630 10270 9821 gene locus_tag LOCUS_08640 10270 9821 CDS product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 protein_id gnl|my_center|LOCUS_08640 11205 10510 gene locus_tag LOCUS_08650 11205 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 11726 11220 gene locus_tag LOCUS_08660 11726 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12675 11779 gene locus_tag LOCUS_08670 12675 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12936 12688 gene locus_tag LOCUS_08680 12936 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 13160 12933 gene locus_tag LOCUS_08690 13160 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13474 13157 gene locus_tag LOCUS_08700 13474 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 13714 13517 gene locus_tag LOCUS_08710 gene xtrA 13714 13517 CDS product phage-like element PBSX protein XtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244900.1 protein_id gnl|my_center|LOCUS_08710 13947 13792 gene locus_tag LOCUS_08720 13947 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 14100 13960 gene locus_tag LOCUS_08730 14100 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 14239 14069 gene locus_tag LOCUS_08740 14239 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 14756 14208 gene locus_tag LOCUS_08750 14756 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 14911 14753 gene locus_tag LOCUS_08760 14911 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 15057 14908 gene locus_tag LOCUS_08770 15057 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 15959 15072 gene locus_tag LOCUS_08780 15959 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 16758 15886 gene locus_tag LOCUS_08790 16758 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 16969 16751 gene locus_tag LOCUS_08800 16969 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 17313 16984 gene locus_tag LOCUS_08810 17313 16984 CDS product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286573.1 protein_id gnl|my_center|LOCUS_08810 17651 17448 gene locus_tag LOCUS_08820 17651 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 17817 18215 gene locus_tag LOCUS_08830 17817 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 18633 18505 gene locus_tag LOCUS_08840 18633 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19752 18652 gene locus_tag LOCUS_08850 19752 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 20007 21116 gene locus_tag LOCUS_08860 20007 21116 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 protein_id gnl|my_center|LOCUS_08860 21347 21275 gene locus_tag LOCUS_t00380 21347 21275 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21945 21400 gene locus_tag LOCUS_08870 21945 21400 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231473.1 protein_id gnl|my_center|LOCUS_08870 22491 22261 gene locus_tag LOCUS_08880 22491 22261 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231472.1 protein_id gnl|my_center|LOCUS_08880 22676 24439 gene locus_tag LOCUS_08890 gene ggt 22676 24439 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 protein_id gnl|my_center|LOCUS_08890 24781 24602 gene locus_tag LOCUS_08900 24781 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 24814 25023 gene locus_tag LOCUS_08910 24814 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 25020 25529 gene locus_tag LOCUS_08920 25020 25529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 27063 25582 gene locus_tag LOCUS_08930 gene gltD 27063 25582 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_08930 31642 27080 gene locus_tag LOCUS_08940 gene gltB 31642 27080 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967365.1 protein_id gnl|my_center|LOCUS_08940 31788 32690 gene locus_tag LOCUS_08950 gene gltC 31788 32690 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_08950 33859 32744 gene locus_tag LOCUS_08960 gene proB 33859 32744 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231456.1 protein_id gnl|my_center|LOCUS_08960 34671 33856 gene locus_tag LOCUS_08970 gene proC 34671 33856 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 protein_id gnl|my_center|LOCUS_08970 35263 34895 gene locus_tag LOCUS_08980 gene rtp 35263 34895 CDS product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 protein_id gnl|my_center|LOCUS_08980 35568 36785 gene locus_tag LOCUS_08990 gene yjiB 35568 36785 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_08990 37533 36817 gene locus_tag LOCUS_09000 37533 36817 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_09000 37692 37997 gene locus_tag LOCUS_09010 37692 37997 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967371.1 protein_id gnl|my_center|LOCUS_09010 38067 38825 gene locus_tag LOCUS_09020 38067 38825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 protein_id gnl|my_center|LOCUS_09020 38882 39415 gene locus_tag LOCUS_09030 38882 39415 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_09030 40595 39603 gene locus_tag LOCUS_09040 40595 39603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966673.1 protein_id gnl|my_center|LOCUS_09040 41335 40589 gene locus_tag LOCUS_09050 41335 40589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966674.1 protein_id gnl|my_center|LOCUS_09050 42061 41345 gene locus_tag LOCUS_09060 42061 41345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966675.1 protein_id gnl|my_center|LOCUS_09060 43953 42709 gene locus_tag LOCUS_09070 43953 42709 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231439.1 protein_id gnl|my_center|LOCUS_09070 45511 44048 gene locus_tag LOCUS_09080 45511 44048 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399436.1 protein_id gnl|my_center|LOCUS_09080 46530 45529 gene locus_tag LOCUS_09090 46530 45529 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967372.1 protein_id gnl|my_center|LOCUS_09090 46889 48931 gene locus_tag LOCUS_09100 46889 48931 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 protein_id gnl|my_center|LOCUS_09100 49040 49333 gene locus_tag LOCUS_09110 49040 49333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231432.1 protein_id gnl|my_center|LOCUS_09110 49640 49425 gene locus_tag LOCUS_09120 49640 49425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 50415 50537 gene locus_tag LOCUS_09130 50415 50537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 50594 50887 gene locus_tag LOCUS_09140 50594 50887 CDS product YozQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231427.1 protein_id gnl|my_center|LOCUS_09140 52632 51028 gene locus_tag LOCUS_09150 52632 51028 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231425.1 protein_id gnl|my_center|LOCUS_09150 53029 54480 gene locus_tag LOCUS_09160 gene hpaB 53029 54480 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231423.1 protein_id gnl|my_center|LOCUS_09160 55243 54545 gene locus_tag LOCUS_09170 gene exlX 55243 54545 CDS product expansin ExlX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231419.1 protein_id gnl|my_center|LOCUS_09170 56183 55506 gene locus_tag LOCUS_09180 56183 55506 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399503.1 protein_id gnl|my_center|LOCUS_09180 56355 57392 gene locus_tag LOCUS_09190 56355 57392 CDS product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967389.1 protein_id gnl|my_center|LOCUS_09190 58340 57711 gene locus_tag LOCUS_09200 58340 57711 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09200 58840 58526 gene locus_tag LOCUS_09210 58840 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 59816 59100 gene locus_tag LOCUS_09220 59816 59100 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975777.1 protein_id gnl|my_center|LOCUS_09220 60073 60759 gene locus_tag LOCUS_09230 60073 60759 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399422.1 protein_id gnl|my_center|LOCUS_09230 61139 60948 gene locus_tag LOCUS_09240 61139 60948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 61438 61136 gene locus_tag LOCUS_09250 61438 61136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399414.1 protein_id gnl|my_center|LOCUS_09250 62159 61674 gene locus_tag LOCUS_09260 62159 61674 CDS product YdhH/YoaO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399262.1 protein_id gnl|my_center|LOCUS_09260 62372 62494 gene locus_tag LOCUS_09270 gene phrK 62372 62494 CDS product phosphatase RapK inhibitor PhrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399440.1 protein_id gnl|my_center|LOCUS_09270 62729 63091 gene locus_tag LOCUS_09280 62729 63091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967392.1 protein_id gnl|my_center|LOCUS_09280 63374 63180 gene locus_tag LOCUS_09290 63374 63180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399432.1 protein_id gnl|my_center|LOCUS_09290 64013 63519 gene locus_tag LOCUS_09300 64013 63519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231402.1 protein_id gnl|my_center|LOCUS_09300 64973 64062 gene locus_tag LOCUS_09310 64973 64062 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231400.1 protein_id gnl|my_center|LOCUS_09310 65345 65827 gene locus_tag LOCUS_09320 65345 65827 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 protein_id gnl|my_center|LOCUS_09320 65838 66062 gene locus_tag LOCUS_09330 65838 66062 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_09330 66186 66983 gene locus_tag LOCUS_09340 66186 66983 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_09340 67956 67069 gene locus_tag LOCUS_09350 67956 67069 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399248.1 protein_id gnl|my_center|LOCUS_09350 68057 68935 gene locus_tag LOCUS_09360 68057 68935 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 protein_id gnl|my_center|LOCUS_09360 69454 69290 gene locus_tag LOCUS_09370 69454 69290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245467.1 protein_id gnl|my_center|LOCUS_09370 70003 69539 gene locus_tag LOCUS_09380 70003 69539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 70234 70088 gene locus_tag LOCUS_09390 70234 70088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 72463 71831 gene locus_tag LOCUS_09400 72463 71831 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_09400 72811 73725 gene locus_tag LOCUS_09410 gene bla 72811 73725 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231385.1 protein_id gnl|my_center|LOCUS_09410 73976 73770 gene locus_tag LOCUS_09420 73976 73770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09420 75098 74478 gene locus_tag LOCUS_09430 75098 74478 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906226.1 protein_id gnl|my_center|LOCUS_09430 75633 76136 gene locus_tag LOCUS_09440 75633 76136 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_09440 77038 76526 gene locus_tag LOCUS_09450 77038 76526 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 protein_id gnl|my_center|LOCUS_09450 77327 77527 gene locus_tag LOCUS_09460 77327 77527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 77977 77777 gene locus_tag LOCUS_09470 77977 77777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 78302 78138 gene locus_tag LOCUS_09480 78302 78138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 78686 80059 gene locus_tag LOCUS_09490 78686 80059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 80056 81162 gene locus_tag LOCUS_09500 80056 81162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 protein_id gnl|my_center|LOCUS_09500 81149 81856 gene locus_tag LOCUS_09510 81149 81856 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_09510 82003 82521 gene locus_tag LOCUS_09520 82003 82521 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651510.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence062 1419 127 gene locus_tag LOCUS_09530 1419 127 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968059.1 protein_id gnl|my_center|LOCUS_09530 2140 1463 gene locus_tag LOCUS_09540 2140 1463 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_09540 2448 2185 gene locus_tag LOCUS_09550 2448 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243434.1 protein_id gnl|my_center|LOCUS_09550 2496 2828 gene locus_tag LOCUS_09560 gene mstX 2496 2828 CDS product biofilm formation protein MstX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228886.1 protein_id gnl|my_center|LOCUS_09560 2825 3811 gene locus_tag LOCUS_09570 gene kbfO 2825 3811 CDS product potassium channel protein KbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242502.1 protein_id gnl|my_center|LOCUS_09570 4212 3808 gene locus_tag LOCUS_09580 4212 3808 CDS product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228878.1 protein_id gnl|my_center|LOCUS_09580 4638 4273 gene locus_tag LOCUS_09590 4638 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886601.1 protein_id gnl|my_center|LOCUS_09590 6055 4703 gene locus_tag LOCUS_09600 6055 4703 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_09600 7339 6167 gene locus_tag LOCUS_09610 7339 6167 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228872.1 protein_id gnl|my_center|LOCUS_09610 8605 7442 gene locus_tag LOCUS_09620 8605 7442 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_09620 8836 9072 gene locus_tag LOCUS_09630 8836 9072 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_09630 9509 9117 gene locus_tag LOCUS_09640 gene yugI 9509 9117 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228864.1 protein_id gnl|my_center|LOCUS_09640 10871 9711 gene locus_tag LOCUS_09650 10871 9711 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_09650 11372 10872 gene locus_tag LOCUS_09660 11372 10872 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_09660 11522 12343 gene locus_tag LOCUS_09670 11522 12343 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_09670 12630 12370 gene locus_tag LOCUS_09680 12630 12370 CDS product YugE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242594.1 protein_id gnl|my_center|LOCUS_09680 12717 13880 gene locus_tag LOCUS_09690 gene patB 12717 13880 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_09690 14006 15292 gene locus_tag LOCUS_09700 gene kinB 14006 15292 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 protein_id gnl|my_center|LOCUS_09700 15338 15724 gene locus_tag LOCUS_09710 gene kapB 15338 15724 CDS product kinase-associated lipoprotein KapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228851.1 protein_id gnl|my_center|LOCUS_09710 16368 15751 gene locus_tag LOCUS_09720 gene kapD 16368 15751 CDS product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228846.1 protein_id gnl|my_center|LOCUS_09720 16647 16444 gene locus_tag LOCUS_09730 16647 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 16700 17758 gene locus_tag LOCUS_09740 16700 17758 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228842.1 protein_id gnl|my_center|LOCUS_09740 17851 19725 gene locus_tag LOCUS_09750 17851 19725 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886602.1 protein_id gnl|my_center|LOCUS_09750 19746 20159 gene locus_tag LOCUS_09760 19746 20159 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_09760 20734 20177 gene locus_tag LOCUS_09770 20734 20177 CDS product YufK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228837.1 protein_id gnl|my_center|LOCUS_09770 20912 22513 gene locus_tag LOCUS_09780 gene maeL 20912 22513 CDS product two-component system sensor histidine kinase MaeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228835.1 protein_id gnl|my_center|LOCUS_09780 22506 23213 gene locus_tag LOCUS_09790 gene maeM 22506 23213 CDS product two-component system response regulator MaeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968074.1 protein_id gnl|my_center|LOCUS_09790 23643 24989 gene locus_tag LOCUS_09800 gene maeN 23643 24989 CDS product sodium/malate symporter MaeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244241.1 protein_id gnl|my_center|LOCUS_09800 25241 25026 gene locus_tag LOCUS_09810 25241 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228823.1 protein_id gnl|my_center|LOCUS_09810 25471 27876 gene locus_tag LOCUS_09820 25471 27876 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228821.1 protein_id gnl|my_center|LOCUS_09820 27869 28300 gene locus_tag LOCUS_09830 27869 28300 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 protein_id gnl|my_center|LOCUS_09830 28300 28641 gene locus_tag LOCUS_09840 28300 28641 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220730.1 protein_id gnl|my_center|LOCUS_09840 28634 30115 gene locus_tag LOCUS_09850 28634 30115 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244432.1 protein_id gnl|my_center|LOCUS_09850 30121 30597 gene locus_tag LOCUS_09860 30121 30597 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244015.1 protein_id gnl|my_center|LOCUS_09860 30597 30881 gene locus_tag LOCUS_09870 30597 30881 CDS product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228814.1 protein_id gnl|my_center|LOCUS_09870 30865 31239 gene locus_tag LOCUS_09880 gene mnhG 30865 31239 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244302.1 protein_id gnl|my_center|LOCUS_09880 31658 31278 gene locus_tag LOCUS_09890 31658 31278 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228810.1 protein_id gnl|my_center|LOCUS_09890 32318 31674 gene locus_tag LOCUS_09900 gene comA 32318 31674 CDS product two-component system response regulator ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220716.1 protein_id gnl|my_center|LOCUS_09900 34723 32399 gene locus_tag LOCUS_09910 gene comP 34723 32399 CDS product two-component system sensor histidine kinase ComP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242894.1 protein_id gnl|my_center|LOCUS_09910 34895 34731 gene locus_tag LOCUS_09920 34895 34731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 35768 34908 gene locus_tag LOCUS_09930 gene comQ 35768 34908 CDS product ComX modifying isoprenyl transferase ComQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243039.1 protein_id gnl|my_center|LOCUS_09930 36094 35954 gene locus_tag LOCUS_09940 gene degQ 36094 35954 CDS product degradation enzyme regulation protein DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220708.1 protein_id gnl|my_center|LOCUS_09940 36557 36925 gene locus_tag LOCUS_09950 36557 36925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243784.1 protein_id gnl|my_center|LOCUS_09950 38130 36901 gene locus_tag LOCUS_09960 gene pdeH 38130 36901 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 protein_id gnl|my_center|LOCUS_09960 39737 38265 gene locus_tag LOCUS_09970 39737 38265 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228788.1 protein_id gnl|my_center|LOCUS_09970 40304 39753 gene locus_tag LOCUS_09980 40304 39753 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 protein_id gnl|my_center|LOCUS_09980 40799 40401 gene locus_tag LOCUS_09990 40799 40401 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242987.1 protein_id gnl|my_center|LOCUS_09990 41119 40871 gene locus_tag LOCUS_10000 41119 40871 CDS product YueH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228783.1 protein_id gnl|my_center|LOCUS_10000 41413 41192 gene locus_tag LOCUS_10010 41413 41192 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242933.1 protein_id gnl|my_center|LOCUS_10010 42582 41473 gene locus_tag LOCUS_10020 42582 41473 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_10020 42697 43086 gene locus_tag LOCUS_10030 42697 43086 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243066.1 protein_id gnl|my_center|LOCUS_10030 43363 43127 gene locus_tag LOCUS_10040 43363 43127 CDS product YuzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220677.1 protein_id gnl|my_center|LOCUS_10040 44079 43549 gene locus_tag LOCUS_10050 44079 43549 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244444.1 protein_id gnl|my_center|LOCUS_10050 45007 44276 gene locus_tag LOCUS_10060 45007 44276 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244421.1 protein_id gnl|my_center|LOCUS_10060 45529 45074 gene locus_tag LOCUS_10070 gene essA 45529 45074 CDS product type VII secretion protein EssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886603.1 protein_id gnl|my_center|LOCUS_10070 48794 45561 gene locus_tag LOCUS_10080 gene esaA 48794 45561 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244105.1 protein_id gnl|my_center|LOCUS_10080 53278 48791 gene locus_tag LOCUS_10090 gene essC 53278 48791 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243866.1 protein_id gnl|my_center|LOCUS_10090 54670 53339 gene locus_tag LOCUS_10100 gene essB 54670 53339 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243575.1 protein_id gnl|my_center|LOCUS_10100 54924 54685 gene locus_tag LOCUS_10110 gene yukD 54924 54685 CDS product ESX secretion system protein YukD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228763.1 protein_id gnl|my_center|LOCUS_10110 55288 54995 gene locus_tag LOCUS_10120 55288 54995 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220661.1 protein_id gnl|my_center|LOCUS_10120 55863 57086 gene locus_tag LOCUS_10130 gene adeR 55863 57086 CDS product sporulation transcriptional activator AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886604.1 protein_id gnl|my_center|LOCUS_10130 57188 58324 gene locus_tag LOCUS_10140 gene ald 57188 58324 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_10140 58437 59114 gene locus_tag LOCUS_10150 58437 59114 CDS product YukJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242737.1 protein_id gnl|my_center|LOCUS_10150 59366 59157 gene locus_tag LOCUS_10160 59366 59157 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243183.1 protein_id gnl|my_center|LOCUS_10160 66520 59381 gene locus_tag LOCUS_10170 gene dhbF 66520 59381 CDS product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 protein_id gnl|my_center|LOCUS_10170 67475 66540 gene locus_tag LOCUS_10180 67475 66540 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228749.1 protein_id gnl|my_center|LOCUS_10180 69127 67508 gene locus_tag LOCUS_10190 69127 67508 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_10190 70355 69156 gene locus_tag LOCUS_10200 gene dhbC 70355 69156 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_10200 71166 70381 gene locus_tag LOCUS_10210 71166 70381 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_10210 72246 71368 gene locus_tag LOCUS_10220 gene besA 72246 71368 CDS product ferri-bacillibactin esterase BesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228740.1 protein_id gnl|my_center|LOCUS_10220 73044 72448 gene locus_tag LOCUS_10230 73044 72448 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228739.1 protein_id gnl|my_center|LOCUS_10230 73147 73749 gene locus_tag LOCUS_10240 73147 73749 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228737.1 protein_id gnl|my_center|LOCUS_10240 75145 73817 gene locus_tag LOCUS_10250 75145 73817 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228736.1 protein_id gnl|my_center|LOCUS_10250 76792 75290 gene locus_tag LOCUS_10260 76792 75290 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 protein_id gnl|my_center|LOCUS_10260 76950 77426 gene locus_tag LOCUS_10270 76950 77426 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 protein_id gnl|my_center|LOCUS_10270 78111 77455 gene locus_tag LOCUS_10280 gene spsC 78111 77455 CDS product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 protein_id gnl|my_center|LOCUS_10280 78535 78215 gene locus_tag LOCUS_10290 78535 78215 CDS product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 protein_id gnl|my_center|LOCUS_10290 80124 78904 gene locus_tag LOCUS_10300 80124 78904 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 protein_id gnl|my_center|LOCUS_10300 80456 81454 gene locus_tag LOCUS_10310 gene yumC 80456 81454 CDS product ferredoxin--NADP reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220618.1 protein_id gnl|my_center|LOCUS_10310 81634 81494 gene locus_tag LOCUS_10320 81634 81494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228723.1 protein_id gnl|my_center|LOCUS_10320 81912 82892 gene locus_tag LOCUS_10330 gene guaC 81912 82892 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 protein_id gnl|my_center|LOCUS_10330 83187 82966 gene locus_tag LOCUS_10340 83187 82966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 83731 83204 gene locus_tag LOCUS_10350 83731 83204 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870301.1 protein_id gnl|my_center|LOCUS_10350 84432 83728 gene locus_tag LOCUS_10360 84432 83728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_10360 84705 84851 gene locus_tag LOCUS_10370 84705 84851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 86498 86163 gene locus_tag LOCUS_10380 86498 86163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 87135 86563 gene locus_tag LOCUS_10390 87135 86563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 88355 88209 gene locus_tag LOCUS_10400 88355 88209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10400 89087 88569 gene locus_tag LOCUS_10410 gene paiA 89087 88569 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 protein_id gnl|my_center|LOCUS_10410 89337 89164 gene locus_tag LOCUS_10420 89337 89164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 90001 89639 gene locus_tag LOCUS_10430 90001 89639 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_10430 90934 90080 gene locus_tag LOCUS_10440 gene dapF 90934 90080 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243745.1 protein_id gnl|my_center|LOCUS_10440 92271 91057 gene locus_tag LOCUS_10450 92271 91057 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243750.1 protein_id gnl|my_center|LOCUS_10450 92646 92410 gene locus_tag LOCUS_10460 92646 92410 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222913.1 protein_id gnl|my_center|LOCUS_10460 92909 93976 gene locus_tag LOCUS_10470 92909 93976 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 protein_id gnl|my_center|LOCUS_10470 94489 94163 gene locus_tag LOCUS_10480 94489 94163 CDS product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 protein_id gnl|my_center|LOCUS_10480 94686 94922 gene locus_tag LOCUS_10490 94686 94922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 96937 94964 gene locus_tag LOCUS_10500 96937 94964 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_10500 97975 97046 gene locus_tag LOCUS_10510 gene thrB 97975 97046 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228699.1 protein_id gnl|my_center|LOCUS_10510 99039 97972 gene locus_tag LOCUS_10520 gene thrC 99039 97972 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 protein_id gnl|my_center|LOCUS_10520 100331 99030 gene locus_tag LOCUS_10530 100331 99030 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 protein_id gnl|my_center|LOCUS_10530 101524 100499 gene locus_tag LOCUS_10540 gene cotNH 101524 100499 CDS product spore coat-associated protein CotNH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242649.1 protein_id gnl|my_center|LOCUS_10540 101680 102180 gene locus_tag LOCUS_10550 101680 102180 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243814.1 protein_id gnl|my_center|LOCUS_10550 102976 102206 gene locus_tag LOCUS_10560 gene nucF 102976 102206 CDS product 5' nucleotidase NucF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243196.1 protein_id gnl|my_center|LOCUS_10560 103439 103005 gene locus_tag LOCUS_10570 103439 103005 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228684.1 protein_id gnl|my_center|LOCUS_10570 103738 103463 gene locus_tag LOCUS_10580 103738 103463 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228682.1 protein_id gnl|my_center|LOCUS_10580 103852 104487 gene locus_tag LOCUS_10590 103852 104487 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243821.1 protein_id gnl|my_center|LOCUS_10590 105399 104503 gene locus_tag LOCUS_10600 gene lipA 105399 104503 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_10600 105634 106614 gene locus_tag LOCUS_10610 gene lytH 105634 106614 CDS product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 protein_id gnl|my_center|LOCUS_10610 107409 106642 gene locus_tag LOCUS_10620 gene yunB 107409 106642 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 protein_id gnl|my_center|LOCUS_10620 107786 107481 gene locus_tag LOCUS_10630 107786 107481 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 protein_id gnl|my_center|LOCUS_10630 109240 107852 gene locus_tag LOCUS_10640 109240 107852 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 protein_id gnl|my_center|LOCUS_10640 110081 109260 gene locus_tag LOCUS_10650 110081 109260 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 protein_id gnl|my_center|LOCUS_10650 110953 110099 gene locus_tag LOCUS_10660 110953 110099 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 protein_id gnl|my_center|LOCUS_10660 111332 110985 gene locus_tag LOCUS_10670 111332 110985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242865.1 protein_id gnl|my_center|LOCUS_10670 112772 111429 gene locus_tag LOCUS_10680 112772 111429 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243112.1 protein_id gnl|my_center|LOCUS_10680 112947 114542 gene locus_tag LOCUS_10690 gene pucR 112947 114542 CDS product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 protein_id gnl|my_center|LOCUS_10690 114686 116038 gene locus_tag LOCUS_10700 gene pucJ 114686 116038 CDS product uric acid permease PucJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243942.1 protein_id gnl|my_center|LOCUS_10700 116044 117336 gene locus_tag LOCUS_10710 gene pucK 116044 117336 CDS product uric acid permease PucK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244570.1 protein_id gnl|my_center|LOCUS_10710 117349 118833 gene locus_tag LOCUS_10720 gene pucL 117349 118833 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242600.1 protein_id gnl|my_center|LOCUS_10720 118833 119177 gene locus_tag LOCUS_10730 gene uraH 118833 119177 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244132.1 protein_id gnl|my_center|LOCUS_10730 119416 119970 gene locus_tag LOCUS_10740 119416 119970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 121248 120712 gene locus_tag LOCUS_10750 gene pucE 121248 120712 CDS product xanthine dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243276.1 protein_id gnl|my_center|LOCUS_10750 123476 121239 gene locus_tag LOCUS_10760 gene pucD 123476 121239 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 protein_id gnl|my_center|LOCUS_10760 124310 123477 gene locus_tag LOCUS_10770 gene pucC 124310 123477 CDS product xanthine dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228646.1 protein_id gnl|my_center|LOCUS_10770 124924 124307 gene locus_tag LOCUS_10780 gene pucB 124924 124307 CDS product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228645.1 protein_id gnl|my_center|LOCUS_10780 125913 124921 gene locus_tag LOCUS_10790 125913 124921 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243519.1 protein_id gnl|my_center|LOCUS_10790 126016 126213 gene locus_tag LOCUS_10800 126016 126213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 127393 126143 gene locus_tag LOCUS_10810 gene pucG 127393 126143 CDS product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 protein_id gnl|my_center|LOCUS_10810 128648 127410 gene locus_tag LOCUS_10820 gene allC 128648 127410 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228640.1 protein_id gnl|my_center|LOCUS_10820 128846 129328 gene locus_tag LOCUS_10830 128846 129328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10830 129377 129907 gene locus_tag LOCUS_10840 129377 129907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10840 129989 130855 gene locus_tag LOCUS_10850 129989 130855 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968119.1 protein_id gnl|my_center|LOCUS_10850 131991 130888 gene locus_tag LOCUS_10860 gene ugpC 131991 130888 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228630.1 protein_id gnl|my_center|LOCUS_10860 132172 132900 gene locus_tag LOCUS_10870 gene frlR 132172 132900 CDS product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 protein_id gnl|my_center|LOCUS_10870 133779 132925 gene locus_tag LOCUS_10880 gene frlD 133779 132925 CDS product fructosamine kinase FrlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228626.1 protein_id gnl|my_center|LOCUS_10880 134695 133793 gene locus_tag LOCUS_10890 134695 133793 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_10890 135577 134699 gene locus_tag LOCUS_10900 135577 134699 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_10900 136903 135635 gene locus_tag LOCUS_10910 136903 135635 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_10910 137970 136984 gene locus_tag LOCUS_10920 gene frlB 137970 136984 CDS product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 protein_id gnl|my_center|LOCUS_10920 138418 138185 gene locus_tag LOCUS_10930 138418 138185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 139779 138655 gene locus_tag LOCUS_10940 139779 138655 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228615.1 protein_id gnl|my_center|LOCUS_10940 139938 140087 gene locus_tag LOCUS_10950 gene sspG 139938 140087 CDS product acid-soluble spore protein SspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228613.1 protein_id gnl|my_center|LOCUS_10950 140087 140359 gene locus_tag LOCUS_10960 140087 140359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243521.1 protein_id gnl|my_center|LOCUS_10960 140896 140513 gene locus_tag LOCUS_10970 gene glxB 140896 140513 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_10970 141283 141005 gene locus_tag LOCUS_10980 141283 141005 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968126.1 protein_id gnl|my_center|LOCUS_10980 143104 141707 gene locus_tag LOCUS_10990 gene sufB 143104 141707 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_10990 143568 143125 gene locus_tag LOCUS_11000 gene sufU 143568 143125 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222809.1 protein_id gnl|my_center|LOCUS_11000 144778 143558 gene locus_tag LOCUS_11010 gene sufS 144778 143558 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_11010 146091 144778 gene locus_tag LOCUS_11020 gene sufD 146091 144778 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 protein_id gnl|my_center|LOCUS_11020 146894 146109 gene locus_tag LOCUS_11030 gene sufC 146894 146109 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_11030 147224 147087 gene locus_tag LOCUS_11040 147224 147087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228600.1 protein_id gnl|my_center|LOCUS_11040 147779 147417 gene locus_tag LOCUS_11050 147779 147417 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228596.1 protein_id gnl|my_center|LOCUS_11050 148704 147880 gene locus_tag LOCUS_11060 gene metQ 148704 147880 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228595.1 protein_id gnl|my_center|LOCUS_11060 149386 148718 gene locus_tag LOCUS_11070 gene metP 149386 148718 CDS product methionine ABC transporter permease MetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228593.1 protein_id gnl|my_center|LOCUS_11070 150404 149379 gene locus_tag LOCUS_11080 gene metN 150404 149379 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_11080 151075 150731 gene locus_tag LOCUS_11090 151075 150731 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228587.1 protein_id gnl|my_center|LOCUS_11090 151503 151183 gene locus_tag LOCUS_11100 151503 151183 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228585.1 protein_id gnl|my_center|LOCUS_11100 151873 151505 gene locus_tag LOCUS_11110 151873 151505 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968134.1 protein_id gnl|my_center|LOCUS_11110 152181 151945 gene locus_tag LOCUS_11120 152181 151945 CDS product YusG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228581.1 protein_id gnl|my_center|LOCUS_11120 152620 152237 gene locus_tag LOCUS_11130 gene gcvH 152620 152237 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_11130 153043 152687 gene locus_tag LOCUS_11140 153043 152687 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_11140 154936 153152 gene locus_tag LOCUS_11150 gene fadE 154936 153152 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 protein_id gnl|my_center|LOCUS_11150 156126 154951 gene locus_tag LOCUS_11160 156126 154951 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 protein_id gnl|my_center|LOCUS_11160 158506 156137 gene locus_tag LOCUS_11170 158506 156137 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_11170 158681 158827 gene locus_tag LOCUS_11180 158681 158827 CDS product YuzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228571.1 protein_id gnl|my_center|LOCUS_11180 159760 158852 gene locus_tag LOCUS_11190 159760 158852 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228569.1 protein_id gnl|my_center|LOCUS_11190 159855 160100 gene locus_tag LOCUS_11200 159855 160100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 protein_id gnl|my_center|LOCUS_11200 160113 160445 gene locus_tag LOCUS_11210 160113 160445 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 protein_id gnl|my_center|LOCUS_11210 160604 161074 gene locus_tag LOCUS_11220 gene mdtR 160604 161074 CDS product MarR family transcriptional regulator MdtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242592.1 protein_id gnl|my_center|LOCUS_11220 161076 162692 gene locus_tag LOCUS_11230 gene mdtP 161076 162692 CDS product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 protein_id gnl|my_center|LOCUS_11230 163112 162729 gene locus_tag LOCUS_11240 163112 162729 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 protein_id gnl|my_center|LOCUS_11240 163871 163131 gene locus_tag LOCUS_11250 163871 163131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 164007 164894 gene locus_tag LOCUS_11260 164007 164894 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228551.1 protein_id gnl|my_center|LOCUS_11260 165202 164915 gene locus_tag LOCUS_11270 165202 164915 CDS product YusU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228549.1 protein_id gnl|my_center|LOCUS_11270 166050 165229 gene locus_tag LOCUS_11280 166050 165229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_11280 166711 166274 gene locus_tag LOCUS_11290 166711 166274 CDS product YusW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228545.1 protein_id gnl|my_center|LOCUS_11290 168668 166860 gene locus_tag LOCUS_11300 168668 166860 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_11300 168802 169656 gene locus_tag LOCUS_11310 168802 169656 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 protein_id gnl|my_center|LOCUS_11310 169733 170194 gene locus_tag LOCUS_11320 gene mrgA 169733 170194 CDS product metalloregulation DNA-binding stress protein MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228537.1 protein_id gnl|my_center|LOCUS_11320 171612 170236 gene locus_tag LOCUS_11330 gene htrB 171612 170236 CDS product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 protein_id gnl|my_center|LOCUS_11330 171890 172567 gene locus_tag LOCUS_11340 gene cssR 171890 172567 CDS product secretion stress-responsive two-component system response regulator CssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228529.1 protein_id gnl|my_center|LOCUS_11340 172564 173919 gene locus_tag LOCUS_11350 gene cssS 172564 173919 CDS product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 protein_id gnl|my_center|LOCUS_11350 174112 173948 gene locus_tag LOCUS_11360 gene spxO 174112 173948 CDS product anti-adapter protein SpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221681.1 protein_id gnl|my_center|LOCUS_11360 174281 175156 gene locus_tag LOCUS_11370 174281 175156 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243192.1 protein_id gnl|my_center|LOCUS_11370 176584 175196 gene locus_tag LOCUS_11380 gene fumC 176584 175196 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_11380 176836 176651 gene locus_tag LOCUS_11390 176836 176651 CDS product YvzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244599.1 protein_id gnl|my_center|LOCUS_11390 176953 178401 gene locus_tag LOCUS_11400 gene gerAA 176953 178401 CDS product spore germination receptor protein GerAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886610.1 protein_id gnl|my_center|LOCUS_11400 178370 179467 gene locus_tag LOCUS_11410 gene gerAB 178370 179467 CDS product spore germination receptor protein GerAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968145.1 protein_id gnl|my_center|LOCUS_11410 179464 180585 gene locus_tag LOCUS_11420 gene gerAC 179464 180585 CDS product spore germination receptor protein GerAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968146.1 protein_id gnl|my_center|LOCUS_11420 181228 180593 gene locus_tag LOCUS_11430 gene liaR 181228 180593 CDS product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 protein_id gnl|my_center|LOCUS_11430 182288 181206 gene locus_tag LOCUS_11440 gene liaS 182288 181206 CDS product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 protein_id gnl|my_center|LOCUS_11440 183010 182285 gene locus_tag LOCUS_11450 gene liaF 183010 182285 CDS product LiaRS two-component regulatory system accessory protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242605.1 protein_id gnl|my_center|LOCUS_11450 183916 183044 gene locus_tag LOCUS_11460 183916 183044 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244420.1 protein_id gnl|my_center|LOCUS_11460 184697 184017 gene locus_tag LOCUS_11470 184697 184017 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 protein_id gnl|my_center|LOCUS_11470 185104 184724 gene locus_tag LOCUS_11480 gene liaI 185104 184724 CDS product cell envelope stress-induced membrane anchor protein LiaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243447.1 protein_id gnl|my_center|LOCUS_11480 186534 185266 gene locus_tag LOCUS_11490 186534 185266 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244338.1 protein_id gnl|my_center|LOCUS_11490 187291 186710 gene locus_tag LOCUS_11500 187291 186710 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228501.1 protein_id gnl|my_center|LOCUS_11500 188647 187313 gene locus_tag LOCUS_11510 188647 187313 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886611.1 protein_id gnl|my_center|LOCUS_11510 189705 188644 gene locus_tag LOCUS_11520 189705 188644 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 protein_id gnl|my_center|LOCUS_11520 190621 189668 gene locus_tag LOCUS_11530 190621 189668 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_11530 191021 191812 gene locus_tag LOCUS_11540 191021 191812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 protein_id gnl|my_center|LOCUS_11540 192728 191850 gene locus_tag LOCUS_11550 192728 191850 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 protein_id gnl|my_center|LOCUS_11550 194539 192797 gene locus_tag LOCUS_11560 gene yvrG 194539 192797 CDS product two-component system sensor histidine kinase YvrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243980.1 protein_id gnl|my_center|LOCUS_11560 195249 194536 gene locus_tag LOCUS_11570 gene yvrH 195249 194536 CDS product two-component system response regulator YvrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243545.1 protein_id gnl|my_center|LOCUS_11570 195639 195403 gene locus_tag LOCUS_11580 gene rsoA 195639 195403 CDS product sigma-O factor regulator RsoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228484.1 protein_id gnl|my_center|LOCUS_11580 196172 195636 gene locus_tag LOCUS_11590 gene sigO 196172 195636 CDS product RNA polymerase sigma factor SigO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243707.1 protein_id gnl|my_center|LOCUS_11590 196376 196531 gene locus_tag LOCUS_11600 196376 196531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 196651 197808 gene locus_tag LOCUS_11610 gene oxdC 196651 197808 CDS product oxalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243476.1 protein_id gnl|my_center|LOCUS_11610 199542 198313 gene locus_tag LOCUS_11620 199542 198313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_11620 200224 199535 gene locus_tag LOCUS_11630 200224 199535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_11630 201401 200208 gene locus_tag LOCUS_11640 201401 200208 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 protein_id gnl|my_center|LOCUS_11640 202382 201573 gene locus_tag LOCUS_11650 202382 201573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 protein_id gnl|my_center|LOCUS_11650 203408 202398 gene locus_tag LOCUS_11660 203408 202398 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244298.1 protein_id gnl|my_center|LOCUS_11660 204454 203408 gene locus_tag LOCUS_11670 204454 203408 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886613.1 protein_id gnl|my_center|LOCUS_11670 204659 205606 gene locus_tag LOCUS_11680 204659 205606 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243220.1 protein_id gnl|my_center|LOCUS_11680 205664 205933 gene locus_tag LOCUS_11690 205664 205933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 207380 205971 gene locus_tag LOCUS_11700 207380 205971 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244227.1 protein_id gnl|my_center|LOCUS_11700 207920 207780 gene locus_tag LOCUS_11710 gene sspJ 207920 207780 CDS product small acid-soluble spore protein SspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221612.1 protein_id gnl|my_center|LOCUS_11710 208089 208571 gene locus_tag LOCUS_11720 208089 208571 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228444.1 protein_id gnl|my_center|LOCUS_11720 208671 210524 gene locus_tag LOCUS_11730 208671 210524 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243932.1 protein_id gnl|my_center|LOCUS_11730 211480 210551 gene locus_tag LOCUS_11740 211480 210551 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243439.1 protein_id gnl|my_center|LOCUS_11740 211587 212369 gene locus_tag LOCUS_11750 gene modA 211587 212369 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_11750 212401 213033 gene locus_tag LOCUS_11760 gene modB 212401 213033 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 protein_id gnl|my_center|LOCUS_11760 213893 213063 gene locus_tag LOCUS_11770 gene pgoN 213893 213063 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_11770 214116 214601 gene locus_tag LOCUS_11780 gene yvgO 214116 214601 CDS product stress response protein YvgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243913.1 protein_id gnl|my_center|LOCUS_11780 216658 214646 gene locus_tag LOCUS_11790 216658 214646 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 protein_id gnl|my_center|LOCUS_11790 218628 216913 gene locus_tag LOCUS_11800 gene cysI 218628 216913 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_11800 220471 218654 gene locus_tag LOCUS_11810 220471 218654 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_11810 222966 220642 gene locus_tag LOCUS_11820 gene helD 222966 220642 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244180.1 protein_id gnl|my_center|LOCUS_11820 223767 223159 gene locus_tag LOCUS_11830 223767 223159 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 protein_id gnl|my_center|LOCUS_11830 224369 223953 gene locus_tag LOCUS_11840 224369 223953 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_11840 225042 224374 gene locus_tag LOCUS_11850 gene bdbD 225042 224374 CDS product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 protein_id gnl|my_center|LOCUS_11850 227271 225163 gene locus_tag LOCUS_11860 227271 225163 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906546.1 protein_id gnl|my_center|LOCUS_11860 229842 227431 gene locus_tag LOCUS_11870 gene copA 229842 227431 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_11870 230135 229926 gene locus_tag LOCUS_11880 gene copZ 230135 229926 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244260.1 protein_id gnl|my_center|LOCUS_11880 230515 230210 gene locus_tag LOCUS_11890 gene csoR 230515 230210 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 protein_id gnl|my_center|LOCUS_11890 230641 231717 gene locus_tag LOCUS_11900 gene iolW 230641 231717 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968169.1 protein_id gnl|my_center|LOCUS_11900 232390 231755 gene locus_tag LOCUS_11910 gene azoRB 232390 231755 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_11910 234448 232550 gene locus_tag LOCUS_11920 234448 232550 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243180.1 protein_id gnl|my_center|LOCUS_11920 235210 234554 gene locus_tag LOCUS_11930 235210 234554 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002040907.1 protein_id gnl|my_center|LOCUS_11930 236165 235218 gene locus_tag LOCUS_11940 236165 235218 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378082.1 protein_id gnl|my_center|LOCUS_11940 237080 236286 gene locus_tag LOCUS_11950 237080 236286 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228388.1 protein_id gnl|my_center|LOCUS_11950 237532 237948 gene locus_tag LOCUS_11960 gene arr 237532 237948 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_11960 238638 238838 gene locus_tag LOCUS_11970 238638 238838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 239770 239411 gene locus_tag LOCUS_tm00010 239770 239411 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 240416 239946 gene locus_tag LOCUS_11980 gene smpB 240416 239946 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_11980 242900 240561 gene locus_tag LOCUS_11990 gene rnr 242900 240561 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_11990 243659 242919 gene locus_tag LOCUS_12000 243659 242919 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_12000 244021 243791 gene locus_tag LOCUS_12010 gene secG 244021 243791 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_12010 244172 244942 gene locus_tag LOCUS_12020 244172 244942 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228381.1 protein_id gnl|my_center|LOCUS_12020 245216 244983 gene locus_tag LOCUS_12030 245216 244983 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968172.1 protein_id gnl|my_center|LOCUS_12030 245368 245775 gene locus_tag LOCUS_12040 gene rghR 245368 245775 CDS product transcriptional repressor RghR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220034.1 protein_id gnl|my_center|LOCUS_12040 245804 246223 gene locus_tag LOCUS_12050 245804 246223 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228377.1 protein_id gnl|my_center|LOCUS_12050 246314 246640 gene locus_tag LOCUS_12060 gene catR 246314 246640 CDS product catDE operon transcriptional regulator CatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242888.1 protein_id gnl|my_center|LOCUS_12060 248229 246850 gene locus_tag LOCUS_12070 248229 246850 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 protein_id gnl|my_center|LOCUS_12070 248882 248220 gene locus_tag LOCUS_12080 248882 248220 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_12080 249460 248900 gene locus_tag LOCUS_12090 249460 248900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 250427 249672 gene locus_tag LOCUS_12100 250427 249672 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 protein_id gnl|my_center|LOCUS_12100 251140 250424 gene locus_tag LOCUS_12110 251140 250424 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 protein_id gnl|my_center|LOCUS_12110 251651 251154 gene locus_tag LOCUS_12120 251651 251154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 252407 252237 gene locus_tag LOCUS_12130 252407 252237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 253807 252482 gene locus_tag LOCUS_12140 253807 252482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 255624 253780 gene locus_tag LOCUS_12150 255624 253780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 protein_id gnl|my_center|LOCUS_12150 258707 255615 gene locus_tag LOCUS_12160 258707 255615 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_12160 259597 258926 gene locus_tag LOCUS_12170 gene opuBD 259597 258926 CDS product choline ABC transporter permease OpuBD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228374.1 protein_id gnl|my_center|LOCUS_12170 260534 259614 gene locus_tag LOCUS_12180 gene opuBC 260534 259614 CDS product choline ABC transporter substrate-binding lipoprotein OpuBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228372.1 protein_id gnl|my_center|LOCUS_12180 261199 260546 gene locus_tag LOCUS_12190 gene opuBB 261199 260546 CDS product choline ABC transporter permease OpuBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228370.1 protein_id gnl|my_center|LOCUS_12190 262359 261214 gene locus_tag LOCUS_12200 gene opuBA 262359 261214 CDS product choline ABC transporter ATP-binding protein OpuBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242811.1 protein_id gnl|my_center|LOCUS_12200 262644 263177 gene locus_tag LOCUS_12210 262644 263177 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243347.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence063 133 1797 gene locus_tag LOCUS_12220 133 1797 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243842.1 protein_id gnl|my_center|LOCUS_12220 1916 2314 gene locus_tag LOCUS_12230 1916 2314 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_12230 2328 3359 gene locus_tag LOCUS_12240 2328 3359 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229861.1 protein_id gnl|my_center|LOCUS_12240 3384 3638 gene locus_tag LOCUS_12250 3384 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244393.1 protein_id gnl|my_center|LOCUS_12250 4388 3651 gene locus_tag LOCUS_12260 4388 3651 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243977.1 protein_id gnl|my_center|LOCUS_12260 4545 6533 gene locus_tag LOCUS_12270 gene mcpB 4545 6533 CDS product methyl-accepting chemotaxis protein McpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243461.1 protein_id gnl|my_center|LOCUS_12270 6712 8697 gene locus_tag LOCUS_12280 gene tlpA 6712 8697 CDS product methyl-accepting chemotaxis protein TlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243846.1 protein_id gnl|my_center|LOCUS_12280 8826 10811 gene locus_tag LOCUS_12290 gene mcpA 8826 10811 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244077.1 protein_id gnl|my_center|LOCUS_12290 10924 12912 gene locus_tag LOCUS_12300 gene tlpB 10924 12912 CDS product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 protein_id gnl|my_center|LOCUS_12300 13049 15118 gene locus_tag LOCUS_12310 13049 15118 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_12310 15178 15954 gene locus_tag LOCUS_12320 gene rhaR 15178 15954 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_12320 15959 17419 gene locus_tag LOCUS_12330 gene rhaB 15959 17419 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 protein_id gnl|my_center|LOCUS_12330 17434 17748 gene locus_tag LOCUS_12340 gene rhaM 17434 17748 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243762.1 protein_id gnl|my_center|LOCUS_12340 17773 19047 gene locus_tag LOCUS_12350 gene rhaA 17773 19047 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_12350 20075 19089 gene locus_tag LOCUS_12360 gene iolU 20075 19089 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_12360 20256 21422 gene locus_tag LOCUS_12370 20256 21422 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 protein_id gnl|my_center|LOCUS_12370 21514 22344 gene locus_tag LOCUS_12380 21514 22344 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 protein_id gnl|my_center|LOCUS_12380 22449 22521 gene locus_tag LOCUS_t00390 22449 22521 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23114 22629 gene locus_tag LOCUS_12390 gene cdoA 23114 22629 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243534.1 protein_id gnl|my_center|LOCUS_12390 23575 25110 gene locus_tag LOCUS_12400 23575 25110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243120.1 protein_id gnl|my_center|LOCUS_12400 25270 26118 gene locus_tag LOCUS_12410 gene lytG 25270 26118 CDS product exo-glucosaminidase LytG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228938.1 protein_id gnl|my_center|LOCUS_12410 26228 26491 gene locus_tag LOCUS_12420 26228 26491 CDS product YiaA/YiaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222348.1 protein_id gnl|my_center|LOCUS_12420 27864 26527 gene locus_tag LOCUS_12430 gene ktrB 27864 26527 CDS product Ktr system potassium transporter KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243582.1 protein_id gnl|my_center|LOCUS_12430 28539 27871 gene locus_tag LOCUS_12440 gene ktrA 28539 27871 CDS product potassium uptake protein KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243377.1 protein_id gnl|my_center|LOCUS_12440 29452 28907 gene locus_tag LOCUS_12450 gene bslA 29452 28907 CDS product biofilm-surface layer protein BslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243556.1 protein_id gnl|my_center|LOCUS_12450 30201 29659 gene locus_tag LOCUS_12460 gene gbsR 30201 29659 CDS product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 protein_id gnl|my_center|LOCUS_12460 30396 31868 gene locus_tag LOCUS_12470 gene betB 30396 31868 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243430.1 protein_id gnl|my_center|LOCUS_12470 31884 33092 gene locus_tag LOCUS_12480 gene gbsB 31884 33092 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243227.1 protein_id gnl|my_center|LOCUS_12480 33180 33761 gene locus_tag LOCUS_12490 33180 33761 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243361.1 protein_id gnl|my_center|LOCUS_12490 34255 33767 gene locus_tag LOCUS_12500 34255 33767 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242867.1 protein_id gnl|my_center|LOCUS_12500 34425 34949 gene locus_tag LOCUS_12510 34425 34949 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243808.1 protein_id gnl|my_center|LOCUS_12510 34970 36499 gene locus_tag LOCUS_12520 gene floT 34970 36499 CDS product flotillin lipid rafts scaffold protein FloT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228960.1 protein_id gnl|my_center|LOCUS_12520 36524 37045 gene locus_tag LOCUS_12530 36524 37045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228963.1 protein_id gnl|my_center|LOCUS_12530 37665 37087 gene locus_tag LOCUS_12540 gene thiT 37665 37087 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence064 44 120 gene locus_tag LOCUS_t00400 44 120 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 182 258 gene locus_tag LOCUS_t00410 182 258 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 439 1416 gene locus_tag LOCUS_12550 gene thiL 439 1416 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 protein_id gnl|my_center|LOCUS_12550 1431 1907 gene locus_tag LOCUS_12560 gene tsaE 1431 1907 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_12560 1888 2577 gene locus_tag LOCUS_12570 gene tsaB 1888 2577 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234078.1 protein_id gnl|my_center|LOCUS_12570 2587 3042 gene locus_tag LOCUS_12580 gene rimI 2587 3042 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_12580 3035 4075 gene locus_tag LOCUS_12590 gene tsaD 3035 4075 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_12590 6231 4303 gene locus_tag LOCUS_12600 6231 4303 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_12600 6357 6869 gene locus_tag LOCUS_12610 gene moaC 6357 6869 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243499.1 protein_id gnl|my_center|LOCUS_12610 6866 7513 gene locus_tag LOCUS_12620 6866 7513 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234073.1 protein_id gnl|my_center|LOCUS_12620 7535 7708 gene locus_tag LOCUS_12630 gene tatAY 7535 7708 CDS product sec-independent protein translocase protein TatAY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234072.1 protein_id gnl|my_center|LOCUS_12630 7724 8479 gene locus_tag LOCUS_12640 gene tatC 7724 8479 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_12640 8708 8517 gene locus_tag LOCUS_12650 8708 8517 CDS product YdiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225680.1 protein_id gnl|my_center|LOCUS_12650 9439 8705 gene locus_tag LOCUS_12660 9439 8705 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234069.1 protein_id gnl|my_center|LOCUS_12660 9677 9961 gene locus_tag LOCUS_12670 gene groES 9677 9961 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_12670 10008 11633 gene locus_tag LOCUS_12680 gene groL 10008 11633 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_12680 12376 13371 gene locus_tag LOCUS_12690 12376 13371 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577694.1 protein_id gnl|my_center|LOCUS_12690 15949 13460 gene locus_tag LOCUS_12700 gene gutR 15949 13460 CDS product glucitol operon transcriptional regulator GutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234045.1 protein_id gnl|my_center|LOCUS_12700 16152 17213 gene locus_tag LOCUS_12710 gene gutB 16152 17213 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_12710 17287 18678 gene locus_tag LOCUS_12720 17287 18678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_12720 18773 19735 gene locus_tag LOCUS_12730 18773 19735 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_12730 19934 20617 gene locus_tag LOCUS_12740 19934 20617 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_12740 20683 21708 gene locus_tag LOCUS_12750 20683 21708 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_12750 21708 22475 gene locus_tag LOCUS_12760 21708 22475 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242723.1 protein_id gnl|my_center|LOCUS_12760 22505 23476 gene locus_tag LOCUS_12770 22505 23476 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 protein_id gnl|my_center|LOCUS_12770 24537 23524 gene locus_tag LOCUS_12780 24537 23524 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242752.1 protein_id gnl|my_center|LOCUS_12780 25151 26572 gene locus_tag LOCUS_12790 gene iolT 25151 26572 CDS product myo-inositol transporter IolT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234027.1 protein_id gnl|my_center|LOCUS_12790 27661 26621 gene locus_tag LOCUS_12800 gene bdhA 27661 26621 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234015.1 protein_id gnl|my_center|LOCUS_12800 28108 28476 gene locus_tag LOCUS_12810 gene walM 28108 28476 CDS product cell wall metabolism protein WalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234013.1 protein_id gnl|my_center|LOCUS_12810 28542 29585 gene locus_tag LOCUS_12820 28542 29585 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243172.