COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..1687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 sequence2 source 1..5662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(765..2183) product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2506..3810) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene eno CDS complement(3832..5250) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene pykF sequence3 source 1..238105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(14..1514) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(1821..2180) product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005973382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(2496..3359) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene lgt CDS complement(3375..4157) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(4171..5235) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 5391..6455 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 6474..7007 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(7196..8683) product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(8721..9044) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(9044..9733) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(9967..10281) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(10297..10944) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 11108..12406 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 12659..13999 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(14198..17446) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005974395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(17513..18379) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene metF CDS 18818..19093 product molecular chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 19106..20725 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016573.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene groL CDS complement(20948..21997) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene disA CDS complement(21990..23369) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene radA CDS complement(23372..23863) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene coaD CDS complement(23873..25276) product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25305..26315) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(26302..27006) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene rnc CDS complement(27026..28267) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene fabF CDS complement(28582..28806) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene acpP CDS complement(28873..29772) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene fabD CDS complement(29813..30799) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(30802..31797) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene plsX CDS 32075..32440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(32561..32977) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene mscL CDS complement(33000..34088) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene mnmA CDS complement(34110..34745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 34971..35330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 35560..36837 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(37051..38964) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene thrS CDS complement(39085..42585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(42645..43091) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene smpB CDS complement(43135..45246) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rnr CDS complement(45246..45818) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene yqeK CDS 46155..47774 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 47856..48074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 48240..48686 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 48698..49276 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(49464..50738) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(50761..51696) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(51944..52831) product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(52992..54812) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016311.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene htpG CDS complement(55039..56262) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(56293..57636) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene dnaB CDS complement(57665..58114) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rplI CDS complement(58128..58958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(58977..60434) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene dnaX CDS complement(60438..61832) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(61845..62714) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(62720..63160) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(63168..63779) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(63801..64136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(64292..67087) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(67084..67632) product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(67948..70491) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(70503..71054) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(71058..72260) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(72422..72928) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(72929..75124) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(75121..75705) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene coaE CDS complement(75706..76743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 76911..77240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 77219..77596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(77778..79124) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 79294..80649 product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 80651..81175 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(81250..83547) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(83752..84642) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(84954..85778) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(85858..87249) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(87419..88390) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(88383..89390) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(89409..90275) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(90285..91211) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(91498..93018) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(93084..93356) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016206.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene minE CDS complement(93359..94156) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene minD CDS complement(94158..94805) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(94988..95944) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(96152..97618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(97635..98360) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016203.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(98705..100528) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene glmS CDS 101151..103727 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene clpB CDS complement(103800..105116) product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(105116..107422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(107583..109010) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 109256..109987 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 110004..110426 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 110740..111954 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene ilvA CDS complement(112213..112521) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene trxA CDS complement(112596..113711) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(113731..114873) product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(114882..115997) product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(116020..116463) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(116479..117558) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene eutH CDS complement(117558..117869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(117878..118126) product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(118130..118723) product TIGR02536 family ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842667.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(118735..119520) product ethanolamine utilization cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(119701..121140) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(121218..121511) product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene eutM CDS complement(121532..121996) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016127.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(122007..122660) product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene eutL CDS complement(122745..123632) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene eutC CDS complement(123644..125011) product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(125035..126465) product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene eutA CDS complement(126847..129126) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(129276..129470) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797412.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(129500..130588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(130954..134526) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005971513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene nifJ CDS complement(134792..136147) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(136199..137389) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene megL CDS 137523..138950 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(139139..139855) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene deoD CDS complement(139870..140358) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene ybeY CDS complement(140373..142445) product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(142456..144930) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(144935..145408) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(145427..147130) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(147231..147482) product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(147561..148541) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(149179..149445) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(149445..149711) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(149950..150150) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 150758..152092 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 152256..153698 product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene creD CDS complement(153882..155183) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(155227..155730) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(155773..156435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(156419..157564) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(157561..158655) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(158677..159072) product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016324.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(159053..159955) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016325.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(160026..161531) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 161649..162101 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene dtd CDS complement(162282..162614) product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(162635..164014) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene nhaC CDS 164621..167179 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene recJ CDS complement(167396..168193) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(168538..169494) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene hutG CDS 170292..170798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 170825..171538 product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 171555..171773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 171895..172308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 172336..172809 product DUF2004 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681659.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(173246..173953) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(173953..174666) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(174870..175304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(175311..175958) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(175960..176910) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(176897..178261) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene glmU CDS complement(178284..178874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(179177..179443) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(179428..179655) product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(179712..180038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(180546..183122) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene leuS CDS complement(183119..183724) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(183734..184438) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rlmB CDS complement(184446..185717) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene murA CDS complement(185795..186271) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 tRNA 186416..186492 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 186500..186575 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 186584..186659 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 186664..186739 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 186762..186845 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 186857..186931 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 187002..187577 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 187595..188302 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 188299..189282 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene mnmA CDS complement(189371..190648) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(191076..192641) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rny CDS complement(192663..193010) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(193012..193410) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(193418..193807) product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(193855..194766) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene miaA CDS complement(194750..196036) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene obgE CDS complement(196282..196959) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(197029..198450) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene putP CDS complement(199023..199694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(199917..200441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(200441..200875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(200978..201502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(201503..205369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(205450..206061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(206088..206243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(206227..206361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(206454..207044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(207041..208696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 208698..208883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(209056..209622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(209624..210484) product immunity 49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002246836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(210493..210771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(211206..211556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(211700..211879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(212033..212416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(212421..213536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(213619..214497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(214454..215530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(215912..216322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 note possible pseudo, internal stop codon CDS complement(216437..216799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(216799..224586) product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(224595..226199) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(226309..226731) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(226963..229023) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene fusA CDS 229387..230235 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 230417..231445 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 231602..232696 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016530.