>Feature sequence01 38 382 gene locus_tag LOCUS_00010 38 382 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461971.1 protein_id gnl|my_center|LOCUS_00010 397 1245 gene locus_tag LOCUS_00020 397 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00020 >Feature sequence02 >Feature sequence03 1653 166 gene locus_tag LOCUS_00030 1653 166 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_00030 2760 1684 gene locus_tag LOCUS_00040 2760 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4415 2847 gene locus_tag LOCUS_00050 4415 2847 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_00050 5216 4530 gene locus_tag LOCUS_00060 5216 4530 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137082021.1 protein_id gnl|my_center|LOCUS_00060 6109 5213 gene locus_tag LOCUS_00070 6109 5213 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880037.1 protein_id gnl|my_center|LOCUS_00070 7455 6106 gene locus_tag LOCUS_00080 7455 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8132 7461 gene locus_tag LOCUS_00090 8132 7461 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_00090 8527 8204 gene locus_tag LOCUS_00100 8527 8204 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_00100 9921 8626 gene locus_tag LOCUS_00110 9921 8626 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_00110 10951 9908 gene locus_tag LOCUS_00120 gene rhaT 10951 9908 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_00120 11092 11247 gene locus_tag LOCUS_00130 11092 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11254 12114 gene locus_tag LOCUS_00140 11254 12114 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_00140 14772 12358 gene locus_tag LOCUS_00150 14772 12358 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_00150 16397 14910 gene locus_tag LOCUS_00160 16397 14910 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_00160 17830 16403 gene locus_tag LOCUS_00170 17830 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20190 17893 gene locus_tag LOCUS_00180 20190 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21813 20272 gene locus_tag LOCUS_00190 21813 20272 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_00190 22916 21834 gene locus_tag LOCUS_00200 22916 21834 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785424.1 protein_id gnl|my_center|LOCUS_00200 25090 22928 gene locus_tag LOCUS_00210 25090 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26171 25356 gene locus_tag LOCUS_00220 26171 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27177 26272 gene locus_tag LOCUS_00230 27177 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28898 27318 gene locus_tag LOCUS_00240 28898 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31473 28978 gene locus_tag LOCUS_00250 31473 28978 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108597.1 protein_id gnl|my_center|LOCUS_00250 33304 31538 gene locus_tag LOCUS_00260 33304 31538 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 protein_id gnl|my_center|LOCUS_00260 34911 33328 gene locus_tag LOCUS_00270 34911 33328 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_00270 36497 34947 gene locus_tag LOCUS_00280 36497 34947 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107895.1 protein_id gnl|my_center|LOCUS_00280 38543 36801 gene locus_tag LOCUS_00290 38543 36801 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_00290 41847 38563 gene locus_tag LOCUS_00300 41847 38563 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791958.1 protein_id gnl|my_center|LOCUS_00300 43172 42162 gene locus_tag LOCUS_00310 43172 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 43836 43279 gene locus_tag LOCUS_00320 43836 43279 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_00320 45464 43992 gene locus_tag LOCUS_00330 45464 43992 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_00330 46520 45504 gene locus_tag LOCUS_00340 46520 45504 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_00340 47497 46661 gene locus_tag LOCUS_00350 47497 46661 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_00350 48434 47508 gene locus_tag LOCUS_00360 48434 47508 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616255.1 protein_id gnl|my_center|LOCUS_00360 48999 48544 gene locus_tag LOCUS_00370 48999 48544 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767034.1 protein_id gnl|my_center|LOCUS_00370 49131 50180 gene locus_tag LOCUS_00380 49131 50180 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_00380 50205 50657 gene locus_tag LOCUS_00390 50205 50657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50654 51745 gene locus_tag LOCUS_00400 50654 51745 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_00400 54241 51806 gene locus_tag LOCUS_00410 gene galB 54241 51806 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_00410 57380 54324 gene locus_tag LOCUS_00420 57380 54324 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993256.1 protein_id gnl|my_center|LOCUS_00420 59452 57509 gene locus_tag LOCUS_00430 59452 57509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 61222 59675 gene locus_tag LOCUS_00440 61222 59675 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_00440 63617 61323 gene locus_tag LOCUS_00450 63617 61323 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_00450 64446 63736 gene locus_tag LOCUS_00460 64446 63736 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786402.1 protein_id gnl|my_center|LOCUS_00460 66654 64663 gene locus_tag LOCUS_00470 66654 64663 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 protein_id gnl|my_center|LOCUS_00470 70104 66667 gene locus_tag LOCUS_00480 70104 66667 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791958.1 protein_id gnl|my_center|LOCUS_00480 71340 70276 gene locus_tag LOCUS_00490 71340 70276 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_00490 71989 71396 gene