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence065 218 328 gene locus_tag LOCUS_r00040 218 328 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 341 415 gene locus_tag LOCUS_t00420 341 415 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 421 512 gene locus_tag LOCUS_t00430 421 512 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 547 618 gene locus_tag LOCUS_t00440 547 618 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 628 703 gene locus_tag LOCUS_t00450 628 703 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 711 787 gene locus_tag LOCUS_t00460 711 787 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 852 928 gene locus_tag LOCUS_t00470 852 928 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 941 1016 gene locus_tag LOCUS_t00480 941 1016 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1022 1095 gene locus_tag LOCUS_t00490 1022 1095 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1117 1201 gene locus_tag LOCUS_t00500 1117 1201 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1207 1280 gene locus_tag LOCUS_t00510 1207 1280 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1305 1380 gene locus_tag LOCUS_t00520 1305 1380 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1389 1463 gene locus_tag LOCUS_t00530 1389 1463 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1510 1584 gene locus_tag LOCUS_t00540 1510 1584 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1590 1660 gene locus_tag LOCUS_t00550 1590 1660 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1668 1756 gene locus_tag LOCUS_t00560 1668 1756 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1989 2072 gene locus_tag LOCUS_t00570 1989 2072 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2898 2122 gene locus_tag LOCUS_12830 gene spo0M 2898 2122 CDS product sporulation control protein Spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233481.1 protein_id gnl|my_center|LOCUS_12830 3044 3241 gene locus_tag LOCUS_12840 3044 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233478.1 protein_id gnl|my_center|LOCUS_12840 3545 3306 gene locus_tag LOCUS_12850 3545 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3714 4367 gene locus_tag LOCUS_12860 3714 4367 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_12860 4673 6448 gene locus_tag LOCUS_12870 gene thiC 4673 6448 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_12870 6580 6759 gene locus_tag LOCUS_12880 gene senS 6580 6759 CDS product transcriptional regulator SenS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245192.1 protein_id gnl|my_center|LOCUS_12880 8254 6803 gene locus_tag LOCUS_12890 gene katA 8254 6803 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 protein_id gnl|my_center|LOCUS_12890 8665 9432 gene locus_tag LOCUS_12900 8665 9432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 protein_id gnl|my_center|LOCUS_12900 9450 10448 gene locus_tag LOCUS_12910 9450 10448 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245431.1 protein_id gnl|my_center|LOCUS_12910 10448 11275 gene locus_tag LOCUS_12920 10448 11275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_12920 11298 12434 gene locus_tag LOCUS_12930 gene ssuD 11298 12434 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245787.1 protein_id gnl|my_center|LOCUS_12930 12561 13067 gene locus_tag LOCUS_12940 12561 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245073.1 protein_id gnl|my_center|LOCUS_12940 13182 13451 gene locus_tag LOCUS_12950 gene rpsN 13182 13451 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233455.1 protein_id gnl|my_center|LOCUS_12950 13942 13469 gene locus_tag LOCUS_12960 13942 13469 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245008.1 protein_id gnl|my_center|LOCUS_12960 14147 13944 gene locus_tag LOCUS_12970 14147 13944 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 protein_id gnl|my_center|LOCUS_12970 14338 14411 gene locus_tag LOCUS_t00580 14338 14411 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15125 14502 gene locus_tag LOCUS_12980 15125 14502 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245517.1 protein_id gnl|my_center|LOCUS_12980 15208 16368 gene locus_tag LOCUS_12990 gene queG 15208 16368 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245522.1 protein_id gnl|my_center|LOCUS_12990 16454 17365 gene locus_tag LOCUS_13000 16454 17365 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886452.1 protein_id gnl|my_center|LOCUS_13000 17412 17885 gene locus_tag LOCUS_13010 gene trmL 17412 17885 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 protein_id gnl|my_center|LOCUS_13010 18009 18650 gene locus_tag LOCUS_13020 18009 18650 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886454.1 protein_id gnl|my_center|LOCUS_13020 18641 19354 gene locus_tag LOCUS_13030 18641 19354 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244751.1 protein_id gnl|my_center|LOCUS_13030 19366 20073 gene locus_tag LOCUS_13040 19366 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245825.1 protein_id gnl|my_center|LOCUS_13040 20422 22317 gene locus_tag LOCUS_13050 gene prkA 20422 22317 CDS product serine/threonine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233433.1 protein_id gnl|my_center|LOCUS_13050 22497 23675 gene locus_tag LOCUS_13060 gene yhbH 22497 23675 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 protein_id gnl|my_center|LOCUS_13060 23836 24300 gene locus_tag LOCUS_13070 23836 24300 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233431.1 protein_id gnl|my_center|LOCUS_13070 24370 25002 gene locus_tag LOCUS_13080 24370 25002 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233430.1 protein_id gnl|my_center|LOCUS_13080 25043 26641 gene locus_tag LOCUS_13090 25043 26641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 protein_id gnl|my_center|LOCUS_13090 26664 27194 gene locus_tag LOCUS_13100 26664 27194 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233428.1 protein_id gnl|my_center|LOCUS_13100 27207 27581 gene locus_tag LOCUS_13110 27207 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233427.1 protein_id gnl|my_center|LOCUS_13110 27722 28483 gene locus_tag LOCUS_13120 27722 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245465.1 protein_id gnl|my_center|LOCUS_13120 28486 28851 gene locus_tag LOCUS_13130 28486 28851 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233424.1 protein_id gnl|my_center|LOCUS_13130 28853 29551 gene locus_tag LOCUS_13140 28853 29551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233423.1 protein_id gnl|my_center|LOCUS_13140 29564 30481 gene locus_tag LOCUS_13150 29564 30481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_13150 30474 30968 gene locus_tag LOCUS_13160 30474 30968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13160 31705 31502 gene locus_tag LOCUS_13170 gene cspB 31705 31502 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224086.1 protein_id gnl|my_center|LOCUS_13170 32143 32973 gene locus_tag LOCUS_13180 32143 32973 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245726.1 protein_id gnl|my_center|LOCUS_13180 34055 32976 gene locus_tag LOCUS_13190 gene dgcK 34055 32976 CDS product diguanylate cyclase DgcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244833.1 protein_id gnl|my_center|LOCUS_13190 34226 35617 gene locus_tag LOCUS_13200 gene tcyP 34226 35617 CDS product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 protein_id gnl|my_center|LOCUS_13200 36096 35659 gene locus_tag LOCUS_13210 36096 35659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245285.1 protein_id gnl|my_center|LOCUS_13210 36251 36838 gene locus_tag LOCUS_13220 36251 36838 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245125.1 protein_id gnl|my_center|LOCUS_13220 36958 37926 gene locus_tag LOCUS_13230 36958 37926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245770.1 protein_id gnl|my_center|LOCUS_13230 38511 37858 gene locus_tag LOCUS_13240 38511 37858 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966881.1 protein_id gnl|my_center|LOCUS_13240 38663 42247 gene locus_tag LOCUS_13250 gene yhcR 38663 42247 CDS product endonuclease YhcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886455.1 protein_id gnl|my_center|LOCUS_13250 42244 42840 gene locus_tag LOCUS_13260 gene srtA 42244 42840 CDS product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244666.1 protein_id gnl|my_center|LOCUS_13260 43779 42871 gene locus_tag LOCUS_13270 43779 42871 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244785.1 protein_id gnl|my_center|LOCUS_13270 43968 44285 gene locus_tag LOCUS_13280 43968 44285 CDS product YhcU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233401.1 protein_id gnl|my_center|LOCUS_13280 44422 44844 gene locus_tag LOCUS_13290 44422 44844 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 protein_id gnl|my_center|LOCUS_13290 44970 45632 gene locus_tag LOCUS_13300 44970 45632 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_13300 45648 47189 gene locus_tag LOCUS_13310 45648 47189 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_13310 47301 48215 gene locus_tag LOCUS_13320 47301 48215 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 protein_id gnl|my_center|LOCUS_13320 48375 49712 gene locus_tag LOCUS_13330 48375 49712 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 protein_id gnl|my_center|LOCUS_13330 49743 50297 gene locus_tag LOCUS_13340 gene glpP 49743 50297 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233388.1 protein_id gnl|my_center|LOCUS_13340 50490 51314 gene locus_tag LOCUS_13350 gene glpF 50490 51314 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233386.1 protein_id gnl|my_center|LOCUS_13350 51333 52823 gene locus_tag LOCUS_13360 gene glpK 51333 52823 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_13360 52968 54632 gene locus_tag LOCUS_13370 gene glpD 52968 54632 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_13370 54765 56510 gene locus_tag LOCUS_13380 gene pgcA 54765 56510 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_13380 56662 57804 gene locus_tag LOCUS_13390 gene yhcY 56662 57804 CDS product two-component system sensor histidine kinase YhcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245750.1 protein_id gnl|my_center|LOCUS_13390 57801 58448 gene locus_tag LOCUS_13400 gene yhcZ 57801 58448 CDS product two-component system response regulator YhcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245647.1 protein_id gnl|my_center|LOCUS_13400 58445 58969 gene locus_tag LOCUS_13410 gene yhdA 58445 58969 CDS product FMN-dependent NADPH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244703.1 protein_id gnl|my_center|LOCUS_13410 59226 58984 gene locus_tag LOCUS_13420 59226 58984 CDS product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233373.1 protein_id gnl|my_center|LOCUS_13420 59427 59750 gene locus_tag LOCUS_13430 59427 59750 CDS product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233371.1 protein_id gnl|my_center|LOCUS_13430 61236 59794 gene locus_tag LOCUS_13440 gene lytF 61236 59794 CDS product peptidoglycan endopeptidase LytF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244874.1 protein_id gnl|my_center|LOCUS_13440 61829 61389 gene locus_tag LOCUS_13450 gene nsrR 61829 61389 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_13450 63468 61942 gene locus_tag LOCUS_13460 63468 61942 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886457.1 protein_id gnl|my_center|LOCUS_13460 63634 65040 gene locus_tag LOCUS_13470 gene spoVR 63634 65040 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233364.1 protein_id gnl|my_center|LOCUS_13470 66446 65070 gene locus_tag LOCUS_13480 gene phoA 66446 65070 CDS product alkaline phosphatase PhoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886458.1 protein_id gnl|my_center|LOCUS_13480 66980 67993 gene locus_tag LOCUS_13490 gene lytE 66980 67993 CDS product peptidoglycan endopeptidase LytE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244816.1 protein_id gnl|my_center|LOCUS_13490 68938 68063 gene locus_tag LOCUS_13500 gene citR 68938 68063 CDS product transcriptional regulator CitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233357.1 protein_id gnl|my_center|LOCUS_13500 69047 70147 gene locus_tag LOCUS_13510 gene citA 69047 70147 CDS product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 protein_id gnl|my_center|LOCUS_13510 70221 71090 gene locus_tag LOCUS_13520 70221 71090 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244867.1 protein_id gnl|my_center|LOCUS_13520 71344 72741 gene locus_tag LOCUS_13530 gene bcaP 71344 72741 CDS product branched-chain amino acid transporter BcaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245791.1 protein_id gnl|my_center|LOCUS_13530 72862 74217 gene locus_tag LOCUS_13540 72862 74217 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245615.1 protein_id gnl|my_center|LOCUS_13540 75661 74252 gene locus_tag LOCUS_13550 75661 74252 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245209.1 protein_id gnl|my_center|LOCUS_13550 75771 76199 gene locus_tag LOCUS_13560 75771 76199 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966899.1 protein_id gnl|my_center|LOCUS_13560 76524 76234 gene locus_tag LOCUS_13570 76524 76234 CDS product anti-sigma-M factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233341.1 protein_id gnl|my_center|LOCUS_13570 77585 76512 gene locus_tag LOCUS_13580 77585 76512 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886459.1 protein_id gnl|my_center|LOCUS_13580 78069 77578 gene locus_tag LOCUS_13590 gene sigM 78069 77578 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 protein_id gnl|my_center|LOCUS_13590 78266 79261 gene locus_tag LOCUS_13600 gene akrN 78266 79261 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_13600 79594 80193 gene locus_tag LOCUS_13610 79594 80193 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233335.1 protein_id gnl|my_center|LOCUS_13610 80295 81422 gene locus_tag LOCUS_13620 80295 81422 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 protein_id gnl|my_center|LOCUS_13620 82342 81443 gene locus_tag LOCUS_13630 82342 81443 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_13630 83835 82501 gene locus_tag LOCUS_13640 83835 82501 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966903.1 protein_id gnl|my_center|LOCUS_13640 84441 83896 gene locus_tag LOCUS_13650 gene cueR 84441 83896 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886460.1 protein_id gnl|my_center|LOCUS_13650 84484 85665 gene locus_tag LOCUS_13660 84484 85665 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245683.1 protein_id gnl|my_center|LOCUS_13660 85956 87341 gene locus_tag LOCUS_13670 85956 87341 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245822.1 protein_id gnl|my_center|LOCUS_13670 87711 87355 gene locus_tag LOCUS_13680 gene crcB 87711 87355 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245812.1 protein_id gnl|my_center|LOCUS_13680 88103 87708 gene locus_tag LOCUS_13690 88103 87708 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245042.1 protein_id gnl|my_center|LOCUS_13690 88821 88090 gene locus_tag LOCUS_13700 88821 88090 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_13700 89312 90427 gene locus_tag LOCUS_13710 gene mscY 89312 90427 CDS product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 protein_id gnl|my_center|LOCUS_13710 90501 91244 gene locus_tag LOCUS_13720 gene srtN 90501 91244 CDS product sirtuin NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233309.1 protein_id gnl|my_center|LOCUS_13720 92122 91274 gene locus_tag LOCUS_13730 92122 91274 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245705.1 protein_id gnl|my_center|LOCUS_13730 92409 93257 gene locus_tag LOCUS_13740 gene dat 92409 93257 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_13740 94661 93300 gene locus_tag LOCUS_13750 gene nhaC 94661 93300 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233301.1 protein_id gnl|my_center|LOCUS_13750 95287 94787 gene locus_tag LOCUS_13760 95287 94787 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233299.1 protein_id gnl|my_center|LOCUS_13760 95430 95714 gene locus_tag LOCUS_13770 95430 95714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 95738 97495 gene locus_tag LOCUS_13780 gene bmrC 95738 97495 CDS product multidrug ABC transporter ATP-binding protein BmrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245157.1 protein_id gnl|my_center|LOCUS_13780 97492 99513 gene locus_tag LOCUS_13790 gene bmrD 97492 99513 CDS product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 protein_id gnl|my_center|LOCUS_13790 100178 99558 gene locus_tag LOCUS_13800 100178 99558 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245013.1 protein_id gnl|my_center|LOCUS_13800 100852 100649 gene locus_tag LOCUS_13810 gene sspB 100852 100649 CDS product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 protein_id gnl|my_center|LOCUS_13810 101269 101060 gene locus_tag LOCUS_13820 101269 101060 CDS product YheE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886462.1 protein_id gnl|my_center|LOCUS_13820 102794 101433 gene locus_tag LOCUS_13830 gene yheD 102794 101433 CDS product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 protein_id gnl|my_center|LOCUS_13830 103875 102784 gene locus_tag LOCUS_13840 gene spaC 103875 102784 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_13840 104142 105275 gene locus_tag LOCUS_13850 104142 105275 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245756.1 protein_id gnl|my_center|LOCUS_13850 105369 105722 gene locus_tag LOCUS_13860 105369 105722 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224239.1 protein_id gnl|my_center|LOCUS_13860 107007 105766 gene locus_tag LOCUS_13870 107007 105766 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 protein_id gnl|my_center|LOCUS_13870 107323 108189 gene locus_tag LOCUS_13880 107323 108189 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233277.1 protein_id gnl|my_center|LOCUS_13880 108302 109807 gene locus_tag LOCUS_13890 108302 109807 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 protein_id gnl|my_center|LOCUS_13890 111042 109825 gene locus_tag LOCUS_13900 gene khtU 111042 109825 CDS product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 protein_id gnl|my_center|LOCUS_13900 111547 111050 gene locus_tag LOCUS_13910 gene khtT 111547 111050 CDS product K(+)/H(+) antiporter subunit KhtT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233269.1 protein_id gnl|my_center|LOCUS_13910 111927 111610 gene locus_tag LOCUS_13920 gene khtS 111927 111610 CDS product K(+)/H(+) antiporter modulator KhtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886463.1 protein_id gnl|my_center|LOCUS_13920 112113 112880 gene locus_tag LOCUS_13930 112113 112880 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245167.1 protein_id gnl|my_center|LOCUS_13930 113086 112901 gene locus_tag LOCUS_13940 113086 112901 CDS product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233264.1 protein_id gnl|my_center|LOCUS_13940 113213 114109 gene locus_tag LOCUS_13950 113213 114109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_13950 114102 115361 gene locus_tag LOCUS_13960 114102 115361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_13960 115469 116692 gene locus_tag LOCUS_13970 115469 116692 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233258.1 protein_id gnl|my_center|LOCUS_13970 116706 119597 gene locus_tag LOCUS_13980 gene sbcE 116706 119597 CDS product DNA repair/recombination ATPase SbcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233256.1 protein_id gnl|my_center|LOCUS_13980 119671 120615 gene locus_tag LOCUS_13990 gene yhaM 119671 120615 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 protein_id gnl|my_center|LOCUS_13990 120742 120954 gene locus_tag LOCUS_14000 gene yhaL 120742 120954 CDS product sporulation protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233252.1 protein_id gnl|my_center|LOCUS_14000 121848 120994 gene locus_tag LOCUS_14010 gene prsA 121848 120994 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_14010 123166 122648 gene locus_tag LOCUS_14020 123166 122648 CDS product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245590.1 protein_id gnl|my_center|LOCUS_14020 123374 123715 gene locus_tag LOCUS_14030 123374 123715 CDS product YhaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966921.1 protein_id gnl|my_center|LOCUS_14030 124323 123712 gene locus_tag LOCUS_14040 124323 123712 CDS product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239501.1 protein_id gnl|my_center|LOCUS_14040 124857 124501 gene locus_tag LOCUS_14050 124857 124501 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245875.1 protein_id gnl|my_center|LOCUS_14050 125771 125253 gene locus_tag LOCUS_14060 gene trpP 125771 125253 CDS product tryptophan transporter TrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233236.1 protein_id gnl|my_center|LOCUS_14060 126973 125894 gene locus_tag LOCUS_14070 gene serC 126973 125894 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_14070 127556 127119 gene locus_tag LOCUS_14080 127556 127119 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 protein_id gnl|my_center|LOCUS_14080 128044 128787 gene locus_tag LOCUS_14090 gene ecsA 128044 128787 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233230.1 protein_id gnl|my_center|LOCUS_14090 128780 130006 gene locus_tag LOCUS_14100 gene ecsB 128780 130006 CDS product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245169.1 protein_id gnl|my_center|LOCUS_14100 130029 130739 gene locus_tag LOCUS_14110 130029 130739 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233225.1 protein_id gnl|my_center|LOCUS_14110 131946 130756 gene locus_tag LOCUS_14120 gene sndC 131946 130756 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_14120 133408 132020 gene locus_tag LOCUS_14130 133408 132020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233218.1 protein_id gnl|my_center|LOCUS_14130 133804 133490 gene locus_tag LOCUS_14140 133804 133490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966927.1 protein_id gnl|my_center|LOCUS_14140 134352 133852 gene locus_tag LOCUS_14150 gene hmoB 134352 133852 CDS product heme-degrading oxygenase HmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244748.1 protein_id gnl|my_center|LOCUS_14150 134474 136618 gene locus_tag LOCUS_14160 134474 136618 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 protein_id gnl|my_center|LOCUS_14160 136740 137801 gene locus_tag LOCUS_14170 gene hemE 136740 137801 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 protein_id gnl|my_center|LOCUS_14170 137873 138805 gene locus_tag LOCUS_14180 gene hemH 137873 138805 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_14180 138820 140232 gene locus_tag LOCUS_14190 gene hemY 138820 140232 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_14190 140378 140953 gene locus_tag LOCUS_14200 140378 140953 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233204.1 protein_id gnl|my_center|LOCUS_14200 141024 143351 gene locus_tag LOCUS_14210 141024 143351 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 protein_id gnl|my_center|LOCUS_14210 144372 143395 gene locus_tag LOCUS_14220 gene fabHB 144372 143395 CDS product beta-ketoacyl-ACP synthase III FabHB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233200.1 protein_id gnl|my_center|LOCUS_14220 144501 145277 gene locus_tag LOCUS_14230 144501 145277 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_14230 145691 146731 gene locus_tag LOCUS_14240 145691 146731 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966936.1 protein_id gnl|my_center|LOCUS_14240 146744 147151 gene locus_tag LOCUS_14250 146744 147151 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244837.1 protein_id gnl|my_center|LOCUS_14250 148478 147189 gene locus_tag LOCUS_14260 gene gltT 148478 147189 CDS product glutamate/proton symporter GltT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245579.1 protein_id gnl|my_center|LOCUS_14260 149040 149774 gene locus_tag LOCUS_14270 149040 149774 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 protein_id gnl|my_center|LOCUS_14270 149787 150782 gene locus_tag LOCUS_14280 gene lplJ 149787 150782 CDS product lipoate--protein ligase LplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244914.1 protein_id gnl|my_center|LOCUS_14280 150847 151491 gene locus_tag LOCUS_14290 150847 151491 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245344.1 protein_id gnl|my_center|LOCUS_14290 151609 153150 gene locus_tag LOCUS_14300 gene lcfB 151609 153150 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_14300 153585 153190 gene locus_tag LOCUS_14310 153585 153190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245187.1 protein_id gnl|my_center|LOCUS_14310 153735 155015 gene locus_tag LOCUS_14320 153735 155015 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_14320 156198 155053 gene locus_tag LOCUS_14330 gene aprE 156198 155053 CDS product subtilisin AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233171.1 protein_id gnl|my_center|LOCUS_14330 156640 157089 gene locus_tag LOCUS_14340 156640 157089 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 protein_id gnl|my_center|LOCUS_14340 157160 158152 gene locus_tag LOCUS_14350 157160 158152 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_14350 158486 159457 gene locus_tag LOCUS_14360 158486 159457 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233159.1 protein_id gnl|my_center|LOCUS_14360 160070 159489 gene locus_tag LOCUS_14370 gene phoE 160070 159489 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_14370 161235 160141 gene locus_tag LOCUS_14380 161235 160141 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233154.1 protein_id gnl|my_center|LOCUS_14380 162676 161237 gene locus_tag LOCUS_14390 162676 161237 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244910.1 protein_id gnl|my_center|LOCUS_14390 163242 162682 gene locus_tag LOCUS_14400 163242 162682 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233151.1 protein_id gnl|my_center|LOCUS_14400 164675 163377 gene locus_tag LOCUS_14410 gene hemAT 164675 163377 CDS product heme-based aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245216.1 protein_id gnl|my_center|LOCUS_14410 166341 164812 gene locus_tag LOCUS_14420 166341 164812 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245031.1 protein_id gnl|my_center|LOCUS_14420 166453 167310 gene locus_tag LOCUS_14430 166453 167310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245662.1 protein_id gnl|my_center|LOCUS_14430 167571 167338 gene locus_tag LOCUS_14440 167571 167338 CDS product IDEAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233142.1 protein_id gnl|my_center|LOCUS_14440 167864 168442 gene locus_tag LOCUS_14450 gene comK 167864 168442 CDS product competence transcription factor ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245329.1 protein_id gnl|my_center|LOCUS_14450 169384 168485 gene locus_tag LOCUS_14460 169384 168485 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245421.1 protein_id gnl|my_center|LOCUS_14460 169601 169870 gene locus_tag LOCUS_14470 169601 169870 CDS product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233136.1 protein_id gnl|my_center|LOCUS_14470 171382 169913 gene locus_tag LOCUS_14480 171382 169913 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 protein_id gnl|my_center|LOCUS_14480 171579 171379 gene locus_tag LOCUS_14490 171579 171379 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224377.1 protein_id gnl|my_center|LOCUS_14490 172167 171805 gene locus_tag LOCUS_14500 172167 171805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233132.1 protein_id gnl|my_center|LOCUS_14500 172323 172943 gene locus_tag LOCUS_14510 172323 172943 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 protein_id gnl|my_center|LOCUS_14510 172945 173451 gene locus_tag LOCUS_14520 gene lepB 172945 173451 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233128.1 protein_id gnl|my_center|LOCUS_14520 173634 175127 gene locus_tag LOCUS_14530 173634 175127 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 protein_id gnl|my_center|LOCUS_14530 175204 175731 gene locus_tag LOCUS_14540 175204 175731 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245853.1 protein_id gnl|my_center|LOCUS_14540 175952 175758 gene locus_tag LOCUS_14550 175952 175758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 177512 176307 gene locus_tag LOCUS_14560 gene glcP 177512 176307 CDS product glucose/mannose transporter GlcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245772.1 protein_id gnl|my_center|LOCUS_14560 178636 177584 gene locus_tag LOCUS_14570 gene ntdC 178636 177584 CDS product glucose-6-phosphate 3-dehydrogenase NdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244701.1 protein_id gnl|my_center|LOCUS_14570 179499 178654 gene locus_tag LOCUS_14580 gene ntdB 179499 178654 CDS product kanosamine-6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244845.1 protein_id gnl|my_center|LOCUS_14580 180796 179471 gene locus_tag LOCUS_14590 gene ntdA 180796 179471 CDS product 3-dehydro-glucose-6-phosphate--glutamate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245503.1 protein_id gnl|my_center|LOCUS_14590 180902 181891 gene locus_tag LOCUS_14600 gene ntdR 180902 181891 CDS product NTD biosynthesis operon transcriptional regulator NtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966948.1 protein_id gnl|my_center|LOCUS_14600 183598 182444 gene locus_tag LOCUS_14610 183598 182444 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245459.1 protein_id gnl|my_center|LOCUS_14610 184908 183706 gene locus_tag LOCUS_14620 184908 183706 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245498.1 protein_id gnl|my_center|LOCUS_14620 185022 186749 gene locus_tag LOCUS_14630 185022 186749 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245281.1 protein_id gnl|my_center|LOCUS_14630 187668 187231 gene locus_tag LOCUS_14640 187668 187231 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245806.1 protein_id gnl|my_center|LOCUS_14640 187635 187850 gene locus_tag LOCUS_14650 187635 187850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 187852 191352 gene locus_tag LOCUS_14660 gene addB 187852 191352 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244988.1 protein_id gnl|my_center|LOCUS_14660 191339 195043 gene locus_tag LOCUS_14670 gene addA 191339 195043 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_14670 195115 196290 gene locus_tag LOCUS_14680 195115 196290 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 protein_id gnl|my_center|LOCUS_14680 196287 199679 gene locus_tag LOCUS_14690 gene sbcC 196287 199679 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 protein_id gnl|my_center|LOCUS_14690 199693 199995 gene locus_tag LOCUS_14700 gene hlpB 199693 199995 CDS product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 protein_id gnl|my_center|LOCUS_14700 200250 200032 gene locus_tag LOCUS_14710 200250 200032 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 protein_id gnl|my_center|LOCUS_14710 200861 200676 gene locus_tag LOCUS_14720 gene gerPD 200861 200676 CDS product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 protein_id gnl|my_center|LOCUS_14720 201475 200858 gene locus_tag LOCUS_14730 201475 200858 CDS product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 protein_id gnl|my_center|LOCUS_14730 201731 201498 gene locus_tag LOCUS_14740 gene gerPB 201731 201498 CDS product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 protein_id gnl|my_center|LOCUS_14740 201966 201745 gene locus_tag LOCUS_14750 201966 201745 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233088.1 protein_id gnl|my_center|LOCUS_14750 202554 202384 gene locus_tag LOCUS_14760 gene yisI 202554 202384 CDS product aspartyl-phosphate phosphatase YisI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233086.1 protein_id gnl|my_center|LOCUS_14760 203621 202698 gene locus_tag LOCUS_14770 203621 202698 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245291.1 protein_id gnl|my_center|LOCUS_14770 203775 204680 gene locus_tag LOCUS_14780 203775 204680 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245441.1 protein_id gnl|my_center|LOCUS_14780 204796 205152 gene locus_tag LOCUS_14790 204796 205152 CDS product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244937.1 protein_id gnl|my_center|LOCUS_14790 205318 208002 gene locus_tag LOCUS_14800 gene wprA 205318 208002 CDS product cell wall-associated protease WprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244653.1 protein_id gnl|my_center|LOCUS_14800 208591 208034 gene locus_tag LOCUS_14810 208591 208034 CDS product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886469.1 protein_id gnl|my_center|LOCUS_14810 208761 210605 gene locus_tag LOCUS_14820 gene asnB 208761 210605 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_14820 211293 210814 gene locus_tag LOCUS_14830 211293 210814 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886470.1 protein_id gnl|my_center|LOCUS_14830 211857 212663 gene locus_tag LOCUS_14840 gene farP 211857 212663 CDS product farnesyl diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245866.1 protein_id gnl|my_center|LOCUS_14840 214055 212688 gene locus_tag LOCUS_14850 214055 212688 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_14850 214179 215042 gene locus_tag LOCUS_14860 214179 215042 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_14860 215060 216073 gene locus_tag LOCUS_14870 gene degA 215060 216073 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_14870 216281 217315 gene locus_tag LOCUS_14880 gene iolX 216281 217315 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_14880 217882 217373 gene locus_tag LOCUS_14890 217882 217373 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 protein_id gnl|my_center|LOCUS_14890 218543 217932 gene locus_tag LOCUS_14900 218543 217932 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966965.1 protein_id gnl|my_center|LOCUS_14900 218667 220112 gene locus_tag LOCUS_14910 218667 220112 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886472.1 protein_id gnl|my_center|LOCUS_14910 220757 220119 gene locus_tag LOCUS_14920 220757 220119 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233060.1 protein_id gnl|my_center|LOCUS_14920 220961 221767 gene locus_tag LOCUS_14930 220961 221767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_14930 222393 221794 gene locus_tag LOCUS_14940 gene cysC 222393 221794 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 protein_id gnl|my_center|LOCUS_14940 223559 222390 gene locus_tag LOCUS_14950 gene sat 223559 222390 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233054.1 protein_id gnl|my_center|LOCUS_14950 224385 223672 gene locus_tag LOCUS_14960 224385 223672 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244757.1 protein_id gnl|my_center|LOCUS_14960 224575 225261 gene locus_tag LOCUS_14970 224575 225261 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 protein_id gnl|my_center|LOCUS_14970 225258 226016 gene locus_tag LOCUS_14980 225258 226016 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233048.1 protein_id gnl|my_center|LOCUS_14980 226690 226061 gene locus_tag LOCUS_14990 226690 226061 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966972.1 protein_id gnl|my_center|LOCUS_14990 227901 226786 gene locus_tag LOCUS_15000 227901 226786 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245056.1 protein_id gnl|my_center|LOCUS_15000 229178 227910 gene locus_tag LOCUS_15010 229178 227910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_15010 230148 229291 gene locus_tag LOCUS_15020 230148 229291 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244917.1 protein_id gnl|my_center|LOCUS_15020 230603 230154 gene locus_tag LOCUS_15030 230603 230154 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966973.1 protein_id gnl|my_center|LOCUS_15030 232533 230695 gene locus_tag LOCUS_15040 232533 230695 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_15040 233340 232849 gene locus_tag LOCUS_15050 233340 232849 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 protein_id gnl|my_center|LOCUS_15050 233488 234336 gene locus_tag LOCUS_15060 233488 234336 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 protein_id gnl|my_center|LOCUS_15060 234449 234739 gene locus_tag LOCUS_15070 234449 234739 CDS product DUF3784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233021.1 protein_id gnl|my_center|LOCUS_15070 235632 234781 gene locus_tag LOCUS_15080 235632 234781 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_15080 235769 236611 gene locus_tag LOCUS_15090 235769 236611 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 protein_id gnl|my_center|LOCUS_15090 236630 237085 gene locus_tag LOCUS_15100 236630 237085 CDS product intracellular proteinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886475.1 protein_id gnl|my_center|LOCUS_15100 237313 237116 gene locus_tag LOCUS_15110 237313 237116 CDS product DUF3813 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245613.1 protein_id gnl|my_center|LOCUS_15110 238382 237570 gene locus_tag LOCUS_15120 gene yitU 238382 237570 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 protein_id gnl|my_center|LOCUS_15120 238503 239270 gene locus_tag LOCUS_15130 238503 239270 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233006.1 protein_id gnl|my_center|LOCUS_15130 239334 239642 gene locus_tag LOCUS_15140 239334 239642 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 protein_id gnl|my_center|LOCUS_15140 239711 239881 gene locus_tag LOCUS_15150 239711 239881 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990233.1 protein_id gnl|my_center|LOCUS_15150 239943 241373 gene locus_tag LOCUS_15160 239943 241373 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232994.1 protein_id gnl|my_center|LOCUS_15160 241373 241912 gene locus_tag LOCUS_15170 241373 241912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886476.1 protein_id gnl|my_center|LOCUS_15170 242117 243154 gene locus_tag LOCUS_15180 gene argC 242117 243154 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 protein_id gnl|my_center|LOCUS_15180 243174 244394 gene locus_tag LOCUS_15190 gene argJ 243174 244394 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232989.1 protein_id gnl|my_center|LOCUS_15190 244409 245185 gene locus_tag LOCUS_15200 gene argB 244409 245185 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232987.1 protein_id gnl|my_center|LOCUS_15200 245182 246339 gene locus_tag LOCUS_15210 245182 246339 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 protein_id gnl|my_center|LOCUS_15210 246410 247471 gene locus_tag LOCUS_15220 246410 247471 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232984.1 protein_id gnl|my_center|LOCUS_15220 247464 250556 gene locus_tag LOCUS_15230 247464 250556 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232982.1 protein_id gnl|my_center|LOCUS_15230 250544 251488 gene locus_tag LOCUS_15240 gene argF 250544 251488 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232980.1 protein_id gnl|my_center|LOCUS_15240 251589 251768 gene locus_tag LOCUS_15250 251589 251768 CDS product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245356.1 protein_id gnl|my_center|LOCUS_15250 251999 251814 gene locus_tag LOCUS_15260 251999 251814 CDS product DUF2929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245236.1 protein_id gnl|my_center|LOCUS_15260 252250 252984 gene locus_tag LOCUS_15270 252250 252984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245223.1 protein_id gnl|my_center|LOCUS_15270 253068 253625 gene locus_tag LOCUS_15280 253068 253625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232974.1 protein_id gnl|my_center|LOCUS_15280 253716 254669 gene locus_tag LOCUS_15290 gene med 253716 254669 CDS product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 protein_id gnl|my_center|LOCUS_15290 254684 254875 gene locus_tag LOCUS_15300 gene comZ 254684 254875 CDS product ComG operon transcriptional repressor ComZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224559.1 protein_id gnl|my_center|LOCUS_15300 255126 254905 gene locus_tag LOCUS_15310 gene yjzB 255126 254905 CDS product spore coat protein YjzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232972.1 protein_id gnl|my_center|LOCUS_15310 255298 256236 gene locus_tag LOCUS_15320 gene fabH 255298 256236 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232971.1 protein_id gnl|my_center|LOCUS_15320 256261 257502 gene locus_tag LOCUS_15330 gene fabF 256261 257502 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_15330 257578 258363 gene locus_tag LOCUS_15340 257578 258363 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232967.1 protein_id gnl|my_center|LOCUS_15340 258554 259540 gene locus_tag LOCUS_15350 gene appD 258554 259540 CDS product oligopeptide ABC transporter ATP-binding protein AppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232965.1 protein_id gnl|my_center|LOCUS_15350 259537 260526 gene locus_tag LOCUS_15360 gene appF 259537 260526 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_15360 260614 262245 gene locus_tag LOCUS_15370 260614 262245 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_15370 262321 263271 gene locus_tag LOCUS_15380 gene appB 262321 263271 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_15380 263288 264199 gene locus_tag LOCUS_15390 gene appC 263288 264199 CDS product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 protein_id gnl|my_center|LOCUS_15390 264405 265157 gene locus_tag LOCUS_15400 264405 265157 CDS product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239298.1 protein_id gnl|my_center|LOCUS_15400 266183 265191 gene locus_tag LOCUS_15410 gene trpS 266183 265191 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 protein_id gnl|my_center|LOCUS_15410 266927 268564 gene locus_tag LOCUS_15420 gene oppA 266927 268564 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_15420 268660 269595 gene locus_tag LOCUS_15430 gene oppB 268660 269595 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_15430 269599 270516 gene locus_tag LOCUS_15440 gene oppC 269599 270516 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 protein_id gnl|my_center|LOCUS_15440 270530 271597 gene locus_tag LOCUS_15450 gene oppD 270530 271597 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 protein_id gnl|my_center|LOCUS_15450 271599 272516 gene locus_tag LOCUS_15460 gene oppF 271599 272516 CDS product oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245567.1 protein_id gnl|my_center|LOCUS_15460 273027 273836 gene locus_tag LOCUS_15470 273027 273836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 274014 274592 gene locus_tag LOCUS_15480 274014 274592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244921.1 protein_id gnl|my_center|LOCUS_15480 274773 275168 gene locus_tag LOCUS_15490 gene spx 274773 275168 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245483.1 protein_id gnl|my_center|LOCUS_15490 275867 275211 gene locus_tag LOCUS_15500 275867 275211 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232944.1 protein_id gnl|my_center|LOCUS_15500 276143 276799 gene locus_tag LOCUS_15510 gene mecA 276143 276799 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245194.1 protein_id gnl|my_center|LOCUS_15510 278157 280169 gene locus_tag LOCUS_15520 gene pepF 278157 280169 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_15520 280374 280207 gene locus_tag LOCUS_15530 280374 280207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244944.1 protein_id gnl|my_center|LOCUS_15530 281587 280688 gene locus_tag LOCUS_15540 gene spxH 281587 280688 CDS product protease adaptor protein SpxH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245184.1 protein_id gnl|my_center|LOCUS_15540 281982 281584 gene locus_tag LOCUS_15550 281982 281584 CDS product group 2 truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232928.1 protein_id gnl|my_center|LOCUS_15550 282974 282237 gene locus_tag LOCUS_15560 282974 282237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 283561 282989 gene locus_tag LOCUS_15570 283561 282989 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 protein_id gnl|my_center|LOCUS_15570 283685 284050 gene locus_tag LOCUS_15580 283685 284050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232922.1 protein_id gnl|my_center|LOCUS_15580 284079 284714 gene locus_tag LOCUS_15590 gene yjbM 284079 284714 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245294.1 protein_id gnl|my_center|LOCUS_15590 284733 285533 gene locus_tag LOCUS_15600 284733 285533 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 protein_id gnl|my_center|LOCUS_15600 285548 286447 gene locus_tag LOCUS_15610 285548 286447 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_15610 287194 286460 gene locus_tag LOCUS_15620 gene prpE 287194 286460 CDS product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244765.1 protein_id gnl|my_center|LOCUS_15620 287428 289272 gene locus_tag LOCUS_15630 287428 289272 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232910.1 protein_id gnl|my_center|LOCUS_15630 289524 290231 gene locus_tag LOCUS_15640 gene tenA 289524 290231 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232909.1 protein_id gnl|my_center|LOCUS_15640 290209 290826 gene locus_tag LOCUS_15650 gene tenI 290209 290826 CDS product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232908.1 protein_id gnl|my_center|LOCUS_15650 290810 291919 gene locus_tag LOCUS_15660 gene thiO 290810 291919 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245044.1 protein_id gnl|my_center|LOCUS_15660 291916 292119 gene locus_tag LOCUS_15670 gene thiS 291916 292119 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886482.1 protein_id gnl|my_center|LOCUS_15670 292122 292886 gene locus_tag LOCUS_15680 gene thiG 292122 292886 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 protein_id gnl|my_center|LOCUS_15680 292883 293893 gene locus_tag LOCUS_15690 gene thiF 292883 293893 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245868.1 protein_id gnl|my_center|LOCUS_15690 293912 294727 gene locus_tag LOCUS_15700 gene thiD 293912 294727 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245050.1 protein_id gnl|my_center|LOCUS_15700 294864 295640 gene locus_tag LOCUS_15710 gene fabI 294864 295640 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232896.1 protein_id gnl|my_center|LOCUS_15710 295747 296430 gene locus_tag LOCUS_15720 gene cotO 295747 296430 CDS product spore coat protein CotO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886484.1 protein_id gnl|my_center|LOCUS_15720 296971 296522 gene locus_tag LOCUS_15730 gene cotZ 296971 296522 CDS product spore coat protein CotZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244982.1 protein_id gnl|my_center|LOCUS_15730 297587 297099 gene locus_tag LOCUS_15740 gene cotY 297587 297099 CDS product spore coat protein CotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239243.1 protein_id gnl|my_center|LOCUS_15740 298244 297738 gene locus_tag LOCUS_15750 gene cotX 298244 297738 CDS product spore coat protein CotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244668.1 protein_id gnl|my_center|LOCUS_15750 298662 298333 gene locus_tag LOCUS_15760 gene cotW 298662 298333 CDS product spore coat protein CotW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245818.1 protein_id gnl|my_center|LOCUS_15760 299089 298703 gene locus_tag LOCUS_15770 gene cotV 299089 298703 CDS product spore coat protein CotV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244871.1 protein_id gnl|my_center|LOCUS_15770 299245 299601 gene locus_tag LOCUS_15780 gene yjcA 299245 299601 CDS product sporulation protein YjcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244844.1 protein_id gnl|my_center|LOCUS_15780 299882 300088 gene locus_tag LOCUS_15790 299882 300088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244769.1 protein_id gnl|my_center|LOCUS_15790 300170 300328 gene locus_tag LOCUS_15800 300170 300328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 300461 300715 gene locus_tag LOCUS_15810 gene spoVIF 300461 300715 CDS product sporulation-specific transcription regulator SopVIF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232870.1 protein_id gnl|my_center|LOCUS_15810 302941 300788 gene locus_tag LOCUS_15820 302941 300788 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 protein_id gnl|my_center|LOCUS_15820 303186 303440 gene locus_tag LOCUS_15830 303186 303440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232866.1 protein_id gnl|my_center|LOCUS_15830 303936 303514 gene locus_tag LOCUS_15840 303936 303514 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245407.1 protein_id gnl|my_center|LOCUS_15840 304456 303941 gene locus_tag LOCUS_15850 304456 303941 CDS product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232861.1 protein_id gnl|my_center|LOCUS_15850 305215 304493 gene locus_tag LOCUS_15860 305215 304493 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 protein_id gnl|my_center|LOCUS_15860 305553 306698 gene locus_tag LOCUS_15870 gene metI 305553 306698 CDS product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 protein_id gnl|my_center|LOCUS_15870 306691 307863 gene locus_tag LOCUS_15880 gene metC 306691 307863 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_15880 308110 307892 gene locus_tag LOCUS_15890 308110 307892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15890 308436 308137 gene locus_tag LOCUS_15900 308436 308137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15900 309696 308506 gene locus_tag LOCUS_15910 309696 308506 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_15910 309869 309943 gene locus_tag LOCUS_t00590 309869 309943 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 310334 310771 gene locus_tag LOCUS_15920 310334 310771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 311107 310817 gene locus_tag LOCUS_15930 311107 310817 CDS product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242733.1 protein_id gnl|my_center|LOCUS_15930 312497 311124 gene locus_tag LOCUS_15940 312497 311124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15940 312985 312503 gene locus_tag LOCUS_15950 312985 312503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15950 313223 314350 gene locus_tag LOCUS_15960 gene rapH 313223 314350 CDS product response regulator aspartate phosphatase RapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243267.1 protein_id gnl|my_center|LOCUS_15960 314794 314973 gene locus_tag LOCUS_15970 314794 314973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 315315 315887 gene locus_tag LOCUS_15980 315315 315887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 316296 315958 gene locus_tag LOCUS_15990 316296 315958 CDS product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 protein_id gnl|my_center|LOCUS_15990 316911 317372 gene locus_tag LOCUS_16000 316911 317372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16000 317369 318859 gene locus_tag LOCUS_16010 gene manR 317369 318859 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16010 319008 320960 gene locus_tag LOCUS_16020 gene manP 319008 320960 CDS product PTS mannose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245781.1 protein_id gnl|my_center|LOCUS_16020 320976 321923 gene locus_tag LOCUS_16030 gene manA 320976 321923 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 protein_id gnl|my_center|LOCUS_16030 322303 322587 gene locus_tag LOCUS_16040 322303 322587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 323210 322824 gene locus_tag LOCUS_16050 323210 322824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16050 323880 323485 gene locus_tag LOCUS_16060 323880 323485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967031.1 protein_id gnl|my_center|LOCUS_16060 324082 324564 gene locus_tag LOCUS_16070 gene ybaK 324082 324564 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_16070 324803 324609 gene locus_tag LOCUS_16080 324803 324609 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232825.1 protein_id gnl|my_center|LOCUS_16080 325675 325869 gene locus_tag LOCUS_16090 325675 325869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 326855 325893 gene locus_tag LOCUS_16100 gene cyoE 326855 325893 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232818.1 protein_id gnl|my_center|LOCUS_16100 327242 327006 gene locus_tag LOCUS_16110 327242 327006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 327496 328896 gene locus_tag LOCUS_16120 gene pdaC 327496 328896 CDS product peptidoglycan-N-acetylmuramic acid deacetylase PdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245023.1 protein_id gnl|my_center|LOCUS_16120 329416 328943 gene locus_tag LOCUS_16130 329416 328943 CDS product YjfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244679.1 protein_id gnl|my_center|LOCUS_16130 329713 329546 gene locus_tag LOCUS_16140 329713 329546 CDS product YjfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232812.1 protein_id gnl|my_center|LOCUS_16140 329841 330740 gene locus_tag LOCUS_16150 329841 330740 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244687.1 protein_id gnl|my_center|LOCUS_16150 331147 330749 gene locus_tag LOCUS_16160 331147 330749 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967034.1 protein_id gnl|my_center|LOCUS_16160 331821 331246 gene locus_tag LOCUS_16170 331821 331246 CDS product YjgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245827.1 protein_id gnl|my_center|LOCUS_16170 331971 334928 gene locus_tag LOCUS_16180 gene fdhF 331971 334928 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 protein_id gnl|my_center|LOCUS_16180 334921 335481 gene locus_tag LOCUS_16190 334921 335481 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232799.1 protein_id gnl|my_center|LOCUS_16190 335679 336317 gene locus_tag LOCUS_16200 335679 336317 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244850.1 protein_id gnl|my_center|LOCUS_16200 336405 337022 gene locus_tag LOCUS_16210 336405 337022 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_16210 337332 337054 gene locus_tag LOCUS_16220 337332 337054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232791.1 protein_id gnl|my_center|LOCUS_16220 337723 338913 gene locus_tag LOCUS_16230 gene yjiB 337723 338913 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_16230 338936 340114 gene locus_tag LOCUS_16240 338936 340114 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232783.1 protein_id gnl|my_center|LOCUS_16240 340344 340156 gene locus_tag LOCUS_16250 340344 340156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232781.1 protein_id gnl|my_center|LOCUS_16250 340519 341331 gene locus_tag LOCUS_16260 340519 341331 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245334.1 protein_id gnl|my_center|LOCUS_16260 342129 341377 gene locus_tag LOCUS_16270 gene fetB 342129 341377 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 protein_id gnl|my_center|LOCUS_16270 342881 342129 gene locus_tag LOCUS_16280 342881 342129 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 protein_id gnl|my_center|LOCUS_16280 343974 343000 gene locus_tag LOCUS_16290 343974 343000 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232772.1 protein_id gnl|my_center|LOCUS_16290 344106 344603 gene locus_tag LOCUS_16300 344106 344603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232768.1 protein_id gnl|my_center|LOCUS_16300 344996 345418 gene locus_tag LOCUS_16310 344996 345418 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220510.1 protein_id gnl|my_center|LOCUS_16310 345458 346636 gene locus_tag LOCUS_16320 345458 346636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232765.1 protein_id gnl|my_center|LOCUS_16320 346818 348257 gene locus_tag LOCUS_16330 gene uxaC 346818 348257 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 protein_id gnl|my_center|LOCUS_16330 348340 349719 gene locus_tag LOCUS_16340 348340 349719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245721.1 protein_id gnl|my_center|LOCUS_16340 349824 350837 gene locus_tag LOCUS_16350 gene allD 349824 350837 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 protein_id gnl|my_center|LOCUS_16350 350843 351862 gene locus_tag LOCUS_16360 350843 351862 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 protein_id gnl|my_center|LOCUS_16360 351887 352966 gene locus_tag LOCUS_16370 gene uxuA 351887 352966 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_16370 352963 353799 gene locus_tag LOCUS_16380 352963 353799 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_16380 353847 