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene dnaN CDS 232749..234209 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 234275..235147 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895540.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 235632..235916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 236128..237453 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene der tRNA complement(237898..237973) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 rRNA complement(237984..238090) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence4 source 1..258896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 899..1282 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 1683..2051 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rpsL CDS 2073..2543 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene rpsG CDS 2584..4665 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015672.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene fusA CDS 4759..5943 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene tuf CDS complement(6223..7563) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 7924..9117 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(9299..10144) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 10557..11711 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene metK CDS 12182..13921 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626891.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 13932..15728 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 15863..17467 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 17476..18396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 note possible pseudo, internal stop codon CDS 18487..18702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 18978..24857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 24844..25518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 25900..26358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 26345..27013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 27399..27593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 27580..28248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 28934..30058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 30058..30564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 30674..31480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 31484..32017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 32245..33045 product PrpR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 33071..33556 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ybaK CDS 33622..34578 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 34604..35212 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 35209..35568 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 35558..35779 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898710.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 35754..36395 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 36405..37007 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 37033..37788 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene tpiA CDS 37820..38914 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene ychF CDS 39145..39324 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene rpmF CDS complement(39490..42900) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017116.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene dnaE CDS complement(42911..44686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(44818..47520) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(47517..48230) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 48423..49238 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 49297..50787 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 51052..52404 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 52429..52965 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 53186..54166 product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene rfaE1 CDS 54160..54642 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene ispF CDS 54636..55988 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 56001..56522 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 56612..56923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 56936..58279 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene ffh CDS 58326..58589 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene rpsP CDS 58874..59485 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 59469..60824 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene pabB CDS 60827..61573 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 tRNA 61711..61786 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 61792..61868 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 61872..61947 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 61955..62028 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 62079..62154 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 62161..62236 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 62245..62319 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 62335..62410 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 62416..62492 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 62496..62571 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 62581..62664 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 62689..62764 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 62783..62859 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 62865..62941 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 63227..63484 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene rpmB CDS 63911..65056 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 65084..65971 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626888.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 65973..66953 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 66943..67722 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 67727..68440 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(68478..69977) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene glpK CDS complement(70105..70851) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(71226..71417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 71658..72317 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 72425..72793 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 72809..73381 product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene amaP CDS 73382..73606 product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 73610..74071 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene nusB CDS complement(74220..74345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(74416..74967) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015710.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 75040..76536 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015709.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 76564..77568 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015708.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 77580..78986 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 78998..79519 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 79521..80378 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015705.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 80400..81158 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 81155..81523 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene acpS CDS 81708..82631 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene prfB note possible pseudo, frameshifted CDS 82798..83517 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene fabG CDS 83567..84775 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(84941..85306) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(85321..86517) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(86633..87640) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene gap CDS complement(87884..88264) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(88515..89057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016228.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 89693..90601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 90661..91530 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 92010..93104 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(93411..95999) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 96573..97349 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 97381..98220 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 98591..99814 product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 100059..100808 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 100999..103068 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene recG CDS 103487..105718 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene pflB CDS 105968..106699 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene pflA CDS 107009..107212 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 107213..109498 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 109479..110525 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(110780..111178) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rpsI CDS complement(111190..111624) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene rplM CDS 112127..113479 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(113648..114718) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene asd CDS complement(114765..115640) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene thrB CDS complement(115640..117091) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene thrC CDS complement(117246..118547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 118870..120735 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 120737..123709 product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033406.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 123711..124841 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 124844..126172 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 126339..128129 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 128144..133918 product filamentous hemagglutinin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143403532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 assembly_gap 133660..133904 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 134091..136382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 136379..137521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 137610..140933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 140946..141509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 141546..142487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 143862..144056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 note possible pseudo, frameshifted CDS 144098..146680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 note possible pseudo, frameshifted CDS 146695..147339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 147644..148624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 note possible pseudo, frameshifted CDS 148719..150572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 150572..150907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 151170..151550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 151703..154312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 154324..154881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 155163..156263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 156509..157066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 note possible pseudo, frameshifted CDS 157089..158561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 note possible pseudo, frameshifted CDS 158563..159078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 159115..159405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 159417..159674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 159691..160590 product immunity 49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002246836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 160603..161160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 161480..162490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 162438..162743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 162763..163101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(163422..165293) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(165283..166212) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene pfkB CDS complement(166222..166956) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 167255..167518 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 167800..169521 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene ptsP CDS complement(169801..170823) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(170832..171506) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(171494..172678) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene dxr CDS complement(172721..173608) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(173601..174293) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 174540..174809 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 174799..175677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 note possible pseudo, frameshifted CDS 175670..177289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 note possible pseudo, frameshifted CDS 177552..178301 product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(178642..179577) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 179947..181122 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 181307..182320 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene mglB CDS 182403..183905 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene mglA CDS 183922..184941 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene mglC CDS complement(185166..186443) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 186822..196706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 196864..197550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(197724..199001) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(199256..200005) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198479972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(200037..201215) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(201724..202788) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene alr CDS complement(202865..203386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 203774..204688 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene accD CDS 204698..205639 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 205661..206629 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene pfkA CDS 206644..206940 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 206949..207542 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene recR CDS 207643..207993 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rplS CDS complement(208547..208909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(208919..209497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(209509..209682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(209777..209938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(210153..210551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(210567..211019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(210982..211317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(211331..211948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(211967..212776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(212967..213941) product phage integrase N-terminal SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 213990..214283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(214295..214687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 214593..214832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 