locus_tag LOCUS_00500 71989 71396 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_00500 72331 74832 gene locus_tag LOCUS_00510 gene hrpB 72331 74832 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_00510 74923 75618 gene locus_tag LOCUS_00520 74923 75618 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_00520 75611 76009 gene locus_tag LOCUS_00530 75611 76009 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_00530 76861 76034 gene locus_tag LOCUS_00540 gene cysQ 76861 76034 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813481.1 protein_id gnl|my_center|LOCUS_00540 77414 76890 gene locus_tag LOCUS_00550 gene cysC 77414 76890 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_00550 79015 77789 gene locus_tag LOCUS_00560 79015 77789 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_00560 81346 79106 gene locus_tag LOCUS_00570 81346 79106 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_00570 84364 81350 gene locus_tag LOCUS_00580 84364 81350 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_00580 87571 84542 gene locus_tag LOCUS_00590 87571 84542 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_00590 88780 87758 gene locus_tag LOCUS_00600 88780 87758 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_00600 90291 88801 gene locus_tag LOCUS_00610 90291 88801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 91860 90403 gene locus_tag LOCUS_00620 91860 90403 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_00620 95286 91966 gene locus_tag LOCUS_00630 95286 91966 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_00630 96510 95491 gene locus_tag LOCUS_00640 96510 95491 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_00640 97176 96601 gene locus_tag LOCUS_00650 97176 96601 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_00650 98474 97476 gene locus_tag LOCUS_00660 gene rhaT 98474 97476 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_00660 100112 98553 gene locus_tag LOCUS_00670 100112 98553 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_00670 103173 100162 gene locus_tag LOCUS_00680 103173 100162 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_00680 104568 103693 gene locus_tag LOCUS_00690 104568 103693 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_00690 105535 104747 gene locus_tag LOCUS_00700 105535 104747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_00700 106835 105675 gene locus_tag LOCUS_00710 106835 105675 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_00710 107651 106953 gene locus_tag LOCUS_00720 107651 106953 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_00720 110566 107657 gene locus_tag LOCUS_00730 gene lacZ 110566 107657 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_00730 113527 110633 gene locus_tag LOCUS_00740 113527 110633 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080241138.1 protein_id gnl|my_center|LOCUS_00740 113813 114700 gene locus_tag LOCUS_00750 113813 114700 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_00750 115838 114786 gene locus_tag LOCUS_00760 115838 114786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 116771 115974 gene locus_tag LOCUS_00770 116771 115974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 117010 116756 gene locus_tag LOCUS_00780 117010 116756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 117528 118304 gene locus_tag LOCUS_00790 117528 118304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00790 119166 119090 gene locus_tag LOCUS_t00010 119166 119090 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 120291 119257 gene locus_tag LOCUS_00800 gene asnA 120291 119257 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_00800 120493 121662 gene locus_tag LOCUS_00810 120493 121662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908499.1 protein_id gnl|my_center|LOCUS_00810 122515 121727 gene locus_tag LOCUS_00820 122515 121727 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_00820 122595 123296 gene locus_tag LOCUS_00830 122595 123296 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_00830 124418 123351 gene locus_tag LOCUS_00840 124418 123351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 124958 124452 gene locus_tag LOCUS_00850 124958 124452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 125571 125056 gene locus_tag LOCUS_00860 125571 125056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 126717 125653 gene locus_tag LOCUS_00870 126717 125653 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_00870 126810 127229 gene locus_tag LOCUS_00880 126810 127229 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_00880 127523 127233 gene locus_tag LOCUS_00890 127523 127233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 128629 127520 gene locus_tag LOCUS_00900 gene recF 128629 127520 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_00900 128628 128858 gene locus_tag LOCUS_00910 128628 128858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 128904 129596 gene locus_tag LOCUS_00920 128904 129596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_00920 129670 130158 gene locus_tag LOCUS_00930 gene ribH 129670 130158 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764452.1 protein_id gnl|my_center|LOCUS_00930 131252 130221 gene locus_tag LOCUS_00940 131252 130221 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_00940 131910 131587 gene locus_tag LOCUS_00950 131910 131587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 132107 132859 gene locus_tag LOCUS_00960 132107 132859 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_00960 135772 132965 gene locus_tag LOCUS_00970 135772 132965 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_00970 137358 136033 gene locus_tag LOCUS_00980 137358 136033 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_00980 137749 138222 gene locus_tag LOCUS_00990 