355115 gene locus_tag LOCUS_16390 353847 355115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245531.1 protein_id gnl|my_center|LOCUS_16390 355203 356204 gene locus_tag LOCUS_16400 355203 356204 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 protein_id gnl|my_center|LOCUS_16400 356282 357724 gene locus_tag LOCUS_16410 356282 357724 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 protein_id gnl|my_center|LOCUS_16410 357721 359214 gene locus_tag LOCUS_16420 357721 359214 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245409.1 protein_id gnl|my_center|LOCUS_16420 360015 359251 gene locus_tag LOCUS_16430 360015 359251 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245643.1 protein_id gnl|my_center|LOCUS_16430 360706 360242 gene locus_tag LOCUS_16440 360706 360242 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245144.1 protein_id gnl|my_center|LOCUS_16440 360856 362127 gene locus_tag LOCUS_16450 gene yjoB 360856 362127 CDS product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 protein_id gnl|my_center|LOCUS_16450 362278 363408 gene locus_tag LOCUS_16460 gene rapA 362278 363408 CDS product response regulator aspartate phosphatase RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886491.1 protein_id gnl|my_center|LOCUS_16460 363398 363532 gene locus_tag LOCUS_16470 gene phrA 363398 363532 CDS product phosphatase RapA inhibitor PhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245487.1 protein_id gnl|my_center|LOCUS_16470 363818 363564 gene locus_tag LOCUS_16480 363818 363564 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232731.1 protein_id gnl|my_center|LOCUS_16480 363942 364895 gene locus_tag LOCUS_16490 363942 364895 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244876.1 protein_id gnl|my_center|LOCUS_16490 365309 364932 gene locus_tag LOCUS_16500 365309 364932 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245254.1 protein_id gnl|my_center|LOCUS_16500 365416 366018 gene locus_tag LOCUS_16510 365416 366018 CDS product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244789.1 protein_id gnl|my_center|LOCUS_16510 366093 366929 gene locus_tag LOCUS_16520 366093 366929 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245071.1 protein_id gnl|my_center|LOCUS_16520 367570 366974 gene locus_tag LOCUS_16530 367570 366974 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 protein_id gnl|my_center|LOCUS_16530 368073 367732 gene locus_tag LOCUS_16540 368073 367732 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 protein_id gnl|my_center|LOCUS_16540 368253 368432 gene locus_tag LOCUS_16550 368253 368432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232712.1 protein_id gnl|my_center|LOCUS_16550 368419 369255 gene locus_tag LOCUS_16560 368419 369255 CDS product phage-like element PBSX protein XkdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245799.1 protein_id gnl|my_center|LOCUS_16560 369320 369955 gene locus_tag LOCUS_16570 369320 369955 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886492.1 protein_id gnl|my_center|LOCUS_16570 369955 370122 gene locus_tag LOCUS_16580 369955 370122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245588.1 protein_id gnl|my_center|LOCUS_16580 370207 370566 gene locus_tag LOCUS_16590 gene xkdD 370207 370566 CDS product phage-like element PBSX protein XkdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245290.1 protein_id gnl|my_center|LOCUS_16590 370553 370759 gene locus_tag LOCUS_16600 gene xtrA 370553 370759 CDS product phage-like element PBSX protein XtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244900.1 protein_id gnl|my_center|LOCUS_16600 370874 371383 gene locus_tag LOCUS_16610 370874 371383 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245797.1 protein_id gnl|my_center|LOCUS_16610 371501 372295 gene locus_tag LOCUS_16620 gene xtmA 371501 372295 CDS product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244697.1 protein_id gnl|my_center|LOCUS_16620 372292 373593 gene locus_tag LOCUS_16630 372292 373593 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245584.1 protein_id gnl|my_center|LOCUS_16630 373594 375084 gene locus_tag LOCUS_16640 373594 375084 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245427.1 protein_id gnl|my_center|LOCUS_16640 375104 375931 gene locus_tag LOCUS_16650 375104 375931 CDS product XkdF-like putative serine protease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245836.1 protein_id gnl|my_center|LOCUS_16650 375956 376891 gene locus_tag LOCUS_16660 375956 376891 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232690.1 protein_id gnl|my_center|LOCUS_16660 376913 377296 gene locus_tag LOCUS_16670 376913 377296 CDS product DUF3199 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245011.1 protein_id gnl|my_center|LOCUS_16670 377293 377649 gene locus_tag LOCUS_16680 377293 377649 CDS product YqbH/XkdH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967053.1 protein_id gnl|my_center|LOCUS_16680 377646 378131 gene locus_tag LOCUS_16690 377646 378131 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245226.1 protein_id gnl|my_center|LOCUS_16690 378144 378584 gene locus_tag LOCUS_16700 378144 378584 CDS product phage-like element PBSX protein XkdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232680.1 protein_id gnl|my_center|LOCUS_16700 378588 378806 gene locus_tag LOCUS_16710 378588 378806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232679.1 protein_id gnl|my_center|LOCUS_16710 378803 380203 gene locus_tag LOCUS_16720 378803 380203 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245369.1 protein_id gnl|my_center|LOCUS_16720 380205 380648 gene locus_tag LOCUS_16730 380205 380648 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232677.1 protein_id gnl|my_center|LOCUS_16730 380739 381185 gene locus_tag LOCUS_16740 380739 381185 CDS product phage-like element PBSX protein XkdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232676.1 protein_id gnl|my_center|LOCUS_16740 381209 381367 gene locus_tag LOCUS_16750 381209 381367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003239113.1 protein_id gnl|my_center|LOCUS_16750 381368 386377 gene locus_tag LOCUS_16760 381368 386377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 386370 387029 gene locus_tag LOCUS_16770 386370 387029 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232674.1 protein_id gnl|my_center|LOCUS_16770 387042 388022 gene locus_tag LOCUS_16780 387042 388022 CDS product phage-like element PBSX protein XkdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245730.1 protein_id gnl|my_center|LOCUS_16780 388022 388288 gene locus_tag LOCUS_16790 388022 388288 CDS product DUF2577 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244812.1 protein_id gnl|my_center|LOCUS_16790 388345 388770 gene locus_tag LOCUS_16800 388345 388770 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232671.1 protein_id gnl|my_center|LOCUS_16800 388763 389809 gene locus_tag LOCUS_16810 388763 389809 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967060.1 protein_id gnl|my_center|LOCUS_16810 389793 390371 gene locus_tag LOCUS_16820 389793 390371 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244743.1 protein_id gnl|my_center|LOCUS_16820 390368 390640 gene locus_tag LOCUS_16830 390368 390640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232665.1 protein_id gnl|my_center|LOCUS_16830 390643 393084 gene locus_tag LOCUS_16840 390643 393084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 393102 393428 gene locus_tag LOCUS_16850 393102 393428 CDS product XkdW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232660.1 protein_id gnl|my_center|LOCUS_16850 393425 393589 gene locus_tag LOCUS_16860 393425 393589 CDS product XkdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232658.1 protein_id gnl|my_center|LOCUS_16860 393634 394473 gene locus_tag LOCUS_16870 gene xepA 393634 394473 CDS product phage-like element PBSX protein XepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245597.1 protein_id gnl|my_center|LOCUS_16870 394526 394795 gene locus_tag LOCUS_16880 394526 394795 CDS product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232655.1 protein_id gnl|my_center|LOCUS_16880 394808 395071 gene locus_tag LOCUS_16890 394808 395071 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232653.1 protein_id gnl|my_center|LOCUS_16890 395084 395977 gene locus_tag LOCUS_16900 395084 395977 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245230.1 protein_id gnl|my_center|LOCUS_16900 396408 396238 gene locus_tag LOCUS_16910 gene spoIISB 396408 396238 CDS product three component toxin-antitoxin-antitoxin system antitoxin SpoIISB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232646.1 protein_id gnl|my_center|LOCUS_16910 397154 396408 gene locus_tag LOCUS_16920 gene spoIISA 397154 396408 CDS product toxin-antitoxin-antitoxin system toxin SpoIISA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244695.1 protein_id gnl|my_center|LOCUS_16920 398265 397264 gene locus_tag LOCUS_16930 398265 397264 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 protein_id gnl|my_center|LOCUS_16930 398895 398278 gene locus_tag LOCUS_16940 398895 398278 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218470.1 protein_id gnl|my_center|LOCUS_16940 400488 399172 gene locus_tag LOCUS_16950 gene steT 400488 399172 CDS product serine/threonine exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244819.1 protein_id gnl|my_center|LOCUS_16950 400871 401821 gene locus_tag LOCUS_16960 400871 401821 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 protein_id gnl|my_center|LOCUS_16960 402076 404262 gene locus_tag LOCUS_16970 402076 404262 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245387.1 protein_id gnl|my_center|LOCUS_16970 404274 405245 gene locus_tag LOCUS_16980 404274 405245 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_16980 407099 405741 gene locus_tag LOCUS_16990 gene htrA 407099 405741 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967069.1 protein_id gnl|my_center|LOCUS_16990 407272 408090 gene locus_tag LOCUS_17000 gene proG 407272 408090 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_17000 408219 409043 gene locus_tag LOCUS_17010 gene dppA 408219 409043 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_17010 409059 409985 gene locus_tag LOCUS_17020 gene dppB 409059 409985 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 protein_id gnl|my_center|LOCUS_17020 409991 410953 gene locus_tag LOCUS_17030 gene dppC 409991 410953 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 protein_id gnl|my_center|LOCUS_17030 410958 411965 gene locus_tag LOCUS_17040 gene dppD 410958 411965 CDS product dipeptide ABC transporter ATP-binding subunit DppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232615.1 protein_id gnl|my_center|LOCUS_17040 411986 413617 gene locus_tag LOCUS_17050 gene dppE 411986 413617 CDS product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 protein_id gnl|my_center|LOCUS_17050 413723 414664 gene locus_tag LOCUS_17060 413723 414664 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_17060 414661 415761 gene locus_tag LOCUS_17070 gene ykfB 414661 415761 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_17070 415758 416648 gene locus_tag LOCUS_17080 gene eepC 415758 416648 CDS product gamma-D-glutamyl-L-lysine dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245577.1 protein_id gnl|my_center|LOCUS_17080 416661 417650 gene locus_tag LOCUS_17090 416661 417650 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967074.1 protein_id gnl|my_center|LOCUS_17090 418736 417690 gene locus_tag LOCUS_17100 gene pgl 418736 417690 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_17100 419684 418824 gene locus_tag LOCUS_17110 419684 418824 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 protein_id gnl|my_center|LOCUS_17110 419802 420362 gene locus_tag LOCUS_17120 419802 420362 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_17120 420600 421799 gene locus_tag LOCUS_17130 gene hmpA 420600 421799 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245238.1 protein_id gnl|my_center|LOCUS_17130 422102 421872 gene locus_tag LOCUS_17140 422102 421872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967080.1 protein_id gnl|my_center|LOCUS_17140 422256 422987 gene locus_tag LOCUS_17150 422256 422987 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244848.1 protein_id gnl|my_center|LOCUS_17150 423080 423607 gene locus_tag LOCUS_17160 423080 423607 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245783.1 protein_id gnl|my_center|LOCUS_17160 423597 424112 gene locus_tag LOCUS_17170 423597 424112 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244793.1 protein_id gnl|my_center|LOCUS_17170 424335 424673 gene locus_tag LOCUS_17180 gene ykkC 424335 424673 CDS product multidrug efflux SMR transporter subunit YkkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232583.1 protein_id gnl|my_center|LOCUS_17180 424673 424990 gene locus_tag LOCUS_17190 gene ykkD 424673 424990 CDS product multidrug efflux SMR transporter subunit YkkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245695.1 protein_id gnl|my_center|LOCUS_17190 425061 425963 gene locus_tag LOCUS_17200 gene purU 425061 425963 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_17200 426324 427421 gene locus_tag LOCUS_17210 gene proB 426324 427421 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244794.1 protein_id gnl|my_center|LOCUS_17210 427433 428680 gene locus_tag LOCUS_17220 gene proA 427433 428680 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245312.1 protein_id gnl|my_center|LOCUS_17220 428809 429234 gene locus_tag LOCUS_17230 428809 429234 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232574.1 protein_id gnl|my_center|LOCUS_17230 429710 429267 gene locus_tag LOCUS_17240 gene ohrR 429710 429267 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_17240 429852 430262 gene locus_tag LOCUS_17250 429852 430262 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232570.1 protein_id gnl|my_center|LOCUS_17250 430387 431490 gene locus_tag LOCUS_17260 430387 431490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 431966 431496 gene locus_tag LOCUS_17270 gene guaD 431966 431496 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_17270 432101 432727 gene locus_tag LOCUS_17280 432101 432727 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 protein_id gnl|my_center|LOCUS_17280 435054 432766 gene locus_tag LOCUS_17290 gene metE 435054 432766 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232565.1 protein_id gnl|my_center|LOCUS_17290 436428 435469 gene locus_tag LOCUS_17300 gene isp 436428 435469 CDS product serine protease Isp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232562.1 protein_id gnl|my_center|LOCUS_17300 436651 437484 gene locus_tag LOCUS_17310 gene rsbRB 436651 437484 CDS product RsbT co-antagonist RsbRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232560.1 protein_id gnl|my_center|LOCUS_17310 438281 437517 gene locus_tag LOCUS_17320 gene thiX 438281 437517 CDS product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 protein_id gnl|my_center|LOCUS_17320 439896 438256 gene locus_tag LOCUS_17330 439896 438256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 protein_id gnl|my_center|LOCUS_17330 440482 439883 gene locus_tag LOCUS_17340 440482 439883 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_17340 441086 440484 gene locus_tag LOCUS_17350 gene thiU 441086 440484 CDS product HMP/thiamine ABC transporter substrate-binding protein ThiU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244962.1 protein_id gnl|my_center|LOCUS_17350 441398 442084 gene locus_tag LOCUS_17360 gene ykoG 441398 442084 CDS product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 protein_id gnl|my_center|LOCUS_17360 442088 443452 gene locus_tag LOCUS_17370 gene ykoH 442088 443452 CDS product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 protein_id gnl|my_center|LOCUS_17370 443449 444123 gene locus_tag LOCUS_17380 443449 444123 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244905.1 protein_id gnl|my_center|LOCUS_17380 444215 444730 gene locus_tag LOCUS_17390 444215 444730 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232544.1 protein_id gnl|my_center|LOCUS_17390 444814 444951 gene locus_tag LOCUS_17400 444814 444951 CDS product transcriptional regulator SplA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218541.1 protein_id gnl|my_center|LOCUS_17400 445458 446813 gene locus_tag LOCUS_17410 gene mgtE 445458 446813 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_17410 447188 446856 gene locus_tag LOCUS_17420 gene tnrA 447188 446856 CDS product MerR family transcriptional regulator TnrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232541.1 protein_id gnl|my_center|LOCUS_17420 447382 447537 gene locus_tag LOCUS_17430 447382 447537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232538.1 protein_id gnl|my_center|LOCUS_17430 447625 447807 gene locus_tag LOCUS_17440 gene ykoL 447625 447807 CDS product stress response protein YkoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245766.1 protein_id gnl|my_center|LOCUS_17440 447944 448405 gene locus_tag LOCUS_17450 447944 448405 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232536.1 protein_id gnl|my_center|LOCUS_17450 449540 448446 gene locus_tag LOCUS_17460 449540 448446 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245161.1 protein_id gnl|my_center|LOCUS_17460 449539 450183 gene locus_tag LOCUS_17470 449539 450183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245777.1 protein_id gnl|my_center|LOCUS_17470 451023 450211 gene locus_tag LOCUS_17480 451023 450211 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245342.1 protein_id gnl|my_center|LOCUS_17480 451221 452915 gene locus_tag LOCUS_17490 451221 452915 CDS product DUF6044 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245165.1 protein_id gnl|my_center|LOCUS_17490 452928 453941 gene locus_tag LOCUS_17500 452928 453941 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_17500 455919 454084 gene locus_tag LOCUS_17510 455919 454084 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886495.1 protein_id gnl|my_center|LOCUS_17510 456807 455923 gene locus_tag LOCUS_17520 456807 455923 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_17520 459298 456896 gene locus_tag LOCUS_17530 459298 456896 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967094.1 protein_id gnl|my_center|LOCUS_17530 459507 460142 gene locus_tag LOCUS_17540 459507 460142 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967095.1 protein_id gnl|my_center|LOCUS_17540 460402 461196 gene locus_tag LOCUS_17550 460402 461196 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 protein_id gnl|my_center|LOCUS_17550 461460 462215 gene locus_tag LOCUS_17560 gene sigI 461460 462215 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 protein_id gnl|my_center|LOCUS_17560 462212 462382 gene locus_tag LOCUS_17570 462212 462382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 462415 463392 gene locus_tag LOCUS_17580 gene rsgI 462415 463392 CDS product anti-sigma-I factor RsgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244727.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17580 463597 463403 gene locus_tag LOCUS_17590 gene sspD 463597 463403 CDS product acid-soluble spore protein SspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218568.1 protein_id gnl|my_center|LOCUS_17590 464430 463729 gene locus_tag LOCUS_17600 gene htpK 464430 463729 CDS product transcriptional regulator HtpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245220.1 protein_id gnl|my_center|LOCUS_17600 464600 465496 gene locus_tag LOCUS_17610 gene htpX 464600 465496 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245353.1 protein_id gnl|my_center|LOCUS_17610 465671 467020 gene locus_tag LOCUS_17620 gene ktrD 465671 467020 CDS product Ktr system potassium transporter KtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244672.1 protein_id gnl|my_center|LOCUS_17620 467176 467331 gene locus_tag LOCUS_17630 467176 467331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232510.1 protein_id gnl|my_center|LOCUS_17630 467334 467504 gene locus_tag LOCUS_17640 467334 467504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245411.1 protein_id gnl|my_center|LOCUS_17640 468568 467546 gene locus_tag LOCUS_17650 468568 467546 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245573.1 protein_id gnl|my_center|LOCUS_17650 468821 471037 gene locus_tag LOCUS_17660 gene kinE 468821 471037 CDS product sporulation two-component system sensor histidine kinase KinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232504.1 protein_id gnl|my_center|LOCUS_17660 471034 471531 gene locus_tag LOCUS_17670 gene ogt 471034 471531 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232502.1 protein_id gnl|my_center|LOCUS_17670 471621 471746 gene locus_tag LOCUS_17680 471621 471746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 472841 471780 gene locus_tag LOCUS_17690 gene mtnA 472841 471780 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232498.1 protein_id gnl|my_center|LOCUS_17690 474042 472849 gene locus_tag LOCUS_17700 gene mtnK 474042 472849 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 protein_id gnl|my_center|LOCUS_17700 475165 474386 gene locus_tag LOCUS_17710 475165 474386 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232495.1 protein_id gnl|my_center|LOCUS_17710 475260 476453 gene locus_tag LOCUS_17720 gene mtnE 475260 476453 CDS product methionine-glutamine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244774.1 protein_id gnl|my_center|LOCUS_17720 476680 477891 gene locus_tag LOCUS_17730 gene mtnW 476680 477891 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_17730 477888 478595 gene locus_tag LOCUS_17740 gene mtnX 477888 478595 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_17740 478553 479182 gene locus_tag LOCUS_17750 478553 479182 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 protein_id gnl|my_center|LOCUS_17750 479197 479733 gene locus_tag LOCUS_17760 gene mtnD 479197 479733 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244952.1 protein_id gnl|my_center|LOCUS_17760 480097 479777 gene locus_tag LOCUS_17770 480097 479777 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232481.1 protein_id gnl|my_center|LOCUS_17770 480300 480557 gene locus_tag LOCUS_17780 gene spo0E 480300 480557 CDS product aspartyl-phosphate phosphatase Spo0E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218598.1 protein_id gnl|my_center|LOCUS_17780 480643 481074 gene locus_tag LOCUS_17790 480643 481074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245685.1 protein_id gnl|my_center|LOCUS_17790 482604 481102 gene locus_tag LOCUS_17800 gene kinD 482604 481102 CDS product sporulation kinase KinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886497.1 protein_id gnl|my_center|LOCUS_17800 482815 483252 gene locus_tag LOCUS_17810 gene mhqR 482815 483252 CDS product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 protein_id gnl|my_center|LOCUS_17810 484076 483291 gene locus_tag LOCUS_17820 gene motB 484076 483291 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 protein_id gnl|my_center|LOCUS_17820 484860 484048 gene locus_tag LOCUS_17830 gene motA 484860 484048 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 protein_id gnl|my_center|LOCUS_17830 487349 485250 gene locus_tag LOCUS_17840 gene clpE 487349 485250 CDS product ATP-dependent protease ATP-binding subunit ClpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967104.1 protein_id gnl|my_center|LOCUS_17840 487716 488759 gene locus_tag LOCUS_17850 487716 488759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_17850 489074 489733 gene locus_tag LOCUS_17860 gene queC 489074 489733 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245417.1 protein_id gnl|my_center|LOCUS_17860 489735 490175 gene locus_tag LOCUS_17870 gene queD 489735 490175 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 protein_id gnl|my_center|LOCUS_17870 490168 490899 gene locus_tag LOCUS_17880 gene queE 490168 490899 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232460.1 protein_id gnl|my_center|LOCUS_17880 490917 491414 gene locus_tag LOCUS_17890 gene queF 490917 491414 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_17890 491813 491682 gene locus_tag LOCUS_17900 491813 491682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 492046 492288 gene locus_tag LOCUS_17910 492046 492288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 492329 492619 gene locus_tag LOCUS_17920 492329 492619 CDS product YkvR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245399.1 protein_id gnl|my_center|LOCUS_17920 492925 492740 gene locus_tag LOCUS_17930 492925 492740 CDS product YkvS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232446.1 protein_id gnl|my_center|LOCUS_17930 493090 493284 gene locus_tag LOCUS_17940 493090 493284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218622.1 protein_id gnl|my_center|LOCUS_17940 493583 494212 gene locus_tag LOCUS_17950 493583 494212 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232442.1 protein_id gnl|my_center|LOCUS_17950 494330 495667 gene locus_tag LOCUS_17960 gene ykvU 494330 495667 CDS product sporulation protein YkvU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245552.1 protein_id gnl|my_center|LOCUS_17960 495721 496215 gene locus_tag LOCUS_17970 gene stoA 495721 496215 CDS product sporulation thiol-disulfide oxidoreductase StoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245444.1 protein_id gnl|my_center|LOCUS_17970 496200 496358 gene locus_tag LOCUS_17980 496200 496358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 496450 498363 gene locus_tag LOCUS_17990 gene pfeT 496450 498363 CDS product metal-transporting ATPase PfeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245873.1 protein_id gnl|my_center|LOCUS_17990 498769 499863 gene locus_tag LOCUS_18000 gene papB 498769 499863 CDS product di/tri-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244662.1 protein_id gnl|my_center|LOCUS_18000 500039 499914 gene locus_tag LOCUS_18010 500039 499914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 500144 501109 gene locus_tag LOCUS_18020 500144 501109 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244772.1 protein_id gnl|my_center|LOCUS_18020 501193 502038 gene locus_tag LOCUS_18030 gene glcT 501193 502038 CDS product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967114.1 protein_id gnl|my_center|LOCUS_18030 502268 504367 gene locus_tag LOCUS_18040 gene ptsG 502268 504367 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244661.1 protein_id gnl|my_center|LOCUS_18040 504466 504732 gene locus_tag LOCUS_18050 504466 504732 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 protein_id gnl|my_center|LOCUS_18050 504732 506444 gene locus_tag LOCUS_18060 gene ptsP 504732 506444 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_18060 506536 506775 gene locus_tag LOCUS_18070 gene splA 506536 506775 CDS product splAB operon transcriptional regulator SplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218644.1 protein_id gnl|my_center|LOCUS_18070 506853 507881 gene locus_tag LOCUS_18080 gene splB 506853 507881 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 protein_id gnl|my_center|LOCUS_18080 508575 507895 gene locus_tag LOCUS_18090 508575 507895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 protein_id gnl|my_center|LOCUS_18090 508712 510679 gene locus_tag LOCUS_18100 gene mcpC 508712 510679 CDS product methyl-accepting chemotaxis protein McpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245443.1 protein_id gnl|my_center|LOCUS_18100 510823 511689 gene locus_tag LOCUS_18110 510823 511689 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_18110 512521 511730 gene locus_tag LOCUS_18120 512521 511730 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244693.1 protein_id gnl|my_center|LOCUS_18120 512859 514979 gene locus_tag LOCUS_18130 512859 514979 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245075.1 protein_id gnl|my_center|LOCUS_18130 515144 516964 gene locus_tag LOCUS_18140 gene kinA 515144 516964 CDS product sporulation kinase KinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245779.1 protein_id gnl|my_center|LOCUS_18140 518155 516974 gene locus_tag LOCUS_18150 518155 516974 CDS product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 protein_id gnl|my_center|LOCUS_18150 518518 518357 gene locus_tag LOCUS_18160 518518 518357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245246.1 protein_id gnl|my_center|LOCUS_18160 518725 519636 gene locus_tag LOCUS_18170 gene cheV 518725 519636 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 protein_id gnl|my_center|LOCUS_18170 520142 519678 gene locus_tag LOCUS_18180 520142 519678 CDS product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232406.1 protein_id gnl|my_center|LOCUS_18180 521560 520268 gene locus_tag LOCUS_18190 521560 520268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245267.1 protein_id gnl|my_center|LOCUS_18190 522139 521636 gene locus_tag LOCUS_18200 522139 521636 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886500.1 protein_id gnl|my_center|LOCUS_18200 523048 522188 gene locus_tag LOCUS_18210 523048 522188 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232400.1 protein_id gnl|my_center|LOCUS_18210 523190 523954 gene locus_tag LOCUS_18220 gene fadH 523190 523954 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232398.1 protein_id gnl|my_center|LOCUS_18220 524018 525241 gene locus_tag LOCUS_18230 524018 525241 CDS product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 protein_id gnl|my_center|LOCUS_18230 525860 526099 gene locus_tag LOCUS_18240 525860 526099 CDS product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218671.1 protein_id gnl|my_center|LOCUS_18240 526208 526726 gene locus_tag LOCUS_18250 526208 526726 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232389.1 protein_id gnl|my_center|LOCUS_18250 526866 527057 gene locus_tag LOCUS_18260 gene abbA 526866 527057 CDS product AbrB antirepressor AbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886502.1 protein_id gnl|my_center|LOCUS_18260 527196 527639 gene locus_tag LOCUS_18270 527196 527639 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218674.1 protein_id gnl|my_center|LOCUS_18270 527786 528667 gene locus_tag LOCUS_18280 gene ccpC 527786 528667 CDS product transcriptional regulator CcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232387.1 protein_id gnl|my_center|LOCUS_18280 528778 529254 gene locus_tag LOCUS_18290 528778 529254 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232386.1 protein_id gnl|my_center|LOCUS_18290 529244 530137 gene locus_tag LOCUS_18300 529244 530137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232385.1 protein_id gnl|my_center|LOCUS_18300 530153 530608 gene locus_tag LOCUS_18310 530153 530608 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245242.1 protein_id gnl|my_center|LOCUS_18310 530714 531424 gene locus_tag LOCUS_18320 gene dapD 530714 531424 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 protein_id gnl|my_center|LOCUS_18320 531494 532618 gene locus_tag LOCUS_18330 531494 532618 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232383.1 protein_id gnl|my_center|LOCUS_18330 532680 532925 gene locus_tag LOCUS_18340 532680 532925 CDS product YkuS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232382.1 protein_id gnl|my_center|LOCUS_18340 533764 532961 gene locus_tag LOCUS_18350 gene mscT 533764 532961 CDS product small-conductance mechanosensitive channel protein MscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244994.1 protein_id gnl|my_center|LOCUS_18350 533821 534027 gene locus_tag LOCUS_18360 533821 534027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 534009 534551 gene locus_tag LOCUS_18370 gene ahpA 534009 534551 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_18370 534621 535079 gene locus_tag LOCUS_18380 gene ykuV 534621 535079 CDS product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 protein_id gnl|my_center|LOCUS_18380 535527 536114 gene locus_tag LOCUS_18390 gene rok 535527 536114 CDS product transcriptional regulator Rok inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232378.1 protein_id gnl|my_center|LOCUS_18390 537119 536154 gene locus_tag LOCUS_18400 gene cse15 537119 536154 CDS product spore protein Cse15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245018.1 protein_id gnl|my_center|LOCUS_18400 537255 537854 gene locus_tag LOCUS_18410 537255 537854 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232376.1 protein_id gnl|my_center|LOCUS_18410 537905 538924 gene locus_tag LOCUS_18420 537905 538924 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232375.1 protein_id gnl|my_center|LOCUS_18420 538942 540234 gene locus_tag LOCUS_18430 538942 540234 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232372.1 protein_id gnl|my_center|LOCUS_18430 540201 540716 gene locus_tag LOCUS_18440 gene mobB 540201 540716 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232370.1 protein_id gnl|my_center|LOCUS_18440 540716 541189 gene locus_tag LOCUS_18450 540716 541189 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_18450 541182 541415 gene locus_tag LOCUS_18460 gene moaD 541182 541415 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232366.1 protein_id gnl|my_center|LOCUS_18460 541641 543398 gene locus_tag LOCUS_18470 541641 543398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_18470 543409 545223 gene locus_tag LOCUS_18480 543409 545223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_18480 545338 546033 gene locus_tag LOCUS_18490 gene yknW 545338 546033 CDS product toxin SDP protection protein YknW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232360.1 protein_id gnl|my_center|LOCUS_18490 546038 547171 gene locus_tag LOCUS_18500 546038 547171 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244902.1 protein_id gnl|my_center|LOCUS_18500 547172 547864 gene locus_tag LOCUS_18510 gene yknY 547172 547864 CDS product ABC transporter ATP-binding protein YknY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232356.1 protein_id gnl|my_center|LOCUS_18510 547861 549054 gene locus_tag LOCUS_18520 gene skiZ 547861 549054 CDS product sporulation-delaying-protein transporter subunit SkiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232354.1 protein_id gnl|my_center|LOCUS_18520 549334 550089 gene locus_tag LOCUS_18530 549334 550089 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245688.1 protein_id gnl|my_center|LOCUS_18530 550086 550997 gene locus_tag LOCUS_18540 gene pfkB 550086 550997 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 protein_id gnl|my_center|LOCUS_18540 551012 552919 gene locus_tag LOCUS_18550 551012 552919 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232350.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence066 4632 3086 gene locus_tag LOCUS_r00050 4632 3086 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence067 144 725 gene locus_tag LOCUS_18560 gene lepB 144 725 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232348.1 protein_id gnl|my_center|LOCUS_18560 1030 761 gene locus_tag LOCUS_18570 1030 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232345.1 protein_id gnl|my_center|LOCUS_18570 1212 2831 gene locus_tag LOCUS_18580 1212 2831 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_18580 2893 3804 gene locus_tag LOCUS_18590 2893 3804 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245639.1 protein_id gnl|my_center|LOCUS_18590 5067 3835 gene locus_tag LOCUS_18600 5067 3835 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_18600 5311 5177 gene locus_tag LOCUS_18610 5311 5177 CDS product protein YkpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238865.1 protein_id gnl|my_center|LOCUS_18610 6432 5413 gene locus_tag LOCUS_18620 gene mreBH 6432 5413 CDS product cell shape-determining protein MreBH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245743.1 protein_id gnl|my_center|LOCUS_18620 6701 6979 gene locus_tag LOCUS_18630 gene abhA 6701 6979 CDS product transcriptional regulator AbhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244728.1 protein_id gnl|my_center|LOCUS_18630 7172 8458 gene locus_tag LOCUS_18640 gene kinC 7172 8458 CDS product two-component sensor histidine kinase KinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232333.1 protein_id gnl|my_center|LOCUS_18640 8475 9302 gene locus_tag LOCUS_18650 8475 9302 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245146.1 protein_id gnl|my_center|LOCUS_18650 9374 10039 gene locus_tag LOCUS_18660 gene ktrC 9374 10039 CDS product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 protein_id gnl|my_center|LOCUS_18660 10197 11930 gene locus_tag LOCUS_18670 gene ade 10197 11930 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245362.1 protein_id gnl|my_center|LOCUS_18670 13633 11966 gene locus_tag LOCUS_18680 gene rnjA 13633 11966 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245660.1 protein_id gnl|my_center|LOCUS_18680 13848 13639 gene locus_tag LOCUS_18690 gene rnpZA 13848 13639 CDS product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 protein_id gnl|my_center|LOCUS_18690 14231 15004 gene locus_tag LOCUS_18700 14231 15004 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_18700 15593 15039 gene locus_tag LOCUS_18710 gene def 15593 15039 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245474.1 protein_id gnl|my_center|LOCUS_18710 15855 15703 gene locus_tag LOCUS_18720 15855 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 16067 16738 gene locus_tag LOCUS_18730 16067 16738 CDS product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967146.1 protein_id gnl|my_center|LOCUS_18730 17161 18276 gene locus_tag LOCUS_18740 gene pdhA 17161 18276 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_18740 18280 19257 gene locus_tag LOCUS_18750 gene pdhB 18280 19257 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 protein_id gnl|my_center|LOCUS_18750 19373 20701 gene locus_tag LOCUS_18760 gene pdhC 19373 20701 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 protein_id gnl|my_center|LOCUS_18760 20706 22118 gene locus_tag LOCUS_18770 gene lpdA 20706 22118 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_18770 22538 22164 gene locus_tag LOCUS_18780 gene slp 22538 22164 CDS product peptidoglycan-associated lipoprotein Slp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245672.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence068 <1 530 gene locus_tag LOCUS_18790 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989424.1:IS3 family transposase >Feature sequence069 >Feature sequence070 849 517 gene locus_tag LOCUS_18800 849 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 >Feature sequence071 >Feature sequence072 170 95 gene locus_tag LOCUS_t00600 170 95 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 254 178 gene locus_tag LOCUS_t00610 254 178 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 357 281 gene locus_tag LOCUS_t00620 357 281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 464 390 gene locus_tag LOCUS_t00630 464 390 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 598 526 gene locus_tag LOCUS_t00640 598 526 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 675 601 gene locus_tag LOCUS_t00650 675 601 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 47 157 gene locus_tag LOCUS_r00060 47 157 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 183 258 gene locus_tag LOCUS_t00660 183 258 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 263 338 gene locus_tag LOCUS_t00670 263 338 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 376 451 gene locus_tag LOCUS_t00680 376 451 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 458 540 gene locus_tag LOCUS_t00690 458 540 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 581 655 gene locus_tag LOCUS_t00700 581 655 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 670 755 gene locus_tag LOCUS_t00710 670 755 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 765 841 gene locus_tag LOCUS_t00720 765 841 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 868 944 gene locus_tag LOCUS_t00730 868 944 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 952 1027 gene locus_tag LOCUS_t00740 952 1027 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 128 53 gene locus_tag LOCUS_t00750 128 53 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 216 140 gene locus_tag LOCUS_t00760 216 140 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 1891 392 gene locus_tag LOCUS_18810 gene lysS 1891 392 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_18810 2984 1983 gene locus_tag LOCUS_18820 gene dusB 2984 1983 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_18820 3216 2998 gene locus_tag LOCUS_18830 3216 2998 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226678.1 protein_id gnl|my_center|LOCUS_18830 3671 3168 gene locus_tag LOCUS_18840 gene folK 3671 3168 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242690.1 protein_id gnl|my_center|LOCUS_18840 4030 3668 gene locus_tag LOCUS_18850 gene folB 4030 3668 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_18850 4880 4023 gene locus_tag LOCUS_18860 gene folP 4880 4023 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242672.1 protein_id gnl|my_center|LOCUS_18860 5746 4862 gene locus_tag LOCUS_18870 gene pabC 5746 4862 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244544.1 protein_id gnl|my_center|LOCUS_18870 6327 5743 gene locus_tag LOCUS_18880 gene pabA 6327 5743 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243797.1 protein_id gnl|my_center|LOCUS_18880 7750 6341 gene locus_tag LOCUS_18890 7750 6341 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242468.1 protein_id gnl|my_center|LOCUS_18890 8841 7915 gene locus_tag LOCUS_18900 gene cysK 8841 7915 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_18900 9810 8917 gene locus_tag LOCUS_18910 9810 8917 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243824.1 protein_id gnl|my_center|LOCUS_18910 10735 9860 gene locus_tag LOCUS_18920 gene hslO 10735 9860 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_18920 11523 10747 gene locus_tag LOCUS_18930 11523 10747 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_18930 13629 11716 gene locus_tag LOCUS_18940 gene ftsH 13629 11716 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 protein_id gnl|my_center|LOCUS_18940 14269 13727 gene locus_tag LOCUS_18950 gene hpt 14269 13727 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 protein_id gnl|my_center|LOCUS_18950 15684 14266 gene locus_tag LOCUS_18960 gene tilS 15684 14266 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_18960 16804 15788 gene locus_tag LOCUS_18970 gene prkT 16804 15788 CDS product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 protein_id gnl|my_center|LOCUS_18970 17507 16770 gene locus_tag LOCUS_18980 17507 16770 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 protein_id gnl|my_center|LOCUS_18980 20075 17592 gene locus_tag LOCUS_18990 gene spoIIE 20075 17592 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_18990 20347 20272 gene locus_tag LOCUS_t00770 20347 20272 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20432 20356 gene locus_tag LOCUS_t00780 20432 20356 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20987 20601 gene locus_tag LOCUS_19000 20987 20601 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 protein_id gnl|my_center|LOCUS_19000 21445 21068 gene locus_tag LOCUS_19010 gene divIC 21445 21068 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243211.1 protein_id gnl|my_center|LOCUS_19010 22098 21463 gene locus_tag LOCUS_19020 gene yabQ 22098 21463 CDS product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243260.1 protein_id gnl|my_center|LOCUS_19020 22397 22095 gene locus_tag LOCUS_19030 gene yabP 22397 22095 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226714.1 protein_id gnl|my_center|LOCUS_19030 22736 22476 gene locus_tag LOCUS_19040 22736 22476 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_19040 24208 22739 gene locus_tag LOCUS_19050 gene mazG 24208 22739 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226718.1 protein_id gnl|my_center|LOCUS_19050 25796 24198 gene locus_tag LOCUS_19060 25796 24198 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243709.1 protein_id gnl|my_center|LOCUS_19060 26514 25978 gene locus_tag LOCUS_19070 gene spoVT 26514 25978 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218365.1 protein_id gnl|my_center|LOCUS_19070 30183 26650 gene locus_tag LOCUS_19080 gene mfd 30183 26650 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_19080 30483 30253 gene locus_tag LOCUS_19090 gene fin 30483 30253 CDS product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 protein_id gnl|my_center|LOCUS_19090 31109 30543 gene locus_tag LOCUS_19100 gene pth 31109 30543 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_19100 31833 31216 gene locus_tag LOCUS_19110 31833 31216 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 protein_id gnl|my_center|LOCUS_19110 32871 31918 gene locus_tag LOCUS_19120 32871 31918 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_19120 34264 32894 gene locus_tag LOCUS_19130 gene glmU 34264 32894 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_19130 34750 34457 gene locus_tag LOCUS_19140 gene spoVG 34750 34457 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966269.1 protein_id gnl|my_center|LOCUS_19140 35323 34946 gene locus_tag LOCUS_19150 35323 34946 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226738.1 protein_id gnl|my_center|LOCUS_19150 36177 35320 gene locus_tag LOCUS_19160 gene purR 36177 35320 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218342.1 protein_id gnl|my_center|LOCUS_19160 37111 36233 gene locus_tag LOCUS_19170 gene ispE 37111 36233 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_19170 37435 37250 gene locus_tag LOCUS_19180 37435 37250 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218333.1 protein_id gnl|my_center|LOCUS_19180 37854 37594 gene locus_tag LOCUS_19190 37854 37594 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 protein_id gnl|my_center|LOCUS_19190 38955 38065 gene locus_tag LOCUS_19200 gene prtG 38955 38065 CDS product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 protein_id gnl|my_center|LOCUS_19200 39977 39099 gene locus_tag LOCUS_19210 gene rsmA 39977 39099 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_19210 40530 39970 gene locus_tag LOCUS_19220 gene rnmV 40530 39970 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 protein_id gnl|my_center|LOCUS_19220 41898 40675 gene locus_tag LOCUS_19230 41898 40675 CDS product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 protein_id gnl|my_center|LOCUS_19230 42911 42144 gene locus_tag LOCUS_19240 42911 42144 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_19240 44984 42990 gene locus_tag LOCUS_19250 gene metG 44984 42990 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226758.1 protein_id gnl|my_center|LOCUS_19250 45485 45769 gene locus_tag LOCUS_19260 gene abrB 45485 45769 CDS product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 protein_id gnl|my_center|LOCUS_19260 46696 45818 gene locus_tag LOCUS_19270 gene rsmI 46696 45818 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 protein_id gnl|my_center|LOCUS_19270 46970 46671 gene locus_tag LOCUS_19280 46970 46671 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242983.1 protein_id gnl|my_center|LOCUS_19280 47700 46957 gene locus_tag LOCUS_19290 47700 46957 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 protein_id gnl|my_center|LOCUS_19290 48118 47759 gene locus_tag LOCUS_19300 gene yabA 48118 47759 CDS product replication initiation-control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218308.1 protein_id gnl|my_center|LOCUS_19300 48960 48133 gene locus_tag LOCUS_19310 gene ricT 48960 48133 CDS product competence/sporulation regulator complex protein RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243571.1 protein_id gnl|my_center|LOCUS_19310 49952 48963 gene locus_tag LOCUS_19320 gene holB 49952 48963 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_19320 50404 49964 gene locus_tag LOCUS_19330 50404 49964 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_19330 50746 50417 gene locus_tag LOCUS_19340 gene darA 50746 50417 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_19340 51459 50821 gene locus_tag LOCUS_19350 gene tmk 51459 50821 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_19350 52898 51456 gene locus_tag LOCUS_19360 52898 51456 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 protein_id gnl|my_center|LOCUS_19360 54137 52980 gene locus_tag LOCUS_19370 54137 52980 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 protein_id gnl|my_center|LOCUS_19370 54770 54156 gene locus_tag LOCUS_19380 54770 54156 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242630.1 protein_id gnl|my_center|LOCUS_19380 55097 54903 gene locus_tag LOCUS_19390 gene csfB 55097 54903 CDS product anti-sigma-G factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243294.1 protein_id gnl|my_center|LOCUS_19390 55388 55278 gene locus_tag LOCUS_r00070 55388 55278 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence076 >Feature sequence077 >Feature sequence078 250 167 gene locus_tag LOCUS_t00790 250 167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 413 331 gene locus_tag LOCUS_t00800 413 331 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 >Feature sequence080 >Feature sequence081 >Feature sequence082 >Feature sequence083 >Feature sequence084 1023 1289 gene locus_tag LOCUS_19400 1023 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1485 1658 gene locus_tag LOCUS_19410 1485 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1861 2211 gene locus_tag LOCUS_19420 1861 2211 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 protein_id gnl|my_center|LOCUS_19420 3595 3005 gene locus_tag LOCUS_19430 3595 3005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518846.1 protein_id gnl|my_center|LOCUS_19430 4415 3567 gene locus_tag LOCUS_19440 4415 3567 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435498.1 protein_id gnl|my_center|LOCUS_19440 4830 4597 gene locus_tag LOCUS_19450 4830 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19450 6107 6613 gene locus_tag LOCUS_19460 6107 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19460 6601 7095 gene locus_tag LOCUS_19470 6601 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19470 7085 7357 gene locus_tag LOCUS_19480 7085 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 7615 8346 gene locus_tag LOCUS_19490 gene bglS 7615 8346 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244531.1 protein_id gnl|my_center|LOCUS_19490 9475 8990 gene locus_tag LOCUS_19500 9475 8990 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246042.1 protein_id gnl|my_center|LOCUS_19500 9679 11115 gene locus_tag LOCUS_19510 9679 11115 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 protein_id gnl|my_center|LOCUS_19510 11703 11371 gene locus_tag LOCUS_19520 gene csaA 11703 11371 CDS product chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399582.1 protein_id gnl|my_center|LOCUS_19520 12487 11768 gene locus_tag LOCUS_19530 12487 11768 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886529.1 protein_id gnl|my_center|LOCUS_19530 13008 12508 gene locus_tag LOCUS_19540 13008 12508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231298.