214843..215187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(215254..216408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(216401..217054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(217051..218151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(218138..218419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(218431..219078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(219075..219605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(219602..220648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(220630..220842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(220823..223552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(223734..224123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(224136..224645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(224655..226103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(226112..226465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(226453..227004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(226992..227537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(227540..227866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(227859..228095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(228111..229139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(229152..229469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(229478..230509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(230478..232007) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(232016..232426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(232423..234243) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(234236..234826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(234953..235633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(235636..236952) product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(237128..238138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(238216..238404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(238371..238616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(238845..239372) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(239408..239806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(239829..240275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 240426..240632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(240716..240940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 241402..241530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 241523..241738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 241750..241980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 242004..242180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 242193..242387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 242408..243379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 243515..243742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 243742..244128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 244144..244848 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 244841..245470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 245473..245646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 245761..246042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 246053..246262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 246313..246906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 246927..247106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 247154..248140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 248068..248745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 248755..248967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 249055..249189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 249192..249347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 249344..250267 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 250311..250574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 250576..250836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 250842..251060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 251070..251357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 251360..251749 product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 251746..252252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 252249..253214 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861113.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 253186..253554 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 253566..253778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 253860..255077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 tRNA complement(255229..255318) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(255344..255427) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(255475..255825) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene rplT CDS complement(255853..256059) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpmI CDS complement(256116..256538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 rRNA 257383..258883 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence5 source 1..420811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(608..2083) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(2188..3942) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016401.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 4231..4665 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 5001..5996 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene hemA CDS 6013..6921 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016555.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene hemC CDS 6937..8394 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene cobA CDS 8413..9381 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene hemB CDS 9398..10699 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene hemL CDS 10689..11141 product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016462.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 11288..11548 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rpsT CDS complement(11736..16559) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(17042..17614) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene frr CDS complement(17659..18378) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene pyrH CDS complement(18564..19457) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene tsf CDS complement(19497..20240) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rpsB CDS 20707..21471 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(21974..22555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(22567..23343) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(23340..24167) product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(24185..25435) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rpoD CDS complement(25463..27364) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene dnaG CDS complement(27752..29464) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(29492..30877) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 31225..32988 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(33291..33707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(33791..34732) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 35126..35308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(35594..36982) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(36984..37562) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(37552..37989) product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene eutP CDS complement(38010..38357) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(38388..39209) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene folP CDS complement(39196..40020) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene folK CDS complement(40079..40633) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene folE CDS complement(40648..42708) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene glyS CDS complement(42789..43661) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene glyQ CDS complement(43658..44122) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene lspA CDS complement(44135..46942) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903528.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene ileS CDS complement(46935..49367) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(49368..51533) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 51783..52241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 52526..54271 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 54261..55955 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 56170..56673 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 56749..57258 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015852.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(57531..59120) product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(59134..60606) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene putP CDS complement(60666..61850) product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893427.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(61863..63071) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene dpaL CDS 63336..65051 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(65048..66274) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene rpoN CDS complement(66398..68014) product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015853.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(68462..68680) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene rpsR CDS complement(68722..69006) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene rpsF CDS complement(69101..70174) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene ftsZ CDS complement(70200..71498) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene ftsA CDS complement(71495..72178) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(72188..73054) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(73110..73949) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene murB CDS complement(73961..75343) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene murC CDS complement(75349..76416) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene murG CDS complement(76424..77722) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene murD CDS complement(77719..78804) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene mraY CDS complement(78804..80651) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene gmhB CDS 80837..82519 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene hcp CDS 83184..84185 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene trpX CDS 84225..85112 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 85114..85878 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 85965..86441 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(86450..86764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 86837..87490 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(87754..89772) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(89850..90860) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(90847..91065) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(91067..91627) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene gmk CDS complement(91647..92525) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(92759..96718) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rpoC CDS complement(96755..100309) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rpoB CDS complement(100476..100841) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005889295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rplL CDS complement(100877..101389) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene rplJ CDS complement(101543..102250) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rplA CDS complement(102312..102737) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rplK CDS complement(102771..103352) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene nusG CDS complement(103349..103525) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene secE tRNA complement(103547..103622) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(103650..103802) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene rpmG CDS 104194..105243 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene dinB CDS 105294..106493 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 106583..107032 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 107573..108403 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 108406..110061 product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627758.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 110084..111136 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 111150..112145 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 112148..112930 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 112961..113815 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 113859..114632 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene murI CDS complement(114677..114943) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rplS CDS complement(115024..115521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(115550..116329) product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(116329..116946) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005966861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene pyrE CDS complement(116976..117833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(117823..118536) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene pyrF CDS complement(118559..119473) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(119485..120276) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(120520..123696) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene carB CDS complement(123711..124787) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene carA CDS complement(124816..126078) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(126273..127163) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(127249..127770) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene pyrR CDS 128067..128525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 129234..130172 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 130172..130984 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 131020..132570 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 132583..133362 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 133379..134143 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(134317..135069) product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(135072..135626) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 tRNA complement(135760..135844) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(135861..135935) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(135938..136013) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(136086..136937) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(137225..137401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902951.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 137668..138846 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016855.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 138904..139329 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 139459..140343 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(140579..140959) product adhesion protein FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(141128..142483) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(142712..144070) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene trkA CDS complement(144406..144909) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(144909..145736) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene thyA CDS 145943..147484 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene gltX CDS 147700..147945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 147964..149202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 149532..150575 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 150604..151056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 151073..151357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 151416..152090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 152041..152499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 152612..153256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143403544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 153329..154441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 154663..155217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 155243..155872 product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016782.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 156065..157306 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139457934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(157575..158300) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene pgeF CDS complement(158300..159295) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015676.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene aroF CDS complement(159305..159568) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015677.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(159584..160450) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(160450..161478) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902246.