137749 138222 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 protein_id gnl|my_center|LOCUS_00990 138329 138724 gene locus_tag LOCUS_01000 138329 138724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 140890 139121 gene locus_tag LOCUS_01010 140890 139121 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_01010 142684 140903 gene locus_tag LOCUS_01020 142684 140903 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_01020 145023 142729 gene locus_tag LOCUS_01030 145023 142729 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_01030 145304 146170 gene locus_tag LOCUS_01040 145304 146170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 146289 147119 gene locus_tag LOCUS_01050 gene prmA 146289 147119 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766150.1 protein_id gnl|my_center|LOCUS_01050 147847 147125 gene locus_tag LOCUS_01060 147847 147125 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016858.1 protein_id gnl|my_center|LOCUS_01060 148509 147853 gene locus_tag LOCUS_01070 148509 147853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 149086 148562 gene locus_tag LOCUS_01080 149086 148562 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_01080 149287 149826 gene locus_tag LOCUS_01090 149287 149826 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_01090 149923 150627 gene locus_tag LOCUS_01100 149923 150627 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_01100 150730 151662 gene locus_tag LOCUS_01110 150730 151662 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_01110 151695 152444 gene locus_tag LOCUS_01120 151695 152444 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_01120 153543 152530 gene locus_tag LOCUS_01130 153543 152530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 153953 153543 gene locus_tag LOCUS_01140 153953 153543 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_01140 154666 153959 gene locus_tag LOCUS_01150 154666 153959 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_01150 156133 154757 gene locus_tag LOCUS_01160 gene nhaD 156133 154757 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_01160 160577 156246 gene locus_tag LOCUS_01170 160577 156246 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_01170 160733 161770 gene locus_tag LOCUS_01180 gene tsaD 160733 161770 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_01180 161827 162789 gene locus_tag LOCUS_01190 161827 162789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 163543 162848 gene locus_tag LOCUS_01200 163543 162848 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_01200 163895 163527 gene locus_tag LOCUS_01210 163895 163527 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_01210 164688 164098 gene locus_tag LOCUS_01220 gene yqaB 164688 164098 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209450.1 protein_id gnl|my_center|LOCUS_01220 165547 168798 gene locus_tag LOCUS_01230 165547 168798 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_01230 169547 170131 gene locus_tag LOCUS_01240 169547 170131 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_01240 170442 170726 gene locus_tag LOCUS_01250 170442 170726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 170813 170899 gene locus_tag LOCUS_t00020 170813 170899 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 171155 170970 gene locus_tag LOCUS_01260 171155 170970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 171195 172418 gene locus_tag LOCUS_01270 171195 172418 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362024.1 protein_id gnl|my_center|LOCUS_01270 172477 172809 gene locus_tag LOCUS_01280 172477 172809 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_01280 172820 173269 gene locus_tag LOCUS_01290 172820 173269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 174179 173757 gene locus_tag LOCUS_01300 174179 173757 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790451.1 protein_id gnl|my_center|LOCUS_01300 174451 176100 gene locus_tag LOCUS_01310 174451 176100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 176428 176156 gene locus_tag LOCUS_01320 176428 176156 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_01320 177278 176685 gene locus_tag LOCUS_01330 177278 176685 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_01330 178444 177293 gene locus_tag LOCUS_01340 178444 177293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 179533 179715 gene locus_tag LOCUS_01350 179533 179715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 184230 180100 gene locus_tag LOCUS_01360 184230 180100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 185254 184232 gene locus_tag LOCUS_01370 185254 184232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 185647 185255 gene locus_tag LOCUS_01380 185647 185255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 186050 185658 gene locus_tag LOCUS_01390 186050 185658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 187211 186270 gene locus_tag LOCUS_01400 187211 186270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence04 127 1173 gene locus_tag LOCUS_01410 127 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 >Feature sequence05 243 1202 gene locus_tag LOCUS_01420 243 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 1195 1845 gene locus_tag LOCUS_01430 1195 1845 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598709.1 protein_id gnl|my_center|LOCUS_01430 2879 1980 gene locus_tag LOCUS_01440 2879 1980 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_01440 3383 2955 gene locus_tag LOCUS_01450 3383 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 4369 3485 gene locus_tag LOCUS_01460 4369 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6198 4594 gene locus_tag LOCUS_01470 gene fumB 6198 4594 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066699.1 protein_id gnl|my_center|LOCUS_01470 