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19540 13780 13205 gene locus_tag LOCUS_19550 13780 13205 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399277.1 protein_id gnl|my_center|LOCUS_19550 14141 13791 gene locus_tag LOCUS_19560 14141 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 14491 14114 gene locus_tag LOCUS_19570 14491 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 15022 14540 gene locus_tag LOCUS_19580 15022 14540 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231292.1 protein_id gnl|my_center|LOCUS_19580 16014 15076 gene locus_tag LOCUS_19590 16014 15076 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231290.1 protein_id gnl|my_center|LOCUS_19590 16212 16757 gene locus_tag LOCUS_19600 gene csk22 16212 16757 CDS product mother cell-specific sporulation protein Csk22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399253.1 protein_id gnl|my_center|LOCUS_19600 17103 16783 gene locus_tag LOCUS_19610 gene czrA 17103 16783 CDS product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 protein_id gnl|my_center|LOCUS_19610 17297 17974 gene locus_tag LOCUS_19620 17297 17974 CDS product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231283.1 protein_id gnl|my_center|LOCUS_19620 18602 18066 gene locus_tag LOCUS_19630 18602 18066 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_19630 19522 18740 gene locus_tag LOCUS_19640 19522 18740 CDS product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399450.1 protein_id gnl|my_center|LOCUS_19640 19692 20189 gene locus_tag LOCUS_19650 19692 20189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399390.1 protein_id gnl|my_center|LOCUS_19650 20253 21230 gene locus_tag LOCUS_19660 20253 21230 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399250.1 protein_id gnl|my_center|LOCUS_19660 21397 22455 gene locus_tag LOCUS_19670 gene desE 21397 22455 CDS product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 protein_id gnl|my_center|LOCUS_19670 22579 23691 gene locus_tag LOCUS_19680 gene desK 22579 23691 CDS product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 protein_id gnl|my_center|LOCUS_19680 23710 24309 gene locus_tag LOCUS_19690 gene desR 23710 24309 CDS product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 protein_id gnl|my_center|LOCUS_19690 25852 24344 gene locus_tag LOCUS_19700 25852 24344 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_19700 26980 26117 gene locus_tag LOCUS_19710 26980 26117 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231267.1 protein_id gnl|my_center|LOCUS_19710 29002 27227 gene locus_tag LOCUS_19720 gene recQ 29002 27227 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399229.1 protein_id gnl|my_center|LOCUS_19720 30186 29560 gene locus_tag LOCUS_19730 gene azoJ 30186 29560 CDS product FMN-dependent NADH-azoreductase AzoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231260.1 protein_id gnl|my_center|LOCUS_19730 30828 30337 gene locus_tag LOCUS_19740 30828 30337 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231259.1 protein_id gnl|my_center|LOCUS_19740 31354 31010 gene locus_tag LOCUS_19750 31354 31010 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220141.1 protein_id gnl|my_center|LOCUS_19750 31766 31563 gene locus_tag LOCUS_19760 31766 31563 CDS product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231245.1 protein_id gnl|my_center|LOCUS_19760 31997 33484 gene locus_tag LOCUS_19770 gene dhaS 31997 33484 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_19770 33584 35482 gene locus_tag LOCUS_19780 gene sqhC 33584 35482 CDS product sporulenol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399534.1 protein_id gnl|my_center|LOCUS_19780 35472 36317 gene locus_tag LOCUS_19790 35472 36317 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399227.1 protein_id gnl|my_center|LOCUS_19790 37687 36350 gene locus_tag LOCUS_19800 37687 36350 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399312.1 protein_id gnl|my_center|LOCUS_19800 37918 38883 gene locus_tag LOCUS_19810 37918 38883 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_19810 40186 38933 gene locus_tag LOCUS_19820 gene odhB 40186 38933 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399364.1 protein_id gnl|my_center|LOCUS_19820 43036 40202 gene locus_tag LOCUS_19830 gene sucA 43036 40202 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 protein_id gnl|my_center|LOCUS_19830 45180 43264 gene locus_tag LOCUS_19840 45180 43264 CDS product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399326.1 protein_id gnl|my_center|LOCUS_19840 46081 45191 gene locus_tag LOCUS_19850 46081 45191 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886530.1 protein_id gnl|my_center|LOCUS_19850 46759 46169 gene locus_tag LOCUS_19860 46759 46169 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399243.1 protein_id gnl|my_center|LOCUS_19860 46938 46738 gene locus_tag LOCUS_19870 46938 46738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 48088 46853 gene locus_tag LOCUS_19880 gene cwlS 48088 46853 CDS product D-gamma-glutamyl-meso-diaminopimelic acid endopeptidase CwlS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399265.1 protein_id gnl|my_center|LOCUS_19880 49685 48468 gene locus_tag LOCUS_19890 49685 48468 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399256.1 protein_id gnl|my_center|LOCUS_19890 50534 49920 gene locus_tag LOCUS_19900 gene cdaS 50534 49920 CDS product cyclic di-AMP synthase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886531.1 protein_id gnl|my_center|LOCUS_19900 50810 52168 gene locus_tag LOCUS_19910 50810 52168 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 protein_id gnl|my_center|LOCUS_19910 52184 53032 gene locus_tag LOCUS_19920 gene rsbRC 52184 53032 CDS product RsbT co-antagonist RsbRC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231216.1 protein_id gnl|my_center|LOCUS_19920 53723 53058 gene locus_tag LOCUS_19930 gene bshB2 53723 53058 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231215.1 protein_id gnl|my_center|LOCUS_19930 54092 53742 gene locus_tag LOCUS_19940 54092 53742 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231213.1 protein_id gnl|my_center|LOCUS_19940 54367 54089 gene locus_tag LOCUS_19950 54367 54089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231211.1 protein_id gnl|my_center|LOCUS_19950 55339 54443 gene locus_tag LOCUS_19960 gene rarD 55339 54443 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231209.1 protein_id gnl|my_center|LOCUS_19960 55438 55899 gene locus_tag LOCUS_19970 gene gerT 55438 55899 CDS product spore germination protein GerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231207.1 protein_id gnl|my_center|LOCUS_19970 56169 55933 gene locus_tag LOCUS_19980 56169 55933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 56593 56982 gene locus_tag LOCUS_19990 56593 56982 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 protein_id gnl|my_center|LOCUS_19990 57738 57400 gene locus_tag LOCUS_20000 gene yodB 57738 57400 CDS product transcriptional regulator YodB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399427.1 protein_id gnl|my_center|LOCUS_20000 57868 58476 gene locus_tag LOCUS_20010 57868 58476 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 protein_id gnl|my_center|LOCUS_20010 59122 58520 gene locus_tag LOCUS_20020 59122 58520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231194.1 protein_id gnl|my_center|LOCUS_20020 59959 59138 gene locus_tag LOCUS_20030 59959 59138 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231191.1 protein_id gnl|my_center|LOCUS_20030 60233 60433 gene locus_tag LOCUS_20040 60233 60433 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231189.1 protein_id gnl|my_center|LOCUS_20040 60433 61923 gene locus_tag LOCUS_20050 60433 61923 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399269.1 protein_id gnl|my_center|LOCUS_20050 63358 61958 gene locus_tag LOCUS_20060 gene ctpA 63358 61958 CDS product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 protein_id gnl|my_center|LOCUS_20060 63511 64212 gene locus_tag LOCUS_20070 63511 64212 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399589.1 protein_id gnl|my_center|LOCUS_20070 64300 64551 gene locus_tag LOCUS_20080 64300 64551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231182.1 protein_id gnl|my_center|LOCUS_20080 65455 64634 gene locus_tag LOCUS_20090 gene ldcB 65455 64634 CDS product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 protein_id gnl|my_center|LOCUS_20090 66239 65538 gene locus_tag LOCUS_20100 gene deoD 66239 65538 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231176.1 protein_id gnl|my_center|LOCUS_20100 66442 66567 gene locus_tag LOCUS_20110 66442 66567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231174.1 protein_id gnl|my_center|LOCUS_20110 66920 66606 gene locus_tag LOCUS_20120 gene yodL 66920 66606 CDS product shape determination protein YodL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399431.1 protein_id gnl|my_center|LOCUS_20120 67592 66981 gene locus_tag LOCUS_20130 gene pgpB 67592 66981 CDS product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 protein_id gnl|my_center|LOCUS_20130 67849 67673 gene locus_tag LOCUS_20140 67849 67673 CDS product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231166.1 protein_id gnl|my_center|LOCUS_20140 67971 68114 gene locus_tag LOCUS_20150 67971 68114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231164.1 protein_id gnl|my_center|LOCUS_20150 68791 68111 gene locus_tag LOCUS_20160 68791 68111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231162.1 protein_id gnl|my_center|LOCUS_20160 69171 68947 gene locus_tag LOCUS_20170 69171 68947 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 protein_id gnl|my_center|LOCUS_20170 69536 69258 gene locus_tag LOCUS_20180 69536 69258 CDS product YokU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399539.1 protein_id gnl|my_center|LOCUS_20180 70948 69533 gene locus_tag LOCUS_20190 gene ablA 70948 69533 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399420.1 protein_id gnl|my_center|LOCUS_20190 71805 70978 gene locus_tag LOCUS_20200 gene ablB 71805 70978 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399564.1 protein_id gnl|my_center|LOCUS_20200 73087 71783 gene locus_tag LOCUS_20210 73087 71783 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_20210 73755 73102 gene locus_tag LOCUS_20220 73755 73102 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399417.1 protein_id gnl|my_center|LOCUS_20220 74429 73740 gene locus_tag LOCUS_20230 74429 73740 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230839.1 protein_id gnl|my_center|LOCUS_20230 75770 74436 gene locus_tag LOCUS_20240 75770 74436 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230836.1 protein_id gnl|my_center|LOCUS_20240 76872 76093 gene locus_tag LOCUS_20250 gene cgeE 76872 76093 CDS product spore maturation N-acetyltransferase CgeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230830.1 protein_id gnl|my_center|LOCUS_20250 78181 76901 gene locus_tag LOCUS_20260 gene cgeD 78181 76901 CDS product spore maturation glycosyltransferase CgeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230828.1 protein_id gnl|my_center|LOCUS_20260 78551 78246 gene locus_tag LOCUS_20270 gene cgeC 78551 78246 CDS product spore maturation protein CgeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230826.1 protein_id gnl|my_center|LOCUS_20270 78757 79143 gene locus_tag LOCUS_20280 gene cgeA 78757 79143 CDS product spore crust protein CgeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230824.1 protein_id gnl|my_center|LOCUS_20280 79150 80103 gene locus_tag LOCUS_20290 gene cgeB 79150 80103 CDS product spore maturation protein CgeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399421.1 protein_id gnl|my_center|LOCUS_20290 81305 80157 gene locus_tag LOCUS_20300 81305 80157 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 protein_id gnl|my_center|LOCUS_20300 81671 82696 gene locus_tag LOCUS_20310 81671 82696 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289359.1 protein_id gnl|my_center|LOCUS_20310 83174 82740 gene locus_tag LOCUS_20320 gene msrB 83174 82740 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230813.1 protein_id gnl|my_center|LOCUS_20320 83708 83175 gene locus_tag LOCUS_20330 gene msrA 83708 83175 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230812.1 protein_id gnl|my_center|LOCUS_20330 83840 84265 gene locus_tag LOCUS_20340 83840 84265 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398634.1 protein_id gnl|my_center|LOCUS_20340 85654 84317 gene locus_tag LOCUS_20350 85654 84317 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398532.1 protein_id gnl|my_center|LOCUS_20350 85922 85728 gene locus_tag LOCUS_20360 gene ypmT 85922 85728 CDS product protein YpmT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230808.1 protein_id gnl|my_center|LOCUS_20360 86498 85935 gene locus_tag LOCUS_20370 86498 85935 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230807.1 protein_id gnl|my_center|LOCUS_20370 87275 86508 gene locus_tag LOCUS_20380 87275 86508 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245956.1 protein_id gnl|my_center|LOCUS_20380 87934 87353 gene locus_tag LOCUS_20390 gene scuA 87934 87353 CDS product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 protein_id gnl|my_center|LOCUS_20390 88338 88087 gene locus_tag LOCUS_20400 88338 88087 CDS product DUF2535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399020.1 protein_id gnl|my_center|LOCUS_20400 89693 88425 gene locus_tag LOCUS_20410 gene ilvA 89693 88425 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 protein_id gnl|my_center|LOCUS_20410 89942 90937 gene locus_tag LOCUS_20420 89942 90937 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399025.1 protein_id gnl|my_center|LOCUS_20420 90958 91599 gene locus_tag LOCUS_20430 90958 91599 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_20430 92252 91632 gene locus_tag LOCUS_20440 92252 91632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398497.1 protein_id gnl|my_center|LOCUS_20440 92759 92253 gene locus_tag LOCUS_20450 gene dfrA 92759 92253 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_20450 93550 92756 gene locus_tag LOCUS_20460 93550 92756 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 protein_id gnl|my_center|LOCUS_20460 94167 93634 gene locus_tag LOCUS_20470 94167 93634 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 protein_id gnl|my_center|LOCUS_20470 94799 94185 gene locus_tag LOCUS_20480 94799 94185 CDS product YpjP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967559.1 protein_id gnl|my_center|LOCUS_20480 95844 95059 gene locus_tag LOCUS_20490 95844 95059 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_20490 96320 95886 gene locus_tag LOCUS_20500 gene brxA 96320 95886 CDS product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 protein_id gnl|my_center|LOCUS_20500 98101 96425 gene locus_tag LOCUS_20510 gene ilvD 98101 96425 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_20510 99525 98392 gene locus_tag LOCUS_20520 99525 98392 CDS product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 protein_id gnl|my_center|LOCUS_20520 100202 99585 gene locus_tag LOCUS_20530 gene hdhQ 100202 99585 CDS product Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230787.1 protein_id gnl|my_center|LOCUS_20530 100697 100215 gene locus_tag LOCUS_20540 100697 100215 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230784.1 protein_id gnl|my_center|LOCUS_20540 101053 101958 gene locus_tag LOCUS_20550 gene metA 101053 101958 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 protein_id gnl|my_center|LOCUS_20550 102189 103337 gene locus_tag LOCUS_20560 102189 103337 CDS product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246153.1 protein_id gnl|my_center|LOCUS_20560 103581 103781 gene locus_tag LOCUS_20570 gene cspD 103581 103781 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 protein_id gnl|my_center|LOCUS_20570 104015 103833 gene locus_tag LOCUS_20580 gene degR 104015 103833 CDS product transcriptional regulator DegR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230774.1 protein_id gnl|my_center|LOCUS_20580 104170 104439 gene locus_tag LOCUS_20590 104170 104439 CDS product DUF2564 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398863.1 protein_id gnl|my_center|LOCUS_20590 104650 104468 gene locus_tag LOCUS_20600 104650 104468 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399003.1 protein_id gnl|my_center|LOCUS_20600 105323 104643 gene locus_tag LOCUS_20610 105323 104643 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230769.1 protein_id gnl|my_center|LOCUS_20610 105406 106095 gene locus_tag LOCUS_20620 105406 106095 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 protein_id gnl|my_center|LOCUS_20620 106095 106550 gene locus_tag LOCUS_20630 106095 106550 CDS product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230765.1 protein_id gnl|my_center|LOCUS_20630 106534 106662 gene locus_tag LOCUS_20640 gene sspL 106534 106662 CDS product small, acid-soluble spore protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218255.1 protein_id gnl|my_center|LOCUS_20640 107560 106670 gene locus_tag LOCUS_20650 gene exnP 107560 106670 CDS product 5'-3' exonuclease ExnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230763.1 protein_id gnl|my_center|LOCUS_20650 107804 107661 gene locus_tag LOCUS_20660 107804 107661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230761.1 protein_id gnl|my_center|LOCUS_20660 108139 107882 gene locus_tag LOCUS_20670 108139 107882 CDS product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230757.1 protein_id gnl|my_center|LOCUS_20670 111785 108204 gene locus_tag LOCUS_20680 gene dynA 111785 108204 CDS product dynamin GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230755.1 protein_id gnl|my_center|LOCUS_20680 112626 112120 gene locus_tag LOCUS_20690 gene bpsB 112626 112120 CDS product alkylpyrone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398552.1 protein_id gnl|my_center|LOCUS_20690 113727 112630 gene locus_tag LOCUS_20700 gene bpsA 113727 112630 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_20700 115116 113800 gene locus_tag LOCUS_20710 gene pbuX 115116 113800 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230748.1 protein_id gnl|my_center|LOCUS_20710 115697 115113 gene locus_tag LOCUS_20720 gene xpt 115697 115113 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230744.1 protein_id gnl|my_center|LOCUS_20720 117537 116032 gene locus_tag LOCUS_20730 gene ypwA 117537 116032 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_20730 118642 117650 gene locus_tag LOCUS_20740 gene kdgT 118642 117650 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230734.1 protein_id gnl|my_center|LOCUS_20740 119276 118686 gene locus_tag LOCUS_20750 gene eda 119276 118686 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230732.1 protein_id gnl|my_center|LOCUS_20750 120252 119278 gene locus_tag LOCUS_20760 gene kdgK 120252 119278 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 protein_id gnl|my_center|LOCUS_20760 121309 120290 gene locus_tag LOCUS_20770 gene kdgR 121309 120290 CDS product pectin utilization transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230725.1 protein_id gnl|my_center|LOCUS_20770 121532 122359 gene locus_tag LOCUS_20780 gene kduI 121532 122359 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230722.1 protein_id gnl|my_center|LOCUS_20780 122361 123125 gene locus_tag LOCUS_20790 gene kduD 122361 123125 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 protein_id gnl|my_center|LOCUS_20790 125093 123168 gene locus_tag LOCUS_20800 125093 123168 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230718.1 protein_id gnl|my_center|LOCUS_20800 125388 125197 gene locus_tag LOCUS_20810 125388 125197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246090.1 protein_id gnl|my_center|LOCUS_20810 126913 125756 gene locus_tag LOCUS_20820 126913 125756 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967571.1 protein_id gnl|my_center|LOCUS_20820 127755 127459 gene locus_tag LOCUS_20830 gene gpsB 127755 127459 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225629.1 protein_id gnl|my_center|LOCUS_20830 128376 127831 gene locus_tag LOCUS_20840 128376 127831 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398656.1 protein_id gnl|my_center|LOCUS_20840 130252 129002 gene locus_tag LOCUS_20850 gene mrfB 130252 129002 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_20850 132515 130266 gene locus_tag LOCUS_20860 gene mrfA 132515 130266 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_20860 133124 132618 gene locus_tag LOCUS_20870 133124 132618 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967573.1 protein_id gnl|my_center|LOCUS_20870 133262 133681 gene locus_tag LOCUS_20880 133262 133681 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398640.1 protein_id gnl|my_center|LOCUS_20880 134070 133702 gene locus_tag LOCUS_20890 134070 133702 CDS product YppG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398696.1 protein_id gnl|my_center|LOCUS_20890 134259 134447 gene locus_tag LOCUS_20900 134259 134447 CDS product YppF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230690.1 protein_id gnl|my_center|LOCUS_20900 134858 134487 gene locus_tag LOCUS_20910 134858 134487 CDS product YppE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246080.1 protein_id gnl|my_center|LOCUS_20910 135149 134904 gene locus_tag LOCUS_20920 135149 134904 CDS product YppD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398488.1 protein_id gnl|my_center|LOCUS_20920 136433 135477 gene locus_tag LOCUS_20930 136433 135477 CDS product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398707.1 protein_id gnl|my_center|LOCUS_20930 136480 137100 gene locus_tag LOCUS_20940 gene recU 136480 137100 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399067.1 protein_id gnl|my_center|LOCUS_20940 137122 139875 gene locus_tag LOCUS_20950 137122 139875 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 protein_id gnl|my_center|LOCUS_20950 140443 139949 gene locus_tag LOCUS_20960 140443 139949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967579.1 protein_id gnl|my_center|LOCUS_20960 141099 140440 gene locus_tag LOCUS_20970 gene nth 141099 140440 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967580.1 protein_id gnl|my_center|LOCUS_20970 141816 141118 gene locus_tag LOCUS_20980 gene dnaD 141816 141118 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 protein_id gnl|my_center|LOCUS_20980 143203 141911 gene locus_tag LOCUS_20990 gene asnS 143203 141911 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_20990 144526 143345 gene locus_tag LOCUS_21000 gene aspB 144526 143345 CDS product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 protein_id gnl|my_center|LOCUS_21000 145034 144549 gene locus_tag LOCUS_21010 gene tseB 145034 144549 CDS product cell wall elongation/penicillin-binding protein regulator TseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230665.1 protein_id gnl|my_center|LOCUS_21010 145213 145043 gene locus_tag LOCUS_21020 145213 145043 CDS product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225588.1 protein_id gnl|my_center|LOCUS_21020 148150 145355 gene locus_tag LOCUS_21030 gene dinG 148150 145355 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398920.1 protein_id gnl|my_center|LOCUS_21030 148659 148276 gene locus_tag LOCUS_21040 gene panD 148659 148276 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_21040 149521 148661 gene locus_tag LOCUS_21050 gene panC 149521 148661 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230656.1 protein_id gnl|my_center|LOCUS_21050 150356 149523 gene locus_tag LOCUS_21060 gene panB 150356 149523 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230652.1 protein_id gnl|my_center|LOCUS_21060 151578 150601 gene locus_tag LOCUS_21070 151578 150601 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_21070 152756 151563 gene locus_tag LOCUS_21080 152756 151563 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230647.1 protein_id gnl|my_center|LOCUS_21080 153894 152761 gene locus_tag LOCUS_21090 gene bshA 153894 152761 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230645.1 protein_id gnl|my_center|LOCUS_21090 154601 153891 gene locus_tag LOCUS_21100 gene bshB1 154601 153891 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230642.1 protein_id gnl|my_center|LOCUS_21100 155007 154594 gene locus_tag LOCUS_21110 gene mgsA 155007 154594 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_21110 155826 155023 gene locus_tag LOCUS_21120 gene dapB 155826 155023 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246190.1 protein_id gnl|my_center|LOCUS_21120 156173 155838 gene locus_tag LOCUS_21130 156173 155838 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 protein_id gnl|my_center|LOCUS_21130 156313 157185 gene locus_tag LOCUS_21140 156313 157185 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230635.1 protein_id gnl|my_center|LOCUS_21140 158016 157222 gene locus_tag LOCUS_21150 gene ypjB 158016 157222 CDS product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230633.1 protein_id gnl|my_center|LOCUS_21150 158642 158085 gene locus_tag LOCUS_21160 158642 158085 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 protein_id gnl|my_center|LOCUS_21160 159556 158789 gene locus_tag LOCUS_21170 159556 158789 CDS product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 protein_id gnl|my_center|LOCUS_21170 160265 159591 gene locus_tag LOCUS_21180 gene qcrB 160265 159591 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 protein_id gnl|my_center|LOCUS_21180 160770 160267 gene locus_tag LOCUS_21190 160770 160267 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 protein_id gnl|my_center|LOCUS_21190 161359 160916 gene locus_tag LOCUS_21200 161359 160916 CDS product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 protein_id gnl|my_center|LOCUS_21200 161953 161414 gene locus_tag LOCUS_21210 161953 161414 CDS product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399171.1 protein_id gnl|my_center|LOCUS_21210 163296 162025 gene locus_tag LOCUS_21220 163296 162025 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230620.1 protein_id gnl|my_center|LOCUS_21220 164931 163645 gene locus_tag LOCUS_21230 gene aroA 164931 163645 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_21230 166058 164943 gene locus_tag LOCUS_21240 166058 164943 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230615.1 protein_id gnl|my_center|LOCUS_21240 167189 166107 gene locus_tag LOCUS_21250 gene hisC 167189 166107 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_21250 168004 167201 gene locus_tag LOCUS_21260 gene trpA 168004 167201 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 protein_id gnl|my_center|LOCUS_21260 169199 167997 gene locus_tag LOCUS_21270 gene trpB 169199 167997 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230605.1 protein_id gnl|my_center|LOCUS_21270 169827 169180 gene locus_tag LOCUS_21280 169827 169180 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 protein_id gnl|my_center|LOCUS_21280 170584 169832 gene locus_tag LOCUS_21290 gene trpC 170584 169832 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886553.1 protein_id gnl|my_center|LOCUS_21290 171593 170577 gene locus_tag LOCUS_21300 gene trpD 171593 170577 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245959.1 protein_id gnl|my_center|LOCUS_21300 173112 171565 gene locus_tag LOCUS_21310 gene trpE 173112 171565 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246124.1 protein_id gnl|my_center|LOCUS_21310 173708 173328 gene locus_tag LOCUS_21320 gene aroH 173708 173328 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 protein_id gnl|my_center|LOCUS_21320 174796 173708 gene locus_tag LOCUS_21330 gene aroB 174796 173708 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230592.1 protein_id gnl|my_center|LOCUS_21330 175968 174796 gene locus_tag LOCUS_21340 gene aroC 175968 174796 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 protein_id gnl|my_center|LOCUS_21340 176813 176043 gene locus_tag LOCUS_21350 gene cheR 176813 176043 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_21350 177499 177053 gene locus_tag LOCUS_21360 gene ndk 177499 177053 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 protein_id gnl|my_center|LOCUS_21360 178664 177618 gene locus_tag LOCUS_21370 gene hepT 178664 177618 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_21370 179307 178606 gene locus_tag LOCUS_21380 gene menG 179307 178606 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230580.1 protein_id gnl|my_center|LOCUS_21380 180069 179314 gene locus_tag LOCUS_21390 gene hepS 180069 179314 CDS product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398550.1 protein_id gnl|my_center|LOCUS_21390 180460 180233 gene locus_tag LOCUS_21400 gene mtrB 180460 180233 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230576.1 protein_id gnl|my_center|LOCUS_21400 181054 180482 gene locus_tag LOCUS_21410 gene folE 181054 180482 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_21410 181520 181242 gene locus_tag LOCUS_21420 gene hbs 181520 181242 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_21420 183373 181895 gene locus_tag LOCUS_21430 gene spoIVA 183373 181895 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_21430 184290 183562 gene locus_tag LOCUS_21440 184290 183562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230571.1 protein_id gnl|my_center|LOCUS_21440 184515 184312 gene locus_tag LOCUS_21450 184515 184312 CDS product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399143.1 protein_id gnl|my_center|LOCUS_21450 185891 184854 gene locus_tag LOCUS_21460 gene gpsA 185891 184854 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_21460 187219 185909 gene locus_tag LOCUS_21470 gene engA 187219 185909 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 protein_id gnl|my_center|LOCUS_21470 187568 187374 gene locus_tag LOCUS_21480 187568 187374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230563.1 protein_id gnl|my_center|LOCUS_21480 188458 187565 gene locus_tag LOCUS_21490 188458 187565 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230562.1 protein_id gnl|my_center|LOCUS_21490 189054 188455 gene locus_tag LOCUS_21500 189054 188455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230560.1 protein_id gnl|my_center|LOCUS_21500 189132 189263 gene locus_tag LOCUS_21510 189132 189263 CDS product YpzI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513900.1 protein_id gnl|my_center|LOCUS_21510 190355 189306 gene locus_tag LOCUS_21520 gene fni 190355 189306 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399098.1 protein_id gnl|my_center|LOCUS_21520 191516 190368 gene locus_tag LOCUS_21530 gene rpsA 191516 190368 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 protein_id gnl|my_center|LOCUS_21530 192425 191751 gene locus_tag LOCUS_21540 gene cmk 192425 191751 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_21540 192680 192504 gene locus_tag LOCUS_21550 192680 192504 CDS product YpfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230553.1 protein_id gnl|my_center|LOCUS_21550 193379 192726 gene locus_tag LOCUS_21560 gene dgrA 193379 192726 CDS product cyclic di-GMP receptor DgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230551.1 protein_id gnl|my_center|LOCUS_21560 194825 193473 gene locus_tag LOCUS_21570 gene ypeB 194825 193473 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230547.1 protein_id gnl|my_center|LOCUS_21570 195772 194861 gene locus_tag LOCUS_21580 gene sleB 195772 194861 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398523.1 protein_id gnl|my_center|LOCUS_21580 196581 195925 gene locus_tag LOCUS_21590 gene prsW 196581 195925 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_21590 197673 196699 gene locus_tag LOCUS_21600 197673 196699 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 protein_id gnl|my_center|LOCUS_21600 199057 197783 gene locus_tag LOCUS_21610 gene gudB 199057 197783 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886557.1 protein_id gnl|my_center|LOCUS_21610 199798 199214 gene locus_tag LOCUS_21620 199798 199214 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 protein_id gnl|my_center|LOCUS_21620 200737 199958 gene locus_tag LOCUS_21630 200737 199958 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230532.1 protein_id gnl|my_center|LOCUS_21630 201264 200821 gene locus_tag LOCUS_21640 201264 200821 CDS product YpbF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230531.1 protein_id gnl|my_center|LOCUS_21640 202079 201327 gene locus_tag LOCUS_21650 202079 201327 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398603.1 protein_id gnl|my_center|LOCUS_21650 202617 202030 gene locus_tag LOCUS_21660 202617 202030 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886558.1 protein_id gnl|my_center|LOCUS_21660 204149 202659 gene locus_tag LOCUS_21670 204149 202659 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230528.1 protein_id gnl|my_center|LOCUS_21670 205200 204142 gene locus_tag LOCUS_21680 205200 204142 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398594.1 protein_id gnl|my_center|LOCUS_21680 205467 205715 gene locus_tag LOCUS_21690 205467 205715 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225461.1 protein_id gnl|my_center|LOCUS_21690 206323 205754 gene locus_tag LOCUS_21700 gene fmnP 206323 205754 CDS product riboflavin transporter FmnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399159.1 protein_id gnl|my_center|LOCUS_21700 206613 206350 gene locus_tag LOCUS_21710 206613 206350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 206817 208394 gene locus_tag LOCUS_21720 gene serA 206817 208394 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398713.1 protein_id gnl|my_center|LOCUS_21720 209205 208438 gene locus_tag LOCUS_21730 gene aroD 209205 208438 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230523.1 protein_id gnl|my_center|LOCUS_21730 210421 209318 gene locus_tag LOCUS_21740 gene rsiX 210421 209318 CDS product anti-sigma-X factor RsiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967642.1 protein_id gnl|my_center|LOCUS_21740 210941 210357 gene locus_tag LOCUS_21750 gene sigX 210941 210357 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_21750 212914 211145 gene locus_tag LOCUS_21760 gene resE 212914 211145 CDS product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 protein_id gnl|my_center|LOCUS_21760 213633 212911 gene locus_tag LOCUS_21770 gene resD 213633 212911 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246107.1 protein_id gnl|my_center|LOCUS_21770 214890 213715 gene locus_tag LOCUS_21780 gene resC 214890 213715 CDS product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 protein_id gnl|my_center|LOCUS_21780 216538 214910 gene locus_tag LOCUS_21790 gene resB 216538 214910 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 protein_id gnl|my_center|LOCUS_21790 217074 216535 gene locus_tag LOCUS_21800 gene resA 217074 216535 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_21800 217903 217169 gene locus_tag LOCUS_21810 gene rluB 217903 217169 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_21810 218531 217995 gene locus_tag LOCUS_21820 gene spmB 218531 217995 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230509.1 protein_id gnl|my_center|LOCUS_21820 219126 218536 gene locus_tag LOCUS_21830 gene spmA 219126 218536 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 protein_id gnl|my_center|LOCUS_21830 220262 219114 gene locus_tag LOCUS_21840 gene dacB 220262 219114 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_21840 220926 220387 gene locus_tag LOCUS_21850 220926 220387 CDS product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399065.1 protein_id gnl|my_center|LOCUS_21850 221574 220981 gene locus_tag LOCUS_21860 gene scpB 221574 220981 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223904.1 protein_id gnl|my_center|LOCUS_21860 222304 221564 gene locus_tag LOCUS_21870 gene scpA 222304 221564 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_21870 222596 223120 gene locus_tag LOCUS_21880 222596 223120 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 protein_id gnl|my_center|LOCUS_21880 223508 223134 gene locus_tag LOCUS_21890 gene ribT 223508 223134 CDS product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 protein_id gnl|my_center|LOCUS_21890 224085 223621 gene locus_tag LOCUS_21900 gene ribH 224085 223621 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 protein_id gnl|my_center|LOCUS_21900 225314 224118 gene locus_tag LOCUS_21910 225314 224118 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398484.1 protein_id gnl|my_center|LOCUS_21910 225976 225329 gene locus_tag LOCUS_21920 gene ribE 225976 225329 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 protein_id gnl|my_center|LOCUS_21920 227072 225987 gene locus_tag LOCUS_21930 gene ribD 227072 225987 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398763.1 protein_id gnl|my_center|LOCUS_21930 227812 227468 gene locus_tag LOCUS_21940 227812 227468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398735.1 protein_id gnl|my_center|LOCUS_21940 228603 228049 gene locus_tag LOCUS_21950 gene lepB 228603 228049 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_21950 229021 229155 gene locus_tag LOCUS_21960 229021 229155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 229320 229114 gene locus_tag LOCUS_21970 229320 229114 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 protein_id gnl|my_center|LOCUS_21970 230285 229854 gene locus_tag LOCUS_21980 230285 229854 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 protein_id gnl|my_center|LOCUS_21980 230331 230519 gene locus_tag LOCUS_21990 230331 230519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 230542 231414 gene locus_tag LOCUS_22000 230542 231414 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_22000 232769 231444 gene locus_tag LOCUS_22010 gene lysA 232769 231444 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_22010 232966 232766 gene locus_tag LOCUS_22020 232966 232766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 234351 232870 gene locus_tag LOCUS_22030 gene spoVAF 234351 232870 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_22030 234913 234296 gene locus_tag LOCUS_22040 gene spoVAEA 234913 234296 CDS product stage V sporulation protein SpoVABEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230469.1 protein_id gnl|my_center|LOCUS_22040 235271 234921 gene locus_tag LOCUS_22050 gene spoVAE 235271 234921 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 protein_id gnl|my_center|LOCUS_22050 236289 235273 gene locus_tag LOCUS_22060 gene spoVAD 236289 235273 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_22060 236754 236302 gene locus_tag LOCUS_22070 gene spoVAC 236754 236302 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_22070 237192 236767 gene locus_tag LOCUS_22080 gene spoVAB 237192 236767 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230463.1 protein_id gnl|my_center|LOCUS_22080 237805 237182 gene locus_tag LOCUS_22090 gene spoVAA 237805 237182 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_22090 238696 237929 gene locus_tag LOCUS_22100 gene sigF 238696 237929 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_22100 239148 238708 gene locus_tag LOCUS_22110 gene spoIIAB 239148 238708 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_22110 239498 239145 gene locus_tag LOCUS_22120 gene spoIIAA 239498 239145 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_22120 240763 239594 gene locus_tag LOCUS_22130 gene dacF 240763 239594 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_22130 241738 240923 gene locus_tag LOCUS_22140 241738 240923 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_22140 242935 241751 gene locus_tag LOCUS_22150 gene deoB 242935 241751 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230444.1 protein_id gnl|my_center|LOCUS_22150 243988 243098 gene locus_tag LOCUS_22160 gene xerD 243988 243098 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_22160 244223 243996 gene locus_tag LOCUS_22170 244223 243996 CDS product YqzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230440.1 protein_id gnl|my_center|LOCUS_22170 244797 244348 gene locus_tag LOCUS_22180 gene fur 244797 244348 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 protein_id gnl|my_center|LOCUS_22180 245554 244910 gene locus_tag LOCUS_22190 gene spoIIM 245554 244910 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398593.1 protein_id gnl|my_center|LOCUS_22190 245871 245656 gene locus_tag LOCUS_22200 245871 245656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246030.1 protein_id gnl|my_center|LOCUS_22200 247292 245973 gene locus_tag LOCUS_22210 247292 245973 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398731.1 protein_id gnl|my_center|LOCUS_22210 248716 247310 gene locus_tag LOCUS_22220 gene mleN 248716 247310 CDS product malate-H+/Na+-lactate antiporter MleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230432.1 protein_id gnl|my_center|LOCUS_22220 250286 248859 gene locus_tag LOCUS_22230 gene aspA 250286 248859 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 protein_id gnl|my_center|LOCUS_22230 251321 250332 gene locus_tag LOCUS_22240 gene ansA 251321 250332 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_22240 251503 251853 gene locus_tag LOCUS_22250 gene ansR 251503 251853 CDS product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399024.1 protein_id gnl|my_center|LOCUS_22250 252038 251862 gene locus_tag LOCUS_22260 252038 251862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence085 >Feature sequence086 >Feature sequence087 389 159 gene locus_tag LOCUS_22270 389 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence088 >Feature sequence089 35 286 gene locus_tag LOCUS_22280 35 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence090 >Feature sequence091 >Feature sequence092 128 268 gene locus_tag LOCUS_22290 128 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22290 >Feature sequence093 >Feature sequence094 194 313 gene locus_tag LOCUS_22300 194 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 329 676 gene locus_tag LOCUS_22310 329 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 609 980 gene locus_tag LOCUS_22320 609 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 973 1356 gene locus_tag LOCUS_22330 973 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1353 1730 gene locus_tag LOCUS_22340 1353 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1734 2348 gene locus_tag LOCUS_22350 1734 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2397 2741 gene locus_tag LOCUS_22360 2397 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2744 2923 gene locus_tag LOCUS_22370 2744 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2936 6814 gene locus_tag LOCUS_22380 2936 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6814 7653 gene locus_tag LOCUS_22390 6814 7653 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911828.1 protein_id gnl|my_center|LOCUS_22390 7665 9371 gene locus_tag LOCUS_22400 7665 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 9408 11303 gene locus_tag LOCUS_22410 9408 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 11319 11627 gene locus_tag LOCUS_22420 11319 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 11624 11794 gene locus_tag LOCUS_22430 11624 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 11807 13597 gene locus_tag LOCUS_22440 11807 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 13610 13981 gene locus_tag LOCUS_22450 13610 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 13981 14154 gene locus_tag LOCUS_22460 13981 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 14210 14422 gene locus_tag LOCUS_22470 14210 14422 CDS product BhlA/UviB family holin-like peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246119.1 protein_id gnl|my_center|LOCUS_22470 14435 14698 gene locus_tag LOCUS_22480 14435 14698 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232653.1 protein_id gnl|my_center|LOCUS_22480 14756 15733 gene locus_tag LOCUS_22490 14756 15733 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244876.1 protein_id gnl|my_center|LOCUS_22490 16357 15800 gene locus_tag LOCUS_22500 16357 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 16562 16425 gene locus_tag LOCUS_22510 16562 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 16922 16728 gene locus_tag LOCUS_22520 16922 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 17577 17014 gene locus_tag LOCUS_22530 17577 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 18575 18030 gene locus_tag LOCUS_22540 gene iseA 18575 18030 CDS product DL-endopeptidase inhibitor IseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399558.1 protein_id gnl|my_center|LOCUS_22540 18862 20253 gene locus_tag LOCUS_22550 18862 20253 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399508.1 protein_id gnl|my_center|LOCUS_22550 20386 21363 gene locus_tag LOCUS_22560 gene galM 20386 21363 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_22560 21396 22871 gene locus_tag LOCUS_22570 gene dacB 21396 22871 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_22570 23842 25044 gene locus_tag LOCUS_22580 gene fabD 23842 25044 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_22580 25065 36980 gene locus_tag LOCUS_22590 25065 36980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 37037 53134 gene locus_tag LOCUS_22600 37037 53134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 53232 61064 gene locus_tag LOCUS_22610 53232 61064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 61234 61626 gene locus_tag LOCUS_22620 61234 61626 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231518.1 protein_id gnl|my_center|LOCUS_22620 61781 63313 gene locus_tag LOCUS_22630 61781 63313 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_22630 63383 63550 gene locus_tag LOCUS_22640 63383 63550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 63820 64962 gene locus_tag LOCUS_22650 63820 64962 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_22650 65005 66654 gene locus_tag LOCUS_22660 65005 66654 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244755.1 protein_id gnl|my_center|LOCUS_22660 66664 67998 gene locus_tag LOCUS_22670 66664 67998 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 protein_id gnl|my_center|LOCUS_22670 68013 68234 gene locus_tag LOCUS_22680 68013 68234 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245519.1 protein_id gnl|my_center|LOCUS_22680 68249 69151 gene locus_tag LOCUS_22690 gene ldeG 68249 69151 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_22690 69169 69951 gene locus_tag LOCUS_22700 69169 69951 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_22700 69968 71497 gene locus_tag LOCUS_22710 69968 71497 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_22710 71667 72866 gene locus_tag LOCUS_22720 gene nrnB 71667 72866 CDS product oligoribonuclease NrnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245472.1 protein_id gnl|my_center|LOCUS_22720 73079 72915 gene locus_tag LOCUS_22730 73079 72915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 73255 73052 gene locus_tag LOCUS_22740 73255 73052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 73415 73735 gene locus_tag LOCUS_22750 73415 73735 CDS product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398710.1 protein_id gnl|my_center|LOCUS_22750 73853 74602 gene locus_tag LOCUS_22760 73853 74602 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_22760 74792 75088 gene locus_tag LOCUS_22770 74792 75088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 75370 75594 gene locus_tag LOCUS_22780 75370 75594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 75557 75685 gene locus_tag LOCUS_22790 75557 75685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 76320 75733 gene locus_tag LOCUS_22800 76320 75733 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231529.1 protein_id gnl|my_center|LOCUS_22800 77290 76400 gene locus_tag LOCUS_22810 gene galU 77290 76400 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245127.1 protein_id gnl|my_center|LOCUS_22810 77742 77314 gene locus_tag LOCUS_22820 77742 77314 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231531.1 protein_id gnl|my_center|LOCUS_22820 78279 78016 gene locus_tag LOCUS_22830 78279 78016 CDS product YnfE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231535.1 protein_id gnl|my_center|LOCUS_22830 79853 78354 gene locus_tag LOCUS_22840 gene eglS 79853 78354 CDS product endo-1,4-beta-glucanase EglS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231540.1 protein_id gnl|my_center|LOCUS_22840 81499 80156 gene locus_tag LOCUS_22850 81499 80156 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231542.1 protein_id gnl|my_center|LOCUS_22850 81995 82348 gene locus_tag LOCUS_22860 81995 82348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014113949.1 protein_id gnl|my_center|LOCUS_22860 82374 82499 gene locus_tag LOCUS_22870 82374 82499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 84967 82547 gene locus_tag LOCUS_22880 gene parC 84967 82547 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_22880 86937 84970 gene locus_tag LOCUS_22890 gene parE 86937 84970 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 protein_id gnl|my_center|LOCUS_22890 87740 87333 gene locus_tag LOCUS_22900 87740 87333 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245606.1 protein_id gnl|my_center|LOCUS_22900 87909 88490 gene locus_tag LOCUS_22910 gene plsY 87909 88490 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 protein_id gnl|my_center|LOCUS_22910 88570 88857 gene locus_tag LOCUS_22920 88570 88857 CDS product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 protein_id gnl|my_center|LOCUS_22920 89187 88888 gene locus_tag LOCUS_22930 89187 88888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 protein_id gnl|my_center|LOCUS_22930 89619 89203 gene locus_tag LOCUS_22940 89619 89203 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 protein_id gnl|my_center|LOCUS_22940 89954 89703 gene locus_tag LOCUS_22950 gene tlp 89954 89703 CDS product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231568.1 protein_id gnl|my_center|LOCUS_22950 90137 89991 gene locus_tag LOCUS_22960 gene sspN 90137 89991 CDS product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231569.1 protein_id gnl|my_center|LOCUS_22960 90327 90202 gene locus_tag LOCUS_22970 90327 90202 CDS product FbpB family small basic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244964.1 protein_id gnl|my_center|LOCUS_22970 90919 90407 gene locus_tag LOCUS_22980 90919 90407 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 protein_id gnl|my_center|LOCUS_22980 93721 90992 gene locus_tag LOCUS_22990 gene acnA 93721 90992 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 protein_id gnl|my_center|LOCUS_22990 93929 94093 gene locus_tag LOCUS_23000 gene sspO 93929 94093 CDS product acid-soluble spore protein SspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244839.1 protein_id gnl|my_center|LOCUS_23000 94125 94271 gene locus_tag LOCUS_23010 94125 94271 CDS product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221237.1 protein_id gnl|my_center|LOCUS_23010 94370 94744 gene locus_tag LOCUS_23020 gene cotM 94370 94744 CDS product outer spore coat protein CotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886520.1 protein_id gnl|my_center|LOCUS_23020 94976 95404 gene locus_tag LOCUS_23030 gene yneK 94976 95404 CDS product DynA interaction protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231580.1 protein_id gnl|my_center|LOCUS_23030 95917 95435 gene locus_tag LOCUS_23040 95917 95435 CDS product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231582.1 protein_id gnl|my_center|LOCUS_23040 96367 96008 gene locus_tag LOCUS_23050 96367 96008 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245707.1 protein_id gnl|my_center|LOCUS_23050 97163 96456 gene locus_tag LOCUS_23060 gene ccdA 97163 96456 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231585.1 protein_id gnl|my_center|LOCUS_23060 97365 97556 gene locus_tag LOCUS_23070 gene ynzD 97365 97556 CDS product aspartyl-phosphate phosphatase YnzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886518.1 protein_id gnl|my_center|LOCUS_23070 97848 97630 gene locus_tag LOCUS_23080 97848 97630 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221221.1 protein_id gnl|my_center|LOCUS_23080 98380 97934 gene locus_tag LOCUS_23090 gene sirA 98380 97934 CDS product sporulation inhibitor of replication protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231591.1 protein_id gnl|my_center|LOCUS_23090 100538 98535 gene locus_tag LOCUS_23100 gene tkt 100538 98535 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_23100 100940 100707 gene locus_tag LOCUS_23110 100940 100707 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 protein_id gnl|my_center|LOCUS_23110 101657 101004 gene locus_tag LOCUS_23120 101657 101004 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231596.1 protein_id gnl|my_center|LOCUS_23120 101987 101676 gene locus_tag LOCUS_23130 gene yneA 101987 101676 CDS product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231598.1 protein_id gnl|my_center|LOCUS_23130 102143 102760 gene locus_tag LOCUS_23140 gene lexA 102143 102760 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_23140 103578 103150 gene locus_tag LOCUS_23150 103578 103150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 104076 103654 gene locus_tag LOCUS_23160 gene fosM 104076 103654 CDS product FosM family fosfomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231604.1 protein_id gnl|my_center|LOCUS_23160 104274 104726 gene locus_tag LOCUS_23170 104274 104726 CDS product YndM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231606.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23170 105507 104749 gene locus_tag LOCUS_23180 gene pghL 105507 104749 CDS product gamma-polyglutamate hydrolase PghL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245793.1 protein_id gnl|my_center|LOCUS_23180 106049 105738 gene locus_tag LOCUS_23190 106049 105738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231610.1 protein_id gnl|my_center|LOCUS_23190 107786 106155 gene locus_tag LOCUS_23200 107786 106155 CDS product YndJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231612.1 protein_id gnl|my_center|LOCUS_23200 108400 107780 gene locus_tag LOCUS_23210 108400 107780 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244960.1 protein_id gnl|my_center|LOCUS_23210 109211 108405 gene locus_tag LOCUS_23220 109211 108405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231618.1 protein_id gnl|my_center|LOCUS_23220 109688 109377 gene locus_tag LOCUS_23230 109688 109377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 110881 109685 gene locus_tag LOCUS_23240 110881 109685 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_23240 111233 111045 gene locus_tag LOCUS_23250 111233 111045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231626.1 protein_id gnl|my_center|LOCUS_23250 111515 111255 gene locus_tag LOCUS_23260 111515 111255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 111670 112104 gene locus_tag LOCUS_23270 111670 112104 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231627.1 protein_id gnl|my_center|LOCUS_23270 112566 112165 gene locus_tag LOCUS_23280 112566 112165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967329.1 protein_id gnl|my_center|LOCUS_23280 113169 113369 gene locus_tag LOCUS_23290 113169 113369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 114142 114861 gene locus_tag LOCUS_23300 114142 114861 CDS product YrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023592782.1 protein_id gnl|my_center|LOCUS_23300 115910 115071 gene locus_tag LOCUS_23310 115910 115071 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_23310 116225 116049 gene locus_tag LOCUS_23320 116225 116049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 116320 116177 gene locus_tag LOCUS_23330 116320 116177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 116554 116396 gene locus_tag LOCUS_23340 116554 116396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 116730 116951 gene locus_tag LOCUS_23350 116730 116951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 117264 117437 gene locus_tag LOCUS_23360 117264 117437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 117996 117562 gene locus_tag LOCUS_23370 gene dutA 117996 117562 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_23370 118488 118027 gene locus_tag LOCUS_23380 118488 118027 CDS product DUF2691 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245293.1 protein_id gnl|my_center|LOCUS_23380 118968 120152 gene locus_tag LOCUS_23390 gene alr 118968 120152 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244881.1 protein_id gnl|my_center|LOCUS_23390 121575 120274 gene locus_tag LOCUS_23400 121575 120274 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886516.1 protein_id gnl|my_center|LOCUS_23400 122311 122754 gene locus_tag LOCUS_23410 122311 122754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23410 123886 123188 gene locus_tag LOCUS_23420 123886 123188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 125733 124234 gene locus_tag LOCUS_23430 gene xylB 125733 124234 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 protein_id gnl|my_center|LOCUS_23430 127242 125905 gene locus_tag LOCUS_23440 gene xylA 127242 125905 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 protein_id gnl|my_center|LOCUS_23440 127501 128655 gene locus_tag LOCUS_23450 127501 128655 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_23450 130425 128824 gene locus_tag LOCUS_23460 gene xynB 130425 128824 CDS product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245202.1 protein_id gnl|my_center|LOCUS_23460 131859 130468 gene locus_tag LOCUS_23470 131859 130468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245259.1 protein_id gnl|my_center|LOCUS_23470 133322 132837 gene locus_tag LOCUS_23480 133322 132837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 133815 133663 gene locus_tag LOCUS_23490 133815 133663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23490 134024 133863 gene locus_tag LOCUS_23500 134024 133863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23500 135181 134342 gene locus_tag LOCUS_23510 135181 134342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 136956 135622 gene locus_tag LOCUS_23520 gene glnA 136956 135622 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 protein_id gnl|my_center|LOCUS_23520 137422 137015 gene locus_tag LOCUS_23530 gene glnR 137422 137015 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 protein_id gnl|my_center|LOCUS_23530 138797 137532 gene locus_tag LOCUS_23540 138797 137532 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_23540 140182 138815 gene locus_tag LOCUS_23550 gene hflX 140182 138815 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 protein_id gnl|my_center|LOCUS_23550 141176 140211 gene locus_tag LOCUS_23560 gene spoVK 141176 140211 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_23560 141413 141210 gene locus_tag LOCUS_23570 141413 141210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 141975 142742 gene locus_tag LOCUS_23580 gene cwlC 141975 142742 CDS product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 protein_id gnl|my_center|LOCUS_23580 143426 142806 gene locus_tag LOCUS_23590 143426 142806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 protein_id gnl|my_center|LOCUS_23590 144464 143475 gene locus_tag LOCUS_23600 gene nrdF 144464 143475 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231754.1 protein_id gnl|my_center|LOCUS_23600 146584 144482 gene locus_tag LOCUS_23610 gene nrdE 146584 144482 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245700.1 protein_id gnl|my_center|LOCUS_23610 146936 146544 gene locus_tag LOCUS_23620 gene nrdI 146936 146544 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231758.1 protein_id gnl|my_center|LOCUS_23620 147410 147180 gene locus_tag LOCUS_23630 147410 147180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245262.1 protein_id gnl|my_center|LOCUS_23630 147764 147492 gene locus_tag LOCUS_23640 147764 147492 CDS product YmzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245879.1 protein_id gnl|my_center|LOCUS_23640 148181 147960 gene locus_tag LOCUS_23650 gene hfq 148181 147960 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221097.1 protein_id gnl|my_center|LOCUS_23650 149165 148221 gene locus_tag LOCUS_23660 gene miaA 149165 148221 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_23660 149669 149265 gene locus_tag LOCUS_23670 149669 149265 CDS product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231769.1 protein_id gnl|my_center|LOCUS_23670 149768 150016 gene locus_tag LOCUS_23680 149768 150016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 150159 150476 gene locus_tag LOCUS_23690 gene ebrA 150159 150476 CDS product multidrug efflux SMR transporter subunit EbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967307.1 protein_id gnl|my_center|LOCUS_23690 150490 150843 gene locus_tag LOCUS_23700 gene ebrB 150490 150843 CDS product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 protein_id gnl|my_center|LOCUS_23700 151307 150855 gene locus_tag LOCUS_23710 151307 150855 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 protein_id gnl|my_center|LOCUS_23710 152089 151382 gene locus_tag LOCUS_23720 152089 151382 CDS product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245758.1 protein_id gnl|my_center|LOCUS_23720 152818 154146 gene locus_tag LOCUS_23730 gene aprX 152818 154146 CDS product serine protease AprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967303.1 protein_id gnl|my_center|LOCUS_23730 154249 155073 gene locus_tag LOCUS_23740 154249 155073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244800.1 protein_id gnl|my_center|LOCUS_23740 155152 155508 gene locus_tag LOCUS_23750 155152 155508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245436.1 protein_id gnl|my_center|LOCUS_23750 155745 156962 gene locus_tag LOCUS_23760 155745 156962 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 protein_id gnl|my_center|LOCUS_23760 164636 157005 gene locus_tag LOCUS_23770 164636 157005 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245624.1 protein_id gnl|my_center|LOCUS_23770 181195 164651 gene locus_tag LOCUS_23780 181195 164651 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886514.1 protein_id gnl|my_center|LOCUS_23780 193967 181185 gene locus_tag LOCUS_23790 gene pksM 193967 181185 CDS product polyketide synthase PksM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245093.1 protein_id gnl|my_center|LOCUS_23790 207653 193983 gene locus_tag LOCUS_23800 gene pksL 207653 193983 CDS product polyketide synthase PksL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886513.1 protein_id gnl|my_center|LOCUS_23800 222795 207655 gene locus_tag LOCUS_23810 gene pksJ 222795 207655 CDS product polyketide synthase PksJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245563.1 protein_id gnl|my_center|LOCUS_23810 223590 222841 gene locus_tag LOCUS_23820 223590 222841 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231800.1 protein_id gnl|my_center|LOCUS_23820 224400 223630 gene locus_tag LOCUS_23830 224400 223630 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 protein_id gnl|my_center|LOCUS_23830 225659 224397 gene locus_tag LOCUS_23840 gene pksG 225659 224397 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 protein_id gnl|my_center|LOCUS_23840 226907 225660 gene locus_tag LOCUS_23850 gene pksF 226907 225660 CDS product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245287.1 protein_id gnl|my_center|LOCUS_23850 227133 226885 gene locus_tag LOCUS_23860 227133 226885 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231809.1 protein_id gnl|my_center|LOCUS_23860 229502 227220 gene locus_tag LOCUS_23870 gene fabD 229502 227220 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231811.1 protein_id gnl|my_center|LOCUS_23870 230473 229499 gene locus_tag LOCUS_23880 230473 229499 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231814.1 protein_id gnl|my_center|LOCUS_23880 230823 230674 gene locus_tag LOCUS_23890 230823 230674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 231844 230978 gene locus_tag LOCUS_23900 gene fabD 231844 230978 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231821.1 protein_id gnl|my_center|LOCUS_23900 232899 232222 gene locus_tag LOCUS_23910 232899 232222 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231824.1 protein_id gnl|my_center|LOCUS_23910 233705 233088 gene locus_tag LOCUS_23920 233705 233088 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_23920 233826 234383 gene locus_tag LOCUS_23930 233826 234383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 protein_id gnl|my_center|LOCUS_23930 234529 234984 gene locus_tag LOCUS_23940 234529 234984 CDS product regulatory YrvL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231830.1 protein_id gnl|my_center|LOCUS_23940 235753 235001 gene locus_tag LOCUS_23950 235753 235001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 238077 236191 gene locus_tag LOCUS_23960 gene mutL 238077 236191 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 protein_id gnl|my_center|LOCUS_23960 240670 238094 gene locus_tag LOCUS_23970 gene mutS 240670 238094 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 protein_id gnl|my_center|LOCUS_23970 241348 240803 gene locus_tag LOCUS_23980 gene cotE 241348 240803 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_23980 242039 241608 gene locus_tag LOCUS_23990 gene ricA 242039 241608 CDS product regulatory iron-sulfur-containing complex subunit RicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231834.1 protein_id gnl|my_center|LOCUS_23990 243570 242041 gene locus_tag LOCUS_24000 gene miaB 243570 242041 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_24000 244893 243715 gene locus_tag LOCUS_24010 244893 243715 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_24010 245950 244907 gene locus_tag LOCUS_24020 gene tdh 245950 244907 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_24020 246476 246216 gene locus_tag LOCUS_24030 gene spoVS 246476 246216 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_24030 247469 246675 gene locus_tag LOCUS_24040 gene ymdB 247469 246675 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_24040 249101 247539 gene locus_tag LOCUS_24050 gene rny 249101 247539 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 protein_id gnl|my_center|LOCUS_24050 250552 249377 gene locus_tag LOCUS_24060 250552 249377 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245877.1 protein_id gnl|my_center|LOCUS_24060 251768 250722 gene locus_tag LOCUS_24070 gene recA 251768 250722 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_24070 