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(161465..161863) product mini-ribonuclease 3-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(161851..163266) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene cysS CDS complement(163288..163989) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ispD CDS complement(163965..166301) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 166609..166878 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 166891..167721 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene eutJ CDS 167730..168629 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(168879..169469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(169583..170914) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene mgtE CDS complement(170949..172070) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene tgt CDS complement(172088..174262) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(174288..174809) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(174864..175661) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(175691..176365) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(176369..177649) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(177678..178127) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(178143..178994) product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(178988..179920) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene fmt CDS complement(179938..180387) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene nrdR CDS complement(180400..180870) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(180864..181547) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene recO CDS complement(181564..182139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(182149..182964) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene mreC CDS 183133..183801 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(184032..185213) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(185229..186749) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(186860..188002) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene mtnK CDS complement(188014..189063) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(189086..190381) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(190394..191551) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 191713..193086 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 193076..193744 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(193886..195376) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(195591..196880) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(197259..197636) product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene nifU CDS complement(197699..198874) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene nifS CDS complement(198946..199602) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene nth CDS complement(199786..200271) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(200289..201497) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene tyrS CDS complement(201562..202842) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016106.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene brnQ CDS complement(202873..204051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(204066..204500) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903558.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene aroQ CDS complement(204481..205284) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(205277..205537) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(205577..206116) product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 206407..207342 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 207365..208195 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 208202..208978 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 tRNA complement(209013..209087) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(209095..209171) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 209727..210188 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene ribE CDS 210190..211275 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene ribD CDS 211307..211963 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene ribE CDS 211972..213171 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 213202..216006 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene ppc CDS complement(216251..216619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(216629..216928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 tRNA complement(217066..217142) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(217154..217229) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(217235..217310) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(217321..217404) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(217406..217480) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(217498..217575) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(217583..217659) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(217668..217743) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(217754..217829) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(217852..217928) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(217939..218026) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(218111..218416) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(218459..219451) product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(219817..220983) product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(221008..221592) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rsxA CDS complement(221589..222206) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(222206..222739) product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(222729..223676) product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(223702..225015) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rsxC CDS complement(225090..225665) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015693.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene pth CDS 225972..227129 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(227344..228843) product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene yfcC CDS complement(228997..230568) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005916172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(230668..231432) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 231742..232107 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 232286..233071 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene thiD CDS 233094..233762 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene thiE CDS 234287..234895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 234902..235087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 235095..236321 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 236318..237355 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 237371..237844 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 237829..238320 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 238317..238727 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 238729..239286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895049.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 239261..239818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 239811..241001 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016028.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 241011..241769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 241766..243334 product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 tRNA 243396..243472 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tmRNA 243525..243869 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(243944..245116) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene dnaJ CDS complement(245162..245674) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(245810..247633) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene dnaK CDS complement(247680..248279) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene grpE CDS complement(248295..249308) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene hrcA CDS complement(249410..249973) product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 250127..250585 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 250582..251217 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016094.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(251458..253095) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 253447..254145 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(254349..255200) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897665.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(255264..255959) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(255959..257131) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 rRNA complement(257533..257639) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(257719..260616) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(260708..260784) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(260788..260864) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 rRNA complement(260922..262422) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(262855..264366) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(264737..265012) product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(265028..265894) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene ispE CDS complement(265887..266186) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(266308..269250) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 269362..269838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(270031..270540) product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367181.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(270554..272446) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene mnmG CDS complement(272467..273837) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene mnmE CDS complement(273847..274596) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(274599..275216) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(275216..275461) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene yidD CDS complement(275458..275814) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016064.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rnpA CDS complement(275874..276008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 276687..278585 product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 278609..280171 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 280182..281612 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 281940..282059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 282224..283435 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 283521..284054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 284291..285553 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 285550..286056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 286166..289216 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 289323..289700 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 290044..290259 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene yaaA CDS 290286..291383 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 291380..291661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 291688..293595 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene gyrB CDS 293668..296106 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene gyrA CDS 296120..296581 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 296599..297615 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene pheS CDS 297743..300139 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene pheT CDS 300245..300730 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 301073..301639 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene ahpC CDS 301873..303510 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 303953..304849 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene nadA CDS 304851..306143 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 306121..306981 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene nadC CDS 306974..307483 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(307558..308724) product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(308737..309726) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene galE CDS complement(309728..311260) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(311303..312469) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(312682..313551) product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 314100..315479 product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 315626..316279 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 316294..316947 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 316951..317604 product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(317764..319227) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene nagE CDS 319667..320614 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 320814..321317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 321867..323921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 324327..325901 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 325925..327271 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 327281..327937 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 327946..329847 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene mnmG CDS 329844..330542 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rsmG CDS 330580..331344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(331479..331928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 332147..332458 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene rpsJ CDS 332605..333240 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene rplC CDS 333260..333892 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene rplD CDS 333892..334179 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rplW CDS 334219..335049 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rplB CDS 335074..335349 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rpsS CDS 335383..335715 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene rplV CDS 335734..336393 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rpsC CDS 336396..336821 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904138.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rplP CDS 336821..337003 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015718.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rpmC CDS 337059..337310 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rpsQ CDS 337339..337707 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rplN CDS 337732..338073 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene rplX CDS 338092..338643 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rplE CDS 338664..338951 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene rpsN CDS 338981..339379 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene rpsH CDS 339404..339937 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene rplF CDS 339964..340332 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene rplR CDS 340356..340850 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rpsE CDS 340864..341049 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene rpmD CDS 341049..341528 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene rplO CDS 341553..342833 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene secY CDS 343072..344562 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 344572..345486 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 345499..347400 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 347542..348516 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 348846..349280 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 349298..350782 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(350942..351949) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene ilvC CDS complement(352092..352877) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(352886..353944) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene leuB CDS complement(354144..354719) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene leuD CDS complement(354719..356110) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene leuC CDS complement(356121..357629) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(357649..358137) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene ilvN CDS complement(358130..359848) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(359869..361080) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene ilvA CDS complement(361157..362818) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene ilvD CDS complement(363066..363185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(363429..364187) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 364353..365249 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 365480..366388 product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 366401..367495 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 367492..368349 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017011.