7191 6367 gene locus_tag LOCUS_01480 7191 6367 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518967.1 protein_id gnl|my_center|LOCUS_01480 7310 8269 gene locus_tag LOCUS_01490 7310 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8966 8247 gene locus_tag LOCUS_01500 8966 8247 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_01500 9552 9175 gene locus_tag LOCUS_01510 9552 9175 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901327.1 protein_id gnl|my_center|LOCUS_01510 9674 11680 gene locus_tag LOCUS_01520 gene ligA 9674 11680 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_01520 11816 12343 gene locus_tag LOCUS_01530 11816 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12366 13247 gene locus_tag LOCUS_01540 gene dapA 12366 13247 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_01540 13447 14589 gene locus_tag LOCUS_01550 gene nspC 13447 14589 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_01550 16257 14644 gene locus_tag LOCUS_01560 16257 14644 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_01560 17758 16406 gene locus_tag LOCUS_01570 17758 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 20091 18625 gene locus_tag LOCUS_01580 gene rhaB 20091 18625 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_01580 20711 20193 gene locus_tag LOCUS_01590 20711 20193 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 protein_id gnl|my_center|LOCUS_01590 22024 20738 gene locus_tag LOCUS_01600 22024 20738 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_01600 23306 22182 gene locus_tag LOCUS_01610 23306 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 25654 23522 gene locus_tag LOCUS_01620 25654 23522 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_01620 27154 26054 gene locus_tag LOCUS_01630 gene buk 27154 26054 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964967.1 protein_id gnl|my_center|LOCUS_01630 28066 27161 gene locus_tag LOCUS_01640 gene ptb 28066 27161 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_01640 29458 28250 gene locus_tag LOCUS_01650 29458 28250 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_01650 30536 29565 gene locus_tag LOCUS_01660 30536 29565 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_01660 31554 30550 gene locus_tag LOCUS_01670 gene pta 31554 30550 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762631.1 protein_id gnl|my_center|LOCUS_01670 32004 34919 gene locus_tag LOCUS_01680 32004 34919 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_01680 35000 35593 gene locus_tag LOCUS_01690 35000 35593 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_01690 35653 36894 gene locus_tag LOCUS_01700 35653 36894 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_01700 36923 38179 gene locus_tag LOCUS_01710 36923 38179 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_01710 38312 40792 gene locus_tag LOCUS_01720 38312 40792 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_01720 40810 41832 gene locus_tag LOCUS_01730 40810 41832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 42088 43020 gene locus_tag LOCUS_01740 42088 43020 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_01740 44359 43103 gene locus_tag LOCUS_01750 44359 43103 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_01750 44578 45159 gene locus_tag LOCUS_01760 44578 45159 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_01760 45175 45750 gene locus_tag LOCUS_01770 45175 45750 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_01770 45805 46038 gene locus_tag LOCUS_01780 45805 46038 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_01780 46135 46713 gene locus_tag LOCUS_01790 46135 46713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 46854 47153 gene locus_tag LOCUS_01800 46854 47153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 47227 47754 gene locus_tag LOCUS_01810 gene msrA 47227 47754 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_01810 47871 48467 gene locus_tag LOCUS_01820 47871 48467 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_01820 48776 48606 gene locus_tag LOCUS_01830 48776 48606 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_01830 49613 48942 gene locus_tag LOCUS_01840 gene nth 49613 48942 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_01840 49756 51627 gene locus_tag LOCUS_01850 49756 51627 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_01850 52575 51664 gene locus_tag LOCUS_01860 52575 51664 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_01860 53147 52725 gene locus_tag LOCUS_01870 53147 52725 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_01870 53922 53179 gene locus_tag LOCUS_01880 53922 53179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 55370 54090 gene locus_tag LOCUS_01890 55370 54090 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860110.1 protein_id gnl|my_center|LOCUS_01890 58127 55776 gene locus_tag LOCUS_01900 58127 55776 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_01900 59013 58120 gene locus_tag LOCUS_01910 59013 58120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 59683 59030 gene locus_tag LOCUS_01920 59683 59030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 60034 59747 gene locus_tag LOCUS_01930 60034 59747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 61102 60704 gene locus_tag LOCUS_01940 61102 60704 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_01940 62434 61397 gene locus_tag LOCUS_01950 62434 61397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 63455 62856 gene locus_tag LOCUS_01960 63455 62856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 64114 63740 gene locus_tag LOCUS_01970 64114 63740 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114616.1 protein_id gnl|my_center|LOCUS_01970 64771 64334 gene locus_tag LOCUS_01980 64771 64334 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_01980 