253191 251941 gene locus_tag LOCUS_24080 253191 251941 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231847.1 protein_id gnl|my_center|LOCUS_24080 253790 253209 gene locus_tag LOCUS_24090 gene pgsA 253790 253209 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 protein_id gnl|my_center|LOCUS_24090 254755 253841 gene locus_tag LOCUS_24100 gene rodZ 254755 253841 CDS product cell shape determination protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886511.1 protein_id gnl|my_center|LOCUS_24100 255565 254774 gene locus_tag LOCUS_24110 255565 254774 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_24110 255952 255695 gene locus_tag LOCUS_24120 255952 255695 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245199.1 protein_id gnl|my_center|LOCUS_24120 256761 256033 gene locus_tag LOCUS_24130 gene efpI 256761 256033 CDS product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 protein_id gnl|my_center|LOCUS_24130 258100 256814 gene locus_tag LOCUS_24140 258100 256814 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 protein_id gnl|my_center|LOCUS_24140 259377 258097 gene locus_tag LOCUS_24150 259377 258097 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_24150 260840 259629 gene locus_tag LOCUS_24160 gene bcbE 260840 259629 CDS product bacillibactin exporter BcbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886509.1 protein_id gnl|my_center|LOCUS_24160 261703 260978 gene locus_tag LOCUS_24170 261703 260978 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245732.1 protein_id gnl|my_center|LOCUS_24170 264210 261847 gene locus_tag LOCUS_24180 gene spoIIIE 264210 261847 CDS product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 protein_id gnl|my_center|LOCUS_24180 264552 264340 gene locus_tag LOCUS_24190 gene tepJ 264552 264340 CDS product TepA modulator TepJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231871.1 protein_id gnl|my_center|LOCUS_24190 265286 264549 gene locus_tag LOCUS_24200 gene tepA 265286 264549 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_24200 267070 265403 gene locus_tag LOCUS_24210 gene rnjB 267070 265403 CDS product ribonuclease J2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231875.1 protein_id gnl|my_center|LOCUS_24210 268121 267249 gene locus_tag LOCUS_24220 gene dapA 268121 267249 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_24220 269366 268152 gene locus_tag LOCUS_24230 gene dapG 269366 268152 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245524.1 protein_id gnl|my_center|LOCUS_24230 270498 269458 gene locus_tag LOCUS_24240 gene asd 270498 269458 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244674.1 protein_id gnl|my_center|LOCUS_24240 271226 270624 gene locus_tag LOCUS_24250 gene dpaB 271226 270624 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244650.1 protein_id gnl|my_center|LOCUS_24250 272122 271229 gene locus_tag LOCUS_24260 gene dpaA 272122 271229 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 protein_id gnl|my_center|LOCUS_24260 272572 272315 gene locus_tag LOCUS_24270 272572 272315 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231890.1 protein_id gnl|my_center|LOCUS_24270 273880 272651 gene locus_tag LOCUS_24280 273880 272651 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_24280 274879 273920 gene locus_tag LOCUS_24290 274879 273920 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 protein_id gnl|my_center|LOCUS_24290 277114 274997 gene locus_tag LOCUS_24300 gene pnp 277114 274997 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_24300 277556 277287 gene locus_tag LOCUS_24310 gene rpsO 277556 277287 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_24310 278663 277713 gene locus_tag LOCUS_24320 gene ribF 278663 277713 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 protein_id gnl|my_center|LOCUS_24320 279611 278682 gene locus_tag LOCUS_24330 gene truB 279611 278682 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_24330 280047 279694 gene locus_tag LOCUS_24340 gene rbfA 280047 279694 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_24340 282486 280339 gene locus_tag LOCUS_24350 gene infB 282486 280339 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 protein_id gnl|my_center|LOCUS_24350 282808 282506 gene locus_tag LOCUS_24360 282808 282506 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 protein_id gnl|my_center|LOCUS_24360 283085 282810 gene locus_tag LOCUS_24370 gene rulR 283085 282810 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_24370 284217 283099 gene locus_tag LOCUS_24380 gene nusA 284217 283099 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_24380 284722 284252 gene locus_tag LOCUS_24390 gene rimP 284722 284252 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_24390 289416 285052 gene locus_tag LOCUS_24400 289416 285052 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_24400 291168 289474 gene locus_tag LOCUS_24410 gene proS 291168 289474 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_24410 292463 291201 gene locus_tag LOCUS_24420 gene rseP 292463 291201 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886508.1 protein_id gnl|my_center|LOCUS_24420 293627 292476 gene locus_tag LOCUS_24430 gene dxr 293627 292476 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 protein_id gnl|my_center|LOCUS_24430 294489 293689 gene locus_tag LOCUS_24440 gene cdsA 294489 293689 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_24440 295284 294502 gene locus_tag LOCUS_24450 295284 294502 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 protein_id gnl|my_center|LOCUS_24450 295972 295415 gene locus_tag LOCUS_24460 gene frr 295972 295415 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_24460 296696 295974 gene locus_tag LOCUS_24470 gene pyrH 296696 295974 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220923.1 protein_id gnl|my_center|LOCUS_24470 297723 296842 gene locus_tag LOCUS_24480 gene tsf 297723 296842 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_24480 298565 297825 gene locus_tag LOCUS_24490 gene rpsB 298565 297825 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_24490 299212 298709 gene locus_tag LOCUS_24500 gene swrB 299212 298709 CDS product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 protein_id gnl|my_center|LOCUS_24500 300005 299241 gene locus_tag LOCUS_24510 gene sigD 300005 299241 CDS product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 protein_id gnl|my_center|LOCUS_24510 300528 300028 gene locus_tag LOCUS_24520 gene cheD 300528 300028 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_24520 301154 300525 gene locus_tag LOCUS_24530 gene cheC 301154 300525 CDS product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 protein_id gnl|my_center|LOCUS_24530 301643 301173 gene locus_tag LOCUS_24540 gene cheW 301643 301173 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231938.1 protein_id gnl|my_center|LOCUS_24540 303680 301665 gene locus_tag LOCUS_24550 gene cheA 303680 301665 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_24550 304756 303686 gene locus_tag LOCUS_24560 gene cheB 304756 303686 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_24560 305648 304758 gene locus_tag LOCUS_24570 gene flhG 305648 304758 CDS product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 protein_id gnl|my_center|LOCUS_24570 306745 305645 gene locus_tag LOCUS_24580 gene flhF 306745 305645 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 protein_id gnl|my_center|LOCUS_24580 308778 306745 gene locus_tag LOCUS_24590 gene flhA 308778 306745 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_24590 309893 308811 gene locus_tag LOCUS_24600 gene flhB 309893 308811 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_24600 310477 309893 gene locus_tag LOCUS_24610 310477 309893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 310949 310680 gene locus_tag LOCUS_24620 gene fliQ 310949 310680 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_24620 311629 310964 gene locus_tag LOCUS_24630 gene fliP 311629 310964 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_24630 312281 311622 gene locus_tag LOCUS_24640 gene fliZ 312281 311622 CDS product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231958.1 protein_id gnl|my_center|LOCUS_24640 312658 312296 gene locus_tag LOCUS_24650 gene cheY 312658 312296 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_24650 313823 312684 gene locus_tag LOCUS_24660 gene fliY 313823 312684 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_24660 314811 313813 gene locus_tag LOCUS_24670 gene fliM 314811 313813 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_24670 315270 314845 gene locus_tag LOCUS_24680 gene fliL 315270 314845 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 protein_id gnl|my_center|LOCUS_24680 315482 315267 gene locus_tag LOCUS_24690 gene swrD 315482 315267 CDS product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 protein_id gnl|my_center|LOCUS_24690 316316 315522 gene locus_tag LOCUS_24700 gene flgG 316316 315522 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_24700 316760 316338 gene locus_tag LOCUS_24710 gene flgD 316760 316338 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231970.1 protein_id gnl|my_center|LOCUS_24710 318220 316757 gene locus_tag LOCUS_24720 318220 316757 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231973.1 protein_id gnl|my_center|LOCUS_24720 318846 318232 gene locus_tag LOCUS_24730 318846 318232 CDS product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231975.1 protein_id gnl|my_center|LOCUS_24730 319301 318858 gene locus_tag LOCUS_24740 gene fliJ 319301 318858 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231977.1 protein_id gnl|my_center|LOCUS_24740 320620 319304 gene locus_tag LOCUS_24750 gene fliI 320620 319304 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 protein_id gnl|my_center|LOCUS_24750 321369 320617 gene locus_tag LOCUS_24760 gene fliH 321369 320617 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967242.1 protein_id gnl|my_center|LOCUS_24760 322378 321362 gene locus_tag LOCUS_24770 gene fliG 322378 321362 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_24770 324001 322391 gene locus_tag LOCUS_24780 gene fliF 324001 322391 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 protein_id gnl|my_center|LOCUS_24780 324373 324047 gene locus_tag LOCUS_24790 gene fliE 324373 324047 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 protein_id gnl|my_center|LOCUS_24790 324831 324379 gene locus_tag LOCUS_24800 gene flgC 324831 324379 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_24800 325220 324831 gene locus_tag LOCUS_24810 gene flgB 325220 324831 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 protein_id gnl|my_center|LOCUS_24810 326380 325601 gene locus_tag LOCUS_24820 gene codY 326380 325601 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 protein_id gnl|my_center|LOCUS_24820 326677 326420 gene locus_tag LOCUS_24830 326677 326420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24830 327812 326652 gene locus_tag LOCUS_24840 gene hslU 327812 326652 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 328374 327829 gene locus_tag LOCUS_24850 gene clpQ 328374 327829 CDS product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 protein_id gnl|my_center|LOCUS_24850 329301 328387 gene locus_tag LOCUS_24860 gene xerC 329301 328387 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 protein_id gnl|my_center|LOCUS_24860 330676 329369 gene locus_tag LOCUS_24870 gene trmFO 330676 329369 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_24870 332827 330752 gene locus_tag LOCUS_24880 gene topA 332827 330752 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_24880 333907 333014 gene locus_tag LOCUS_24890 gene dprA 333907 333014 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245871.1 protein_id gnl|my_center|LOCUS_24890 334870 333968 gene locus_tag LOCUS_24900 gene sucD 334870 333968 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_24900 336056 334899 gene locus_tag LOCUS_24910 gene sucC 336056 334899 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_24910 336511 336230 gene locus_tag LOCUS_24920 336511 336230 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232001.1 protein_id gnl|my_center|LOCUS_24920 338238 336508 gene locus_tag LOCUS_24930 338238 336508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245096.1 protein_id gnl|my_center|LOCUS_24930 339034 338267 gene locus_tag LOCUS_24940 gene rnhB 339034 338267 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 protein_id gnl|my_center|LOCUS_24940 339953 339105 gene locus_tag LOCUS_24950 gene ylqF 339953 339105 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_24950 340445 340098 gene locus_tag LOCUS_24960 gene rplS 340445 340098 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_24960 341316 340585 gene locus_tag LOCUS_24970 gene trmD 341316 340585 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967234.1 protein_id gnl|my_center|LOCUS_24970 341837 341313 gene locus_tag LOCUS_24980 gene rimM 341837 341313 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232013.1 protein_id gnl|my_center|LOCUS_24980 342228 341842 gene locus_tag LOCUS_24990 342228 341842 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232015.1 protein_id gnl|my_center|LOCUS_24990 342595 342350 gene locus_tag LOCUS_25000 342595 342350 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232017.1 protein_id gnl|my_center|LOCUS_25000 342867 342595 gene locus_tag LOCUS_25010 gene rpsP 342867 342595 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_25010 344313 342973 gene locus_tag LOCUS_25020 gene ffh 344313 342973 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_25020 344659 344327 gene locus_tag LOCUS_25030 344659 344327 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238590.1 protein_id gnl|my_center|LOCUS_25030 344838 345323 gene locus_tag LOCUS_25040 344838 345323 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245834.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence095 >Feature sequence096 >Feature sequence097 >Feature sequence098 >Feature sequence099 518 69 gene locus_tag LOCUS_25050 518 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25050 >Feature sequence100 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 203 499 gene locus_tag LOCUS_25060 203 499 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232015.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25060 >Feature sequence105 846 34 gene locus_tag LOCUS_25070 846 34 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229090.1 protein_id gnl|my_center|LOCUS_25070 1603 821 gene locus_tag LOCUS_25080 1603 821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229092.1 protein_id gnl|my_center|LOCUS_25080 2620 1616 gene locus_tag LOCUS_25090 2620 1616 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245977.1 protein_id gnl|my_center|LOCUS_25090 2770 3543 gene locus_tag LOCUS_25100 2770 3543 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246204.1 protein_id gnl|my_center|LOCUS_25100 3595 3837 gene locus_tag LOCUS_25110 3595 3837 CDS product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398611.1 protein_id gnl|my_center|LOCUS_25110 5459 3876 gene locus_tag LOCUS_25120 gene pckA 5459 3876 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229100.1 protein_id gnl|my_center|LOCUS_25120 5964 7166 gene locus_tag LOCUS_25130 gene metK 5964 7166 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_25130 7315 9213 gene locus_tag LOCUS_25140 gene asnB 7315 9213 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 protein_id gnl|my_center|LOCUS_25140 9353 10744 gene locus_tag LOCUS_25150 gene alaP 9353 10744 CDS product alanine permease AlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229105.1 protein_id gnl|my_center|LOCUS_25150 11519 11004 gene locus_tag LOCUS_25160 11519 11004 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399093.1 protein_id gnl|my_center|LOCUS_25160 11568 12347 gene locus_tag LOCUS_25170 gene ytpA 11568 12347 CDS product phospholipase YtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398545.1 protein_id gnl|my_center|LOCUS_25170 12368 13474 gene locus_tag LOCUS_25180 gene tbcS 12368 13474 CDS product tetraprenyl-beta-curcumene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399076.1 protein_id gnl|my_center|LOCUS_25180 14048 13464 gene locus_tag LOCUS_25190 14048 13464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398483.1 protein_id gnl|my_center|LOCUS_25190 15016 14045 gene locus_tag LOCUS_25200 15016 14045 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 protein_id gnl|my_center|LOCUS_25200 15178 15450 gene locus_tag LOCUS_25210 15178 15450 CDS product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229117.1 protein_id gnl|my_center|LOCUS_25210 15777 16169 gene locus_tag LOCUS_25220 gene ytrA 15777 16169 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_25220 16162 17040 gene locus_tag LOCUS_25230 gene ytrB 16162 17040 CDS product ABC transporter ATP-binding protein YtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398506.1 protein_id gnl|my_center|LOCUS_25230 17034 18020 gene locus_tag LOCUS_25240 gene ytrC 17034 18020 CDS product ABC transporter permease YtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246175.1 protein_id gnl|my_center|LOCUS_25240 18050 19027 gene locus_tag LOCUS_25250 gene ytrD 18050 19027 CDS product ABC transporter permease YtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398887.1 protein_id gnl|my_center|LOCUS_25250 19042 19737 gene locus_tag LOCUS_25260 gene ytrE 19042 19737 CDS product ABC transporter ATP-binding protein YtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229129.1 protein_id gnl|my_center|LOCUS_25260 19727 21037 gene locus_tag LOCUS_25270 gene ytrF 19727 21037 CDS product ABC transporter permease YtrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398682.1 protein_id gnl|my_center|LOCUS_25270 21135 21830 gene locus_tag LOCUS_25280 gene bceR 21135 21830 CDS product two-component response regulator BceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399109.1 protein_id gnl|my_center|LOCUS_25280 21823 22827 gene locus_tag LOCUS_25290 gene bceS 21823 22827 CDS product two-component sensor histidine kinase BceS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398652.1 protein_id gnl|my_center|LOCUS_25290 22929 23690 gene locus_tag LOCUS_25300 gene bceA 22929 23690 CDS product bacitracin ABC transporter ATP-binding protein BceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229137.1 protein_id gnl|my_center|LOCUS_25300 23680 25620 gene locus_tag LOCUS_25310 gene bceB 23680 25620 CDS product bacitracin ABC transporter permease BceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229139.1 protein_id gnl|my_center|LOCUS_25310 26403 25657 gene locus_tag LOCUS_25320 26403 25657 CDS product LMBR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229141.1 protein_id gnl|my_center|LOCUS_25320 26593 27786 gene locus_tag LOCUS_25330 26593 27786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398741.1 protein_id gnl|my_center|LOCUS_25330 28603 27818 gene locus_tag LOCUS_25340 28603 27818 CDS product blue-light photoreceptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399022.1 protein_id gnl|my_center|LOCUS_25340 29003 29332 gene locus_tag LOCUS_25350 29003 29332 CDS product DUF4257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246114.1 protein_id gnl|my_center|LOCUS_25350 29760 32174 gene locus_tag LOCUS_25360 gene leuS 29760 32174 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_25360 32289 32600 gene locus_tag LOCUS_25370 32289 32600 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 protein_id gnl|my_center|LOCUS_25370 33921 32623 gene locus_tag LOCUS_25380 gene melA 33921 32623 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_25380 34771 33941 gene locus_tag LOCUS_25390 34771 33941 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 protein_id gnl|my_center|LOCUS_25390 35679 34768 gene locus_tag LOCUS_25400 35679 34768 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968010.1 protein_id gnl|my_center|LOCUS_25400 36953 35676 gene locus_tag LOCUS_25410 36953 35676 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398680.1 protein_id gnl|my_center|LOCUS_25410 38021 36987 gene locus_tag LOCUS_25420 38021 36987 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398480.1 protein_id gnl|my_center|LOCUS_25420 38239 39138 gene locus_tag LOCUS_25430 38239 39138 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_25430 39423 39728 gene locus_tag LOCUS_25440 39423 39728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 39928 40704 gene locus_tag LOCUS_25450 gene bioW 39928 40704 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 protein_id gnl|my_center|LOCUS_25450 40694 42040 gene locus_tag LOCUS_25460 gene bioA 40694 42040 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398913.1 protein_id gnl|my_center|LOCUS_25460 42030 43199 gene locus_tag LOCUS_25470 gene bioF 42030 43199 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 protein_id gnl|my_center|LOCUS_25470 43196 43891 gene locus_tag LOCUS_25480 gene bioD 43196 43891 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 protein_id gnl|my_center|LOCUS_25480 43894 44901 gene locus_tag LOCUS_25490 gene bioB 43894 44901 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 protein_id gnl|my_center|LOCUS_25490 44968 46155 gene locus_tag LOCUS_25500 gene bioI 44968 46155 CDS product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398783.1 protein_id gnl|my_center|LOCUS_25500 46233 46994 gene locus_tag LOCUS_25510 46233 46994 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245974.1 protein_id gnl|my_center|LOCUS_25510 47182 48063 gene locus_tag LOCUS_25520 47182 48063 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_25520 48087 49589 gene locus_tag LOCUS_25530 48087 49589 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_25530 51945 49630 gene locus_tag LOCUS_25540 51945 49630 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 protein_id gnl|my_center|LOCUS_25540 52161 53126 gene locus_tag LOCUS_25550 gene rmgP 52161 53126 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_25550 53143 54255 gene locus_tag LOCUS_25560 gene rmgQ 53143 54255 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_25560 54333 54755 gene locus_tag LOCUS_25570 gene rmgS 54333 54755 CDS product rhamnogalaturonan transport/degradation protein RmgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886596.1 protein_id gnl|my_center|LOCUS_25570 54767 56053 gene locus_tag LOCUS_25580 54767 56053 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968003.1 protein_id gnl|my_center|LOCUS_25580 56075 56743 gene locus_tag LOCUS_25590 56075 56743 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 protein_id gnl|my_center|LOCUS_25590 56811 56993 gene locus_tag LOCUS_25600 56811 56993 CDS product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223398.1 protein_id gnl|my_center|LOCUS_25600 58566 57031 gene locus_tag LOCUS_25610 gene opuD 58566 57031 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 protein_id gnl|my_center|LOCUS_25610 59973 58756 gene locus_tag LOCUS_25620 59973 58756 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 protein_id gnl|my_center|LOCUS_25620 60221 61855 gene locus_tag LOCUS_25630 gene murJ 60221 61855 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229224.1 protein_id gnl|my_center|LOCUS_25630 61924 62643 gene locus_tag LOCUS_25640 61924 62643 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_25640 62985 62764 gene locus_tag LOCUS_25650 62985 62764 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152337.1 protein_id gnl|my_center|LOCUS_25650 63275 63985 gene locus_tag LOCUS_25660 63275 63985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229230.1 protein_id gnl|my_center|LOCUS_25660 63982 65139 gene locus_tag LOCUS_25670 63982 65139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229232.1 protein_id gnl|my_center|LOCUS_25670 66476 65178 gene locus_tag LOCUS_25680 gene pbuO 66476 65178 CDS product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 protein_id gnl|my_center|LOCUS_25680 66573 67964 gene locus_tag LOCUS_25690 gene pepV 66573 67964 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399126.1 protein_id gnl|my_center|LOCUS_25690 68881 67997 gene locus_tag LOCUS_25700 gene cysK 68881 67997 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229237.1 protein_id gnl|my_center|LOCUS_25700 69082 69633 gene locus_tag LOCUS_25710 gene thpR 69082 69633 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229239.1 protein_id gnl|my_center|LOCUS_25710 69659 70573 gene locus_tag LOCUS_25720 69659 70573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 protein_id gnl|my_center|LOCUS_25720 70622 71551 gene locus_tag LOCUS_25730 70622 71551 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229243.1 protein_id gnl|my_center|LOCUS_25730 71576 73732 gene locus_tag LOCUS_25740 gene pulA 71576 73732 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229246.1 protein_id gnl|my_center|LOCUS_25740 73911 74708 gene locus_tag LOCUS_25750 73911 74708 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886595.1 protein_id gnl|my_center|LOCUS_25750 74987 74709 gene locus_tag LOCUS_25760 74987 74709 CDS product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237926.1 protein_id gnl|my_center|LOCUS_25760 75192 75833 gene locus_tag LOCUS_25770 gene trmB 75192 75833 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_25770 75900 76745 gene locus_tag LOCUS_25780 75900 76745 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246020.1 protein_id gnl|my_center|LOCUS_25780 76828 78528 gene locus_tag LOCUS_25790 76828 78528 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 protein_id gnl|my_center|LOCUS_25790 78899 78582 gene locus_tag LOCUS_25800 78899 78582 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229259.1 protein_id gnl|my_center|LOCUS_25800 79058 80131 gene locus_tag LOCUS_25810 79058 80131 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229261.1 protein_id gnl|my_center|LOCUS_25810 80634 80188 gene locus_tag LOCUS_25820 80634 80188 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_25820 80868 81191 gene locus_tag LOCUS_25830 80868 81191 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229265.1 protein_id gnl|my_center|LOCUS_25830 81206 82015 gene locus_tag LOCUS_25840 81206 82015 CDS product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 protein_id gnl|my_center|LOCUS_25840 82031 82636 gene locus_tag LOCUS_25850 82031 82636 CDS product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229269.1 protein_id gnl|my_center|LOCUS_25850 82797 85673 gene locus_tag LOCUS_25860 gene sftA 82797 85673 CDS product DNA translocase SftA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229272.1 protein_id gnl|my_center|LOCUS_25860 85922 87220 gene locus_tag LOCUS_25870 gene murC 85922 87220 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229274.1 protein_id gnl|my_center|LOCUS_25870 87382 87804 gene locus_tag LOCUS_25880 87382 87804 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229276.1 protein_id gnl|my_center|LOCUS_25880 87835 88290 gene locus_tag LOCUS_25890 87835 88290 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398549.1 protein_id gnl|my_center|LOCUS_25890 88314 88640 gene locus_tag LOCUS_25900 gene ytxJ 88314 88640 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229280.1 protein_id gnl|my_center|LOCUS_25900 88876 89952 gene locus_tag LOCUS_25910 88876 89952 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223454.1 protein_id gnl|my_center|LOCUS_25910 90228 91232 gene locus_tag LOCUS_25920 gene ccpA 90228 91232 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_25920 91296 92114 gene locus_tag LOCUS_25930 gene motP 91296 92114 CDS product flagellar motor protein MotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398692.1 protein_id gnl|my_center|LOCUS_25930 92104 92814 gene locus_tag LOCUS_25940 gene motS 92104 92814 CDS product flagellar motor protein MotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229290.1 protein_id gnl|my_center|LOCUS_25940 94009 92843 gene locus_tag LOCUS_25950 94009 92843 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398517.1 protein_id gnl|my_center|LOCUS_25950 94650 94006 gene locus_tag LOCUS_25960 94650 94006 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229294.1 protein_id gnl|my_center|LOCUS_25960 95309 94677 gene locus_tag LOCUS_25970 gene acuA 95309 94677 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 protein_id gnl|my_center|LOCUS_25970 95469 97187 gene locus_tag LOCUS_25980 gene acsA 95469 97187 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_25980 97529 98797 gene locus_tag LOCUS_25990 gene tyrS 97529 98797 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_25990 98928 99056 gene locus_tag LOCUS_26000 98928 99056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 99680 99078 gene locus_tag LOCUS_26010 gene rpsD 99680 99078 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_26010 99975 101714 gene locus_tag LOCUS_26020 99975 101714 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 protein_id gnl|my_center|LOCUS_26020 102243 101752 gene locus_tag LOCUS_26030 102243 101752 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229311.1 protein_id gnl|my_center|LOCUS_26030 102370 102993 gene locus_tag LOCUS_26040 gene refZ 102370 102993 CDS product transcriptional regulator RefZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229313.1 protein_id gnl|my_center|LOCUS_26040 103795 102986 gene locus_tag LOCUS_26050 gene hisJ 103795 102986 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229318.1 protein_id gnl|my_center|LOCUS_26050 103992 105695 gene locus_tag LOCUS_26060 gene ezrA 103992 105695 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229320.1 protein_id gnl|my_center|LOCUS_26060 107134 105794 gene locus_tag LOCUS_26070 gene brnQ 107134 105794 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 protein_id gnl|my_center|LOCUS_26070 107336 108481 gene locus_tag LOCUS_26080 107336 108481 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398687.1 protein_id gnl|my_center|LOCUS_26080 108485 109690 gene locus_tag LOCUS_26090 gene thiI 108485 109690 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229326.1 protein_id gnl|my_center|LOCUS_26090 109782 109991 gene locus_tag LOCUS_26100 gene sspA 109782 109991 CDS product alpha type acid-soluble spore protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223491.1 protein_id gnl|my_center|LOCUS_26100 110171 111760 gene locus_tag LOCUS_26110 110171 111760 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 protein_id gnl|my_center|LOCUS_26110 111780 113369 gene locus_tag LOCUS_26120 111780 113369 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 protein_id gnl|my_center|LOCUS_26120 114206 113403 gene locus_tag LOCUS_26130 114206 113403 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399091.1 protein_id gnl|my_center|LOCUS_26130 114393 115400 gene locus_tag LOCUS_26140 gene sppA 114393 115400 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_26140 115413 115907 gene locus_tag LOCUS_26150 115413 115907 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229340.1 protein_id gnl|my_center|LOCUS_26150 115982 116662 gene locus_tag LOCUS_26160 115982 116662 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399127.1 protein_id gnl|my_center|LOCUS_26160 116676 117131 gene locus_tag LOCUS_26170 gene ytfJ 116676 117131 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_26170 117240 117743 gene locus_tag LOCUS_26180 gene tpx 117240 117743 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 protein_id gnl|my_center|LOCUS_26180 117803 118789 gene locus_tag LOCUS_26190 117803 118789 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229346.1 protein_id gnl|my_center|LOCUS_26190 119136 120323 gene locus_tag LOCUS_26200 119136 120323 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_26200 120409 120921 gene locus_tag LOCUS_26210 120409 120921 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_26210 121092 122303 gene locus_tag LOCUS_26220 121092 122303 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 protein_id gnl|my_center|LOCUS_26220 122300 123685 gene locus_tag LOCUS_26230 gene argH 122300 123685 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 protein_id gnl|my_center|LOCUS_26230 123750 123881 gene locus_tag LOCUS_26240 123750 123881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399018.1 protein_id gnl|my_center|LOCUS_26240 124007 124774 gene locus_tag LOCUS_26250 124007 124774 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 protein_id gnl|my_center|LOCUS_26250 124837 125520 gene locus_tag LOCUS_26260 124837 125520 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_26260 125641 126960 gene locus_tag LOCUS_26270 125641 126960 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398641.1 protein_id gnl|my_center|LOCUS_26270 127282 126980 gene locus_tag LOCUS_26280 127282 126980 CDS product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229401.1 protein_id gnl|my_center|LOCUS_26280 127413 128354 gene locus_tag LOCUS_26290 gene nrnA 127413 128354 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398971.1 protein_id gnl|my_center|LOCUS_26290 128563 128372 gene locus_tag LOCUS_26300 128563 128372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229407.1 protein_id gnl|my_center|LOCUS_26300 129168 128665 gene locus_tag LOCUS_26310 gene ytrI 129168 128665 CDS product sporulation membrane protein YtrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229408.1 protein_id gnl|my_center|LOCUS_26310 129506 129165 gene locus_tag LOCUS_26320 gene ytrH 129506 129165 CDS product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 protein_id gnl|my_center|LOCUS_26320 129646 132993 gene locus_tag LOCUS_26330 gene dnaE 129646 132993 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229412.1 protein_id gnl|my_center|LOCUS_26330 133130 134362 gene locus_tag LOCUS_26340 gene maeB 133130 134362 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_26340 134696 135568 gene locus_tag LOCUS_26350 gene accD 134696 135568 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 protein_id gnl|my_center|LOCUS_26350 135553 136530 gene locus_tag LOCUS_26360 gene accA 135553 136530 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 protein_id gnl|my_center|LOCUS_26360 136714 137673 gene locus_tag LOCUS_26370 gene pfkA 136714 137673 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_26370 137715 139472 gene locus_tag LOCUS_26380 gene pyk 137715 139472 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_26380 139567 139950 gene locus_tag LOCUS_26390 gene fxsA 139567 139950 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 protein_id gnl|my_center|LOCUS_26390 141098 139983 gene locus_tag LOCUS_26400 gene ytvI 141098 139983 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399115.1 protein_id gnl|my_center|LOCUS_26400 141195 141659 gene locus_tag LOCUS_26410 141195 141659 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398695.1 protein_id gnl|my_center|LOCUS_26410 141992 143110 gene locus_tag LOCUS_26420 gene citZ 141992 143110 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_26420 143275 144546 gene locus_tag LOCUS_26430 gene icd 143275 144546 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_26430 144590 145528 gene locus_tag LOCUS_26440 gene mdh 144590 145528 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 protein_id gnl|my_center|LOCUS_26440 145740 146462 gene locus_tag LOCUS_26450 gene phoP 145740 146462 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_26450 146455 148194 gene locus_tag LOCUS_26460 gene phoR 146455 148194 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398493.1 protein_id gnl|my_center|LOCUS_26460 148436 151078 gene locus_tag LOCUS_26470 gene polA 148436 151078 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_26470 151101 151931 gene locus_tag LOCUS_26480 gene mutM 151101 151931 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_26480 152098 152730 gene locus_tag LOCUS_26490 gene ytaF 152098 152730 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 protein_id gnl|my_center|LOCUS_26490 152746 153339 gene locus_tag LOCUS_26500 gene coaE 152746 153339 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_26500 154218 153376 gene locus_tag LOCUS_26510 gene ytbE 154218 153376 CDS product aldo/keto reductase YtbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229455.1 protein_id gnl|my_center|LOCUS_26510 155432 154242 gene locus_tag LOCUS_26520 155432 154242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229456.1 protein_id gnl|my_center|LOCUS_26520 155616 155996 gene locus_tag LOCUS_26530 155616 155996 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 protein_id gnl|my_center|LOCUS_26530 156201 157223 gene locus_tag LOCUS_26540 156201 157223 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 protein_id gnl|my_center|LOCUS_26540 157462 157842 gene locus_tag LOCUS_26550 gene speD 157462 157842 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 protein_id gnl|my_center|LOCUS_26550 158116 158574 gene locus_tag LOCUS_26560 gene nrdR 158116 158574 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_26560 158689 160110 gene locus_tag LOCUS_26570 gene dnaB 158689 160110 CDS product replication initiation membrane attachment protein DnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229464.1 protein_id gnl|my_center|LOCUS_26570 160138 161073 gene locus_tag LOCUS_26580 gene dnaI 160138 161073 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_26580 161107 161748 gene locus_tag LOCUS_26590 161107 161748 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229468.1 protein_id gnl|my_center|LOCUS_26590 161827 162672 gene locus_tag LOCUS_26600 gene ytxC 161827 162672 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229471.1 protein_id gnl|my_center|LOCUS_26600 163072 165003 gene locus_tag LOCUS_26610 gene thrS 163072 165003 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_26610 165826 165044 gene locus_tag LOCUS_26620 165826 165044 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_26620 165993 167774 gene locus_tag LOCUS_26630 gene lytS 165993 167774 CDS product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229477.1 protein_id gnl|my_center|LOCUS_26630 167752 168477 gene locus_tag LOCUS_26640 gene lytT 167752 168477 CDS product two-component system response regulator LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229479.1 protein_id gnl|my_center|LOCUS_26640 168611 169051 gene locus_tag LOCUS_26650 gene lrgA 168611 169051 CDS product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399155.1 protein_id gnl|my_center|LOCUS_26650 169072 169767 gene locus_tag LOCUS_26660 gene lrgB 169072 169767 CDS product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229482.1 protein_id gnl|my_center|LOCUS_26660 170458 169799 gene locus_tag LOCUS_26670 170458 169799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229484.1 protein_id gnl|my_center|LOCUS_26670 170573 170776 gene locus_tag LOCUS_26680 170573 170776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 171113 171616 gene locus_tag LOCUS_26690 gene infC 171113 171616 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 protein_id gnl|my_center|LOCUS_26690 171629 171829 gene locus_tag LOCUS_26700 gene rpmI 171629 171829 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_26700 171861 172220 gene locus_tag LOCUS_26710 gene rplT 171861 172220 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_26710 172276 172545 gene locus_tag LOCUS_26720 172276 172545 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_26720 172954 172562 gene locus_tag LOCUS_26730 gene ysdB 172954 172562 CDS product sigma W pathway protein YsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229493.1 protein_id gnl|my_center|LOCUS_26730 173138 174223 gene locus_tag LOCUS_26740 173138 174223 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_26740 174418 175392 gene locus_tag LOCUS_26750 gene abnA 174418 175392 CDS product arabinan endo-1,5-alpha-L-arabinosidase AbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229496.1 protein_id gnl|my_center|LOCUS_26750 175576 177066 gene locus_tag LOCUS_26760 gene araA 175576 177066 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_26760 177082 178767 gene locus_tag LOCUS_26770 gene araB 177082 178767 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_26770 178781 179470 gene locus_tag LOCUS_26780 gene araD 178781 179470 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229501.1 protein_id gnl|my_center|LOCUS_26780 179457 180266 gene locus_tag LOCUS_26790 gene araL 179457 180266 CDS product sugar-phosphatase AraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886590.1 protein_id gnl|my_center|LOCUS_26790 180263 181447 gene locus_tag LOCUS_26800 gene egsA 180263 181447 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_26800 181478 182779 gene locus_tag LOCUS_26810 181478 182779 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_26810 182815 183756 gene locus_tag LOCUS_26820 182815 183756 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_26820 183757 184602 gene locus_tag LOCUS_26830 gene araQ 183757 184602 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_26830 184621 186123 gene locus_tag LOCUS_26840 gene abfA 184621 186123 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_26840 186277 186603 gene locus_tag LOCUS_26850 186277 186603 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117500.1 protein_id gnl|my_center|LOCUS_26850 186600 187154 gene locus_tag LOCUS_26860 186600 187154 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032393.1 protein_id gnl|my_center|LOCUS_26860 187151 188041 gene locus_tag LOCUS_26870 187151 188041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 188153 189949 gene locus_tag LOCUS_26880 gene cstA 188153 189949 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229512.1 protein_id gnl|my_center|LOCUS_26880 189983 190363 gene locus_tag LOCUS_26890 189983 190363 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_26890 191734 190400 gene locus_tag LOCUS_26900 191734 190400 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 protein_id gnl|my_center|LOCUS_26900 193143 191731 gene locus_tag LOCUS_26910 gene glcD 193143 191731 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_26910 194526 193666 gene locus_tag LOCUS_26920 194526 193666 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_26920 195270 195055 gene locus_tag LOCUS_26930 gene sspI 195270 195055 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 protein_id gnl|my_center|LOCUS_26930 195389 196135 gene locus_tag LOCUS_26940 195389 196135 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 protein_id gnl|my_center|LOCUS_26940 196488 197522 gene locus_tag LOCUS_26950 gene pheS 196488 197522 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_26950 197538 199952 gene locus_tag LOCUS_26960 gene pheT 197538 199952 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_26960 200929 199988 gene locus_tag LOCUS_26970 gene rnhC 200929 199988 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245949.1 protein_id gnl|my_center|LOCUS_26970 201062 201319 gene locus_tag LOCUS_26980 gene zapA 201062 201319 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229534.1 protein_id gnl|my_center|LOCUS_26980 201326 201859 gene locus_tag LOCUS_26990 201326 201859 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 protein_id gnl|my_center|LOCUS_26990 201931 203643 gene locus_tag LOCUS_27000 gene polX 201931 203643 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229538.1 protein_id gnl|my_center|LOCUS_27000 203664 206021 gene locus_tag LOCUS_27010 203664 206021 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_27010 206036 206440 gene locus_tag LOCUS_27020 206036 206440 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 protein_id gnl|my_center|LOCUS_27020 206628 208310 gene locus_tag LOCUS_27030 gene lcfA 206628 208310 CDS product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 protein_id gnl|my_center|LOCUS_27030 208428 209012 gene locus_tag LOCUS_27040 gene fadR 208428 209012 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_27040 209027 209803 gene locus_tag LOCUS_27050 209027 209803 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 protein_id gnl|my_center|LOCUS_27050 209818 210591 gene locus_tag LOCUS_27060 gene etfB 209818 210591 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398765.1 protein_id gnl|my_center|LOCUS_27060 210627 211604 gene locus_tag LOCUS_27070 gene etfA 210627 211604 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 protein_id gnl|my_center|LOCUS_27070 211739 211587 gene locus_tag LOCUS_27080 211739 211587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 211818 213305 gene locus_tag LOCUS_27090 gene abfB 211818 213305 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_27090 213633 213947 gene locus_tag LOCUS_27100 gene trxA 213633 213947 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 protein_id gnl|my_center|LOCUS_27100 214083 215855 gene locus_tag LOCUS_27110 gene uvrC 214083 215855 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_27110 216225 217454 gene locus_tag LOCUS_27120 216225 217454 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 protein_id gnl|my_center|LOCUS_27120 217944 217498 gene locus_tag LOCUS_27130 217944 217498 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222508.1 protein_id gnl|my_center|LOCUS_27130 218236 218844 gene locus_tag LOCUS_27140 gene sdhC 218236 218844 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_27140 218878 220644 gene locus_tag LOCUS_27150 gene sdhA 218878 220644 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 protein_id gnl|my_center|LOCUS_27150 220641 221402 gene locus_tag LOCUS_27160 gene sdhB 220641 221402 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_27160 221462 221905 gene locus_tag LOCUS_27170 221462 221905 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398491.1 protein_id gnl|my_center|LOCUS_27170 222021 222245 gene locus_tag LOCUS_27180 gene gerE 222021 222245 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_27180 222490 222930 gene locus_tag LOCUS_27190 222490 222930 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 protein_id gnl|my_center|LOCUS_27190 222941 223756 gene locus_tag LOCUS_27200 gene racE 222941 223756 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886589.1 protein_id gnl|my_center|LOCUS_27200 223872 224972 gene locus_tag LOCUS_27210 gene gerM 223872 224972 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 protein_id gnl|my_center|LOCUS_27210 225083 225820 gene locus_tag LOCUS_27220 225083 225820 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_27220 225842 226429 gene locus_tag LOCUS_27230 225842 226429 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_27230 226445 226954 gene locus_tag LOCUS_27240 226445 226954 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 protein_id gnl|my_center|LOCUS_27240 227083 227158 gene locus_tag LOCUS_t00810 227083 227158 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 228046 227222 gene locus_tag LOCUS_27250 228046 227222 CDS product YsnF/AvaK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229586.1 protein_id gnl|my_center|LOCUS_27250 228268 229578 gene locus_tag LOCUS_27260 228268 229578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 230174 229719 gene locus_tag LOCUS_27270 230174 229719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 protein_id gnl|my_center|LOCUS_27270 230697 230374 gene locus_tag LOCUS_27280 gene cotQ 230697 230374 CDS product inner spore coat protein CotQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398743.1 protein_id gnl|my_center|LOCUS_27280 231514 233238 gene locus_tag LOCUS_27290 gene ilvB 231514 233238 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_27290 233235 233753 gene locus_tag LOCUS_27300 gene ilvN 233235 233753 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 protein_id gnl|my_center|LOCUS_27300 233777 234805 gene locus_tag LOCUS_27310 gene ilvC 233777 234805 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222549.1 protein_id gnl|my_center|LOCUS_27310 234792 236348 gene locus_tag LOCUS_27320 234792 236348 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 protein_id gnl|my_center|LOCUS_27320 236369 237466 gene locus_tag LOCUS_27330 gene leuB 236369 237466 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 protein_id gnl|my_center|LOCUS_27330 237517 238935 gene locus_tag LOCUS_27340 gene leuC 237517 238935 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_27340 238948 239547 gene locus_tag LOCUS_27350 gene leuD 238948 239547 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229606.1 protein_id gnl|my_center|LOCUS_27350 239664 240668 gene locus_tag LOCUS_27360 gene ddcA 239664 240668 CDS product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 protein_id gnl|my_center|LOCUS_27360 240896 242170 gene locus_tag LOCUS_27370 gene tig 240896 242170 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_27370 242442 243704 gene locus_tag LOCUS_27380 gene clpX 242442 243704 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_27380 243858 245516 gene locus_tag LOCUS_27390 gene lonB 243858 245516 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398923.1 protein_id gnl|my_center|LOCUS_27390 245697 248021 gene locus_tag LOCUS_27400 gene lon 245697 248021 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_27400 248018 248605 gene locus_tag LOCUS_27410 gene yihA 248018 248605 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_27410 249126 248629 gene locus_tag LOCUS_27420 249126 248629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229624.1 protein_id gnl|my_center|LOCUS_27420 249356 250723 gene locus_tag LOCUS_27430 gene hemA 249356 250723 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_27430 250842 251561 gene locus_tag LOCUS_27440 250842 251561 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 protein_id gnl|my_center|LOCUS_27440 251598 252539 gene locus_tag LOCUS_27450 gene hemC 251598 252539 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_27450 252529 253317 gene locus_tag LOCUS_27460 gene hemD 252529 253317 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229629.1 protein_id gnl|my_center|LOCUS_27460 253314 254288 gene locus_tag LOCUS_27470 gene hemB 253314 254288 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229631.1 protein_id gnl|my_center|LOCUS_27470 254318 255610 gene locus_tag LOCUS_27480 gene hemL 254318 255610 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_27480 255744 257954 gene locus_tag LOCUS_27490 255744 257954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 257987 259012 gene locus_tag LOCUS_27500 gene cotN 257987 259012 CDS product spore coat protein CotN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399056.1 protein_id gnl|my_center|LOCUS_27500 259222 259031 gene locus_tag LOCUS_27510 259222 259031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222590.1 protein_id gnl|my_center|LOCUS_27510 259672 262314 gene locus_tag LOCUS_27520 gene valS 259672 262314 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_27520 262375 263667 gene locus_tag LOCUS_27530 262375 263667 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 protein_id gnl|my_center|LOCUS_27530 264014 264550 gene locus_tag LOCUS_27540 264014 264550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 264684 265682 gene locus_tag LOCUS_27550 gene spoIIB 264684 265682 CDS product stage II sporulation protein SpoIIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398782.1 protein_id gnl|my_center|LOCUS_27550 265834 266403 gene locus_tag LOCUS_27560 265834 266403 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_27560 266440 267135 gene locus_tag LOCUS_27570 gene radC 266440 267135 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_27570 267227 268240 gene locus_tag LOCUS_27580 gene mreB 267227 268240 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 protein_id gnl|my_center|LOCUS_27580 268271 269143 gene locus_tag LOCUS_27590 gene mreC 268271 269143 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967915.1 protein_id gnl|my_center|LOCUS_27590 269140 269658 gene locus_tag LOCUS_27600 gene mreD 269140 269658 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398811.1 protein_id gnl|my_center|LOCUS_27600 269711 270391 gene locus_tag LOCUS_27610 gene minC 269711 270391 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398901.1 protein_id gnl|my_center|LOCUS_27610 270393 271199 gene locus_tag LOCUS_27620 gene minD 270393 271199 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 protein_id gnl|my_center|LOCUS_27620 271348 272139 gene locus_tag LOCUS_27630 gene spoIVFA 271348 272139 CDS product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398684.1 protein_id gnl|my_center|LOCUS_27630 272132 272998 gene locus_tag LOCUS_27640 gene spoIVFB 272132 272998 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398649.1 protein_id gnl|my_center|LOCUS_27640 273145 273453 gene locus_tag LOCUS_27650 gene rplU 273145 273453 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_27650 273456 273797 gene locus_tag LOCUS_27660 273456 273797 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229669.1 protein_id gnl|my_center|LOCUS_27660 273810 274094 gene locus_tag LOCUS_27670 gene rpmA 273810 274094 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_27670 274414 274992 gene locus_tag LOCUS_27680 gene spo0B 274414 274992 CDS product sporulation initiation phosphotransferase Sop0B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399131.1 protein_id gnl|my_center|LOCUS_27680 275026 276312 gene locus_tag LOCUS_27690 gene obgE 275026 276312 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_27690 276370 276813 gene locus_tag LOCUS_27700 gene thrR 276370 276813 CDS product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 protein_id gnl|my_center|LOCUS_27700 276830 277684 gene locus_tag LOCUS_27710 gene pheA 276830 277684 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398512.1 protein_id gnl|my_center|LOCUS_27710 278249 277707 gene locus_tag LOCUS_27720 278249 277707 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398582.1 protein_id gnl|my_center|LOCUS_27720 279396 278209 gene locus_tag LOCUS_27730 gene nifS 279396 278209 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398844.1 protein_id gnl|my_center|LOCUS_27730 279500 281095 gene locus_tag LOCUS_27740 gene nadB 279500 281095 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229687.1 protein_id gnl|my_center|LOCUS_27740 281049 281918 gene locus_tag LOCUS_27750 gene nadC 281049 281918 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229689.1 protein_id gnl|my_center|LOCUS_27750 281905 283011 gene locus_tag LOCUS_27760 gene nadA 281905 283011 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229691.1 protein_id gnl|my_center|LOCUS_27760 283127 284287 gene locus_tag LOCUS_27770 gene safA 283127 284287 CDS product spore coat assembly protein SafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229695.1 protein_id gnl|my_center|LOCUS_27770 284436 285035 gene locus_tag LOCUS_27780 gene sgpA 284436 285035 CDS product spore germination protein SgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245996.1 protein_id gnl|my_center|LOCUS_27780 285137 285859 gene locus_tag LOCUS_27790 285137 285859 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398802.1 protein_id gnl|my_center|LOCUS_27790 287354 285900 gene locus_tag LOCUS_27800 287354 285900 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398698.1 protein_id gnl|my_center|LOCUS_27800 287628 287750 gene locus_tag LOCUS_27810 287628 287750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 288443 287796 gene locus_tag LOCUS_27820 288443 287796 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246159.1 protein_id gnl|my_center|LOCUS_27820 288680 289774 gene locus_tag LOCUS_27830 gene iolG 288680 289774 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_27830 289787 291094 gene locus_tag LOCUS_27840 289787 291094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246197.1 protein_id gnl|my_center|LOCUS_27840 291142 291654 gene locus_tag LOCUS_27850 gene bofC 291142 291654 CDS product sporulation cell-cell signaling protein BofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229715.1 protein_id gnl|my_center|LOCUS_27850 291793 292398 gene locus_tag LOCUS_27860 gene ruvA 291793 292398 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 protein_id gnl|my_center|LOCUS_27860 292409 293413 gene locus_tag LOCUS_27870 gene ruvB 292409 293413 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 protein_id gnl|my_center|LOCUS_27870 293406 293606 gene locus_tag LOCUS_27880 293406 293606 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222669.1 protein_id gnl|my_center|LOCUS_27880 293636 294664 gene locus_tag LOCUS_27890 gene queA 293636 294664 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229723.1 protein_id gnl|my_center|LOCUS_27890 294691 295836 gene locus_tag LOCUS_27900 gene tgt 294691 295836 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 protein_id gnl|my_center|LOCUS_27900 295877 296143 gene locus_tag LOCUS_27910 gene yajC 295877 296143 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398708.1 protein_id gnl|my_center|LOCUS_27910 296589 296200 gene locus_tag LOCUS_27920 296589 296200 CDS product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 protein_id gnl|my_center|LOCUS_27920 296787 297443 gene locus_tag LOCUS_27930 296787 297443 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 protein_id gnl|my_center|LOCUS_27930 299003 297447 gene locus_tag LOCUS_27940 gene spoVB 299003 297447 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 protein_id gnl|my_center|LOCUS_27940 299120 299416 gene locus_tag LOCUS_27950 gene comN 299120 299416 CDS product post-transcriptional regulator ComN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398498.1 protein_id gnl|my_center|LOCUS_27950 299455 301668 gene locus_tag LOCUS_27960 gene secDF 299455 301668 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_27960 301826 302323 gene locus_tag LOCUS_27970 301826 302323 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229739.1 protein_id gnl|my_center|LOCUS_27970 302400 302732 gene locus_tag LOCUS_27980 302400 302732 CDS product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229740.1 protein_id gnl|my_center|LOCUS_27980 302799 305159 gene locus_tag LOCUS_27990 gene recJ 302799 305159 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_27990 305165 305677 gene locus_tag LOCUS_28000 305165 305677 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 protein_id gnl|my_center|LOCUS_28000 305846 308050 gene locus_tag LOCUS_28010 gene relA 305846 308050 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_28010 308063 308503 gene locus_tag LOCUS_28020 gene dtd 308063 308503 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_28020 310081 308528 gene locus_tag LOCUS_28030 310081 308528 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399040.1 protein_id gnl|my_center|LOCUS_28030 310214 310384 gene locus_tag LOCUS_28040 310214 310384 CDS product YrzK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399157.1 protein_id gnl|my_center|LOCUS_28040 310381 310590 gene locus_tag LOCUS_28050 310381 310590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 310766 312040 