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 368360..369076 product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 369077..369745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 369738..370496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 370521..371711 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 371713..372783 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 372777..373967 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(374053..374409) product DUF1353 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(374712..375008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(375261..378089) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(378303..379631) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(379787..380701) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene glsA CDS complement(381228..381779) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene rnmV CDS complement(381789..383177) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene asnS CDS complement(383189..383377) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(383430..384683) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 384878..386116 product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 386558..387790 product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 387973..389562 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 389555..390583 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 390576..391658 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 391676..391975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 392081..392791 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(393084..393629) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016408.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene raiA CDS 393914..394969 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene corA CDS complement(395258..395824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(395855..397060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(397108..398538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 398726..399265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(399354..400631) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 400803..401048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(401357..401506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 401501..401716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 402333..402779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 403028..403966 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 404038..404718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 405143..405409 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 405409..405675 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 406194..407420 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 407865..408194 product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 408296..409567 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene serS CDS 409551..410036 product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 410066..414610 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 414708..416813 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 416849..417325 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 417351..418346 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene lpxD CDS 418672..420516 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 sequence6 source 1..884009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 133..208 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 337..1875 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017155.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene guaA CDS complement(2258..3265) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 3652..4929 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 5170..6090 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 6122..6940 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene nagB CDS 7003..7416 product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene glmS CDS 7423..8829 product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene glmL CDS 8840..10291 product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(10487..11401) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ilvE CDS 11923..12642 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 12897..14360 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene guaB CDS 14375..15199 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 15183..15623 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 15783..16184 product adhesion protein FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060555389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 16218..16844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 16854..17456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 17458..17715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 17676..18215 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627726.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 18234..25739 product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 26034..26708 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 26724..28181 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 28171..29007 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene kdsA CDS 29628..31334 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene argS CDS complement(31740..33098) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(33115..34113) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene pdxA CDS complement(34138..35415) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(35431..36198) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(36910..38289) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 38443..38775 product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene hxlR CDS complement(38985..39956) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(39967..40506) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(40499..41086) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(41095..41877) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(41874..42593) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(42695..44575) product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 44932..45609 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 45629..46903 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 46932..47999 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 47999..51070 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 51063..51470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(51775..53709) product glycogen-debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 54118..54924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 54926..55504 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 55525..56580 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 56598..57143 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene scpB CDS 57133..57837 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 57847..58137 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene gatC CDS 58146..59606 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene gatA CDS 59621..61066 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene gatB CDS 61394..62353 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene pip CDS 62343..63353 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 63366..64049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016628.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 64075..65181 product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(65272..66045) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(66077..66706) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(66959..67396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 68024..68773 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 68775..69347 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ruvC CDS 69356..69862 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(70122..70601) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(70618..71895) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(71911..73845) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene trmB CDS complement(73865..74518) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene cmk CDS complement(74573..75505) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029493681.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene prmA CDS complement(75486..76277) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 76404..77384 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene trpS CDS complement(77632..77922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 78052..78675 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 78733..79224 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 79229..79672 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene rpiB CDS 79696..80034 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(80263..82245) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 82426..82620 product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(82851..83636) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(83717..86008) product autotransporter phospholipase A1 FplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene fplA CDS 86158..87156 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rfaD CDS 87169..87987 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 88217..88795 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842710.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rfbC CDS 88804..89703 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene rfbD CDS 89706..90683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 90707..92497 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 92501..93088 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 93108..94319 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 94329..94949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 94946..96121 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 96133..97155 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 97155..98261 product type 8 capsular polysaccharide synthesis protein Cap8F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene cap8F CDS 98269..99300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 99300..100427 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene wecB CDS 100443..101465 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 101469..102512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 102527..104014 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene murJ CDS 104133..105038 product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rfaE1 CDS 105060..106199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 106758..107060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 107076..107369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(107616..108593) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(108606..109061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(109081..110178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(110168..110686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 110844..111545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 111561..111773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 111851..113635 product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 113652..114317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 114801..115427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 115533..116774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 117016..117258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 117383..118216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 118213..118515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 118484..119044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(119280..119714) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(119859..120404) product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(120608..121954) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(121935..122606) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(122637..123314) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(123307..124476) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(124572..126380) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene recQ CDS complement(126597..127526) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(127779..129353) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(129313..130062) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene phnC CDS complement(130156..131037) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(131235..131696) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492147.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 131815..132978 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene nagA CDS 133123..134160 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene bioB CDS 134150..134812 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene bioD CDS 134962..136296 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene bioA CDS complement(136527..137126) product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(137149..138966) product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(139091..140893) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene lepA CDS complement(141174..141965) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(141962..142513) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(142780..144801) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016651.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(145168..146703) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene hutH CDS 147025..148143 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 148161..148580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(148883..150700) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene typA CDS complement(150715..151578) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene truB CDS 151775..152197 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 152494..153828 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 153869..154165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 154192..154842 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 154938..156065 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene cbiD CDS 156052..156708 product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene cbiE CDS 156695..157660 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901670.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 157681..158250 product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene cbiT CDS 158442..159680 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 159700..160587 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 160611..161924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 161943..162665 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene cobI CDS 162680..163363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 163401..164171 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene cobM CDS 164214..165215 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene cbiG CDS 165215..165964 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene cobJ CDS 165978..166721 product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene cobK CDS 166745..167857 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 167975..168232 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene rpsO CDS 168588..169664 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene rlmN CDS 169667..171817 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 171819..174656 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 174656..175888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 175891..178671 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 178680..179348 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 179341..179958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016448.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 179971..180567 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene ruvA CDS 180571..181071 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 181250..182485 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 182497..183789 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016643.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 183867..185930 product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(186064..187086) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(187114..188082) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(188092..189939) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene hprK CDS complement(189976..190983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(190976..192211) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(192249..192950) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 193215..194105 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 tRNA 194270..194346 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(194325..194807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 194749..194919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 195087..195329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 195329..196231 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 196695..197885 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 197896..198225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 198247..199506 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 199490..201673 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 201689..204001 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene priA CDS 204015..204527 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene def CDS 204538..204861 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 204858..205898 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016951.