68030 66762 gene locus_tag LOCUS_01990 68030 66762 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_01990 69425 68331 gene locus_tag LOCUS_02000 69425 68331 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_02000 70072 69497 gene locus_tag LOCUS_02010 70072 69497 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_02010 71319 70318 gene locus_tag LOCUS_02020 71319 70318 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107685.1 protein_id gnl|my_center|LOCUS_02020 72662 71352 gene locus_tag LOCUS_02030 gene fucP 72662 71352 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_02030 73954 72704 gene locus_tag LOCUS_02040 73954 72704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_02040 75771 73990 gene locus_tag LOCUS_02050 gene fucI 75771 73990 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_02050 75905 77323 gene locus_tag LOCUS_02060 75905 77323 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_02060 77739 77320 gene locus_tag LOCUS_02070 77739 77320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 78813 77740 gene locus_tag LOCUS_02080 gene aroC 78813 77740 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766481.1 protein_id gnl|my_center|LOCUS_02080 79452 78877 gene locus_tag LOCUS_02090 79452 78877 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_02090 82341 79708 gene locus_tag LOCUS_02100 82341 79708 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_02100 82444 83595 gene locus_tag LOCUS_02110 82444 83595 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_02110 83663 84928 gene locus_tag LOCUS_02120 83663 84928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 85205 86635 gene locus_tag LOCUS_02130 gene dnaA 85205 86635 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_02130 86681 87283 gene locus_tag LOCUS_02140 86681 87283 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_02140 87590 88501 gene locus_tag LOCUS_02150 gene pyrB 87590 88501 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_02150 88507 88974 gene locus_tag LOCUS_02160 gene pyrI 88507 88974 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_02160 88998 89450 gene locus_tag LOCUS_02170 88998 89450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 89701 90087 gene locus_tag LOCUS_02180 89701 90087 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_02180 91158 90169 gene locus_tag LOCUS_02190 91158 90169 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_02190 91332 92243 gene locus_tag LOCUS_02200 91332 92243 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169648.1 protein_id gnl|my_center|LOCUS_02200 92376 93026 gene locus_tag LOCUS_02210 92376 93026 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_02210 93761 93072 gene locus_tag LOCUS_02220 gene truC 93761 93072 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 protein_id gnl|my_center|LOCUS_02220 93950 95188 gene locus_tag LOCUS_02230 93950 95188 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_02230 95195 96382 gene locus_tag LOCUS_02240 95195 96382 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_02240 96471 97532 gene locus_tag LOCUS_02250 96471 97532 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_02250 97649 98017 gene locus_tag LOCUS_02260 97649 98017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 98057 98632 gene locus_tag LOCUS_02270 98057 98632 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_02270 98819 99691 gene locus_tag LOCUS_02280 98819 99691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 100976 99699 gene locus_tag LOCUS_02290 100976 99699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 102338 100986 gene locus_tag LOCUS_02300 102338 100986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 103813 102332 gene locus_tag LOCUS_02310 103813 102332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 106532 103827 gene locus_tag LOCUS_02320 106532 103827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 109199 106596 gene locus_tag LOCUS_02330 109199 106596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 112292 109203 gene locus_tag LOCUS_02340 112292 109203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 112721 112296 gene locus_tag LOCUS_02350 112721 112296 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_02350 113038 112748 gene locus_tag LOCUS_02360 113038 112748 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_02360 114805 113051 gene locus_tag LOCUS_02370 114805 113051 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_02370 115539 114802 gene locus_tag LOCUS_02380 115539 114802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 115706 115542 gene locus_tag LOCUS_02390 115706 115542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 116156 115710 gene locus_tag LOCUS_02400 116156 115710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 116598 116167 gene locus_tag LOCUS_02410 116598 116167 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_02410 118048 116639 gene locus_tag LOCUS_02420 118048 116639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 119118 118069 gene locus_tag LOCUS_02430 119118 118069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 119688 119122 gene locus_tag LOCUS_02440 119688 119122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 120483 121799 gene locus_tag LOCUS_02450 120483 121799 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_02450 121980 122384 gene locus_tag LOCUS_02460 gene mce 121980 122384 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_02460 122411 123970 gene locus_tag LOCUS_02470 122411 123970 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_02470 123985 124347 gene locus_tag LOCUS_02480 123985 124347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 124375 124800 gene locus_tag LOCUS_02490 124375 124800 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_02490 124816 