gene locus_tag LOCUS_28060 gene hisS 310766 312040 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_28060 312054 313832 gene locus_tag LOCUS_28070 gene aspS 312054 313832 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 protein_id gnl|my_center|LOCUS_28070 314169 314933 gene locus_tag LOCUS_28080 314169 314933 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence106 >Feature sequence107 1 153 gene locus_tag LOCUS_28090 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 710 36 gene locus_tag LOCUS_28100 gene opuCD 710 36 CDS product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244403.1 protein_id gnl|my_center|LOCUS_28100 1645 728 gene locus_tag LOCUS_28110 gene opuCC 1645 728 CDS product osmoprotectant ABC transporter substrate-binding lipoprotein OpuCC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228350.1 protein_id gnl|my_center|LOCUS_28110 2312 1659 gene locus_tag LOCUS_28120 gene opuCB 2312 1659 CDS product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228349.1 protein_id gnl|my_center|LOCUS_28120 3474 2335 gene locus_tag LOCUS_28130 gene opuCA 3474 2335 CDS product osmoprotectant ABC transporter ATP-binding protein OpuCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243370.1 protein_id gnl|my_center|LOCUS_28130 3738 4295 gene locus_tag LOCUS_28140 gene opcR 3738 4295 CDS product opuC operon transcriptional regulator OpcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244093.1 protein_id gnl|my_center|LOCUS_28140 4308 4637 gene locus_tag LOCUS_28150 4308 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4822 5520 gene locus_tag LOCUS_28160 4822 5520 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228340.1 protein_id gnl|my_center|LOCUS_28160 7363 5558 gene locus_tag LOCUS_28170 7363 5558 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228338.1 protein_id gnl|my_center|LOCUS_28170 7495 7956 gene locus_tag LOCUS_28180 7495 7956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 protein_id gnl|my_center|LOCUS_28180 9291 7999 gene locus_tag LOCUS_28190 gene eno 9291 7999 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_28190 10855 9320 gene locus_tag LOCUS_28200 gene gpmI 10855 9320 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_28200 11609 10848 gene locus_tag LOCUS_28210 gene tpiA 11609 10848 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_28210 12824 11640 gene locus_tag LOCUS_28220 12824 11640 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_28220 14140 13133 gene locus_tag LOCUS_28230 gene gap 14140 13133 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_28230 15209 14187 gene locus_tag LOCUS_28240 gene cggR 15209 14187 CDS product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 protein_id gnl|my_center|LOCUS_28240 16904 15510 gene locus_tag LOCUS_28250 gene araE 16904 15510 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_28250 17108 18196 gene locus_tag LOCUS_28260 gene araR 17108 18196 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_28260 19255 18245 gene locus_tag LOCUS_28270 19255 18245 CDS product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 protein_id gnl|my_center|LOCUS_28270 21089 19746 gene locus_tag LOCUS_28280 21089 19746 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228313.1 protein_id gnl|my_center|LOCUS_28280 22524 21490 gene locus_tag LOCUS_28290 22524 21490 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228311.1 protein_id gnl|my_center|LOCUS_28290 23353 22631 gene locus_tag LOCUS_28300 gene lutC 23353 22631 CDS product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 protein_id gnl|my_center|LOCUS_28300 24792 23353 gene locus_tag LOCUS_28310 gene lutB 24792 23353 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_28310 25535 24819 gene locus_tag LOCUS_28320 gene lutA 25535 24819 CDS product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 protein_id gnl|my_center|LOCUS_28320 26327 25710 gene locus_tag LOCUS_28330 26327 25710 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948669.1 protein_id gnl|my_center|LOCUS_28330 26653 26324 gene locus_tag LOCUS_28340 26653 26324 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078066.1 protein_id gnl|my_center|LOCUS_28340 27375 26773 gene locus_tag LOCUS_28350 gene yvfU 27375 26773 CDS product two-component system response regulator YvfU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228302.1 protein_id gnl|my_center|LOCUS_28350 28507 27392 gene locus_tag LOCUS_28360 gene yvfT 28507 27392 CDS product two-component system sensor histidine kinase YvfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228300.1 protein_id gnl|my_center|LOCUS_28360 29248 28511 gene locus_tag LOCUS_28370 29248 28511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228297.1 protein_id gnl|my_center|LOCUS_28370 30154 29249 gene locus_tag LOCUS_28380 30154 29249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228295.1 protein_id gnl|my_center|LOCUS_28380 30439 31248 gene locus_tag LOCUS_28390 gene rsbQ 30439 31248 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_28390 31283 32494 gene locus_tag LOCUS_28400 gene rsbP 31283 32494 CDS product phosphoserine phosphatase RsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228290.1 protein_id gnl|my_center|LOCUS_28400 33431 32535 gene locus_tag LOCUS_28410 33431 32535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28410 33826 33566 gene locus_tag LOCUS_28420 33826 33566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28420 35967 33907 gene locus_tag LOCUS_28430 gene ganA 35967 33907 CDS product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 protein_id gnl|my_center|LOCUS_28430 36839 35988 gene locus_tag LOCUS_28440 gene ganQ 36839 35988 CDS product arabinogalactan oligomer ABC transporter permease GanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228283.1 protein_id gnl|my_center|LOCUS_28440 38099 36843 gene locus_tag LOCUS_28450 gene ganP 38099 36843 CDS product arabinogalactan oligomer ABC transporter permease GanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243623.1 protein_id gnl|my_center|LOCUS_28450 39404 38139 gene locus_tag LOCUS_28460 gene ganS 39404 38139 CDS product arabinogalactan oligomer ABC transporter substrate-binding protein GanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228280.1 protein_id gnl|my_center|LOCUS_28460 40538 39546 gene locus_tag LOCUS_28470 gene ganR 40538 39546 CDS product galactan degradation operon transcriptional regulator GanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244199.1 protein_id gnl|my_center|LOCUS_28470 41442 40720 gene locus_tag LOCUS_28480 gene lutR 41442 40720 CDS product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 protein_id gnl|my_center|LOCUS_28480 41670 43361 gene locus_tag LOCUS_28490 gene lutP 41670 43361 CDS product L-lactate permease LutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228275.1 protein_id gnl|my_center|LOCUS_28490 44698 43388 gene locus_tag LOCUS_28500 gene rpoN 44698 43388 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 protein_id gnl|my_center|LOCUS_28500 44777 44995 gene locus_tag LOCUS_28510 gene yvfG 44777 44995 CDS product protein YvfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219905.1 protein_id gnl|my_center|LOCUS_28510 45971 45006 gene locus_tag LOCUS_28520 45971 45006 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 protein_id gnl|my_center|LOCUS_28520 47116 45950 gene locus_tag LOCUS_28530 47116 45950 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_28530 47771 47133 gene locus_tag LOCUS_28540 47771 47133 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 protein_id gnl|my_center|LOCUS_28540 48376 47768 gene locus_tag LOCUS_28550 48376 47768 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 protein_id gnl|my_center|LOCUS_28550 49821 48373 gene locus_tag LOCUS_28560 49821 48373 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 protein_id gnl|my_center|LOCUS_28560 50921 49887 gene locus_tag LOCUS_28570 50921 49887 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 protein_id gnl|my_center|LOCUS_28570 51994 50918 gene locus_tag LOCUS_28580 51994 50918 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 protein_id gnl|my_center|LOCUS_28580 53033 51999 gene locus_tag LOCUS_28590 53033 51999 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243644.1 protein_id gnl|my_center|LOCUS_28590 54161 53058 gene locus_tag LOCUS_28600 gene epsG 54161 53058 CDS product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 protein_id gnl|my_center|LOCUS_28600 55313 54165 gene locus_tag LOCUS_28610 55313 54165 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_28610 56142 55306 gene locus_tag LOCUS_28620 gene epsE 56142 55306 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_28620 57284 56139 gene locus_tag LOCUS_28630 57284 56139 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_28630 59116 57296 gene locus_tag LOCUS_28640 59116 57296 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244548.1 protein_id gnl|my_center|LOCUS_28640 60035 59352 gene locus_tag LOCUS_28650 gene epsB 60035 59352 CDS product protein tyrosine kinase EpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228249.1 protein_id gnl|my_center|LOCUS_28650 60745 60041 gene locus_tag LOCUS_28660 60745 60041 CDS product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228247.1 protein_id gnl|my_center|LOCUS_28660 60991 61449 gene locus_tag LOCUS_28670 gene slrR 60991 61449 CDS product transcriptional regulator SlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242589.1 protein_id gnl|my_center|LOCUS_28670 61524 62993 gene locus_tag LOCUS_28680 gene pnbA 61524 62993 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_28680 62996 63187 gene locus_tag LOCUS_28690 62996 63187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 63699 63214 gene locus_tag LOCUS_28700 gene padC 63699 63214 CDS product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243190.1 protein_id gnl|my_center|LOCUS_28700 64176 63721 gene locus_tag LOCUS_28710 64176 63721 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084993485.1 protein_id gnl|my_center|LOCUS_28710 64986 64303 gene locus_tag LOCUS_28720 gene racX 64986 64303 CDS product broad specificity amino-acid racemase RacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244427.1 protein_id gnl|my_center|LOCUS_28720 66357 65002 gene locus_tag LOCUS_28730 66357 65002 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 protein_id gnl|my_center|LOCUS_28730 67113 68534 gene locus_tag LOCUS_28740 gene sacB 67113 68534 CDS product levansucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022105.1 protein_id gnl|my_center|LOCUS_28740 68611 70161 gene locus_tag LOCUS_28750 gene levB 68611 70161 CDS product 2,6-beta-fructan 6-levanbiohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243729.1 protein_id gnl|my_center|LOCUS_28750 70269 71831 gene locus_tag LOCUS_28760 gene aspP 70269 71831 CDS product aspartate/proton symporter AspP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228228.1 protein_id gnl|my_center|LOCUS_28760 71926 72510 gene locus_tag LOCUS_28770 71926 72510 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244443.1 protein_id gnl|my_center|LOCUS_28770 72591 72926 gene locus_tag LOCUS_28780 72591 72926 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242480.1 protein_id gnl|my_center|LOCUS_28780 72926 73240 gene locus_tag LOCUS_28790 72926 73240 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228222.1 protein_id gnl|my_center|LOCUS_28790 73794 73282 gene locus_tag LOCUS_28800 73794 73282 CDS product DUF3231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243249.1 protein_id gnl|my_center|LOCUS_28800 74025 73945 gene locus_tag LOCUS_t00820 74025 73945 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 74295 74891 gene locus_tag LOCUS_28810 gene clpP 74295 74891 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_28810 75501 74926 gene locus_tag LOCUS_28820 75501 74926 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 protein_id gnl|my_center|LOCUS_28820 75619 75939 gene locus_tag LOCUS_28830 75619 75939 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242570.1 protein_id gnl|my_center|LOCUS_28830 77567 75966 gene locus_tag LOCUS_28840 77567 75966 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244488.1 protein_id gnl|my_center|LOCUS_28840 78170 77586 gene locus_tag LOCUS_28850 78170 77586 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886620.1 protein_id gnl|my_center|LOCUS_28850 78576 79550 gene locus_tag LOCUS_28860 78576 79550 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886621.1 protein_id gnl|my_center|LOCUS_28860 81520 79586 gene locus_tag LOCUS_28870 gene psdB 81520 79586 CDS product lantibiotic ABC transporter permease PsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243432.1 protein_id gnl|my_center|LOCUS_28870 82274 81495 gene locus_tag LOCUS_28880 gene psdA 82274 81495 CDS product lantibiotic ABC transporter ATP-binding protein PsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228167.1 protein_id gnl|my_center|LOCUS_28880 83427 82357 gene locus_tag LOCUS_28890 gene psdS 83427 82357 CDS product two-component sensor histidine kinase PsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242699.1 protein_id gnl|my_center|LOCUS_28890 84134 83421 gene locus_tag LOCUS_28900 gene psdR 84134 83421 CDS product two-component system response regulator PsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244535.1 protein_id gnl|my_center|LOCUS_28900 84281 84490 gene locus_tag LOCUS_28910 84281 84490 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243327.1 protein_id gnl|my_center|LOCUS_28910 85281 84526 gene locus_tag LOCUS_28920 85281 84526 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968228.1 protein_id gnl|my_center|LOCUS_28920 85547 85290 gene locus_tag LOCUS_28930 85547 85290 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_28930 86521 85571 gene locus_tag LOCUS_28940 gene whiA 86521 85571 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 protein_id gnl|my_center|LOCUS_28940 87496 86543 gene locus_tag LOCUS_28950 gene mgfK 87496 86543 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_28950 88385 87498 gene locus_tag LOCUS_28960 gene rapZ 88385 87498 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_28960 88856 88410 gene locus_tag LOCUS_28970 88856 88410 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886622.1 protein_id gnl|my_center|LOCUS_28970 90157 89207 gene locus_tag LOCUS_28980 gene trxB 90157 89207 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 protein_id gnl|my_center|LOCUS_28980 91785 90376 gene locus_tag LOCUS_28990 gene cwlO 91785 90376 CDS product peptidoglycan DL-endopeptidase CwlO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968231.1 protein_id gnl|my_center|LOCUS_28990 93620 92166 gene locus_tag LOCUS_29000 93620 92166 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242799.1 protein_id gnl|my_center|LOCUS_29000 95514 93745 gene locus_tag LOCUS_29010 gene bmrA 95514 93745 CDS product multidrug resistance ABC transporter ATP-binding protein/permease BmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243345.1 protein_id gnl|my_center|LOCUS_29010 96038 95679 gene locus_tag LOCUS_29020 96038 95679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228131.1 protein_id gnl|my_center|LOCUS_29020 97939 96053 gene locus_tag LOCUS_29030 97939 96053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242583.1 protein_id gnl|my_center|LOCUS_29030 98582 97929 gene locus_tag LOCUS_29040 98582 97929 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244157.1 protein_id gnl|my_center|LOCUS_29040 99518 98895 gene locus_tag LOCUS_29050 gene hisIE 99518 98895 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_29050 100273 99515 gene locus_tag LOCUS_29060 gene hisF 100273 99515 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 protein_id gnl|my_center|LOCUS_29060 101007 100270 gene locus_tag LOCUS_29070 gene hisA 101007 100270 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_29070 101642 101004 gene locus_tag LOCUS_29080 gene hisH 101642 101004 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_29080 102227 101643 gene locus_tag LOCUS_29090 gene hisB 102227 101643 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_29090 103507 102224 gene locus_tag LOCUS_29100 gene hisD 103507 102224 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_29100 104145 103504 gene locus_tag LOCUS_29110 gene hisG 104145 103504 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_29110 105316 104138 gene locus_tag LOCUS_29120 105316 104138 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_29120 105563 106306 gene locus_tag LOCUS_29130 105563 106306 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243552.1 protein_id gnl|my_center|LOCUS_29130 106561 107226 gene locus_tag LOCUS_29140 gene pelC 106561 107226 CDS product pectate/pectin lyase PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242578.1 protein_id gnl|my_center|LOCUS_29140 107767 107249 gene locus_tag LOCUS_29150 gene hprF 107767 107249 CDS product heptaprenylglyceryl phosphate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244270.1 protein_id gnl|my_center|LOCUS_29150 108421 107771 gene locus_tag LOCUS_29160 gene ppaX 108421 107771 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_29160 109356 108418 gene locus_tag LOCUS_29170 109356 108418 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_29170 110189 109380 gene locus_tag LOCUS_29180 gene lgt 110189 109380 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_29180 111135 110203 gene locus_tag LOCUS_29190 gene hprK 111135 110203 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_29190 111317 112507 gene locus_tag LOCUS_29200 gene nagA 111317 112507 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 protein_id gnl|my_center|LOCUS_29200 112504 113232 gene locus_tag LOCUS_29210 gene nagB 112504 113232 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 protein_id gnl|my_center|LOCUS_29210 113250 113981 gene locus_tag LOCUS_29220 gene nagR 113250 113981 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_29220 117869 114000 gene locus_tag LOCUS_29230 117869 114000 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228085.1 protein_id gnl|my_center|LOCUS_29230 118034 118507 gene locus_tag LOCUS_29240 118034 118507 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228083.1 protein_id gnl|my_center|LOCUS_29240 119765 118548 gene locus_tag LOCUS_29250 gene cypX 119765 118548 CDS product pulcherriminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244436.1 protein_id gnl|my_center|LOCUS_29250 120526 119780 gene locus_tag LOCUS_29260 gene pchC 120526 119780 CDS product cyclo(L-leucyl-L-leucyl) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242712.1 protein_id gnl|my_center|LOCUS_29260 120966 121475 gene locus_tag LOCUS_29270 gene pchR 120966 121475 CDS product pulcherriminic acid biosynthesis transcriptional regulator PchR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228073.1 protein_id gnl|my_center|LOCUS_29270 121497 122708 gene locus_tag LOCUS_29280 121497 122708 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228068.1 protein_id gnl|my_center|LOCUS_29280 123097 122738 gene locus_tag LOCUS_29290 123097 122738 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 protein_id gnl|my_center|LOCUS_29290 123296 123099 gene locus_tag LOCUS_29300 123296 123099 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228065.1 protein_id gnl|my_center|LOCUS_29300 124398 123301 gene locus_tag LOCUS_29310 124398 123301 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228061.1 protein_id gnl|my_center|LOCUS_29310 124749 124423 gene locus_tag LOCUS_29320 gene yvlA 124749 124423 CDS product protein YvlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244375.1 protein_id gnl|my_center|LOCUS_29320 124968 125198 gene locus_tag LOCUS_29330 124968 125198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228059.1 protein_id gnl|my_center|LOCUS_29330 128115 125242 gene locus_tag LOCUS_29340 gene uvrA 128115 125242 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_29340 130108 128123 gene locus_tag LOCUS_29350 gene uvrB 130108 128123 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_29350 130523 130293 gene locus_tag LOCUS_29360 130523 130293 CDS product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228053.1 protein_id gnl|my_center|LOCUS_29360 131493 133988 gene locus_tag LOCUS_29370 131493 133988 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243243.1 protein_id gnl|my_center|LOCUS_29370 134065 134628 gene locus_tag LOCUS_29380 134065 134628 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244088.1 protein_id gnl|my_center|LOCUS_29380 134663 135997 gene locus_tag LOCUS_29390 134663 135997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242625.1 protein_id gnl|my_center|LOCUS_29390 137241 136045 gene locus_tag LOCUS_29400 gene minJ 137241 136045 CDS product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 protein_id gnl|my_center|LOCUS_29400 137673 137320 gene locus_tag LOCUS_29410 137673 137320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 139498 138056 gene locus_tag LOCUS_29420 gene ctpB 139498 138056 CDS product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 protein_id gnl|my_center|LOCUS_29420 140734 139835 gene locus_tag LOCUS_29430 gene ftsX 140734 139835 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_29430 141404 140718 gene locus_tag LOCUS_29440 gene ftsE 141404 140718 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_29440 141989 141639 gene locus_tag LOCUS_29450 gene cccB 141989 141639 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242725.1 protein_id gnl|my_center|LOCUS_29450 142871 142026 gene locus_tag LOCUS_29460 142871 142026 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242677.1 protein_id gnl|my_center|LOCUS_29460 144022 143039 gene locus_tag LOCUS_29470 gene prfB 144022 143039 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_29470 146735 144210 gene locus_tag LOCUS_29480 gene secA 146735 144210 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_29480 147473 146904 gene locus_tag LOCUS_29490 gene hpf 147473 146904 CDS product ribosome hibernation promotion factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228031.1 protein_id gnl|my_center|LOCUS_29490 147712 147494 gene locus_tag LOCUS_29500 147712 147494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 148392 148051 gene locus_tag LOCUS_29510 gene fliT 148392 148051 CDS product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242603.1 protein_id gnl|my_center|LOCUS_29510 148790 148389 gene locus_tag LOCUS_29520 gene fliS 148790 148389 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_29520 150308 148812 gene locus_tag LOCUS_29530 150308 148812 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 protein_id gnl|my_center|LOCUS_29530 150655 150326 gene locus_tag LOCUS_29540 gene flaG 150655 150326 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968250.1 protein_id gnl|my_center|LOCUS_29540 151712 150885 gene locus_tag LOCUS_29550 gene hag 151712 150885 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_29550 152081 151857 gene locus_tag LOCUS_29560 gene csrA 152081 151857 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 protein_id gnl|my_center|LOCUS_29560 152506 152075 gene locus_tag LOCUS_29570 gene fliW 152506 152075 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_29570 153102 152527 gene locus_tag LOCUS_29580 153102 152527 CDS product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 protein_id gnl|my_center|LOCUS_29580 154045 153149 gene locus_tag LOCUS_29590 gene flgL 154045 153149 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 protein_id gnl|my_center|LOCUS_29590 155578 154055 gene locus_tag LOCUS_29600 gene flgK 155578 154055 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 protein_id gnl|my_center|LOCUS_29600 156079 155597 gene locus_tag LOCUS_29610 gene flgN 156079 155597 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227999.1 protein_id gnl|my_center|LOCUS_29610 156361 156095 gene locus_tag LOCUS_29620 gene flgM 156361 156095 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227997.1 protein_id gnl|my_center|LOCUS_29620 156861 156442 gene locus_tag LOCUS_29630 156861 156442 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_29630 157413 156934 gene locus_tag LOCUS_29640 157413 156934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 157916 157620 gene locus_tag LOCUS_29650 gene comFB 157916 157620 CDS product late competence protein ComFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227989.1 protein_id gnl|my_center|LOCUS_29650 159370 157985 gene locus_tag LOCUS_29660 gene comFA 159370 157985 CDS product ATP-dependent helicase ComFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243962.1 protein_id gnl|my_center|LOCUS_29660 160320 159475 gene locus_tag LOCUS_29670 160320 159475 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 protein_id gnl|my_center|LOCUS_29670 161107 160418 gene locus_tag LOCUS_29680 gene degU 161107 160418 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_29680 162347 161190 gene locus_tag LOCUS_29690 gene degS 162347 161190 CDS product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 protein_id gnl|my_center|LOCUS_29690 162563 163216 gene locus_tag LOCUS_29700 162563 163216 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_29700 163216 164340 gene locus_tag LOCUS_29710 gene tagV 163216 164340 CDS product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244117.1 protein_id gnl|my_center|LOCUS_29710 165490 164414 gene locus_tag LOCUS_29720 165490 164414 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_29720 166834 165635 gene locus_tag LOCUS_29730 166834 165635 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243252.1 protein_id gnl|my_center|LOCUS_29730 167615 166857 gene locus_tag LOCUS_29740 167615 166857 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 protein_id gnl|my_center|LOCUS_29740 168319 167639 gene locus_tag LOCUS_29750 168319 167639 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243110.1 protein_id gnl|my_center|LOCUS_29750 169814 168348 gene locus_tag LOCUS_29760 gene tuaE 169814 168348 CDS product teichuronic acid biosynthesis protein TuaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886625.1 protein_id gnl|my_center|LOCUS_29760 171292 169898 gene locus_tag LOCUS_29770 gene tuaD 171292 169898 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_29770 172514 171345 gene locus_tag LOCUS_29780 172514 171345 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242807.1 protein_id gnl|my_center|LOCUS_29780 173965 172511 gene locus_tag LOCUS_29790 173965 172511 CDS product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244371.1 protein_id gnl|my_center|LOCUS_29790 174677 174018 gene locus_tag LOCUS_29800 174677 174018 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891044.1 protein_id gnl|my_center|LOCUS_29800 176816 174912 gene locus_tag LOCUS_29810 gene tarS 176816 174912 CDS product poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 protein_id gnl|my_center|LOCUS_29810 178522 177035 gene locus_tag LOCUS_29820 gene lytC 178522 177035 CDS product N-acetylmuramoyl-L-alanine amidase LytC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242758.1 protein_id gnl|my_center|LOCUS_29820 180763 178610 gene locus_tag LOCUS_29830 180763 178610 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243620.1 protein_id gnl|my_center|LOCUS_29830 181114 180791 gene locus_tag LOCUS_29840 gene lytA 181114 180791 CDS product membrane-bound protein LytA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242772.1 protein_id gnl|my_center|LOCUS_29840 181327 182247 gene locus_tag LOCUS_29850 gene lytR 181327 182247 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_29850 183430 182288 gene locus_tag LOCUS_29860 gene wecB 183430 182288 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_29860 185354 183453 gene locus_tag LOCUS_29870 gene tarS 185354 183453 CDS product poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975351.1 protein_id gnl|my_center|LOCUS_29870 186952 185432 gene locus_tag LOCUS_29880 186952 185432 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727141.1 protein_id gnl|my_center|LOCUS_29880 188354 186987 gene locus_tag LOCUS_29890 188354 186987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 188696 189574 gene locus_tag LOCUS_29900 gene galU 188696 189574 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227944.1 protein_id gnl|my_center|LOCUS_29900 191196 189613 gene locus_tag LOCUS_29910 gene tagH 191196 189613 CDS product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227930.1 protein_id gnl|my_center|LOCUS_29910 192043 191216 gene locus_tag LOCUS_29920 gene tagG 192043 191216 CDS product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 protein_id gnl|my_center|LOCUS_29920 194287 192260 gene locus_tag LOCUS_29930 194287 192260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 195088 194312 gene locus_tag LOCUS_29940 195088 194312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 197769 195085 gene locus_tag LOCUS_29950 gene ggaB 197769 195085 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_29950 199156 197810 gene locus_tag LOCUS_29960 199156 197810 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968267.1 protein_id gnl|my_center|LOCUS_29960 200371 199187 gene locus_tag LOCUS_29970 200371 199187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 200864 200475 gene locus_tag LOCUS_29980 gene tagD 200864 200475 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227921.1 protein_id gnl|my_center|LOCUS_29980 201373 202146 gene locus_tag LOCUS_29990 gene tagA 201373 202146 CDS product N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D- mannosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227919.1 protein_id gnl|my_center|LOCUS_29990 202242 203393 gene locus_tag LOCUS_30000 gene tagB 202242 203393 CDS product teichoic acid glycerol-phosphate primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968271.1 protein_id gnl|my_center|LOCUS_30000 203482 204195 gene locus_tag LOCUS_30010 203482 204195 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_30010 204192 205217 gene locus_tag LOCUS_30020 204192 205217 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 protein_id gnl|my_center|LOCUS_30020 205221 206390 gene locus_tag LOCUS_30030 205221 206390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 206397 208268 gene locus_tag LOCUS_30040 206397 208268 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645039.1 protein_id gnl|my_center|LOCUS_30040 210949 208307 gene locus_tag LOCUS_30050 gene lytD 210949 208307 CDS product beta-N-acetylglucosaminidase LytD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243594.1 protein_id gnl|my_center|LOCUS_30050 212027 211077 gene locus_tag LOCUS_30060 gene manA 212027 211077 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244253.1 protein_id gnl|my_center|LOCUS_30060 212294 213745 gene locus_tag LOCUS_30070 gene gerBA 212294 213745 CDS product spore germination protein GerBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243291.1 protein_id gnl|my_center|LOCUS_30070 213751 214857 gene locus_tag LOCUS_30080 gene gerBB 213751 214857 CDS product spore germination protein GerBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244581.1 protein_id gnl|my_center|LOCUS_30080 214854 215987 gene locus_tag LOCUS_30090 gene gerBC 214854 215987 CDS product spore germination protein GerBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242990.1 protein_id gnl|my_center|LOCUS_30090 217397 216024 gene locus_tag LOCUS_30100 217397 216024 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 protein_id gnl|my_center|LOCUS_30100 217735 218703 gene locus_tag LOCUS_30110 gene tagT 217735 218703 CDS product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243404.1 protein_id gnl|my_center|LOCUS_30110 218861 219721 gene locus_tag LOCUS_30120 gene ywtE 218861 219721 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YwtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244395.1 protein_id gnl|my_center|LOCUS_30120 220997 219756 gene locus_tag LOCUS_30130 gene pgdS 220997 219756 CDS product gamma-DL-glutamyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242751.1 protein_id gnl|my_center|LOCUS_30130 221305 221138 gene locus_tag LOCUS_30140 gene edmS 221305 221138 CDS product extrachromosomal elements maintenance protein EdmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227896.1 protein_id gnl|my_center|LOCUS_30140 222462 221320 gene locus_tag LOCUS_30150 gene pgsA 222462 221320 CDS product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 protein_id gnl|my_center|LOCUS_30150 222930 222481 gene locus_tag LOCUS_30160 gene pgsC 222930 222481 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227889.1 protein_id gnl|my_center|LOCUS_30160 224126 222945 gene locus_tag LOCUS_30170 gene pgsB 224126 222945 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 protein_id gnl|my_center|LOCUS_30170 224908 225897 gene locus_tag LOCUS_30180 224908 225897 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968279.1 protein_id gnl|my_center|LOCUS_30180 225890 226771 gene locus_tag LOCUS_30190 gene rbsK 225890 226771 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 protein_id gnl|my_center|LOCUS_30190 226768 227163 gene locus_tag LOCUS_30200 gene rbsD 226768 227163 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 protein_id gnl|my_center|LOCUS_30200 227179 228660 gene locus_tag LOCUS_30210 gene rbsA 227179 228660 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 protein_id gnl|my_center|LOCUS_30210 228662 229630 gene locus_tag LOCUS_30220 gene rbsC 228662 229630 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_30220 229644 230561 gene locus_tag LOCUS_30230 gene rbsB 229644 230561 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 protein_id gnl|my_center|LOCUS_30230 230671 231207 gene locus_tag LOCUS_30240 230671 231207 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243596.1 protein_id gnl|my_center|LOCUS_30240 231362 231658 gene locus_tag LOCUS_30250 231362 231658 CDS product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243460.1 protein_id gnl|my_center|LOCUS_30250 232226 231699 gene locus_tag LOCUS_30260 232226 231699 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242788.1 protein_id gnl|my_center|LOCUS_30260 233092 232325 gene locus_tag LOCUS_30270 gene budA 233092 232325 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244457.1 protein_id gnl|my_center|LOCUS_30270 234866 233154 gene locus_tag LOCUS_30280 gene alsS 234866 233154 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244057.1 protein_id gnl|my_center|LOCUS_30280 235026 235913 gene locus_tag LOCUS_30290 gene alsR 235026 235913 CDS product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227859.1 protein_id gnl|my_center|LOCUS_30290 237043 235952 gene locus_tag LOCUS_30300 gene cotH 237043 235952 CDS product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227854.1 protein_id gnl|my_center|LOCUS_30300 237185 237625 gene locus_tag LOCUS_30310 237185 237625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 237796 238413 gene locus_tag LOCUS_30320 237796 238413 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227852.1 protein_id gnl|my_center|LOCUS_30320 238576 238911 gene locus_tag LOCUS_30330 238576 238911 CDS product DUF4181 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227850.1 protein_id gnl|my_center|LOCUS_30330 240493 238916 gene locus_tag LOCUS_30340 gene ggt 240493 238916 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_30340 240708 241184 gene locus_tag LOCUS_30350 gene chrS 240708 241184 CDS product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 protein_id gnl|my_center|LOCUS_30350 241198 241791 gene locus_tag LOCUS_30360 gene chrB 241198 241791 CDS product chromate efflux transporter subunit ChrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227843.1 protein_id gnl|my_center|LOCUS_30360 241788 242324 gene locus_tag LOCUS_30370 gene chrA 241788 242324 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_30370 242572 242351 gene locus_tag LOCUS_30380 242572 242351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243378.1 protein_id gnl|my_center|LOCUS_30380 243114 242569 gene locus_tag LOCUS_30390 243114 242569 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242945.1 protein_id gnl|my_center|LOCUS_30390 243237 244118 gene locus_tag LOCUS_30400 243237 244118 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243262.1 protein_id gnl|my_center|LOCUS_30400 246464 244179 gene locus_tag LOCUS_30410 246464 244179 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_30410 246622 247488 gene locus_tag LOCUS_30420 246622 247488 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_30420 248236 247520 gene locus_tag LOCUS_30430 248236 247520 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243213.1 protein_id gnl|my_center|LOCUS_30430 248784 248293 gene locus_tag LOCUS_30440 248784 248293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963657.1 protein_id gnl|my_center|LOCUS_30440 249650 248997 gene locus_tag LOCUS_30450 249650 248997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 250278 249727 gene locus_tag LOCUS_30460 250278 249727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 251412 250861 gene locus_tag LOCUS_30470 251412 250861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 253318 251417 gene locus_tag LOCUS_30480 253318 251417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 253597 253337 gene locus_tag LOCUS_30490 253597 253337 CDS product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221757.1 protein_id gnl|my_center|LOCUS_30490 254029 253607 gene locus_tag LOCUS_30500 254029 253607 CDS product DUF5082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242741.1 protein_id gnl|my_center|LOCUS_30500 254359 254096 gene locus_tag LOCUS_30510 254359 254096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 255723 254401 gene locus_tag LOCUS_30520 gene uglF 255723 254401 CDS product UDP-glucose 6-dehydrogenase UglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243223.1 protein_id gnl|my_center|LOCUS_30520 256683 255919 gene locus_tag LOCUS_30530 256683 255919 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_30530 257449 256733 gene locus_tag LOCUS_30540 gene ptkA 257449 256733 CDS product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 protein_id gnl|my_center|LOCUS_30540 258185 257439 gene locus_tag LOCUS_30550 gene tkmA 258185 257439 CDS product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 protein_id gnl|my_center|LOCUS_30550 258563 258420 gene locus_tag LOCUS_30560 258563 258420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242876.1 protein_id gnl|my_center|LOCUS_30560 258767 260377 gene locus_tag LOCUS_30570 258767 260377 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227806.1 protein_id gnl|my_center|LOCUS_30570 260364 263132 gene locus_tag LOCUS_30580 260364 263132 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227803.1 protein_id gnl|my_center|LOCUS_30580 264118 263261 gene locus_tag LOCUS_30590 gene ywpJ 264118 263261 CDS product phosphatase YwpJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242946.1 protein_id gnl|my_center|LOCUS_30590 264900 264124 gene locus_tag LOCUS_30600 gene glcR 264900 264124 CDS product transcriptional regulator GlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244075.1 protein_id gnl|my_center|LOCUS_30600 265466 265125 gene locus_tag LOCUS_30610 gene ssbB 265466 265125 CDS product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 protein_id gnl|my_center|LOCUS_30610 265926 265543 gene locus_tag LOCUS_30620 gene ywpG 265926 265543 CDS product DynA interaction protein YwpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227796.1 protein_id gnl|my_center|LOCUS_30620 266091 266513 gene locus_tag LOCUS_30630 266091 266513 CDS product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227794.1 protein_id gnl|my_center|LOCUS_30630 267284 266646 gene locus_tag LOCUS_30640 267284 266646 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722751.1 protein_id gnl|my_center|LOCUS_30640 273323 267381 gene locus_tag LOCUS_30650 273323 267381 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905155.1 protein_id gnl|my_center|LOCUS_30650 274720 273644 gene locus_tag LOCUS_30660 274720 273644 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 protein_id gnl|my_center|LOCUS_30660 274894 277974 gene locus_tag LOCUS_30670 274894 277974 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_30670 278406 278014 gene locus_tag LOCUS_30680 gene mscL 278406 278014 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_30680 278907 278482 gene locus_tag LOCUS_30690 gene fabZ 278907 278482 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_30690 279099 280163 gene locus_tag LOCUS_30700 gene rapD 279099 280163 CDS product aspartate phosphatase RapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227782.1 protein_id gnl|my_center|LOCUS_30700 280993 280184 gene locus_tag LOCUS_30710 gene flhP 280993 280184 CDS product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 protein_id gnl|my_center|LOCUS_30710 281878 281027 gene locus_tag LOCUS_30720 gene flhO 281878 281027 CDS product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 protein_id gnl|my_center|LOCUS_30720 283002 282001 gene locus_tag LOCUS_30730 gene mbl 283002 282001 CDS product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 protein_id gnl|my_center|LOCUS_30730 283462 283181 gene locus_tag LOCUS_30740 gene spoIIID 283462 283181 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 protein_id gnl|my_center|LOCUS_30740 283811 284224 gene locus_tag LOCUS_30750 283811 284224 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227771.1 protein_id gnl|my_center|LOCUS_30750 284246 285436 gene locus_tag LOCUS_30760 284246 285436 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227769.1 protein_id gnl|my_center|LOCUS_30760 286938 285532 gene locus_tag LOCUS_30770 286938 285532 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243080.1 protein_id gnl|my_center|LOCUS_30770 288511 287045 gene locus_tag LOCUS_30780 gene pucI 288511 287045 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243156.1 protein_id gnl|my_center|LOCUS_30780 289996 288692 gene locus_tag LOCUS_30790 289996 288692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243939.1 protein_id gnl|my_center|LOCUS_30790 290619 290050 gene locus_tag LOCUS_30800 290619 290050 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227761.1 protein_id gnl|my_center|LOCUS_30800 291265 290804 gene locus_tag LOCUS_30810 291265 290804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244424.1 protein_id gnl|my_center|LOCUS_30810 291536 292750 gene locus_tag LOCUS_30820 gene amtB 291536 292750 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227757.1 protein_id gnl|my_center|LOCUS_30820 292762 293112 gene locus_tag LOCUS_30830 292762 293112 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221829.1 protein_id gnl|my_center|LOCUS_30830 293290 293871 gene locus_tag LOCUS_30840 gene bcrC 293290 293871 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_30840 294334 293897 gene locus_tag LOCUS_30850 294334 293897 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227753.1 protein_id gnl|my_center|LOCUS_30850 295317 294445 gene locus_tag LOCUS_30860 gene spoIIQ 295317 294445 CDS product stage II sporulation protein spoIIQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227751.1 protein_id gnl|my_center|LOCUS_30860 295452 295949 gene locus_tag LOCUS_30870 295452 295949 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886629.1 protein_id gnl|my_center|LOCUS_30870 295946 296455 gene locus_tag LOCUS_30880 295946 296455 CDS product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227749.1 protein_id gnl|my_center|LOCUS_30880 296686 298476 gene locus_tag LOCUS_30890 296686 298476 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627530.1 protein_id gnl|my_center|LOCUS_30890 299017 298583 gene locus_tag LOCUS_30900 299017 298583 CDS product DUF5392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244359.1 protein_id gnl|my_center|LOCUS_30900 299261 300709 gene locus_tag LOCUS_30910 gene cls 299261 300709 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_30910 301504 300731 gene locus_tag LOCUS_30920 gene mta 301504 300731 CDS product transcriptional activator Mta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242936.1 protein_id gnl|my_center|LOCUS_30920 301650 302039 gene locus_tag LOCUS_30930 301650 302039 CDS product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227738.1 protein_id gnl|my_center|LOCUS_30930 302715 302074 gene locus_tag LOCUS_30940 302715 302074 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 protein_id gnl|my_center|LOCUS_30940 303185 302784 gene locus_tag LOCUS_30950 303185 302784 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227734.1 protein_id gnl|my_center|LOCUS_30950 305028 303319 gene locus_tag LOCUS_30960 gene ureC 305028 303319 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243090.1 protein_id gnl|my_center|LOCUS_30960 305399 305025 gene locus_tag LOCUS_30970 gene ureB 305399 305025 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227726.1 protein_id gnl|my_center|LOCUS_30970 305713 305396 gene locus_tag LOCUS_30980 gene ureA 305713 305396 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227724.1 protein_id gnl|my_center|LOCUS_30980 306514 305813 gene locus_tag LOCUS_30990 gene urtE 306514 305813 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 protein_id gnl|my_center|LOCUS_30990 307260 306511 gene locus_tag LOCUS_31000 gene urtD 307260 306511 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972305.1 protein_id gnl|my_center|LOCUS_31000 308305 307235 gene locus_tag LOCUS_31010 gene urtC 308305 307235 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_31010 309219 308317 gene locus_tag LOCUS_31020 gene urtB 309219 308317 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_31020 310508 309252 gene locus_tag LOCUS_31030 gene urtA 310508 309252 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_31030 310905 310717 gene locus_tag LOCUS_31040 gene csbD 310905 310717 CDS product stress response protein CsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227718.1 protein_id gnl|my_center|LOCUS_31040 311456 310977 gene locus_tag LOCUS_31050 311456 310977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244390.1 protein_id gnl|my_center|LOCUS_31050 312760 311627 gene locus_tag LOCUS_31060 gene rapB 312760 311627 CDS product response regulator aspartate phosphatase RapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227715.1 protein_id gnl|my_center|LOCUS_31060 313982 312957 gene locus_tag LOCUS_31070 gene moaA 313982 312957 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 protein_id gnl|my_center|LOCUS_31070 314786 313998 gene locus_tag LOCUS_31080 gene fdhD 314786 313998 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_31080 315047 314886 gene locus_tag LOCUS_31090 315047 314886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227706.1 protein_id gnl|my_center|LOCUS_31090 315817 315143 gene locus_tag LOCUS_31100 315817 315143 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243553.1 protein_id gnl|my_center|LOCUS_31100 316822 316139 gene locus_tag LOCUS_31110 316822 316139 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227700.1 protein_id gnl|my_center|LOCUS_31110 318240 317209 gene locus_tag LOCUS_31120 gene spoIID 318240 317209 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_31120 319746 318436 gene locus_tag LOCUS_31130 gene murA 319746 318436 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_31130 320520 319780 gene locus_tag LOCUS_31140 320520 319780 CDS product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244344.1 protein_id gnl|my_center|LOCUS_31140 320885 320655 gene locus_tag LOCUS_31150 320885 320655 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 protein_id gnl|my_center|LOCUS_31150 321063 321536 gene locus_tag LOCUS_31160 321063 321536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243900.1 protein_id gnl|my_center|LOCUS_31160 321969 321571 gene locus_tag LOCUS_31170 321969 321571 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_31170 323414 321993 gene locus_tag LOCUS_31180 gene atpD 323414 321993 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227686.1 protein_id gnl|my_center|LOCUS_31180 324303 323440 gene locus_tag LOCUS_31190 gene atpG 324303 323440 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_31190 325888 324380 gene locus_tag LOCUS_31200 gene atpA 325888 324380 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 protein_id gnl|my_center|LOCUS_31200 326450 325905 gene locus_tag LOCUS_31210 326450 325905 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243176.1 protein_id gnl|my_center|LOCUS_31210 326959 326447 gene locus_tag LOCUS_31220 gene atpF 326959 326447 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_31220 327334 327122 gene locus_tag LOCUS_31230 gene atpE 327334 327122 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151167.1 protein_id gnl|my_center|LOCUS_31230 328114 327380 gene locus_tag LOCUS_31240 gene atpB 328114 327380 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242621.1 protein_id gnl|my_center|LOCUS_31240 328508 328122 gene locus_tag LOCUS_31250 gene atpI 328508 328122 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243159.1 protein_id gnl|my_center|LOCUS_31250 329554 328925 gene locus_tag LOCUS_31260 gene upp 329554 328925 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227670.1 protein_id gnl|my_center|LOCUS_31260 330936 329689 gene locus_tag LOCUS_31270 gene glyA 330936 329689 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_31270 331684 331142 gene locus_tag LOCUS_31280 331684 331142 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_31280 332146 331697 gene locus_tag LOCUS_31290 gene rpiB 332146 331697 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_31290 332754 332302 gene locus_tag LOCUS_31300 gene prpB 332754 332302 CDS product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 protein_id gnl|my_center|LOCUS_31300 333389 332832 gene locus_tag LOCUS_31310 333389 332832 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_31310 334507 333467 gene locus_tag LOCUS_31320 334507 333467 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227659.1 protein_id gnl|my_center|LOCUS_31320 335108 334665 gene locus_tag LOCUS_31330 335108 334665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244265.1 protein_id gnl|my_center|LOCUS_31330 335849 335175 gene locus_tag LOCUS_31340 gene spoIIR 335849 335175 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_31340 335990 336352 gene locus_tag LOCUS_31350 335990 336352 CDS product UPF0715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227651.1 protein_id gnl|my_center|LOCUS_31350 336655 336371 gene locus_tag LOCUS_31360 336655 336371 CDS product DUF5316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244050.1 protein_id gnl|my_center|LOCUS_31360 337583 336717 gene locus_tag LOCUS_31370 gene prmC 337583 336717 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227647.1 protein_id gnl|my_center|LOCUS_31370 338655 337585 gene locus_tag LOCUS_31380 gene prfA 338655 337585 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_31380 338784 339167 gene locus_tag LOCUS_31390 338784 339167 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_31390 339289 339843 gene locus_tag LOCUS_31400 gene racA 339289 339843 CDS product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227642.1 protein_id gnl|my_center|LOCUS_31400 340834 339878 gene locus_tag LOCUS_31410 340834 339878 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242497.1 protein_id gnl|my_center|LOCUS_31410 342613 340916 gene locus_tag LOCUS_31420 gene malS 342613 340916 CDS product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227639.1 protein_id gnl|my_center|LOCUS_31420 343489 342902 gene locus_tag LOCUS_31430 343489 342902 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_31430 343778 343578 gene locus_tag LOCUS_31440 gene rpmE 343778 343578 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_31440 345180 343897 gene locus_tag LOCUS_31450 gene rho 345180 343897 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221939.1 protein_id gnl|my_center|LOCUS_31450 346548 345583 gene locus_tag LOCUS_31460 gene glpX 346548 345583 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242962.1 protein_id gnl|my_center|LOCUS_31460 347868 346579 gene locus_tag LOCUS_31470 347868 346579 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_31470 348885 348247 gene locus_tag LOCUS_31480 gene fsa 348885 348247 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227626.1 protein_id gnl|my_center|LOCUS_31480 349861 349004 gene locus_tag LOCUS_31490 349861 349004 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 protein_id gnl|my_center|LOCUS_31490 350412 350041 gene locus_tag LOCUS_31500 gene spo0F 350412 350041 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 protein_id gnl|my_center|LOCUS_31500 350581 351102 gene locus_tag LOCUS_31510 350581 351102 CDS product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242809.1 protein_id gnl|my_center|LOCUS_31510 352792 351185 gene locus_tag LOCUS_31520 gene pyrG 352792 351185 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_31520 353553 353032 gene locus_tag LOCUS_31530 353553 353032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 354875 353736 gene locus_tag LOCUS_31540 gene acdA 354875 353736 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_31540 356989 354872 gene locus_tag LOCUS_31550 356989 354872 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244084.1 protein_id gnl|my_center|LOCUS_31550 357144 358343 gene locus_tag LOCUS_31560 gene cls 357144 358343 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227602.1 protein_id gnl|my_center|LOCUS_31560 358356 359318 gene locus_tag LOCUS_31570 gene uvsE 358356 359318 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227599.1 protein_id gnl|my_center|LOCUS_31570 359399 359671 gene locus_tag LOCUS_31580 359399 359671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227597.1 protein_id gnl|my_center|LOCUS_31580 360245 359721 gene locus_tag LOCUS_31590 360245 359721 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227595.1 protein_id gnl|my_center|LOCUS_31590 361898 360255 gene locus_tag LOCUS_31600 361898 360255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968321.1 protein_id gnl|my_center|LOCUS_31600 363570 362068 gene locus_tag LOCUS_31610 gene cls 363570 362068 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242612.1 protein_id gnl|my_center|LOCUS_31610 364301 363672 gene locus_tag LOCUS_31620 364301 363672 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 protein_id gnl|my_center|LOCUS_31620 365144 364473 gene locus_tag LOCUS_31630 gene narI 365144 364473 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242665.1 protein_id gnl|my_center|LOCUS_31630 365695 365141 gene locus_tag LOCUS_31640 gene narJ 365695 365141 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 protein_id gnl|my_center|LOCUS_31640 367184 365721 gene locus_tag LOCUS_31650 gene narH 367184 365721 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244173.1 protein_id gnl|my_center|LOCUS_31650 370860 367174 gene locus_tag LOCUS_31660 370860 367174 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243085.1 protein_id gnl|my_center|LOCUS_31660 371554 371078 gene locus_tag LOCUS_31670 gene arfM 371554 371078 CDS product Crp/Fnr family transcriptional regulator ArfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243032.1 protein_id gnl|my_center|LOCUS_31670 371737 372417 gene locus_tag LOCUS_31680 371737 372417 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243773.1 protein_id gnl|my_center|LOCUS_31680 373166 372450 gene locus_tag LOCUS_31690 gene fnr 373166 372450 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 protein_id gnl|my_center|LOCUS_31690 374451 373264 gene locus_tag LOCUS_31700 gene narK 374451 373264 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886631.1 protein_id gnl|my_center|LOCUS_31700 376256 374586 gene locus_tag LOCUS_31710 gene argS 376256 374586 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_31710 376681 376253 gene locus_tag LOCUS_31720 376681 376253 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243604.1 protein_id gnl|my_center|LOCUS_31720 376995 377126 gene locus_tag LOCUS_31730 gene sboA 376995 377126 CDS product subtilosin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222002.1 protein_id gnl|my_center|LOCUS_31730 377271 378617 gene locus_tag LOCUS_31740 gene albA 377271 378617 CDS product subtilosin maturase AlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242599.1 protein_id gnl|my_center|LOCUS_31740 378630 378791 gene locus_tag LOCUS_31750 gene albB 378630 378791 CDS product antilisterial bacteriocin subtilosin biosynthesis protein AlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222006.1 protein_id gnl|my_center|LOCUS_31750 378788 379507 gene locus_tag LOCUS_31760 378788 379507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 protein_id gnl|my_center|LOCUS_31760 379500 380810 gene locus_tag LOCUS_31770 gene albD 379500 380810 CDS product antilisterial bacteriocin subtilosin biosynthesis protein AlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243158.1 protein_id gnl|my_center|LOCUS_31770 380776 381960 gene locus_tag LOCUS_31780 gene albE 380776 381960 CDS product antilisterial bacteriocin subtilosin biosynthesis protein AlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886633.1 protein_id gnl|my_center|LOCUS_31780 381965 383248 gene locus_tag LOCUS_31790 381965 383248 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242974.1 protein_id gnl|my_center|LOCUS_31790 383245 383946 gene locus_tag LOCUS_31800 gene albG 383245 383946 CDS product antilisterial bacteriocin subtilosin biosynthesis protein AlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243391.1 protein_id gnl|my_center|LOCUS_31800 385438 384083 gene locus_tag LOCUS_31810 385438 384083 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227552.1 protein_id gnl|my_center|LOCUS_31810 385665 386810 gene locus_tag LOCUS_31820 gene rapF 385665 386810 CDS product response regulator aspartate phosphatase RapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227549.1 protein_id gnl|my_center|LOCUS_31820 386794 386913 gene locus_tag LOCUS_31830 gene phrF 386794 386913 CDS product phosphatase RapF inhibitor PhrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968329.1 protein_id gnl|my_center|LOCUS_31830 387938 387066 gene locus_tag LOCUS_31840 gene speB 387938 387066 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227545.1 protein_id gnl|my_center|LOCUS_31840 388829 387999 gene locus_tag LOCUS_31850 gene speE 388829 387999 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227543.1 protein_id gnl|my_center|LOCUS_31850 389031 391106 gene locus_tag LOCUS_31860 389031 391106 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 protein_id gnl|my_center|LOCUS_31860 391945 391427 gene locus_tag LOCUS_31870 391945 391427 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_31870 392617 391958 gene locus_tag LOCUS_31880 392617 391958 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 