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene glpX CDS 205908..206393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795010.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 206411..207667 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene aroA CDS 207664..208746 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene aroC CDS 209145..211388 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 211414..215385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 215472..217571 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(217707..219092) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(219112..219873) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 220061..221275 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene xseA CDS 221256..222014 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 222044..222913 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene dprA CDS 222966..225218 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene topA CDS 225231..226550 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016878.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene trmFO CDS 226543..227433 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 227412..228521 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene yqeH CDS 228523..229008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 229031..230140 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene ftsY CDS 230565..231569 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene pta CDS 231638..232834 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 232936..236505 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene nifJ CDS complement(236670..237947) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(238242..238538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(238821..239447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 note possible pseudo, internal stop codon CDS 239642..241357 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 241361..243085 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 243458..243994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(244194..245141) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(245168..246109) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(246132..246755) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 247337..247645 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 247648..249099 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene panF CDS 249474..250481 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 250471..251172 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 251189..251977 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(252237..253751) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(253926..254798) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627801.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 254957..255727 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 255728..256255 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 256364..256834 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 256861..257949 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene nusA CDS 257942..258475 product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 258495..260711 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene infB CDS 260728..261087 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene rbfA CDS 261087..262763 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene recJ CDS 262786..264075 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene tig CDS 264316..264897 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene clpP CDS 264918..266177 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene clpX CDS 266207..268513 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene lon CDS 268526..269110 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene yihA CDS 269201..271861 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 271947..272522 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 272777..273958 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 273963..274502 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 274516..275592 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 275592..276683 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 276831..278063 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 278081..278521 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene dut CDS 278543..279655 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene rodA CDS 279652..280524 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016843.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 280546..281838 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 281986..282294 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 282598..283887 product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 283889..285169 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 285184..286386 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 286392..287084 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 287118..287540 product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 287580..288017 product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 288020..289225 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 289226..289924 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902775.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 290282..290656 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 290817..293381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 293683..297234 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene smc CDS 297244..298248 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene lpxK CDS 298256..299029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 299042..299614 product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene nadD CDS complement(299802..304727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 305210..307210 product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 307229..307546 product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367483.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 307575..307979 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 307997..309118 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 309230..310195 product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene gctA CDS 310198..311001 product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene gctB CDS 311081..312835 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 312873..314114 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 314149..314949 product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 315109..316434 product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 316447..317604 product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 317615..318208 product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 318550..319134 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626307.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 319200..319973 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 319970..321142 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 321132..321782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 321779..322756 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198481065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 322725..323564 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 323548..324834 product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 324831..325760 product 3-oxoacyl-ACP synthase III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 325909..327039 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 327382..328455 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene prfA CDS 328456..329595 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene prmC CDS 329576..330607 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene queA CDS 330626..331180 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene rsmD CDS 331245..331457 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene xseB CDS 331459..332355 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 332423..333070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 333283..334785 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene malQ CDS 334795..337161 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 337193..339019 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene glgB CDS 339219..340358 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 340361..341524 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene glgD CDS 341539..342426 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 342438..343652 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 343798..344109 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene rplU CDS 344112..344441 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 344442..344726 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rpmA CDS 344940..345926 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 347008..347697 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 347851..348924 product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene asrA CDS 348927..349730 product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene asrB CDS 349739..350713 product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene asrC CDS complement(350771..351199) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(351432..352076) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016759.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene tsaB CDS complement(352057..352524) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene tsaE CDS complement(352536..353000) product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene rfaE2 CDS complement(352987..353604) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(353729..354010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903162.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(354062..354814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(354823..357021) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(357028..357414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(357427..357921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 358162..359436 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene brnQ CDS complement(359674..360312) product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(360335..361573) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene hutI CDS complement(361720..362685) product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene ftcD CDS complement(362802..363167) product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(363194..363979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(364131..365171) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene tnpB CDS 365456..365710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 365777..367405 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 367430..368395 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049518049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 368571..368906 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(369203..369889) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(369905..372400) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(372410..372559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(372568..373260) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(373282..374103) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(374134..374919) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(374929..375789) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(375770..377782) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene aroB CDS 377894..378871 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 378960..379613 product viroplasmin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 379625..380317 product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016817.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(380474..381835) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(382038..383783) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(383780..384850) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene lpxB CDS complement(384859..385662) product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(385662..386435) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene lpxA CDS complement(386448..386873) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene fabZ CDS complement(386969..387796) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene lpxC CDS complement(387811..390009) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898558.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(390076..390798) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(390791..392476) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 392672..394096 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(394178..395461) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene purD CDS complement(395482..396996) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene purH CDS complement(397000..397551) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(397539..398558) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016807.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene purM CDS complement(398580..399962) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene purF CDS complement(399962..400675) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(400703..401176) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene purE CDS complement(401189..404929) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 405640..406296 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 406313..407383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 407459..408442 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903470.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene asnA CDS complement(408584..410575) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene uvrB CDS complement(410850..411398) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(411429..411677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(412048..412872) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(412923..413708) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(413701..414555) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(414542..415672) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(416042..417406) product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005970668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(417419..418147) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 418480..420948 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(421137..423290) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene ftsH CDS complement(423287..424669) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene tilS CDS complement(424727..425659) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015952.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene mltG CDS complement(425676..427271) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 427390..427860 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 427892..428794 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(429012..432164) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(432154..434889) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016942.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(434916..436259) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(436459..437121) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(437170..438477) product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 438640..440073 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(440287..441069) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 441408..442022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842716.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 442049..442963 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 443033..443941 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 443941..444630 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 444639..445532 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 445534..446415 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 446738..447157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897638.