126459 gene locus_tag LOCUS_02500 124816 126459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 126707 127312 gene locus_tag LOCUS_02510 126707 127312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 127583 127374 gene locus_tag LOCUS_02520 127583 127374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 128479 127676 gene locus_tag LOCUS_02530 128479 127676 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_02530 128627 128701 gene locus_tag LOCUS_t00030 128627 128701 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 129586 128837 gene locus_tag LOCUS_02540 129586 128837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 131033 130020 gene locus_tag LOCUS_02550 131033 130020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 132095 131301 gene locus_tag LOCUS_02560 132095 131301 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930865.1 protein_id gnl|my_center|LOCUS_02560 133177 132269 gene locus_tag LOCUS_02570 133177 132269 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_02570 133748 133338 gene locus_tag LOCUS_02580 133748 133338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_02580 134125 134781 gene locus_tag LOCUS_02590 134125 134781 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_02590 134858 135847 gene locus_tag LOCUS_02600 134858 135847 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_02600 136010 139519 gene locus_tag LOCUS_02610 136010 139519 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_02610 139532 141289 gene locus_tag LOCUS_02620 139532 141289 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_02620 141305 142255 gene locus_tag LOCUS_02630 141305 142255 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665481.1 protein_id gnl|my_center|LOCUS_02630 142272 143882 gene locus_tag LOCUS_02640 142272 143882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 144232 144942 gene locus_tag LOCUS_02650 144232 144942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 145106 145504 gene locus_tag LOCUS_02660 145106 145504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_02660 146845 145607 gene locus_tag LOCUS_02670 146845 145607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 148397 146901 gene locus_tag LOCUS_02680 148397 146901 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130892939.1 protein_id gnl|my_center|LOCUS_02680 148857 148462 gene locus_tag LOCUS_02690 148857 148462 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_02690 150075 149290 gene locus_tag LOCUS_02700 150075 149290 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 protein_id gnl|my_center|LOCUS_02700 150747 150220 gene locus_tag LOCUS_02710 150747 150220 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_02710 151438 150773 gene locus_tag LOCUS_02720 151438 150773 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_02720 152201 151551 gene locus_tag LOCUS_02730 152201 151551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 153103 152213 gene locus_tag LOCUS_02740 gene lipA 153103 152213 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_02740 154453 153161 gene locus_tag LOCUS_02750 154453 153161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 154622 155455 gene locus_tag LOCUS_02760 154622 155455 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_02760 155613 155539 gene locus_tag LOCUS_t00040 155613 155539 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 155863 155789 gene locus_tag LOCUS_t00050 155863 155789 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 156011 155937 gene locus_tag LOCUS_t00060 156011 155937 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 157102 156194 gene locus_tag LOCUS_02770 157102 156194 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 protein_id gnl|my_center|LOCUS_02770 158696 157407 gene locus_tag LOCUS_02780 gene galK 158696 157407 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_02780 159773 158721 gene locus_tag LOCUS_02790 gene galT 159773 158721 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_02790 160865 159867 gene locus_tag LOCUS_02800 160865 159867 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_02800 161229 162278 gene locus_tag LOCUS_02810 161229 162278 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_02810 162615 164564 gene locus_tag LOCUS_02820 162615 164564 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_02820 165217 164921 gene locus_tag LOCUS_02830 165217 164921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 165216 165827 gene locus_tag LOCUS_02840 165216 165827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 165855 166355 gene locus_tag LOCUS_02850 165855 166355 CDS product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_02850 166504 167418 gene locus_tag LOCUS_02860 gene bla 166504 167418 CDS product class A beta-lactamase, subclass A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109295.1 protein_id gnl|my_center|LOCUS_02860 167446 168033 gene locus_tag LOCUS_02870 167446 168033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 168099 168530 gene locus_tag LOCUS_02880 168099 168530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 168865 169764 gene locus_tag LOCUS_02890 168865 169764 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682241.1 protein_id gnl|my_center|LOCUS_02890 170126 171151 gene locus_tag LOCUS_02900 170126 171151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 171415 171642 gene locus_tag LOCUS_02910 171415 171642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 171629 172078 gene locus_tag LOCUS_02920 171629 172078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 protein_id gnl|my_center|LOCUS_02920 172224 172967 gene locus_tag LOCUS_02930 172224 172967 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_02930 173424 174164 gene locus_tag LOCUS_02940 173424 174164 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_02940 