protein_id gnl|my_center|LOCUS_31880 392726 392914 gene locus_tag LOCUS_31890 392726 392914 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222038.1 protein_id gnl|my_center|LOCUS_31890 393377 392958 gene locus_tag LOCUS_31900 393377 392958 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242889.1 protein_id gnl|my_center|LOCUS_31900 395413 393497 gene locus_tag LOCUS_31910 gene thrS 395413 393497 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 protein_id gnl|my_center|LOCUS_31910 396816 396316 gene locus_tag LOCUS_31920 396816 396316 CDS product YwgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227524.1 protein_id gnl|my_center|LOCUS_31920 398153 396852 gene locus_tag LOCUS_31930 398153 396852 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_31930 398539 398315 gene locus_tag LOCUS_31940 398539 398315 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 protein_id gnl|my_center|LOCUS_31940 398754 399539 gene locus_tag LOCUS_31950 gene rsfA 398754 399539 CDS product prespore-specific transcription regulator RsfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243464.1 protein_id gnl|my_center|LOCUS_31950 400573 399683 gene locus_tag LOCUS_31960 400573 399683 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 protein_id gnl|my_center|LOCUS_31960 401587 400742 gene locus_tag LOCUS_31970 gene ywfL 401587 400742 CDS product octanoyl-[GcvH]:protein N-octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227511.1 protein_id gnl|my_center|LOCUS_31970 402534 401635 gene locus_tag LOCUS_31980 gene cysL 402534 401635 CDS product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 protein_id gnl|my_center|LOCUS_31980 403652 402681 gene locus_tag LOCUS_31990 gene pta 403652 402681 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 protein_id gnl|my_center|LOCUS_31990 403922 404686 gene locus_tag LOCUS_32000 403922 404686 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 protein_id gnl|my_center|LOCUS_32000 404819 405598 gene locus_tag LOCUS_32010 gene bacG 404819 405598 CDS product NADPH-dependent reductase BacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244095.1 protein_id gnl|my_center|LOCUS_32010 406812 405613 gene locus_tag LOCUS_32020 gene bacF 406812 405613 CDS product transaminase BacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242568.1 protein_id gnl|my_center|LOCUS_32020 407997 406813 gene locus_tag LOCUS_32030 gene bacE 407997 406813 CDS product bacilysin exporter BacE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244502.1 protein_id gnl|my_center|LOCUS_32030 409412 407994 gene locus_tag LOCUS_32040 gene bacD 409412 407994 CDS product alanine--anticapsin ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242921.1 protein_id gnl|my_center|LOCUS_32040 410192 409431 gene locus_tag LOCUS_32050 gene bacC 410192 409431 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_32050 410902 410195 gene locus_tag LOCUS_32060 gene bacB 410902 410195 CDS product 3-((4R)-4-hydroxycyclohexa-1,5-dien-1-yl)-2-oxopropanoate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244300.1 protein_id gnl|my_center|LOCUS_32060 411506 410892 gene locus_tag LOCUS_32070 gene bacA 411506 410892 CDS product prephenate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968341.1 protein_id gnl|my_center|LOCUS_32070 412897 411659 gene locus_tag LOCUS_32080 412897 411659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242790.1 protein_id gnl|my_center|LOCUS_32080 414526 413114 gene locus_tag LOCUS_32090 414526 413114 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244348.1 protein_id gnl|my_center|LOCUS_32090 416226 414526 gene locus_tag LOCUS_32100 416226 414526 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227487.1 protein_id gnl|my_center|LOCUS_32100 417846 416299 gene locus_tag LOCUS_32110 gene pruA 417846 416299 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 protein_id gnl|my_center|LOCUS_32110 419359 418085 gene locus_tag LOCUS_32120 gene rocG 419359 418085 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227482.1 protein_id gnl|my_center|LOCUS_32120 419997 419533 gene locus_tag LOCUS_32130 gene bslB 419997 419533 CDS product biofilm-surface layer protein BslB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242493.1 protein_id gnl|my_center|LOCUS_32130 420777 420322 gene locus_tag LOCUS_32140 420777 420322 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_32140 421621 420770 gene locus_tag LOCUS_32150 gene rfbD 421621 420770 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_32150 422585 421635 gene locus_tag LOCUS_32160 gene rfbB 422585 421635 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244201.1 protein_id gnl|my_center|LOCUS_32160 423322 422582 gene locus_tag LOCUS_32170 423322 422582 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243368.1 protein_id gnl|my_center|LOCUS_32170 424366 423347 gene locus_tag LOCUS_32180 424366 423347 CDS product PseG/SpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244190.1 protein_id gnl|my_center|LOCUS_32180 425091 424369 gene locus_tag LOCUS_32190 425091 424369 CDS product spore coat polysaccharide biosynthesis protein SpsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243421.1 protein_id gnl|my_center|LOCUS_32190 426205 425084 gene locus_tag LOCUS_32200 426205 425084 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243135.1 protein_id gnl|my_center|LOCUS_32200 427074 426205 gene locus_tag LOCUS_32210 427074 426205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243179.1 protein_id gnl|my_center|LOCUS_32210 428244 427075 gene locus_tag LOCUS_32220 428244 427075 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_32220 429689 428265 gene locus_tag LOCUS_32230 429689 428265 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243510.1 protein_id gnl|my_center|LOCUS_32230 430464 429694 gene locus_tag LOCUS_32240 gene spsA 430464 429694 CDS product spore coat dTDP-glycosyltransferase SpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244383.1 protein_id gnl|my_center|LOCUS_32240 430784 431329 gene locus_tag LOCUS_32250 gene gerQ 430784 431329 CDS product spore coat protein GerQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227448.1 protein_id gnl|my_center|LOCUS_32250 431744 431373 gene locus_tag LOCUS_32260 431744 431373 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_32260 433137 431806 gene locus_tag LOCUS_32270 433137 431806 CDS product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886635.1 protein_id gnl|my_center|LOCUS_32270 433464 433147 gene locus_tag LOCUS_32280 433464 433147 CDS product YwdI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243806.1 protein_id gnl|my_center|LOCUS_32280 433632 435002 gene locus_tag LOCUS_32290 433632 435002 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227441.1 protein_id gnl|my_center|LOCUS_32290 435705 435028 gene locus_tag LOCUS_32300 435705 435028 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 protein_id gnl|my_center|LOCUS_32300 436525 435719 gene locus_tag LOCUS_32310 436525 435719 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242519.1 protein_id gnl|my_center|LOCUS_32310 437148 436615 gene locus_tag LOCUS_32320 437148 436615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968358.1 protein_id gnl|my_center|LOCUS_32320 437831 437196 gene locus_tag LOCUS_32330 437831 437196 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227434.1 protein_id gnl|my_center|LOCUS_32330 438162 437824 gene locus_tag LOCUS_32340 438162 437824 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_32340 438306 439121 gene locus_tag LOCUS_32350 438306 439121 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242645.1 protein_id gnl|my_center|LOCUS_32350 439458 439210 gene locus_tag LOCUS_32360 439458 439210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243437.1 protein_id gnl|my_center|LOCUS_32360 440990 439551 gene locus_tag LOCUS_32370 gene sacA 440990 439551 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_32370 442372 440987 gene locus_tag LOCUS_32380 gene scrA 442372 440987 CDS product PTS system sucrose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227426.1 protein_id gnl|my_center|LOCUS_32380 442673 443443 gene locus_tag LOCUS_32390 442673 443443 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243563.1 protein_id gnl|my_center|LOCUS_32390 444312 443482 gene locus_tag LOCUS_32400 gene sacT 444312 443482 CDS product sac operon transcriptional antiterminator SacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243088.1 protein_id gnl|my_center|LOCUS_32400 444654 444352 gene locus_tag LOCUS_32410 444654 444352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222155.1 protein_id gnl|my_center|LOCUS_32410 445183 447603 gene locus_tag LOCUS_32420 gene vpr 445183 447603 CDS product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 protein_id gnl|my_center|LOCUS_32420 448642 447641 gene locus_tag LOCUS_32430 448642 447641 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244349.1 protein_id gnl|my_center|LOCUS_32430 449567 448818 gene locus_tag LOCUS_32440 gene nfsA 449567 448818 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244098.1 protein_id gnl|my_center|LOCUS_32440 450857 449673 gene locus_tag LOCUS_32450 gene rodA 450857 449673 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227413.1 protein_id gnl|my_center|LOCUS_32450 451488 451186 gene locus_tag LOCUS_32460 451488 451186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32460 451639 451493 gene locus_tag LOCUS_32470 451639 451493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 452167 451745 gene locus_tag LOCUS_32480 452167 451745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32480 452440 452700 gene locus_tag LOCUS_32490 gene ywcE 452440 452700 CDS product spore morphogenesis/germination protein YwcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227411.1 protein_id gnl|my_center|LOCUS_32490 453315 452941 gene locus_tag LOCUS_32500 gene qoxD 453315 452941 CDS product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227410.1 protein_id gnl|my_center|LOCUS_32500 453931 453317 gene locus_tag LOCUS_32510 gene qoxC 453931 453317 CDS product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227409.1 protein_id gnl|my_center|LOCUS_32510 455894 453945 gene locus_tag LOCUS_32520 gene qoxB 455894 453945 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 protein_id gnl|my_center|LOCUS_32520 456878 455922 gene locus_tag LOCUS_32530 gene qoxA 456878 455922 CDS product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886637.1 protein_id gnl|my_center|LOCUS_32530 457401 457646 gene locus_tag LOCUS_32540 457401 457646 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968363.1 protein_id gnl|my_center|LOCUS_32540 459257 457716 gene locus_tag LOCUS_32550 gene galT 459257 457716 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 protein_id gnl|my_center|LOCUS_32550 460433 459261 gene locus_tag LOCUS_32560 460433 459261 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227400.1 protein_id gnl|my_center|LOCUS_32560 460922 460518 gene locus_tag LOCUS_32570 460922 460518 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 protein_id gnl|my_center|LOCUS_32570 461590 460919 gene locus_tag LOCUS_32580 gene slrC 461590 460919 CDS product transcriptional regulator SlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227396.1 protein_id gnl|my_center|LOCUS_32580 461943 462101 gene locus_tag LOCUS_32590 gene slrA 461943 462101 CDS product transcriptional regulator SlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243648.1 protein_id gnl|my_center|LOCUS_32590 462541 462849 gene locus_tag LOCUS_32600 462541 462849 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227392.1 protein_id gnl|my_center|LOCUS_32600 462846 464387 gene locus_tag LOCUS_32610 462846 464387 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227390.1 protein_id gnl|my_center|LOCUS_32610 465019 464420 gene locus_tag LOCUS_32620 465019 464420 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 protein_id gnl|my_center|LOCUS_32620 466358 465108 gene locus_tag LOCUS_32630 gene efeB 466358 465108 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243445.1 protein_id gnl|my_center|LOCUS_32630 466715 466377 gene locus_tag LOCUS_32640 466715 466377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 467533 466871 gene locus_tag LOCUS_32650 gene thiE 467533 466871 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244128.1 protein_id gnl|my_center|LOCUS_32650 468348 467530 gene locus_tag LOCUS_32660 gene thiM 468348 467530 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244274.1 protein_id gnl|my_center|LOCUS_32660 469261 468356 gene locus_tag LOCUS_32670 469261 468356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_32670 469367 469753 gene locus_tag LOCUS_32680 469367 469753 CDS product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227375.1 protein_id gnl|my_center|LOCUS_32680 469735 470412 gene locus_tag LOCUS_32690 469735 470412 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227371.1 protein_id gnl|my_center|LOCUS_32690 471117 470467 gene locus_tag LOCUS_32700 471117 470467 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_32700 472091 471819 gene locus_tag LOCUS_32710 472091 471819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 473316 472519 gene locus_tag LOCUS_32720 473316 472519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 473813 473382 gene locus_tag LOCUS_32730 473813 473382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 474221 475423 gene locus_tag LOCUS_32740 474221 475423 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 protein_id gnl|my_center|LOCUS_32740 475457 475654 gene locus_tag LOCUS_32750 475457 475654 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243869.1 protein_id gnl|my_center|LOCUS_32750 476876 475689 gene locus_tag LOCUS_32760 476876 475689 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244593.1 protein_id gnl|my_center|LOCUS_32760 476998 477378 gene locus_tag LOCUS_32770 gene glxA 476998 477378 CDS product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 protein_id gnl|my_center|LOCUS_32770 478093 477416 gene locus_tag LOCUS_32780 478093 477416 CDS product DUF2711 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242887.1 protein_id gnl|my_center|LOCUS_32780 479496 478174 gene locus_tag LOCUS_32790 gene celB 479496 478174 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242539.1 protein_id gnl|my_center|LOCUS_32790 479720 481657 gene locus_tag LOCUS_32800 gene epr 479720 481657 CDS product minor protease Epr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243950.1 protein_id gnl|my_center|LOCUS_32800 482101 483480 gene locus_tag LOCUS_32810 gene sacX 482101 483480 CDS product SacY negative regulator SacX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243800.1 protein_id gnl|my_center|LOCUS_32810 483534 484376 gene locus_tag LOCUS_32820 gene sacY 483534 484376 CDS product transcription antiterminator SacY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244589.1 protein_id gnl|my_center|LOCUS_32820 485289 484429 gene locus_tag LOCUS_32830 485289 484429 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 protein_id gnl|my_center|LOCUS_32830 486113 485400 gene locus_tag LOCUS_32840 486113 485400 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242863.1 protein_id gnl|my_center|LOCUS_32840 486264 486779 gene locus_tag LOCUS_32850 gene ywaE 486264 486779 CDS product tyrZ transcriptional regulator YwaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243598.1 protein_id gnl|my_center|LOCUS_32850 487031 488269 gene locus_tag LOCUS_32860 gene tyrS 487031 488269 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886638.1 protein_id gnl|my_center|LOCUS_32860 488424 489791 gene locus_tag LOCUS_32870 gene ywaD 488424 489791 CDS product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 protein_id gnl|my_center|LOCUS_32870 490450 489818 gene locus_tag LOCUS_32880 gene ywaC 490450 489818 CDS product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 protein_id gnl|my_center|LOCUS_32880 491202 490690 gene locus_tag LOCUS_32890 491202 490690 CDS product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830214.1 protein_id gnl|my_center|LOCUS_32890 492491 491556 gene locus_tag LOCUS_32900 492491 491556 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968370.1 protein_id gnl|my_center|LOCUS_32900 493087 494601 gene locus_tag LOCUS_32910 gene dltA 493087 494601 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242511.1 protein_id gnl|my_center|LOCUS_32910 494598 495785 gene locus_tag LOCUS_32920 gene dltB 494598 495785 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227327.1 protein_id gnl|my_center|LOCUS_32920 495802 496038 gene locus_tag LOCUS_32930 gene dltC 495802 496038 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227325.1 protein_id gnl|my_center|LOCUS_32930 496038 497216 gene locus_tag LOCUS_32940 gene dltD 496038 497216 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227323.1 protein_id gnl|my_center|LOCUS_32940 497304 498062 gene locus_tag LOCUS_32950 497304 498062 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_32950 498204 499295 gene locus_tag LOCUS_32960 498204 499295 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_32960 500657 499329 gene locus_tag LOCUS_32970 gene licH 500657 499329 CDS product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 protein_id gnl|my_center|LOCUS_32970 500917 500654 gene locus_tag LOCUS_32980 gene licA 500917 500654 CDS product PTS lichenan transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227313.1 protein_id gnl|my_center|LOCUS_32980 502363 501005 gene locus_tag LOCUS_32990 gene licC 502363 501005 CDS product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 protein_id gnl|my_center|LOCUS_32990 502687 502379 gene locus_tag LOCUS_33000 gene licB 502687 502379 CDS product PTS lichenan transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218755.1 protein_id gnl|my_center|LOCUS_33000 504736 502811 gene locus_tag LOCUS_33010 gene licR 504736 502811 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_33010 505665 505075 gene locus_tag LOCUS_33020 505665 505075 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227303.1 protein_id gnl|my_center|LOCUS_33020 505794 507437 gene locus_tag LOCUS_33030 gene katX 505794 507437 CDS product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 protein_id gnl|my_center|LOCUS_33030 507539 508741 gene locus_tag LOCUS_33040 507539 508741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 protein_id gnl|my_center|LOCUS_33040 509514 508738 gene locus_tag LOCUS_33050 509514 508738 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243335.1 protein_id gnl|my_center|LOCUS_33050 510398 509511 gene locus_tag LOCUS_33060 510398 509511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244494.1 protein_id gnl|my_center|LOCUS_33060 510593 510405 gene locus_tag LOCUS_33070 510593 510405 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227293.1 protein_id gnl|my_center|LOCUS_33070 510796 510590 gene locus_tag LOCUS_33080 gene yxlD 510796 510590 CDS product sigma Y negative regulator YxlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242917.1 protein_id gnl|my_center|LOCUS_33080 511113 510793 gene locus_tag LOCUS_33090 511113 510793 CDS product YxlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227289.1 protein_id gnl|my_center|LOCUS_33090 511642 511106 gene locus_tag LOCUS_33100 gene sigY 511642 511106 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_33100 511854 513224 gene locus_tag LOCUS_33110 511854 513224 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244111.1 protein_id gnl|my_center|LOCUS_33110 514068 513238 gene locus_tag LOCUS_33120 514068 513238 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244033.1 protein_id gnl|my_center|LOCUS_33120 515882 514155 gene locus_tag LOCUS_33130 gene cydC 515882 514155 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244401.1 protein_id gnl|my_center|LOCUS_33130 517582 515879 gene locus_tag LOCUS_33140 gene cydD 517582 515879 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244017.1 protein_id gnl|my_center|LOCUS_33140 518598 517582 gene locus_tag LOCUS_33150 gene cydB 518598 517582 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244559.1 protein_id gnl|my_center|LOCUS_33150 519988 518582 gene locus_tag LOCUS_33160 gene cydA 519988 518582 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243795.1 protein_id gnl|my_center|LOCUS_33160 520545 521897 gene locus_tag LOCUS_33170 gene cimH 520545 521897 CDS product citrate/malate transporter CimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227271.1 protein_id gnl|my_center|LOCUS_33170 522022 523509 gene locus_tag LOCUS_33180 522022 523509 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886639.1 protein_id gnl|my_center|LOCUS_33180 523768 523968 gene locus_tag LOCUS_33190 523768 523968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 524821 523982 gene locus_tag LOCUS_33200 524821 523982 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244194.1 protein_id gnl|my_center|LOCUS_33200 525442 525092 gene locus_tag LOCUS_33210 525442 525092 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232839.1 protein_id gnl|my_center|LOCUS_33210 526385 525657 gene locus_tag LOCUS_33220 526385 525657 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_33220 527588 526491 gene locus_tag LOCUS_33230 gene msmX 527588 526491 CDS product maltodextrin ABC transporter ATP-binding protein MsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242648.1 protein_id gnl|my_center|LOCUS_33230 528601 527708 gene locus_tag LOCUS_33240 528601 527708 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242549.1 protein_id gnl|my_center|LOCUS_33240 528787 530244 gene locus_tag LOCUS_33250 528787 530244 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243062.1 protein_id gnl|my_center|LOCUS_33250 531120 530284 gene locus_tag LOCUS_33260 531120 530284 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242615.1 protein_id gnl|my_center|LOCUS_33260 531580 532218 gene locus_tag LOCUS_33270 531580 532218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 533313 532294 gene locus_tag LOCUS_33280 gene galE 533313 532294 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_33280 533832 535064 gene locus_tag LOCUS_33290 gene pepT 533832 535064 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_33290 535169 535294 gene locus_tag LOCUS_33300 535169 535294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 535681 535851 gene locus_tag LOCUS_33310 535681 535851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 536027 536515 gene locus_tag LOCUS_33320 536027 536515 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242923.1 protein_id gnl|my_center|LOCUS_33320 536772 537905 gene locus_tag LOCUS_33330 536772 537905 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244296.1 protein_id gnl|my_center|LOCUS_33330 538058 538252 gene locus_tag LOCUS_33340 538058 538252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 538158 539294 gene locus_tag LOCUS_33350 538158 539294 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244221.1 protein_id gnl|my_center|LOCUS_33350 540119 539346 gene locus_tag LOCUS_33360 540119 539346 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244042.1 protein_id gnl|my_center|LOCUS_33360 540792 540136 gene locus_tag LOCUS_33370 540792 540136 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243049.1 protein_id gnl|my_center|LOCUS_33370 541505 540789 gene locus_tag LOCUS_33380 541505 540789 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 protein_id gnl|my_center|LOCUS_33380 542947 541529 gene locus_tag LOCUS_33390 542947 541529 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243205.1 protein_id gnl|my_center|LOCUS_33390 543658 543098 gene locus_tag LOCUS_33400 543658 543098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 544573 545766 gene locus_tag LOCUS_33410 544573 545766 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227216.1 protein_id gnl|my_center|LOCUS_33410 546482 545811 gene locus_tag LOCUS_33420 546482 545811 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810357.1 protein_id gnl|my_center|LOCUS_33420 546915 546625 gene locus_tag LOCUS_33430 546915 546625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242704.1 protein_id gnl|my_center|LOCUS_33430 549025 546965 gene locus_tag LOCUS_33440 549025 546965 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_33440 549221 550501 gene locus_tag LOCUS_33450 gene citH 549221 550501 CDS product citrate transporter CitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227205.1 protein_id gnl|my_center|LOCUS_33450 550600 551184 gene locus_tag LOCUS_33460 550600 551184 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886423.1 protein_id gnl|my_center|LOCUS_33460 552328 551222 gene locus_tag LOCUS_33470 552328 551222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 553846 552425 gene locus_tag LOCUS_33480 553846 552425 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_33480 555699 553867 gene locus_tag LOCUS_33490 555699 553867 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 protein_id gnl|my_center|LOCUS_33490 556847 556014 gene locus_tag LOCUS_33500 gene licT 556847 556014 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_33500 557622 556942 gene locus_tag LOCUS_33510 557622 556942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886641.1 protein_id gnl|my_center|LOCUS_33510 557828 559114 gene locus_tag LOCUS_33520 557828 559114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 protein_id gnl|my_center|LOCUS_33520 560572 559133 gene locus_tag LOCUS_33530 gene dbpA 560572 559133 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243023.1 protein_id gnl|my_center|LOCUS_33530 561802 560654 gene locus_tag LOCUS_33540 561802 560654 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242617.1 protein_id gnl|my_center|LOCUS_33540 561967 562302 gene locus_tag LOCUS_33550 561967 562302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 562305 562862 gene locus_tag LOCUS_33560 562305 562862 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986155.1 protein_id gnl|my_center|LOCUS_33560 563318 562881 gene locus_tag LOCUS_33570 563318 562881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 564270 563920 gene locus_tag LOCUS_33580 564270 563920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 564740 564288 gene locus_tag LOCUS_33590 564740 564288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243382.1 protein_id gnl|my_center|LOCUS_33590 565052 564756 gene locus_tag LOCUS_33600 565052 564756 CDS product YxiJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227182.1 protein_id gnl|my_center|LOCUS_33600 565374 565045 gene locus_tag LOCUS_33610 565374 565045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 565883 565401 gene locus_tag LOCUS_33620 565883 565401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 566672 565914 gene locus_tag LOCUS_33630 566672 565914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 567183 566698 gene locus_tag LOCUS_33640 567183 566698 CDS product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 protein_id gnl|my_center|LOCUS_33640 567778 567203 gene locus_tag LOCUS_33650 567778 567203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227178.1 protein_id gnl|my_center|LOCUS_33650 568014 567802 gene locus_tag LOCUS_33660 568014 567802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 568948 568079 gene locus_tag LOCUS_33670 568948 568079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 569498 569121 gene locus_tag LOCUS_33680 569498 569121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 570076 569645 gene locus_tag LOCUS_33690 gene wapI 570076 569645 CDS product immunity protein WapI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227169.1 protein_id gnl|my_center|LOCUS_33690 570685 570224 gene locus_tag LOCUS_33700 570685 570224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227174.1 protein_id gnl|my_center|LOCUS_33700 570932 570687 gene locus_tag LOCUS_33710 570932 570687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 571504 571199 gene locus_tag LOCUS_33720 571504 571199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33720 572014 571646 gene locus_tag LOCUS_33730 572014 571646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33730 572917 572069 gene locus_tag LOCUS_33740 572917 572069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 579986 572970 gene locus_tag LOCUS_33750 gene wapA 579986 572970 CDS product tRNA nuclease WapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243665.1 protein_id gnl|my_center|LOCUS_33750 581094 580156 gene locus_tag LOCUS_33760 581094 580156 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227165.1 protein_id gnl|my_center|LOCUS_33760 581506 581261 gene locus_tag LOCUS_33770 581506 581261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33770 581875 581612 gene locus_tag LOCUS_33780 581875 581612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33780 582285 583049 gene locus_tag LOCUS_33790 582285 583049 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967096.1 protein_id gnl|my_center|LOCUS_33790 583739 583293 gene locus_tag LOCUS_33800 583739 583293 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_33800 585252 583843 gene locus_tag LOCUS_33810 gene bglH 585252 583843 CDS product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 protein_id gnl|my_center|LOCUS_33810 587112 585274 gene locus_tag LOCUS_33820 gene bglP 587112 585274 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_33820 587804 587505 gene locus_tag LOCUS_33830 587804 587505 CDS product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242733.1 protein_id gnl|my_center|LOCUS_33830 588209 587946 gene locus_tag LOCUS_33840 588209 587946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 588742 588356 gene locus_tag LOCUS_33850 588742 588356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 589022 588795 gene locus_tag LOCUS_33860 589022 588795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963460.1 protein_id gnl|my_center|LOCUS_33860 589482 589033 gene locus_tag LOCUS_33870 589482 589033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 589975 589643 gene locus_tag LOCUS_33880 589975 589643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048526177.1 protein_id gnl|my_center|LOCUS_33880 591601 589997 gene locus_tag LOCUS_33890 591601 589997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 591890 591621 gene locus_tag LOCUS_33900 591890 591621 CDS product YwqI/YxiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244193.1 protein_id gnl|my_center|LOCUS_33900 592267 591902 gene locus_tag LOCUS_33910 592267 591902 CDS product DUF5082 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968400.1 protein_id gnl|my_center|LOCUS_33910 593994 592576 gene locus_tag LOCUS_33920 gene abnB 593994 592576 CDS product arabinan endo-1,5-alpha-L-arabinosidase AbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244268.1 protein_id gnl|my_center|LOCUS_33920 595057 594068 gene locus_tag LOCUS_33930 595057 594068 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 protein_id gnl|my_center|LOCUS_33930 595300 595746 gene locus_tag LOCUS_33940 gene hutP 595300 595746 CDS product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243875.1 protein_id gnl|my_center|LOCUS_33940 595859 597385 gene locus_tag LOCUS_33950 gene hutH 595859 597385 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 protein_id gnl|my_center|LOCUS_33950 597382 599040 gene locus_tag LOCUS_33960 gene hutU 597382 599040 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243634.1 protein_id gnl|my_center|LOCUS_33960 599053 600318 gene locus_tag LOCUS_33970 gene hutI 599053 600318 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_33970 600311 601267 gene locus_tag LOCUS_33980 gene hutG 600311 601267 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 protein_id gnl|my_center|LOCUS_33980 601346 602773 gene locus_tag LOCUS_33990 601346 602773 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227134.1 protein_id gnl|my_center|LOCUS_33990 604117 602816 gene locus_tag LOCUS_34000 604117 602816 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 protein_id gnl|my_center|LOCUS_34000 605328 604147 gene locus_tag LOCUS_34010 gene nupC 605328 604147 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244143.1 protein_id gnl|my_center|LOCUS_34010 606094 605423 gene locus_tag LOCUS_34020 gene deoC 606094 605423 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244069.1 protein_id gnl|my_center|LOCUS_34020 607141 606200 gene locus_tag LOCUS_34030 gene deoR 607141 606200 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 protein_id gnl|my_center|LOCUS_34030 608107 607277 gene locus_tag LOCUS_34040 608107 607277 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243667.1 protein_id gnl|my_center|LOCUS_34040 609281 608172 gene locus_tag LOCUS_34050 gene eutH 609281 608172 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243423.1 protein_id gnl|my_center|LOCUS_34050 610688 609351 gene locus_tag LOCUS_34060 610688 609351 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 protein_id gnl|my_center|LOCUS_34060 611827 610685 gene locus_tag LOCUS_34070 gene sndB 611827 610685 CDS product N-acetyl-sulfur-metabolite deacetylase SndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243840.1 protein_id gnl|my_center|LOCUS_34070 612593 611844 gene locus_tag LOCUS_34080 612593 611844 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 protein_id gnl|my_center|LOCUS_34080 613280 612606 gene locus_tag LOCUS_34090 613280 612606 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 protein_id gnl|my_center|LOCUS_34090 614097 613303 gene locus_tag LOCUS_34100 614097 613303 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_34100 614619 614122 gene locus_tag LOCUS_34110 gene snaB 614619 614122 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_34110 615958 614633 gene locus_tag LOCUS_34120 615958 614633 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 protein_id gnl|my_center|LOCUS_34120 617322 616336 gene locus_tag LOCUS_34130 gene yxeI 617322 616336 CDS product penicillin V amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243495.1 protein_id gnl|my_center|LOCUS_34130 618542 617730 gene locus_tag LOCUS_34140 gene yidA 618542 617730 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243315.1 protein_id gnl|my_center|LOCUS_34140 619142 618582 gene locus_tag LOCUS_34150 619142 618582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242636.1 protein_id gnl|my_center|LOCUS_34150 619557 619162 gene locus_tag LOCUS_34160 619557 619162 CDS product YxeF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244165.1 protein_id gnl|my_center|LOCUS_34160 619658 620023 gene locus_tag LOCUS_34170 gene cotNE 619658 620023 CDS product inner spore coat protein CotNE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227093.1 protein_id gnl|my_center|LOCUS_34170 620274 620627 gene locus_tag LOCUS_34180 620274 620627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242469.1 protein_id gnl|my_center|LOCUS_34180 621068 620670 gene locus_tag LOCUS_34190 621068 620670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243293.1 protein_id gnl|my_center|LOCUS_34190 621245 622210 gene locus_tag LOCUS_34200 621245 622210 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243725.1 protein_id gnl|my_center|LOCUS_34200 622598 622251 gene locus_tag LOCUS_34210 622598 622251 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227084.1 protein_id gnl|my_center|LOCUS_34210 624479 622611 gene locus_tag LOCUS_34220 gene yxdM 624479 622611 CDS product ABC transporter permease YxdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244410.1 protein_id gnl|my_center|LOCUS_34220 625227 624454 gene locus_tag LOCUS_34230 gene yxdL 625227 624454 CDS product ABC transporter ATP-binding protein YxdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243557.1 protein_id gnl|my_center|LOCUS_34230 626350 625373 gene locus_tag LOCUS_34240 gene yxdK 626350 625373 CDS product two-component system sensor histidine kinase YxdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243885.1 protein_id gnl|my_center|LOCUS_34240 627036 626347 gene locus_tag LOCUS_34250 gene yxdJ 627036 626347 CDS product two-component system response regulator YxdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243527.1 protein_id gnl|my_center|LOCUS_34250 628017 627145 gene locus_tag LOCUS_34260 gene iolJ 628017 627145 CDS product 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242766.1 protein_id gnl|my_center|LOCUS_34260 628874 628038 gene locus_tag LOCUS_34270 gene iolI 628874 628038 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_34270 629830 628961 gene locus_tag LOCUS_34280 629830 628961 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243149.1 protein_id gnl|my_center|LOCUS_34280 630886 629852 gene locus_tag LOCUS_34290 gene iolG 630886 629852 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_34290 632225 630909 gene locus_tag LOCUS_34300 gene iolF 632225 630909 CDS product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 protein_id gnl|my_center|LOCUS_34300 633133 632240 gene locus_tag LOCUS_34310 gene iolE 633133 632240 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227062.1 protein_id gnl|my_center|LOCUS_34310 635063 633150 gene locus_tag LOCUS_34320 gene iolD 635063 633150 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242642.1 protein_id gnl|my_center|LOCUS_34320 636073 635096 gene locus_tag LOCUS_34330 gene iolC 636073 635096 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 protein_id gnl|my_center|LOCUS_34330 636912 636097 gene locus_tag LOCUS_34340 gene iolB 636912 636097 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243247.1 protein_id gnl|my_center|LOCUS_34340 638450 636987 gene locus_tag LOCUS_34350 gene iolA 638450 636987 CDS product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243682.1 protein_id gnl|my_center|LOCUS_34350 638868 639623 gene locus_tag LOCUS_34360 gene iolR 638868 639623 CDS product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 protein_id gnl|my_center|LOCUS_34360 639677 640609 gene locus_tag LOCUS_34370 639677 640609 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243075.1 protein_id gnl|my_center|LOCUS_34370 641240 641112 gene locus_tag LOCUS_34380 641240 641112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 641404 641589 gene locus_tag LOCUS_34390 641404 641589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 641593 641901 gene locus_tag LOCUS_34400 641593 641901 CDS product YxcD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227046.1 protein_id gnl|my_center|LOCUS_34400 642107 643492 gene locus_tag LOCUS_34410 642107 643492 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244055.1 protein_id gnl|my_center|LOCUS_34410 645412 643532 gene locus_tag LOCUS_34420 gene htpG 645412 643532 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_34420 645843 645607 gene locus_tag LOCUS_34430 645843 645607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244458.1 protein_id gnl|my_center|LOCUS_34430 645959 646780 gene locus_tag LOCUS_34440 645959 646780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244072.1 protein_id gnl|my_center|LOCUS_34440 646999 647166 gene locus_tag LOCUS_34450 646999 647166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 648940 647801 gene locus_tag LOCUS_34460 648940 647801 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243187.1 protein_id gnl|my_center|LOCUS_34460 649083 650420 gene locus_tag LOCUS_34470 649083 650420 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243415.1 protein_id gnl|my_center|LOCUS_34470 651203 650778 gene locus_tag LOCUS_34480 651203 650778 CDS product DUF5391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242533.1 protein_id gnl|my_center|LOCUS_34480 651455 651910 gene locus_tag LOCUS_34490 651455 651910 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242940.1 protein_id gnl|my_center|LOCUS_34490 653148 651940 gene locus_tag LOCUS_34500 653148 651940 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 protein_id gnl|my_center|LOCUS_34500 654268 653255 gene locus_tag LOCUS_34510 gene qdoI 654268 653255 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243000.1 protein_id gnl|my_center|LOCUS_34510 654935 654360 gene locus_tag LOCUS_34520 gene yxaF 654935 654360 CDS product transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227022.1 protein_id gnl|my_center|LOCUS_34520 655065 656129 gene locus_tag LOCUS_34530 655065 656129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244500.1 protein_id gnl|my_center|LOCUS_34530 656617 656186 gene locus_tag LOCUS_34540 656617 656186 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243994.1 protein_id gnl|my_center|LOCUS_34540 656845 657249 gene locus_tag LOCUS_34550 656845 657249 CDS product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968420.1 protein_id gnl|my_center|LOCUS_34550 657219 657911 gene locus_tag LOCUS_34560 657219 657911 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227015.1 protein_id gnl|my_center|LOCUS_34560 658112 659689 gene locus_tag LOCUS_34570 658112 659689 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_34570 660758 659727 gene locus_tag LOCUS_34580 660758 659727 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242482.1 protein_id gnl|my_center|LOCUS_34580 661998 660850 gene locus_tag LOCUS_34590 661998 660850 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 protein_id gnl|my_center|LOCUS_34590 662194 662925 gene locus_tag LOCUS_34600 gene gntR 662194 662925 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243132.1 protein_id gnl|my_center|LOCUS_34600 662918 664459 gene locus_tag LOCUS_34610 gene gntK 662918 664459 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968422.1 protein_id gnl|my_center|LOCUS_34610 664488 665834 gene locus_tag LOCUS_34620 gene gntP 664488 665834 CDS product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243139.1 protein_id gnl|my_center|LOCUS_34620 665858 667264 gene locus_tag LOCUS_34630 gene gnd 665858 667264 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243876.1 protein_id gnl|my_center|LOCUS_34630 667784 668347 gene locus_tag LOCUS_34640 gene ahpC 667784 668347 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243686.1 protein_id gnl|my_center|LOCUS_34640 668361 669890 gene locus_tag LOCUS_34650 gene ahpF 668361 669890 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243077.1 protein_id gnl|my_center|LOCUS_34650 671354 670002 gene locus_tag LOCUS_34660 671354 670002 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 protein_id gnl|my_center|LOCUS_34660 673084 671645 gene locus_tag LOCUS_34670 gene bglA 673084 671645 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 protein_id gnl|my_center|LOCUS_34670 674966 673098 gene locus_tag LOCUS_34680 674966 673098 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 protein_id gnl|my_center|LOCUS_34680 675121 675831 gene locus_tag LOCUS_34690 675121 675831 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 protein_id gnl|my_center|LOCUS_34690 676133 675963 gene locus_tag LOCUS_34700 676133 675963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 676294 678219 gene locus_tag LOCUS_34710 gene fbp 676294 678219 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243329.1 protein_id gnl|my_center|LOCUS_34710 678298 678459 gene locus_tag LOCUS_34720 678298 678459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 680538 679072 gene locus_tag LOCUS_34730 680538 679072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 681598 680933 gene locus_tag LOCUS_34740 681598 680933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 683376 681601 gene locus_tag LOCUS_34750 683376 681601 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_34750 686707 683366 gene locus_tag LOCUS_34760 gene drmA 686707 683366 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_34760 689062 686723 gene locus_tag LOCUS_34770 689062 686723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 689571 689092 gene locus_tag LOCUS_34780 gene rlmH 689571 689092 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_34780 689822 689652 gene locus_tag LOCUS_34790 689822 689652 CDS product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219122.1 protein_id gnl|my_center|LOCUS_34790 690007 690282 gene locus_tag LOCUS_34800 690007 690282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34800 690674 690504 gene locus_tag LOCUS_34810 690674 690504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244248.1 protein_id gnl|my_center|LOCUS_34810 690822 691118 gene locus_tag LOCUS_34820 690822 691118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 692347 691190 gene locus_tag LOCUS_34830 692347 691190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243905.1 protein_id gnl|my_center|LOCUS_34830 693095 692358 gene locus_tag LOCUS_34840 693095 692358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243470.1 protein_id gnl|my_center|LOCUS_34840 693721 693251 gene locus_tag LOCUS_34850 693721 693251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243975.1 protein_id gnl|my_center|LOCUS_34850 693832 694929 gene locus_tag LOCUS_34860 gene rapG 693832 694929 CDS product response regulator aspartate phosphatase RapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243386.1 protein_id gnl|my_center|LOCUS_34860 695972 695082 gene locus_tag LOCUS_34870 gene rocF 695972 695082 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 protein_id gnl|my_center|LOCUS_34870 697449 696046 gene locus_tag LOCUS_34880 697449 696046 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242721.1 protein_id gnl|my_center|LOCUS_34880 698879 697674 gene locus_tag LOCUS_34890 gene rocD 698879 697674 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_34890 699120 700505 gene locus_tag LOCUS_34900 gene rocR 699120 700505 CDS product arginine utilization regulatory protein RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244510.1 protein_id gnl|my_center|LOCUS_34900 700749 700447 gene locus_tag LOCUS_34910 700749 700447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 702102 700894 gene locus_tag LOCUS_34920 gene htrC 702102 700894 CDS product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 protein_id gnl|my_center|LOCUS_34920 702981 702187 gene locus_tag LOCUS_34930 702981 702187 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242676.1 protein_id gnl|my_center|LOCUS_34930 703846 703004 gene locus_tag LOCUS_34940 gene walI 703846 703004 CDS product WalRK two-component regulatory system regulator WalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244037.1 protein_id gnl|my_center|LOCUS_34940 705209 703833 gene locus_tag LOCUS_34950 gene walH 705209 703833 CDS product WalRK two-component regulatory system regulator WalH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242498.1 protein_id gnl|my_center|LOCUS_34950 707025 705190 gene locus_tag LOCUS_34960 gene walK 707025 705190 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 protein_id gnl|my_center|LOCUS_34960 707743 707033 gene locus_tag LOCUS_34970 gene walR 707743 707033 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_34970 708196 708123 gene locus_tag LOCUS_t00830 708196 708123 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 708308 708232 gene locus_tag LOCUS_t00840 708308 708232 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 708462 708391 gene locus_tag LOCUS_t00850 708462 708391 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 708547 708472 gene locus_tag LOCUS_t00860 708547 708472 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 710060 708768 gene locus_tag LOCUS_34980 gene purA 710060 708768 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_34980 710685 710266 gene locus_tag LOCUS_34990 710685 710266 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243491.1 protein_id gnl|my_center|LOCUS_34990 712166 710802 gene locus_tag LOCUS_35000 gene dnaB 712166 710802 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_35000 712336 712536 gene locus_tag LOCUS_35010 712336 712536 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226922.1 protein_id gnl|my_center|LOCUS_35010 712784 712581 gene locus_tag LOCUS_35020 712784 712581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244312.1 protein_id gnl|my_center|LOCUS_35020 712905 713048 gene locus_tag LOCUS_35030 712905 713048 CDS product YycC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242786.1 protein_id gnl|my_center|LOCUS_35030 713121 714329 gene locus_tag LOCUS_35040 713121 714329 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226917.1 protein_id gnl|my_center|LOCUS_35040 714446 716536 gene locus_tag LOCUS_35050 714446 716536 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242651.1 protein_id gnl|my_center|LOCUS_35050 717022 716573 gene locus_tag LOCUS_35060 gene rplI 717022 716573 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_35060 718998 717019 gene locus_tag LOCUS_35070 gene gdpP 718998 717019 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_35070 719964 719035 gene locus_tag LOCUS_35080 719964 719035 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243969.1 protein_id gnl|my_center|LOCUS_35080 720339 720190 gene locus_tag LOCUS_35090 720339 720190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226909.1 protein_id gnl|my_center|LOCUS_35090 720484 720966 gene locus_tag LOCUS_35100 gene cotF 720484 720966 CDS product spore coat protein CotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243364.1 protein_id gnl|my_center|LOCUS_35100 721373 720996 gene locus_tag LOCUS_35110 gene hypR 721373 720996 CDS product transcriptional regulator HypR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242487.1 protein_id gnl|my_center|LOCUS_35110 721579 722508 gene locus_tag LOCUS_35120 721579 722508 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 protein_id gnl|my_center|LOCUS_35120 723190 722744 gene locus_tag LOCUS_35130 723190 722744 CDS product DUF6376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244214.1 protein_id gnl|my_center|LOCUS_35130 723648 724937 gene locus_tag LOCUS_35140 723648 724937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 protein_id gnl|my_center|LOCUS_35140 725209 725364 gene locus_tag LOCUS_35150 725209 725364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 725389 725571 gene locus_tag LOCUS_35160 725389 725571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 726512 725712 gene locus_tag LOCUS_35170 726512 725712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244492.1 protein_id gnl|my_center|LOCUS_35170 727578 726619 gene locus_tag LOCUS_35180 727578 726619 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243239.1 protein_id gnl|my_center|LOCUS_35180 728006 728884 gene locus_tag LOCUS_35190 728006 728884 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_35190 728899 729342 gene locus_tag LOCUS_35200 728899 729342 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226881.1 protein_id gnl|my_center|LOCUS_35200 729425 729904 gene locus_tag LOCUS_35210 729425 729904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243923.1 protein_id gnl|my_center|LOCUS_35210 730682 730020 gene locus_tag LOCUS_35220 730682 730020 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226877.1 protein_id gnl|my_center|LOCUS_35220 730788 731078 gene locus_tag LOCUS_35230 730788 731078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35230 731244 732161 gene locus_tag LOCUS_35240 731244 732161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231350.1 protein_id gnl|my_center|LOCUS_35240 732702 732250 gene locus_tag LOCUS_35250 732702 732250 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226875.1 protein_id gnl|my_center|LOCUS_35250 732823 733269 gene locus_tag LOCUS_35260 732823 733269 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243577.1 protein_id gnl|my_center|LOCUS_35260 733266 733856 gene locus_tag LOCUS_35270 733266 733856 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 protein_id gnl|my_center|LOCUS_35270 734145 736214 gene locus_tag LOCUS_35280 734145 736214 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_35280 737110 736211 gene locus_tag LOCUS_35290 737110 736211 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244361.1 protein_id gnl|my_center|LOCUS_35290 737337 738692 gene locus_tag LOCUS_35300 737337 738692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243011.1 protein_id gnl|my_center|LOCUS_35300 739279 738725 gene locus_tag LOCUS_35310 739279 738725 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242928.1 protein_id gnl|my_center|LOCUS_35310 739677 739297 gene locus_tag LOCUS_35320 739677 739297 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244460.1 protein_id gnl|my_center|LOCUS_35320 740668 739733 gene locus_tag LOCUS_35330 gene ccpB 740668 739733 CDS product transcriptional regulator CcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243573.1 protein_id gnl|my_center|LOCUS_35330 741485 740727 gene locus_tag LOCUS_35340 gene xth 741485 740727 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243194.1 protein_id gnl|my_center|LOCUS_35340 741785 741546 gene locus_tag LOCUS_35350 gene rpsR 741785 741546 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 protein_id gnl|my_center|LOCUS_35350 742347 741829 gene locus_tag LOCUS_35360 gene ssbA 742347 741829 CDS product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219228.1 protein_id gnl|my_center|LOCUS_35360 742675 742388 gene locus_tag LOCUS_35370 gene rpsF 742675 742388 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_35370 743886 742786 gene locus_tag LOCUS_35380 gene ychF 743886 742786 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_35380 746016 744013 gene locus_tag LOCUS_35390 746016 744013 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244290.1 protein_id gnl|my_center|LOCUS_35390 746273 746067 gene locus_tag LOCUS_35400 746273 746067 CDS product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 protein_id gnl|my_center|LOCUS_35400 747380 746367 gene locus_tag LOCUS_35410 747380 746367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 protein_id gnl|my_center|LOCUS_35410 747799 748416 gene locus_tag LOCUS_35420 gene yyaC 747799 748416 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_35420 749304 748456 gene locus_tag LOCUS_35430 gene spo0J 749304 748456 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_35430 750058 749297 gene locus_tag LOCUS_35440 gene soj 750058 749297 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_35440 750302 750742 gene locus_tag LOCUS_35450 750302 750742 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244005.1 protein_id gnl|my_center|LOCUS_35450 751643 750792 gene locus_tag LOCUS_35460 gene noc 751643 750792 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 protein_id gnl|my_center|LOCUS_35460 752484 751765 gene locus_tag LOCUS_35470 gene rsmG 752484 751765 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_35470 754384 752498 gene locus_tag LOCUS_35480 gene mnmG 754384 752498 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_35480 755784 754405 gene locus_tag LOCUS_35490 gene mnmE 755784 754405 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_35490 756722 756096 gene locus_tag LOCUS_35500 756722 756096 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 protein_id gnl|my_center|LOCUS_35500 757480 756719 gene locus_tag LOCUS_35510 gene spoIIIJ 757480 756719 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 protein_id gnl|my_center|LOCUS_35510 757999 757649 gene locus_tag LOCUS_35520 gene rnpA 757999 757649 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 protein_id gnl|my_center|LOCUS_35520 758285 758151 gene locus_tag LOCUS_35530 758285 758151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 758697 758476 gene locus_tag LOCUS_35540 758697 758476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 758905 760245 gene locus_tag LOCUS_35550 gene dnaA 758905 760245 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_35550 760433 761569 gene locus_tag LOCUS_35560 gene dnaN 760433 761569 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_35560 761701 761916 gene locus_tag LOCUS_35570 gene rlbA 761701 761916 CDS product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 protein_id gnl|my_center|LOCUS_35570 761932 763044 gene locus_tag LOCUS_35580 gene recF 761932 763044 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_35580 763067 763312 gene locus_tag LOCUS_35590 gene remB 763067 763312 CDS product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 protein_id gnl|my_center|LOCUS_35590 763361 765283 gene locus_tag LOCUS_35600 gene gyrB 763361 765283 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_35600 765500 767965 gene locus_tag LOCUS_35610 gene gyrA 765500 767965 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_35610 767940 768107 gene locus_tag LOCUS_35620 767940 768107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence116 >Feature sequence117 >Feature sequence118 >Feature sequence119 390 190 gene locus_tag LOCUS_35630 390 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence120 >Feature sequence121 >Feature sequence122 >Feature sequence123 >Feature sequence124 >Feature sequence125 >Feature sequence126 283 1047 gene locus_tag LOCUS_35640 gene pdaB 283 1047 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 protein_id gnl|my_center|LOCUS_35640 1644 1048 gene locus_tag LOCUS_35650 gene kbaA 1644 1048 CDS product KinB-signaling pathway activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399693.1 protein_id gnl|my_center|LOCUS_35650 1754 2311 gene locus_tag LOCUS_35660 gene gerD 1754 2311 CDS product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235126.1 protein_id gnl|my_center|LOCUS_35660 3404 2346 gene locus_tag LOCUS_35670 gene salA 3404 2346 CDS product iron-sulfur carrier protein/transcriptional regulator SalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235124.1 protein_id gnl|my_center|LOCUS_35670 4213 3500 gene locus_tag LOCUS_35680 gene cwlD 4213 3500 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_35680 4716 4273 gene locus_tag LOCUS_35690 4716 4273 CDS product YbaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235118.1 protein_id gnl|my_center|LOCUS_35690 5680 4913 gene locus_tag LOCUS_35700 5680 4913 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399665.1 protein_id gnl|my_center|LOCUS_35700 5924 6058 gene locus_tag LOCUS_35710 5924 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 6556 6164 gene locus_tag LOCUS_35720 gene rpsI 6556 6164 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_35720 7014 6577 gene locus_tag LOCUS_35730 gene rplM 7014 6577 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241966.1 protein_id gnl|my_center|LOCUS_35730 7919 7176 gene locus_tag LOCUS_35740 gene truA 7919 7176 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_35740 8726 7929 gene locus_tag LOCUS_35750 8726 7929 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 protein_id gnl|my_center|LOCUS_35750 9592 8723 gene locus_tag LOCUS_35760 9592 8723 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886389.1 protein_id gnl|my_center|LOCUS_35760 10413 9568 gene locus_tag LOCUS_35770 10413 9568 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 protein_id gnl|my_center|LOCUS_35770 10906 10544 gene locus_tag LOCUS_35780 gene rplQ 10906 10544 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 