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 447241..448032 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(448284..449366) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(449363..450337) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene cbiB CDS complement(450404..451888) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(452169..452792) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032884835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene upp CDS complement(452853..453044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(452986..453228) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 453432..455114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(455339..455842) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(455856..456560) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 456887..457126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 457120..457395 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(457553..458056) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 458391..459698 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene miaB CDS 459742..460980 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene rho CDS 460999..462153 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 462347..463402 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene ispG CDS 463458..463907 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 463909..464214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 464234..464632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 464857..465402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016871.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 465427..466275 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016856.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 466306..467541 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene pepT CDS 467874..469601 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(469842..471014) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(471040..471828) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(471849..472994) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 473200..473931 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 473941..474702 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 474712..475197 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(475522..475686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(475676..475888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(476518..477042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(477035..477436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(477417..477779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(477694..479637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(479837..479992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(480061..480612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(480642..481919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(482038..482427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(482455..482673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(482643..490577) product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(490593..492392) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(492620..493432) product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(493673..494326) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(494537..495307) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 495643..496242 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016652.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 496252..498807 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene ppdK CDS 498809..500746 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 501178..502611 product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 502782..503348 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(503518..503856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(503923..505545) product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(505547..506224) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(506224..506874) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene rpe CDS complement(506867..507754) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene rsgA CDS complement(507762..508292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 repeat_region 508799..510284 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttaaattccaatatggttttacataaat CDS complement(510396..510728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(510741..510962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 note possible pseudo, frameshifted CDS complement(510995..511234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 note possible pseudo, frameshifted CDS complement(511304..513742) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(513818..514918) product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene cas5 CDS complement(514929..515813) product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene cas7i CDS complement(515826..517370) product type I CRISPR-associated protein Cas8a1/Csx8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene cas8a1 CDS complement(517360..518112) product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene cas6 CDS complement(518140..519039) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 519596..520117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 520410..521042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 note possible pseudo, internal stop codon CDS complement(521078..521254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 521325..521621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(521856..522143) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(522277..522702) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(522724..523626) product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(523646..525169) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(525234..527000) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene uvrC CDS complement(526987..527847) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene rapZ CDS complement(527954..529303) product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(529554..532388) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene uvrA CDS complement(532392..533138) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(533150..534697) product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(534722..535462) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene kdsB CDS 535584..536204 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 536301..536753 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene trmL CDS complement(537065..537361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 537432..537608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(537644..537892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(538078..539052) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(539045..539830) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(539842..541413) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(541469..542299) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(542300..543238) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(543255..544598) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 545222..545932 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 545925..546653 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 546696..547421 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 547809..548468 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 548449..549129 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 549126..549881 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 549989..550858 product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 551127..552275 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(552506..554089) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(554113..554448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147387007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(554455..555465) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(555462..556142) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(556144..557082) product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene ricT CDS complement(557102..557806) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene radC CDS complement(557827..558900) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene cobT CDS complement(558923..559498) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(559515..560306) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene cobS CDS complement(560328..560891) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene cobU CDS 561192..561818 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 561821..562210 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 562219..562956 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(563207..563929) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008798583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(563926..565470) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(565570..567189) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(567226..568095) product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(568108..569466) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene pepV CDS complement(569485..570258) product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(570248..571534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(571546..575910) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(575938..576501) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(576491..577225) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene trmD CDS complement(577222..577743) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene rimM CDS complement(577752..577991) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(578003..578245) product DUF4911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016281.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(578252..579046) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene rsmA CDS complement(579055..579582) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene hpt CDS complement(579815..580525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 580693..583425 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene polA CDS 583451..584356 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902471.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene whiA CDS 584378..585334 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016595.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 585309..585983 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 585977..587446 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016596.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene murJ CDS 587509..588246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 588248..589462 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene coaBC CDS 589462..590013 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 590010..590534 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 590553..591521 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016600.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 591514..592314 product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 592304..593191 product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 593178..593858 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 593895..594263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 594266..595321 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene earP CDS 595324..595887 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene efp CDS 596213..597235 product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 597317..597790 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 597802..599088 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 599103..599894 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(600070..600246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(600689..602530) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(602548..602763) product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(602765..603136) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 603444..603959 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 604126..605385 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200863.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 605398..606537 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(606708..607112) product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene atpC CDS complement(607123..608511) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene atpD CDS complement(608552..609400) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene atpG CDS complement(609412..610914) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene atpA CDS complement(610939..611463) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene atpH CDS complement(611460..611951) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene atpF CDS complement(611992..612261) product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene atpE CDS complement(612291..613043) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene atpB CDS complement(613085..613459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(613459..613704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(613708..615069) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene glmM CDS complement(615091..615609) product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902602.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(615759..617192) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene purB CDS complement(617185..617616) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene rimI CDS complement(617631..618551) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene lepB CDS 618775..618918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 619028..620305 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 620534..621481 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 622077..622616 product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(622890..623534) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016305.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(623528..624835) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene rsmB CDS complement(624859..625086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(625110..625616) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene nrdG CDS complement(625622..627808) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene nrdD CDS complement(627974..628222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(628643..629269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(629285..631945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(632178..632489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(632512..632751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(632824..633066) product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(633310..633882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(634036..642057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(642073..643872) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(644215..646017) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene pepF CDS complement(646041..646520) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(646554..647777) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(647801..648181) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(648380..649018) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903694.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(649023..649877) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(650079..650303) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene secG CDS complement(650394..650750) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene crcB CDS complement(650752..651666) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene metA CDS complement(651681..652892) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(652963..653808) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 653972..654976 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(655229..655960) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(655980..656978) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(656965..657741) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(657751..658671) product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 658932..659207 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(659537..660736) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene gltS CDS complement(660904..662442) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(662886..663494) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(663505..664197) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(664175..664555) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(664770..666251) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene lysS CDS complement(666272..667519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(667535..667870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(667958..668425) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(668434..670377) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene mutL CDS complement(670398..670823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(670829..671857) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(672304..672579) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017079.