174330 174731 gene locus_tag LOCUS_02950 174330 174731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 174955 176268 gene locus_tag LOCUS_02960 174955 176268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 176380 176811 gene locus_tag LOCUS_02970 176380 176811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 178463 176907 gene locus_tag LOCUS_02980 178463 176907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 178978 178652 gene locus_tag LOCUS_02990 178978 178652 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_02990 179429 179031 gene locus_tag LOCUS_03000 179429 179031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 181434 179503 gene locus_tag LOCUS_03010 gene yidC 181434 179503 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_03010 183054 181453 gene locus_tag LOCUS_03020 183054 181453 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_03020 185290 183194 gene locus_tag LOCUS_03030 185290 183194 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_03030 185933 185475 gene locus_tag LOCUS_03040 185933 185475 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_03040 186199 186882 gene locus_tag LOCUS_03050 gene trmD 186199 186882 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_03050 189716 186879 gene locus_tag LOCUS_03060 189716 186879 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_03060 189832 190539 gene locus_tag LOCUS_03070 189832 190539 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107771.1 protein_id gnl|my_center|LOCUS_03070 190986 190633 gene locus_tag LOCUS_03080 190986 190633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 192474 191236 gene locus_tag LOCUS_03090 192474 191236 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_03090 193393 197217 gene locus_tag LOCUS_03100 193393 197217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 197345 199534 gene locus_tag LOCUS_03110 197345 199534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 200486 199542 gene locus_tag LOCUS_03120 200486 199542 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_03120 200610 202175 gene locus_tag LOCUS_03130 200610 202175 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_03130 203005 202316 gene locus_tag LOCUS_03140 203005 202316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 203880 202996 gene locus_tag LOCUS_03150 203880 202996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 205253 204051 gene locus_tag LOCUS_03160 205253 204051 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_03160 205571 206230 gene locus_tag LOCUS_03170 205571 206230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 207894 206311 gene locus_tag LOCUS_03180 207894 206311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 209257 207977 gene locus_tag LOCUS_03190 209257 207977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 211262 209295 gene locus_tag LOCUS_03200 211262 209295 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_03200 214633 211280 gene locus_tag LOCUS_03210 214633 211280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767190.1 protein_id gnl|my_center|LOCUS_03210 215976 214834 gene locus_tag LOCUS_03220 215976 214834 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767176.1 protein_id gnl|my_center|LOCUS_03220 216678 216052 gene locus_tag LOCUS_03230 216678 216052 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence06 637 996 gene locus_tag LOCUS_03240 637 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1049 2323 gene locus_tag LOCUS_03250 gene wecB 1049 2323 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203393.1 protein_id gnl|my_center|LOCUS_03250 2415 3467 gene locus_tag LOCUS_03260 gene rfbB 2415 3467 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_03260 3596 4372 gene locus_tag LOCUS_03270 gene rfbA 3596 4372 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963425.1 protein_id gnl|my_center|LOCUS_03270 4373 5824 gene locus_tag LOCUS_03280 4373 5824 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_03280 5821 6936 gene locus_tag LOCUS_03290 5821 6936 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_03290 6946 7407 gene locus_tag LOCUS_03300 6946 7407 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_03300 7404 8297 gene locus_tag LOCUS_03310 gene citE 7404 8297 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355998.1 protein_id gnl|my_center|LOCUS_03310 8294 8947 gene locus_tag LOCUS_03320 8294 8947 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_03320 8954 9862 gene locus_tag LOCUS_03330 8954 9862 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765261.1 protein_id gnl|my_center|LOCUS_03330 9883 11271 gene locus_tag LOCUS_03340 9883 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 11333 12109 gene locus_tag LOCUS_03350 11333 12109 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_03350 12090 13184 gene locus_tag LOCUS_03360 12090 13184 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_03360 13191 13934 gene locus_tag LOCUS_03370 13191 13934 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 protein_id gnl|my_center|LOCUS_03370 13952 14179 gene locus_tag LOCUS_03380 13952 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 15993 15307 gene locus_tag LOCUS_03390 15993 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 16320 17480 gene locus_tag LOCUS_03400 gene gmd 16320 17480 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_03400 18282 19385 gene locus_tag LOCUS_03410 18282 19385 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_03410 19491 22355 gene locus_tag LOCUS_03420 19491 22355 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_03420 22777 23832 gene locus_tag LOCUS_03430 22777 23832 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_03430 24268 25356 gene locus_tag LOCUS_03440 24268 25356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_03440 