protein_id gnl|my_center|LOCUS_35780 11928 10984 gene locus_tag LOCUS_35790 11928 10984 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_35790 12500 12105 gene locus_tag LOCUS_35800 gene rpsK 12500 12105 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 protein_id gnl|my_center|LOCUS_35800 12886 12521 gene locus_tag LOCUS_35810 gene rpsM 12886 12521 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 protein_id gnl|my_center|LOCUS_35810 13274 13056 gene locus_tag LOCUS_35820 gene infA 13274 13056 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_35820 14331 13585 gene locus_tag LOCUS_35830 gene map 14331 13585 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 protein_id gnl|my_center|LOCUS_35830 14981 14328 gene locus_tag LOCUS_35840 14981 14328 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_35840 16331 15036 gene locus_tag LOCUS_35850 gene secY 16331 15036 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399662.1 protein_id gnl|my_center|LOCUS_35850 16773 16333 gene locus_tag LOCUS_35860 gene rplO 16773 16333 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_35860 16983 16804 gene locus_tag LOCUS_35870 gene rpmD 16983 16804 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_35870 17503 16997 gene locus_tag LOCUS_35880 gene rpsE 17503 16997 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_35880 17884 17522 gene locus_tag LOCUS_35890 gene rplR 17884 17522 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_35890 18456 17917 gene locus_tag LOCUS_35900 gene rplF 18456 17917 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_35900 18884 18486 gene locus_tag LOCUS_35910 gene rpsH 18884 18486 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_35910 19101 18916 gene locus_tag LOCUS_35920 gene rpsN 19101 18916 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_35920 19663 19124 gene locus_tag LOCUS_35930 gene rplE 19663 19124 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_35930 20001 19690 gene locus_tag LOCUS_35940 gene rplX 20001 19690 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_35940 20406 20038 gene locus_tag LOCUS_35950 gene rplN 20406 20038 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225805.1 protein_id gnl|my_center|LOCUS_35950 20710 20447 gene locus_tag LOCUS_35960 gene rpsQ 20710 20447 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 protein_id gnl|my_center|LOCUS_35960 20933 20733 gene locus_tag LOCUS_35970 gene rpmC 20933 20733 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_35970 21357 20923 gene locus_tag LOCUS_35980 gene rplP 21357 20923 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_35980 22015 21359 gene locus_tag LOCUS_35990 gene rpsC 22015 21359 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_35990 22360 22019 gene locus_tag LOCUS_36000 gene rplV 22360 22019 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_36000 22655 22377 gene locus_tag LOCUS_36010 gene rpsS 22655 22377 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156472.1 protein_id gnl|my_center|LOCUS_36010 23546 22713 gene locus_tag LOCUS_36020 gene rplB 23546 22713 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_36020 23865 23578 gene locus_tag LOCUS_36030 gene rplW 23865 23578 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 protein_id gnl|my_center|LOCUS_36030 24488 23865 gene locus_tag LOCUS_36040 gene rplD 24488 23865 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_36040 25145 24516 gene locus_tag LOCUS_36050 gene rplC 25145 24516 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_36050 25493 25185 gene locus_tag LOCUS_36060 gene rpsJ 25493 25185 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_36060 26687 25731 gene locus_tag LOCUS_36070 26687 25731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235060.1 protein_id gnl|my_center|LOCUS_36070 27978 26788 gene locus_tag LOCUS_36080 gene tuf 27978 26788 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 protein_id gnl|my_center|LOCUS_36080 30176 28098 gene locus_tag LOCUS_36090 gene fusA 30176 28098 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 protein_id gnl|my_center|LOCUS_36090 30699 30229 gene locus_tag LOCUS_36100 gene rpsG 30699 30229 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 protein_id gnl|my_center|LOCUS_36100 31157 30741 gene locus_tag LOCUS_36110 gene rpsL 31157 30741 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_36110 31519 31271 gene locus_tag LOCUS_36120 31519 31271 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 protein_id gnl|my_center|LOCUS_36120 35294 31695 gene locus_tag LOCUS_36130 gene rpoC 35294 31695 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399688.1 protein_id gnl|my_center|LOCUS_36130 38937 35356 gene locus_tag LOCUS_36140 gene rpoB 38937 35356 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_36140 39790 39185 gene locus_tag LOCUS_36150 39790 39185 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235045.1 protein_id gnl|my_center|LOCUS_36150 40251 39880 gene locus_tag LOCUS_36160 gene rplL 40251 39880 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156436.1 protein_id gnl|my_center|LOCUS_36160 40795 40295 gene locus_tag LOCUS_36170 gene rplJ 40795 40295 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_36170 41746 41048 gene locus_tag LOCUS_36180 gene rplA 41746 41048 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_36180 42266 41841 gene locus_tag LOCUS_36190 gene rplK 42266 41841 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 protein_id gnl|my_center|LOCUS_36190 42967 42434 gene locus_tag LOCUS_36200 gene nusG 42967 42434 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_36200 43326 43147 gene locus_tag LOCUS_36210 gene secE 43326 43147 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399676.1 protein_id gnl|my_center|LOCUS_36210 44258 43602 gene locus_tag LOCUS_36220 gene sigH 44258 43602 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_36220 44833 44321 gene locus_tag LOCUS_36230 gene rae1 44833 44321 CDS product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 protein_id gnl|my_center|LOCUS_36230 45589 44840 gene locus_tag LOCUS_36240 gene rlmB 45589 44840 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_36240 46004 45573 gene locus_tag LOCUS_36250 46004 45573 CDS product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 protein_id gnl|my_center|LOCUS_36250 47408 46008 gene locus_tag LOCUS_36260 gene cysS 47408 46008 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 protein_id gnl|my_center|LOCUS_36260 48058 47405 gene locus_tag LOCUS_36270 gene cysE 48058 47405 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225749.1 protein_id gnl|my_center|LOCUS_36270 49813 48362 gene locus_tag LOCUS_36280 gene gltX 49813 48362 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_36280 50380 49904 gene locus_tag LOCUS_36290 gene ispF 50380 49904 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_36290 51071 50373 gene locus_tag LOCUS_36300 gene ispD 51071 50373 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_36300 52186 51086 gene locus_tag LOCUS_36310 52186 51086 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_36310 53382 52300 gene locus_tag LOCUS_36320 gene disA 53382 52300 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225736.1 protein_id gnl|my_center|LOCUS_36320 54666 53386 gene locus_tag LOCUS_36330 gene radA 54666 53386 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_36330 57286 54854 gene locus_tag LOCUS_36340 gene clpC 57286 54854 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_36340 58374 57283 gene locus_tag LOCUS_36350 58374 57283 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_36350 58931 58374 gene locus_tag LOCUS_36360 gene mcsA 58931 58374 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_36360 59409 58945 gene locus_tag LOCUS_36370 gene ctsR 59409 58945 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_36370 59768 59658 gene locus_tag LOCUS_r00080 59768 59658 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence127 >Feature sequence128 >Feature sequence129 >Feature sequence130 >Feature sequence131 >Feature sequence132 >Feature sequence133 >Feature sequence134 >Feature sequence135 >Feature sequence136 >Feature sequence137 1591 1034 gene locus_tag LOCUS_36380 gene nudF 1591 1034 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_36380 1665 1787 gene locus_tag LOCUS_36390 1665 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 1851 2771 gene locus_tag LOCUS_36400 1851 2771 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398525.1 protein_id gnl|my_center|LOCUS_36400 3027 2803 gene locus_tag LOCUS_36410 3027 2803 CDS product YqkE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886561.1 protein_id gnl|my_center|LOCUS_36410 3191 4108 gene locus_tag LOCUS_36420 3191 4108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398519.1 protein_id gnl|my_center|LOCUS_36420 5286 4147 gene locus_tag LOCUS_36430 gene ftsW 5286 4147 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_36430 6446 5289 gene locus_tag LOCUS_36440 gene rodA 6446 5289 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_36440 7106 6462 gene locus_tag LOCUS_36450 7106 6462 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123715.1 protein_id gnl|my_center|LOCUS_36450 7813 7574 gene locus_tag LOCUS_36460 7813 7574 CDS product YqkC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230411.1 protein_id gnl|my_center|LOCUS_36460 8150 7827 gene locus_tag LOCUS_36470 8150 7827 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 protein_id gnl|my_center|LOCUS_36470 9178 8147 gene locus_tag LOCUS_36480 9178 8147 CDS product bifunctional GNAT family N-acetyltransferase/GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398771.1 protein_id gnl|my_center|LOCUS_36480 9513 9175 gene locus_tag LOCUS_36490 9513 9175 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_36490 9996 9526 gene locus_tag LOCUS_36500 9996 9526 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 protein_id gnl|my_center|LOCUS_36500 10524 10186 gene locus_tag LOCUS_36510 10524 10186 CDS product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398477.1 protein_id gnl|my_center|LOCUS_36510 11756 10521 gene locus_tag LOCUS_36520 11756 10521 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 protein_id gnl|my_center|LOCUS_36520 11926 12132 gene locus_tag LOCUS_36530 11926 12132 CDS product YqzH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398642.1 protein_id gnl|my_center|LOCUS_36530 12439 12158 gene locus_tag LOCUS_36540 12439 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 12649 13881 gene locus_tag LOCUS_36550 12649 13881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398495.1 protein_id gnl|my_center|LOCUS_36550 13933 14118 gene locus_tag LOCUS_36560 13933 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 14473 14087 gene locus_tag LOCUS_36570 14473 14087 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398989.1 protein_id gnl|my_center|LOCUS_36570 15437 14478 gene locus_tag LOCUS_36580 gene coaA 15437 14478 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245966.1 protein_id gnl|my_center|LOCUS_36580 16855 15509 gene locus_tag LOCUS_36590 gene dsdA 16855 15509 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399082.1 protein_id gnl|my_center|LOCUS_36590 17712 16933 gene locus_tag LOCUS_36600 17712 16933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398795.1 protein_id gnl|my_center|LOCUS_36600 18677 17718 gene locus_tag LOCUS_36610 18677 17718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_36610 19080 19916 gene locus_tag LOCUS_36620 gene proC 19080 19916 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398788.1 protein_id gnl|my_center|LOCUS_36620 21600 19966 gene locus_tag LOCUS_36630 21600 19966 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398867.1 protein_id gnl|my_center|LOCUS_36630 21774 22790 gene locus_tag LOCUS_36640 gene namA 21774 22790 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230377.1 protein_id gnl|my_center|LOCUS_36640 22900 23661 gene locus_tag LOCUS_36650 22900 23661 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230373.1 protein_id gnl|my_center|LOCUS_36650 24389 23724 gene locus_tag LOCUS_36660 24389 23724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36660 24905 24573 gene locus_tag LOCUS_36670 24905 24573 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017149794.1 protein_id gnl|my_center|LOCUS_36670 25156 25007 gene locus_tag LOCUS_36680 gene rpmG 25156 25007 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 protein_id gnl|my_center|LOCUS_36680 26159 25236 gene locus_tag LOCUS_36690 gene rnz 26159 25236 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398681.1 protein_id gnl|my_center|LOCUS_36690 26385 27854 gene locus_tag LOCUS_36700 gene zwf 26385 27854 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246151.1 protein_id gnl|my_center|LOCUS_36700 29395 27986 gene locus_tag LOCUS_36710 gene gndA 29395 27986 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_36710 30750 29506 gene locus_tag LOCUS_36720 30750 29506 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_36720 30814 31110 gene locus_tag LOCUS_36730 gene mifM 30814 31110 CDS product membrane protein insertion/folding monitor MifM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886563.1 protein_id gnl|my_center|LOCUS_36730 31141 31968 gene locus_tag LOCUS_36740 31141 31968 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230359.1 protein_id gnl|my_center|LOCUS_36740 32133 32861 gene locus_tag LOCUS_36750 32133 32861 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_36750 34025 32910 gene locus_tag LOCUS_36760 34025 32910 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_36760 35572 34043 gene locus_tag LOCUS_36770 35572 34043 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886564.1 protein_id gnl|my_center|LOCUS_36770 35981 35559 gene locus_tag LOCUS_36780 gene mce 35981 35559 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399095.1 protein_id gnl|my_center|LOCUS_36780 36714 36184 gene locus_tag LOCUS_36790 36714 36184 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398604.1 protein_id gnl|my_center|LOCUS_36790 37734 36766 gene locus_tag LOCUS_36800 37734 36766 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 protein_id gnl|my_center|LOCUS_36800 38529 37807 gene locus_tag LOCUS_36810 gene artR 38529 37807 CDS product arginine ABC transporter ATP-binding protein ArtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398740.1 protein_id gnl|my_center|LOCUS_36810 39181 38522 gene locus_tag LOCUS_36820 gene artQ 39181 38522 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230340.1 protein_id gnl|my_center|LOCUS_36820 40027 39260 gene locus_tag LOCUS_36830 gene artP 40027 39260 CDS product arginine ABC transporter substrate-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398706.1 protein_id gnl|my_center|LOCUS_36830 40732 40295 gene locus_tag LOCUS_36840 gene brxB 40732 40295 CDS product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 protein_id gnl|my_center|LOCUS_36840 40891 41775 gene locus_tag LOCUS_36850 40891 41775 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230330.1 protein_id gnl|my_center|LOCUS_36850 41857 43026 gene locus_tag LOCUS_36860 gene bmr 41857 43026 CDS product multidrug efflux MFS transporter Bmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230328.1 protein_id gnl|my_center|LOCUS_36860 43099 43935 gene locus_tag LOCUS_36870 gene bmrR 43099 43935 CDS product multidrug efflux transcriptional regulator BmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230325.1 protein_id gnl|my_center|LOCUS_36870 45273 43996 gene locus_tag LOCUS_36880 gene bfmBB 45273 43996 CDS product branched-chain alpha-keto dehydrogenase complex dihydrolipoyllysine-residue (2-methylpropanoyl)transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230323.1 protein_id gnl|my_center|LOCUS_36880 46278 45295 gene locus_tag LOCUS_36890 gene bfmBAB 46278 45295 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398638.1 protein_id gnl|my_center|LOCUS_36890 47284 46292 gene locus_tag LOCUS_36900 gene bfmBAA 47284 46292 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 protein_id gnl|my_center|LOCUS_36900 48730 47306 gene locus_tag LOCUS_36910 gene lpdA 48730 47306 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_36910 49837 48752 gene locus_tag LOCUS_36920 gene buk 49837 48752 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 protein_id gnl|my_center|LOCUS_36920 50956 49862 gene locus_tag LOCUS_36930 gene bcd 50956 49862 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_36930 51867 50968 gene locus_tag LOCUS_36940 gene yqiS 51867 50968 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398694.1 protein_id gnl|my_center|LOCUS_36940 54068 51993 gene locus_tag LOCUS_36950 54068 51993 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398669.1 protein_id gnl|my_center|LOCUS_36950 54221 54457 gene locus_tag LOCUS_36960 54221 54457 CDS product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230304.1 protein_id gnl|my_center|LOCUS_36960 55405 54500 gene locus_tag LOCUS_36970 gene prpB 55405 54500 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398772.1 protein_id gnl|my_center|LOCUS_36970 56843 55425 gene locus_tag LOCUS_36980 56843 55425 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398686.1 protein_id gnl|my_center|LOCUS_36980 57983 56865 gene locus_tag LOCUS_36990 gene mmgD 57983 56865 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230298.1 protein_id gnl|my_center|LOCUS_36990 59155 58016 gene locus_tag LOCUS_37000 59155 58016 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_37000 60045 59182 gene locus_tag LOCUS_37010 60045 59182 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230294.1 protein_id gnl|my_center|LOCUS_37010 61250 60069 gene locus_tag LOCUS_37020 61250 60069 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230291.1 protein_id gnl|my_center|LOCUS_37020 62109 61378 gene locus_tag LOCUS_37030 62109 61378 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230288.1 protein_id gnl|my_center|LOCUS_37030 62809 62189 gene locus_tag LOCUS_37040 62809 62189 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886565.1 protein_id gnl|my_center|LOCUS_37040 63125 62829 gene locus_tag LOCUS_37050 63125 62829 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230284.1 protein_id gnl|my_center|LOCUS_37050 63452 63586 gene locus_tag LOCUS_37060 63452 63586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 63659 64777 gene locus_tag LOCUS_37070 63659 64777 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_37070 66121 65318 gene locus_tag LOCUS_37080 gene spo0A 66121 65318 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_37080 67678 66398 gene locus_tag LOCUS_37090 gene spoIVB 67678 66398 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_37090 69582 67852 gene locus_tag LOCUS_37100 gene recN 69582 67852 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_37100 70067 69618 gene locus_tag LOCUS_37110 gene argR 70067 69618 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 protein_id gnl|my_center|LOCUS_37110 71009 70164 gene locus_tag LOCUS_37120 71009 70164 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_37120 72907 71006 gene locus_tag LOCUS_37130 gene dxs 72907 71006 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 protein_id gnl|my_center|LOCUS_37130 73978 73088 gene locus_tag LOCUS_37140 73978 73088 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 protein_id gnl|my_center|LOCUS_37140 74222 73968 gene locus_tag LOCUS_37150 74222 73968 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_37150 75565 74219 gene locus_tag LOCUS_37160 gene xseA 75565 74219 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 protein_id gnl|my_center|LOCUS_37160 76555 75704 gene locus_tag LOCUS_37170 gene folD 76555 75704 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_37170 76962 76567 gene locus_tag LOCUS_37180 gene nusB 76962 76567 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_37180 77634 77227 gene locus_tag LOCUS_37190 gene yqhY 77634 77227 CDS product fatty acid biosynthesis protein YqhY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230254.1 protein_id gnl|my_center|LOCUS_37190 79007 77655 gene locus_tag LOCUS_37200 gene accC 79007 77655 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_37200 79501 79019 gene locus_tag LOCUS_37210 gene accB 79501 79019 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 protein_id gnl|my_center|LOCUS_37210 80314 79658 gene locus_tag LOCUS_37220 gene spoIIIAH 80314 79658 CDS product stage III sporulation ratchet engulfment protein SpoIIIAH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230250.1 protein_id gnl|my_center|LOCUS_37220 81004 80315 gene locus_tag LOCUS_37230 gene spoIIIAG 81004 80315 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_37230 81617 80997 gene locus_tag LOCUS_37240 gene spoIIIAF 81617 80997 CDS product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230233.1 protein_id gnl|my_center|LOCUS_37240 82830 81631 gene locus_tag LOCUS_37250 gene spoIIIAE 82830 81631 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_37250 83250 82849 gene locus_tag LOCUS_37260 gene spoIIIAD 83250 82849 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_37260 83463 83257 gene locus_tag LOCUS_37270 gene spoIIIAC 83463 83257 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_37270 84001 83486 gene locus_tag LOCUS_37280 gene spoIIIAB 84001 83486 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 protein_id gnl|my_center|LOCUS_37280 84918 83995 gene locus_tag LOCUS_37290 gene spoIIIAA 84918 83995 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_37290 85275 84994 gene locus_tag LOCUS_37300 85275 84994 CDS product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 protein_id gnl|my_center|LOCUS_37300 85982 85425 gene locus_tag LOCUS_37310 gene efp 85982 85425 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 protein_id gnl|my_center|LOCUS_37310 87068 86007 gene locus_tag LOCUS_37320 gene papA 87068 86007 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_37320 87511 87071 gene locus_tag LOCUS_37330 gene aroQ 87511 87071 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 protein_id gnl|my_center|LOCUS_37330 88132 87599 gene locus_tag LOCUS_37340 88132 87599 CDS product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 protein_id gnl|my_center|LOCUS_37340 88361 89317 gene locus_tag LOCUS_37350 88361 89317 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967716.1 protein_id gnl|my_center|LOCUS_37350 89357 89752 gene locus_tag LOCUS_37360 89357 89752 CDS product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226367.1 protein_id gnl|my_center|LOCUS_37360 90624 89749 gene locus_tag LOCUS_37370 90624 89749 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230220.1 protein_id gnl|my_center|LOCUS_37370 91177 90749 gene locus_tag LOCUS_37380 gene mntR 91177 90749 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 protein_id gnl|my_center|LOCUS_37380 92113 91277 gene locus_tag LOCUS_37390 gene lipM 92113 91277 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_37390 92304 92684 gene locus_tag LOCUS_37400 92304 92684 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398485.1 protein_id gnl|my_center|LOCUS_37400 94188 92722 gene locus_tag LOCUS_37410 gene gcvPB 94188 92722 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_37410 95527 94181 gene locus_tag LOCUS_37420 gene gcvPA 95527 94181 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 protein_id gnl|my_center|LOCUS_37420 96645 95557 gene locus_tag LOCUS_37430 gene gcvT 96645 95557 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_37430 97088 98761 gene locus_tag LOCUS_37440 97088 98761 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_37440 98782 99576 gene locus_tag LOCUS_37450 98782 99576 CDS product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230200.1 protein_id gnl|my_center|LOCUS_37450 99762 99935 gene locus_tag LOCUS_37460 99762 99935 CDS product anti-repressor SinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230187.1 protein_id gnl|my_center|LOCUS_37460 99969 100304 gene locus_tag LOCUS_37470 gene sinR 99969 100304 CDS product transcriptional regulator SinR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226345.1 protein_id gnl|my_center|LOCUS_37470 101183 100398 gene locus_tag LOCUS_37480 gene tasA 101183 100398 CDS product biofilm matrix protein TasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398632.1 protein_id gnl|my_center|LOCUS_37480 101831 101247 gene locus_tag LOCUS_37490 101831 101247 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 protein_id gnl|my_center|LOCUS_37490 102564 101803 gene locus_tag LOCUS_37500 gene tapA 102564 101803 CDS product amyloid fiber anchoring/assembly protein TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399106.1 protein_id gnl|my_center|LOCUS_37500 102836 103159 gene locus_tag LOCUS_37510 102836 103159 CDS product YqzG/YhdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246051.1 protein_id gnl|my_center|LOCUS_37510 103380 103201 gene locus_tag LOCUS_37520 103380 103201 CDS product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230176.1 protein_id gnl|my_center|LOCUS_37520 103826 103452 gene locus_tag LOCUS_37530 gene comGG 103826 103452 CDS product ComG operon protein ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230170.1 protein_id gnl|my_center|LOCUS_37530 104186 103827 gene locus_tag LOCUS_37540 gene comGF 104186 103827 CDS product ComG operon protein ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230168.1 protein_id gnl|my_center|LOCUS_37540 104583 104236 gene locus_tag LOCUS_37550 gene comGE 104583 104236 CDS product ComG operon protein 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230165.1 protein_id gnl|my_center|LOCUS_37550 104998 104567 gene locus_tag LOCUS_37560 gene comGD 104998 104567 CDS product comG operon protein ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398628.1 protein_id gnl|my_center|LOCUS_37560 105284 104988 gene locus_tag LOCUS_37570 gene comGC 105284 104988 CDS product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 protein_id gnl|my_center|LOCUS_37570 106335 105298 gene locus_tag LOCUS_37580 gene comGB 106335 105298 CDS product comG operon protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246116.1 protein_id gnl|my_center|LOCUS_37580 107392 106322 gene locus_tag LOCUS_37590 gene comGA 107392 106322 CDS product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 protein_id gnl|my_center|LOCUS_37590 108021 107605 gene locus_tag LOCUS_37600 108021 107605 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245462.1 protein_id gnl|my_center|LOCUS_37600 109031 108078 gene locus_tag LOCUS_37610 gene corA 109031 108078 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399136.1 protein_id gnl|my_center|LOCUS_37610 109175 110503 gene locus_tag LOCUS_37620 109175 110503 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967730.1 protein_id gnl|my_center|LOCUS_37620 111394 110555 gene locus_tag LOCUS_37630 gene rsbRD 111394 110555 CDS product RsbT co-antagonist protein RsbRD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398754.1 protein_id gnl|my_center|LOCUS_37630 111483 111553 gene locus_tag LOCUS_t00870 111483 111553 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 111997 111620 gene locus_tag LOCUS_37640 gene mgsR 111997 111620 CDS product transcriptional regulator MgsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230147.1 protein_id gnl|my_center|LOCUS_37640 112230 112475 gene locus_tag LOCUS_37650 112230 112475 CDS product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226300.1 protein_id gnl|my_center|LOCUS_37650 113150 112515 gene locus_tag LOCUS_37660 113150 112515 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 protein_id gnl|my_center|LOCUS_37660 113308 113481 gene locus_tag LOCUS_37670 113308 113481 CDS product DUF2759 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230141.1 protein_id gnl|my_center|LOCUS_37670 113827 113513 gene locus_tag LOCUS_37680 113827 113513 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 protein_id gnl|my_center|LOCUS_37680 114885 113830 gene locus_tag LOCUS_37690 114885 113830 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230137.1 protein_id gnl|my_center|LOCUS_37690 116081 114957 gene locus_tag LOCUS_37700 116081 114957 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 protein_id gnl|my_center|LOCUS_37700 118080 116167 gene locus_tag LOCUS_37710 118080 116167 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399146.1 protein_id gnl|my_center|LOCUS_37710 119248 118196 gene locus_tag LOCUS_37720 gene glcK 119248 118196 CDS product glucose kinase GlcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230132.1 protein_id gnl|my_center|LOCUS_37720 119388 119179 gene locus_tag LOCUS_37730 119388 119179 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399107.1 protein_id gnl|my_center|LOCUS_37730 121024 119504 gene locus_tag LOCUS_37740 gene yqgP 121024 119504 CDS product rhomboid protease YqgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230128.1 protein_id gnl|my_center|LOCUS_37740 121286 121113 gene locus_tag LOCUS_37750 121286 121113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230126.1 protein_id gnl|my_center|LOCUS_37750 121916 121353 gene locus_tag LOCUS_37760 121916 121353 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230122.1 protein_id gnl|my_center|LOCUS_37760 122151 122002 gene locus_tag LOCUS_37770 gene rpmG 122151 122002 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153056.1 protein_id gnl|my_center|LOCUS_37770 123314 122235 gene locus_tag LOCUS_37780 123314 122235 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967743.1 protein_id gnl|my_center|LOCUS_37780 123790 123311 gene locus_tag LOCUS_37790 123790 123311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967744.1 protein_id gnl|my_center|LOCUS_37790 123961 124314 gene locus_tag LOCUS_37800 123961 124314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245993.1 protein_id gnl|my_center|LOCUS_37800 124311 124775 gene locus_tag LOCUS_37810 124311 124775 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230109.1 protein_id gnl|my_center|LOCUS_37810 125589 124807 gene locus_tag LOCUS_37820 gene pstB 125589 124807 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399074.1 protein_id gnl|my_center|LOCUS_37820 126409 125600 gene locus_tag LOCUS_37830 gene pstB 126409 125600 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967747.1 protein_id gnl|my_center|LOCUS_37830 127315 126431 gene locus_tag LOCUS_37840 gene pstA 127315 126431 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230103.1 protein_id gnl|my_center|LOCUS_37840 128244 127315 gene locus_tag LOCUS_37850 gene pstC 128244 127315 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 protein_id gnl|my_center|LOCUS_37850 129215 128313 gene locus_tag LOCUS_37860 129215 128313 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398774.1 protein_id gnl|my_center|LOCUS_37860 131520 129370 gene locus_tag LOCUS_37870 gene pbpA 131520 129370 CDS product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 protein_id gnl|my_center|LOCUS_37870 132927 131635 gene locus_tag LOCUS_37880 132927 131635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_37880 133642 133034 gene locus_tag LOCUS_37890 gene sodA 133642 133034 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_37890 134303 133821 gene locus_tag LOCUS_37900 134303 133821 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 protein_id gnl|my_center|LOCUS_37900 134414 135175 gene locus_tag LOCUS_37910 134414 135175 CDS product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230089.1 protein_id gnl|my_center|LOCUS_37910 135270 135569 gene locus_tag LOCUS_37920 135270 135569 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230087.1 protein_id gnl|my_center|LOCUS_37920 135697 136824 gene locus_tag LOCUS_37930 gene ispG 135697 136824 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 protein_id gnl|my_center|LOCUS_37930 137233 136850 gene locus_tag LOCUS_37940 137233 136850 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 protein_id gnl|my_center|LOCUS_37940 137373 137954 gene locus_tag LOCUS_37950 137373 137954 CDS product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 protein_id gnl|my_center|LOCUS_37950 138437 138000 gene locus_tag LOCUS_37960 gene zur 138437 138000 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 protein_id gnl|my_center|LOCUS_37960 139455 138574 gene locus_tag LOCUS_37970 139455 138574 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230077.1 protein_id gnl|my_center|LOCUS_37970 139571 139825 gene locus_tag LOCUS_37980 139571 139825 CDS product DUF2624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230076.1 protein_id gnl|my_center|LOCUS_37980 140742 139852 gene locus_tag LOCUS_37990 140742 139852 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_37990 142071 140755 gene locus_tag LOCUS_38000 gene cshB 142071 140755 CDS product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399101.1 protein_id gnl|my_center|LOCUS_38000 142240 142962 gene locus_tag LOCUS_38010 142240 142962 CDS product YqfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246095.1 protein_id gnl|my_center|LOCUS_38010 143085 144029 gene locus_tag LOCUS_38020 143085 144029 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 protein_id gnl|my_center|LOCUS_38020 145173 144052 gene locus_tag LOCUS_38030 145173 144052 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399125.1 protein_id gnl|my_center|LOCUS_38030 145816 145166 gene locus_tag LOCUS_38040 gene trmK 145816 145166 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166854628.1 protein_id gnl|my_center|LOCUS_38040 146433 146071 gene locus_tag LOCUS_38050 gene cccA 146433 146071 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 protein_id gnl|my_center|LOCUS_38050 147875 146760 gene locus_tag LOCUS_38060 gene rpoD 147875 146760 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_38060 149895 148075 gene locus_tag LOCUS_38070 gene dnaG 149895 148075 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_38070 150423 149929 gene locus_tag LOCUS_38080 150423 149929 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 protein_id gnl|my_center|LOCUS_38080 151487 150675 gene locus_tag LOCUS_38090 151487 150675 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 protein_id gnl|my_center|LOCUS_38090 152154 151513 gene locus_tag LOCUS_38100 gene ccpN 152154 151513 CDS product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 protein_id gnl|my_center|LOCUS_38100 154324 152285 gene locus_tag LOCUS_38110 gene glyS 154324 152285 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_38110 155204 154317 gene locus_tag LOCUS_38120 gene glyQ 155204 154317 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_38120 156268 155501 gene locus_tag LOCUS_38130 gene recO 156268 155501 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_38130 156448 156305 gene locus_tag LOCUS_38140 156448 156305 CDS product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230053.1 protein_id gnl|my_center|LOCUS_38140 157498 156593 gene locus_tag LOCUS_38150 gene era 157498 156593 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_38150 157889 157479 gene locus_tag LOCUS_38160 157889 157479 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 protein_id gnl|my_center|LOCUS_38160 158381 158010 gene locus_tag LOCUS_38170 158381 158010 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 protein_id gnl|my_center|LOCUS_38170 158835 158362 gene locus_tag LOCUS_38180 gene ybeY 158835 158362 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_38180 160902 158836 gene locus_tag LOCUS_38190 gene pgpH 160902 158836 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_38190 161050 160916 gene locus_tag LOCUS_38200 161050 160916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 162009 161050 gene locus_tag LOCUS_38210 162009 161050 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_38210 163202 162006 gene locus_tag LOCUS_38220 gene yqfD 163202 162006 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 protein_id gnl|my_center|LOCUS_38220 163502 163221 gene locus_tag LOCUS_38230 gene yqfC 163502 163221 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_38230 163975 163559 gene locus_tag LOCUS_38240 163975 163559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230029.1 protein_id gnl|my_center|LOCUS_38240 164995 164000 gene locus_tag LOCUS_38250 gene floA 164995 164000 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_38250 166330 165017 gene locus_tag LOCUS_38260 166330 165017 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_38260 166907 166461 gene locus_tag LOCUS_38270 166907 166461 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230022.1 protein_id gnl|my_center|LOCUS_38270 167095 166922 gene locus_tag LOCUS_38280 gene rpsU 167095 166922 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003152957.1 protein_id gnl|my_center|LOCUS_38280 167268 168191 gene locus_tag LOCUS_38290 167268 168191 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230019.1 protein_id gnl|my_center|LOCUS_38290 169583 168228 gene locus_tag LOCUS_38300 gene mtaB 169583 168228 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_38300 170353 169583 gene locus_tag LOCUS_38310 170353 169583 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 protein_id gnl|my_center|LOCUS_38310 171311 170376 gene locus_tag LOCUS_38320 gene prmA 171311 170376 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 protein_id gnl|my_center|LOCUS_38320 172463 171336 gene locus_tag LOCUS_38330 gene dnaJ 172463 171336 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_38330 174496 172661 gene locus_tag LOCUS_38340 gene dnaK 174496 172661 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_38340 175083 174520 gene locus_tag LOCUS_38350 gene grpE 175083 174520 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_38350 176186 175155 gene locus_tag LOCUS_38360 gene hrcA 176186 175155 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_38360 177406 176267 gene locus_tag LOCUS_38370 gene hemW 177406 176267 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 protein_id gnl|my_center|LOCUS_38370 179297 177462 gene locus_tag LOCUS_38380 gene lepA 179297 177462 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_38380 179769 179431 gene locus_tag LOCUS_38390 179769 179431 CDS product YqxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399162.1 protein_id gnl|my_center|LOCUS_38390 180991 179786 gene locus_tag LOCUS_38400 gene spoIIP 180991 179786 CDS product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 protein_id gnl|my_center|LOCUS_38400 182160 181054 gene locus_tag LOCUS_38410 gene gpr 182160 181054 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 protein_id gnl|my_center|LOCUS_38410 182237 182377 gene locus_tag LOCUS_38420 182237 182377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 182364 182630 gene locus_tag LOCUS_38430 gene rpsT 182364 182630 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_38430 183688 182645 gene locus_tag LOCUS_38440 gene holA 183688 182645 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_38440 183918 184052 gene locus_tag LOCUS_38450 183918 184052 CDS product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 protein_id gnl|my_center|LOCUS_38450 184917 184093 gene locus_tag LOCUS_38460 184917 184093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 186996 186427 gene locus_tag LOCUS_38470 186996 186427 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229978.1 protein_id gnl|my_center|LOCUS_38470 187680 187063 gene locus_tag LOCUS_38480 gene comEA 187680 187063 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_38480 187764 188585 gene locus_tag LOCUS_38490 gene comER 187764 188585 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398597.1 protein_id gnl|my_center|LOCUS_38490 189394 188651 gene locus_tag LOCUS_38500 189394 188651 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_38500 189747 189391 gene locus_tag LOCUS_38510 gene rsfS 189747 189391 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_38510 190325 189765 gene locus_tag LOCUS_38520 gene yqeK 190325 189765 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_38520 190884 190315 gene locus_tag LOCUS_38530 190884 190315 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_38530 191186 190896 gene locus_tag LOCUS_38540 gene yhbY 191186 190896 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_38540 192022 191180 gene locus_tag LOCUS_38550 gene aroE 192022 191180 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229967.1 protein_id gnl|my_center|LOCUS_38550 193141 192041 gene locus_tag LOCUS_38560 gene yqeH 193141 192041 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 protein_id gnl|my_center|LOCUS_38560 193663 193145 gene locus_tag LOCUS_38570 193663 193145 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 protein_id gnl|my_center|LOCUS_38570 195198 194467 gene locus_tag LOCUS_38580 195198 194467 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229964.1 protein_id gnl|my_center|LOCUS_38580 196201 195449 gene locus_tag LOCUS_38590 gene cwlH 196201 195449 CDS product N-acetylmuramoyl-L-alanine amidase CwlH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229963.1 protein_id gnl|my_center|LOCUS_38590 196396 197022 gene locus_tag LOCUS_38600 196396 197022 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229962.1 protein_id gnl|my_center|LOCUS_38600 197934 197041 gene locus_tag LOCUS_38610 gene gnd 197934 197041 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229961.1 protein_id gnl|my_center|LOCUS_38610 198239 198961 gene locus_tag LOCUS_38620 198239 198961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 protein_id gnl|my_center|LOCUS_38620 199404 198994 gene locus_tag LOCUS_38630 gene nucB 199404 198994 CDS product sporulation-specific Dnase NucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967785.1 protein_id gnl|my_center|LOCUS_38630 199600 200328 gene locus_tag LOCUS_38640 gene sigK 199600 200328 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_38640 200718 200470 gene locus_tag LOCUS_38650 200718 200470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 202324 200936 gene locus_tag LOCUS_38660 gene fumC 202324 200936 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_38660 202479 203369 gene locus_tag LOCUS_38670 202479 203369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_38670 204007 203732 gene locus_tag LOCUS_38680 204007 203732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 204463 204912 gene locus_tag LOCUS_38690 204463 204912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 205217 205047 gene locus_tag LOCUS_38700 205217 205047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886576.1 protein_id gnl|my_center|LOCUS_38700 206534 205575 gene locus_tag LOCUS_38710 206534 205575 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 protein_id gnl|my_center|LOCUS_38710 207067 206642 gene locus_tag LOCUS_38720 207067 206642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 208421 207687 gene locus_tag LOCUS_38730 208421 207687 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246762.1 protein_id gnl|my_center|LOCUS_38730 208647 209006 gene locus_tag LOCUS_38740 208647 209006 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 protein_id gnl|my_center|LOCUS_38740 209399 210139 gene locus_tag LOCUS_38750 gene nfsA 209399 210139 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 protein_id gnl|my_center|LOCUS_38750 211282 210371 gene locus_tag LOCUS_38760 gene cmrA 211282 210371 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_38760 211411 211659 gene locus_tag LOCUS_38770 211411 211659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 211646 212434 gene locus_tag LOCUS_38780 211646 212434 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_38780 213177 213635 gene locus_tag LOCUS_38790 gene bltD 213177 213635 CDS product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229879.1 protein_id gnl|my_center|LOCUS_38790 214661 213807 gene locus_tag LOCUS_38800 gene bltR 214661 213807 CDS product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 protein_id gnl|my_center|LOCUS_38800 214789 215991 gene locus_tag LOCUS_38810 gene blt 214789 215991 CDS product multidrug efflux MFS transporter Blt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229880.1 protein_id gnl|my_center|LOCUS_38810 216134 216595 gene locus_tag LOCUS_38820 gene pssA 216134 216595 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966430.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38820 216586 216861 gene locus_tag LOCUS_38830 216586 216861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38830 217244 217972 gene locus_tag LOCUS_38840 217244 217972 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_38840 218230 218084 gene locus_tag LOCUS_38850 218230 218084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 218760 218539 gene locus_tag LOCUS_38860 218760 218539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 220167 218830 gene locus_tag LOCUS_38870 220167 218830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 protein_id gnl|my_center|LOCUS_38870 221139 220381 gene locus_tag LOCUS_38880 221139 220381 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 protein_id gnl|my_center|LOCUS_38880 222115 221165 gene locus_tag LOCUS_38890 222115 221165 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_38890 222948 222112 gene locus_tag LOCUS_38900 222948 222112 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_38900 224074 223601 gene locus_tag LOCUS_38910 224074 223601 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 protein_id gnl|my_center|LOCUS_38910 224516 224088 gene locus_tag LOCUS_38920 224516 224088 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096713.1 protein_id gnl|my_center|LOCUS_38920 224911 224597 gene locus_tag LOCUS_38930 224911 224597 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 protein_id gnl|my_center|LOCUS_38930 226030 225812 gene locus_tag LOCUS_38940 226030 225812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 227089 226757 gene locus_tag LOCUS_38950 227089 226757 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906360.1 protein_id gnl|my_center|LOCUS_38950 229224 227476 gene locus_tag LOCUS_38960 229224 227476 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 protein_id gnl|my_center|LOCUS_38960 230358 229603 gene locus_tag LOCUS_38970 230358 229603 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229858.1 protein_id gnl|my_center|LOCUS_38970 231022 230666 gene locus_tag LOCUS_38980 231022 230666 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398671.1 protein_id gnl|my_center|LOCUS_38980 231433 231074 gene locus_tag LOCUS_38990 231433 231074 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399021.1 protein_id gnl|my_center|LOCUS_38990 231837 232082 gene locus_tag LOCUS_39000 231837 232082 CDS product spore coat protein F-like protein YraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229845.1 protein_id gnl|my_center|LOCUS_39000 232100 232468 gene locus_tag LOCUS_39010 232100 232468 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967868.1 protein_id gnl|my_center|LOCUS_39010 232487 233623 gene locus_tag LOCUS_39020 232487 233623 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229843.1 protein_id gnl|my_center|LOCUS_39020 233642 233839 gene locus_tag LOCUS_39030 233642 233839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229842.1 protein_id gnl|my_center|LOCUS_39030 233855 234154 gene locus_tag LOCUS_39040 233855 234154 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246006.1 protein_id gnl|my_center|LOCUS_39040 234564 234286 gene locus_tag LOCUS_39050 234564 234286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 235579 234599 gene locus_tag LOCUS_39060 235579 234599 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_39060 235746 236648 gene locus_tag LOCUS_39070 gene cmrA 235746 236648 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_39070 237209 236802 gene locus_tag LOCUS_39080 237209 236802 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 protein_id gnl|my_center|LOCUS_39080 237714 237310 gene locus_tag LOCUS_39090 gene adhR 237714 237310 CDS product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 protein_id gnl|my_center|LOCUS_39090 237902 238573 gene locus_tag LOCUS_39100 237902 238573 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_39100 238759 239808 gene locus_tag LOCUS_39110 gene adhA 238759 239808 CDS product formaldehyde dehydrogenase AdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229837.1 protein_id gnl|my_center|LOCUS_39110 239957 240466 gene locus_tag LOCUS_39120 gene yraA 239957 240466 CDS product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 protein_id gnl|my_center|LOCUS_39120 242543 240507 gene locus_tag LOCUS_39130 gene sacC 242543 240507 CDS product levanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398804.1 protein_id gnl|my_center|LOCUS_39130 243530 242703 gene locus_tag LOCUS_39140 gene levG 243530 242703 CDS product PTS fructose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229834.1 protein_id gnl|my_center|LOCUS_39140 244355 243552 gene locus_tag LOCUS_39150 gene levF 244355 243552 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229833.1 protein_id gnl|my_center|LOCUS_39150 244860 244372 gene locus_tag LOCUS_39160 gene levE 244860 244372 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399158.1 protein_id gnl|my_center|LOCUS_39160 245300 244860 gene locus_tag LOCUS_39170 gene levD 245300 244860 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246144.1 protein_id gnl|my_center|LOCUS_39170 248297 245490 gene locus_tag LOCUS_39180 gene levR 248297 245490 CDS product transcriptional regulator LevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229830.1 protein_id gnl|my_center|LOCUS_39180 249318 248692 gene locus_tag LOCUS_39190 249318 248692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 249964 249437 gene locus_tag LOCUS_39200 249964 249437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 250185 251573 gene locus_tag LOCUS_39210 250185 251573 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886581.1 protein_id gnl|my_center|LOCUS_39210 252366 251734 gene locus_tag LOCUS_39220 252366 251734 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229828.1 protein_id gnl|my_center|LOCUS_39220 252518 253345 gene locus_tag LOCUS_39230 252518 253345 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398526.1 protein_id gnl|my_center|LOCUS_39230 253537 254037 gene locus_tag LOCUS_39240 gene sigV 253537 254037 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_39240 254037 254894 gene locus_tag LOCUS_39250 gene rsiV 254037 254894 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_39250 255007 256926 gene locus_tag LOCUS_39260 gene oatA 255007 256926 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398729.1 protein_id gnl|my_center|LOCUS_39260 257048 257344 gene locus_tag LOCUS_39270 257048 257344 CDS product YrhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398584.1 protein_id gnl|my_center|LOCUS_39270 260752 257588 gene locus_tag LOCUS_39280 gene cypB 260752 257588 CDS product bifunctional cytochrome P450/NADPH--P450 reductase CypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246174.1 protein_id gnl|my_center|LOCUS_39280 261354 260770 gene locus_tag LOCUS_39290 gene fatR 261354 260770 CDS product transcriptional regulator FatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967878.1 protein_id gnl|my_center|LOCUS_39290 262114 261575 gene locus_tag LOCUS_39300 262114 261575 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398716.1 protein_id gnl|my_center|LOCUS_39300 262766 262617 gene locus_tag LOCUS_39310 262766 262617 CDS product YrzI family small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399102.1 protein_id gnl|my_center|LOCUS_39310 263089 262916 gene locus_tag LOCUS_39320 263089 262916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 263957 263157 gene locus_tag LOCUS_39330 263957 263157 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229815.1 protein_id gnl|my_center|LOCUS_39330 264589 264221 gene locus_tag LOCUS_39340 264589 264221 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398508.1 protein_id gnl|my_center|LOCUS_39340 264897 267845 gene locus_tag LOCUS_39350 gene fdhF 264897 267845 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886582.1 protein_id gnl|my_center|LOCUS_39350 267864 268346 gene locus_tag LOCUS_39360 267864 268346 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246168.1 protein_id gnl|my_center|LOCUS_39360 268613 268383 gene locus_tag LOCUS_39370 268613 268383 CDS product YrhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237358.1 protein_id gnl|my_center|LOCUS_39370 269835 268696 gene locus_tag LOCUS_39380 269835 268696 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229810.1 protein_id gnl|my_center|LOCUS_39380 270760 269837 gene locus_tag LOCUS_39390 270760 269837 CDS product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229809.1 protein_id gnl|my_center|LOCUS_39390 271519 270824 gene locus_tag LOCUS_39400 gene mtnN 271519 270824 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 protein_id gnl|my_center|LOCUS_39400 272183 271542 gene locus_tag LOCUS_39410 272183 271542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229807.1 protein_id gnl|my_center|LOCUS_39410 272375 272578 gene locus_tag LOCUS_39420 272375 272578 CDS product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967883.1 protein_id gnl|my_center|LOCUS_39420 273313 272615 gene locus_tag LOCUS_39430 273313 272615 CDS product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246156.1 protein_id gnl|my_center|LOCUS_39430 275132 273378 gene locus_tag LOCUS_39440 275132 273378 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 protein_id gnl|my_center|LOCUS_39440 275659 275186 gene locus_tag LOCUS_39450 gene greA 275659 275186 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 protein_id gnl|my_center|LOCUS_39450 276545 275910 gene locus_tag LOCUS_39460 gene udk 276545 275910 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_39460 277819 276551 gene locus_tag LOCUS_39470 277819 276551 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_39470 278767 277838 gene locus_tag LOCUS_39480 278767 277838 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 protein_id gnl|my_center|LOCUS_39480 279426 278773 gene locus_tag LOCUS_39490 279426 278773 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 protein_id gnl|my_center|LOCUS_39490 280660 279578 gene locus_tag LOCUS_39500 gene mltG 280660 279578 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229799.1 protein_id gnl|my_center|LOCUS_39500 281077 280796 gene locus_tag LOCUS_39510 281077 280796 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246199.1 protein_id gnl|my_center|LOCUS_39510 281511 281095 gene locus_tag LOCUS_39520 gene ruvX 281511 281095 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_39520 281785 281519 gene locus_tag LOCUS_39530 281785 281519 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_39530 284506 281870 gene locus_tag LOCUS_39540 gene alaS 284506 281870 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 protein_id gnl|my_center|LOCUS_39540 285901 284840 gene locus_tag LOCUS_39550 285901 284840 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_39550 286343 286152 gene locus_tag LOCUS_39560 286343 286152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 protein_id gnl|my_center|LOCUS_39560 286879 286355 gene locus_tag LOCUS_39570 286879 286355 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886583.1 protein_id gnl|my_center|LOCUS_39570 289332 286936 gene locus_tag LOCUS_39580 289332 286936 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398511.1 protein_id gnl|my_center|LOCUS_39580 290008 289358 gene locus_tag LOCUS_39590 290008 289358 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886584.1 protein_id gnl|my_center|LOCUS_39590 291188 290064 gene locus_tag LOCUS_39600 gene mnmA 291188 290064 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398509.1 protein_id gnl|my_center|LOCUS_39600 292349 291207 gene locus_tag LOCUS_39610 292349 291207 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246057.1 protein_id gnl|my_center|LOCUS_39610 292784 292368 gene locus_tag LOCUS_39620 gene cymR 292784 292368 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_39620 292986 294251 gene locus_tag LOCUS_39630 292986 294251 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398500.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence138 >Feature sequence139 >Feature sequence140 >Feature sequence141 >Feature sequence142 >Feature sequence143 >Feature sequence144 >Feature sequence145 >Feature sequence146 >Feature sequence147 >Feature sequence148 582 319 gene locus_tag LOCUS_39640 gene bofA 582 319 CDS product sigma-K factor-processing regulator BofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225421.1 protein_id gnl|my_center|LOCUS_39640 873 649 gene locus_tag LOCUS_39650 873 649 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242387.1 protein_id gnl|my_center|LOCUS_39650 1487 891 gene locus_tag LOCUS_39660 gene recR 1487 891 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_39660 1825 1502 gene locus_tag LOCUS_39670 1825 1502 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 protein_id gnl|my_center|LOCUS_39670 3540 1849 gene locus_tag LOCUS_39680 gene dnaX 3540 1849 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247135.1 protein_id gnl|my_center|LOCUS_39680 4501 4016 gene locus_tag LOCUS_39690 gene tadA 4501 4016 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_39690 4587 5132 gene locus_tag LOCUS_39700 4587 5132 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247139.1 protein_id gnl|my_center|LOCUS_39700 5202 6485 gene locus_tag LOCUS_39710 5202 6485 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_39710 6584 7207 gene locus_tag LOCUS_39720 gene dgk 6584 7207 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247138.1 protein_id gnl|my_center|LOCUS_39720 7204 7857 gene locus_tag LOCUS_39730 gene dck 7204 7857 CDS product deoxyadenosine/deoxycytidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226792.1 protein_id gnl|my_center|LOCUS_39730 8061 7969 gene locus_tag LOCUS_t00880 8061 7969 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9473 8196 gene locus_tag LOCUS_39740 gene serS 9473 8196 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 protein_id gnl|my_center|LOCUS_39740 10384 9794 gene locus_tag LOCUS_39750 gene pdxT 10384 9794 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226797.1 protein_id gnl|my_center|LOCUS_39750 11290 10406 gene locus_tag LOCUS_39760 gene pdxS 11290 10406 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_39760 12818 11487 gene locus_tag LOCUS_39770 gene dacA 12818 11487 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966224.1 protein_id gnl|my_center|LOCUS_39770 14437 12971 gene locus_tag LOCUS_39780 gene guaB 14437 12971 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_39780 14519 15505 gene locus_tag LOCUS_39790 14519 15505 CDS product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247147.1 protein_id gnl|my_center|LOCUS_39790 15658 15548 gene locus_tag LOCUS_r00090 15658 15548 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8