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene yajC CDS complement(672687..673481) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074017151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 673645..673887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 674415..675194 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016812.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene pssA CDS 675200..676276 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 676289..677734 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(677908..679689) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016293.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene aspS CDS complement(679691..680935) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene hisS CDS complement(680948..682168) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(682363..683142) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016757.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(683161..683802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(684201..685019) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 685171..686616 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene cls CDS 686630..687550 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016754.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(687873..689246) product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016702.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(689271..689942) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene bioC CDS complement(689932..690540) product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(690533..691678) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(691903..692487) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene gmhA CDS complement(692531..693415) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 693740..696091 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903647.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(696211..696540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 note possible pseudo, internal stop codon, frameshifted CDS complement(696718..697338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(697361..697825) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016571.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(697847..699163) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(699393..700388) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081212.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(700408..700710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(700718..701620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(701708..703381) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(703418..703984) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(704128..705021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(705173..708556) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(708628..709617) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(709659..710360) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(710466..711569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(711559..713052) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(713308..713889) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015911.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(713886..715064) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(715080..716408) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(716411..717619) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(717632..718165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902446.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(718185..718871) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene gpmA CDS 719409..721319 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 721346..722563 product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(722747..723487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(723498..726134) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene secA CDS complement(726190..728202) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene ligA CDS complement(728473..728970) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(729019..729504) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 729657..730673 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 730796..731476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 731790..732446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(732655..732930) product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(732948..733754) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene murI CDS complement(733910..735136) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(735133..735798) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(735816..736883) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(736896..738191) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(738204..739058) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(739247..741049) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene hflX CDS complement(741064..741582) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(741927..743381) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(743810..744598) product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(744598..746154) product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(746135..747616) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(747618..748634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(748638..749915) product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene ablA CDS complement(750029..751066) product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene kdd CDS complement(751095..751910) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(751935..752321) product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 752843..752989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 tRNA complement(753241..753327) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(753441..754313) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(754486..755223) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(755230..757029) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(757067..757960) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016357.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(757979..758779) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(759078..760625) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(760845..761798) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene secF CDS complement(761788..763026) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene secD CDS complement(763042..763458) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ruvX CDS complement(763483..766089) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene alaS CDS complement(766104..766829) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene lptB CDS complement(766829..769501) product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(769494..772136) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene mutS CDS 772741..773325 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene plsY CDS 773334..774479 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene dnaN CDS 774516..775802 product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 775824..776201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 776203..776520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 776854..778053 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 778204..778752 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 778859..780106 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 780106..780666 product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 780923..782227 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rph CDS 782487..782891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(783076..783999) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 784322..785134 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 785158..786087 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 786389..786718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 786757..787218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 787555..788076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 788398..789675 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 789836..790504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(790714..790878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(790883..791110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(791374..791718) product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(791718..792983) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(792994..794424) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(794702..795589) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene galU CDS complement(795727..797637) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017027.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene metG CDS complement(797687..798361) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(798556..798903) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008797059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(798984..800717) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene sppA CDS complement(800928..801950) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene tsaD CDS complement(801947..802507) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(802488..803663) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene recA CDS complement(803665..804669) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(804671..805303) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(805305..806333) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(806330..807349) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(807339..808121) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(808162..809247) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(809564..810370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896379.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(810399..810758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023037397.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(810765..811541) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(811550..812614) product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(812626..813495) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene ylqF CDS complement(813476..814174) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rsmI CDS complement(814174..815559) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(815663..816493) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016988.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(816456..817295) product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(817270..819078) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene dxs CDS complement(819101..819400) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene yhbY CDS complement(819419..821347) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(821298..823250) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene mrdA CDS complement(823251..823658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(823668..824657) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(824650..825969) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene mtaB CDS complement(825956..826663) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(826673..827095) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(827092..828090) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene ruvB CDS complement(828120..828719) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 829063..829983 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene cysK CDS complement(830193..831248) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(831537..832541) product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(832525..833046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(833065..833736) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(833749..834852) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene hemW CDS complement(834836..836524) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(836541..837272) product complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 837607..839706 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene pnp CDS 839728..840288 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene pgsA CDS 840314..840595 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 840711..841655 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene rsmH CDS 841656..841913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897415.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 841915..843273 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene rlmD CDS complement(843437..844450) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(844443..845189) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene pxpB CDS complement(845343..846530) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(846548..847321) product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 tRNA 847529..847605 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 847655..847731 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(847973..851425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(851822..852172) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903918.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene rplQ CDS complement(852199..853179) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(853208..853795) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene rpsD CDS complement(853836..854225) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene rpsK CDS complement(854270..854626) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene rpsM CDS complement(854950..855171) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene infA CDS complement(855296..856060) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene map CDS complement(856243..856869) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 857211..857846 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(858001..858201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(858217..859110) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene era CDS complement(859107..859886) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627738.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(859888..861549) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016269.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene recN CDS complement(861543..862346) product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(862375..863667) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(863615..864586) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 864753..866057 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 866190..866780 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 866874..867941 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 868155..868889 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene truA CDS 868906..869376 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 869438..869866 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 870244..871875 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 871936..873270 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 873749..875095 product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(875336..875950) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(875969..877111) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene thiH CDS complement(877234..878010) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(877991..878644) product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897548.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene thiF CDS complement(878658..878852) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008702803.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene thiS CDS complement(879048..880349) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015816.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene thiC rRNA complement(880913..881019) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(881099..883996) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080