27012 25549 gene locus_tag LOCUS_03450 27012 25549 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969322.1 protein_id gnl|my_center|LOCUS_03450 27496 27017 gene locus_tag LOCUS_03460 27496 27017 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_03460 28491 27508 gene locus_tag LOCUS_03470 28491 27508 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_03470 29178 28507 gene locus_tag LOCUS_03480 29178 28507 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_03480 30315 29278 gene locus_tag LOCUS_03490 30315 29278 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_03490 31919 30516 gene locus_tag LOCUS_03500 gene uxaC 31919 30516 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_03500 33198 31951 gene locus_tag LOCUS_03510 33198 31951 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_03510 33561 34556 gene locus_tag LOCUS_03520 33561 34556 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_03520 34543 35394 gene locus_tag LOCUS_03530 34543 35394 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 protein_id gnl|my_center|LOCUS_03530 35589 36671 gene locus_tag LOCUS_03540 35589 36671 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_03540 36724 37089 gene locus_tag LOCUS_03550 36724 37089 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_03550 37161 38450 gene locus_tag LOCUS_03560 37161 38450 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_03560 38521 39543 gene locus_tag LOCUS_03570 38521 39543 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_03570 39564 40700 gene locus_tag LOCUS_03580 gene pdxB 39564 40700 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_03580 40781 42232 gene locus_tag LOCUS_03590 gene gnd 40781 42232 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_03590 42976 42317 gene locus_tag LOCUS_03600 42976 42317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 43511 43104 gene locus_tag LOCUS_03610 43511 43104 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_03610 43904 43521 gene locus_tag LOCUS_03620 43904 43521 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_03620 44562 43981 gene locus_tag LOCUS_03630 44562 43981 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_03630 44823 45452 gene locus_tag LOCUS_03640 44823 45452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 45449 45745 gene locus_tag LOCUS_03650 45449 45745 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_03650 45808 47127 gene locus_tag LOCUS_03660 gene creD 45808 47127 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_03660 48994 47297 gene locus_tag LOCUS_03670 48994 47297 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403075.1 protein_id gnl|my_center|LOCUS_03670 49517 49188 gene locus_tag LOCUS_03680 49517 49188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 50361 49690 gene locus_tag LOCUS_03690 50361 49690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 51296 52651 gene locus_tag LOCUS_03700 51296 52651 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_03700 53610 52876 gene locus_tag LOCUS_03710 53610 52876 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_03710 53898 55610 gene locus_tag LOCUS_03720 53898 55610 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_03720 55792 56139 gene locus_tag LOCUS_03730 gene rplS 55792 56139 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_03730 56279 57202 gene locus_tag LOCUS_03740 56279 57202 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_03740 57281 59569 gene locus_tag LOCUS_03750 57281 59569 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 protein_id gnl|my_center|LOCUS_03750 61203 59791 gene locus_tag LOCUS_03760 61203 59791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 61431 62534 gene locus_tag LOCUS_03770 61431 62534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 62587 64161 gene locus_tag LOCUS_03780 62587 64161 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_03780 64225 64806 gene locus_tag LOCUS_03790 64225 64806 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_03790 64978 65538 gene locus_tag LOCUS_03800 64978 65538 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769868.1 protein_id gnl|my_center|LOCUS_03800 65734 66726 gene locus_tag LOCUS_03810 65734 66726 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_03810 66864 70190 gene locus_tag LOCUS_03820 66864 70190 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786045.1 protein_id gnl|my_center|LOCUS_03820 70205 71791 gene locus_tag LOCUS_03830 70205 71791 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786046.1 protein_id gnl|my_center|LOCUS_03830 71839 72993 gene locus_tag LOCUS_03840 71839 72993 CDS product glycoside hydrolase family 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763540.1 protein_id gnl|my_center|LOCUS_03840 73043 74188 gene locus_tag LOCUS_03850 73043 74188 CDS product DUF1735 and LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202361.1 protein_id gnl|my_center|LOCUS_03850 74657 75826 gene locus_tag LOCUS_03860 74657 75826 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_03860 75983 78010 gene locus_tag LOCUS_03870 75983 78010 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_03870 78871 78110 gene locus_tag LOCUS_03880 78871 78110 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_03880 79413 78868 gene locus_tag LOCUS_03890 79413 78868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946945.1 protein_id gnl|my_center|LOCUS_03890 79662 81140 gene locus_tag LOCUS_03900 79662 81140 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_03900 81212 82702 gene locus_tag LOCUS_03910 81212 82702 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964015.1 protein_id gnl|my_center|LOCUS_03910 84005 82815 gene locus_tag LOCUS_03920 84005 82815 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_03920 84162 85223 gene locus_tag LOCUS_03930 gene mltG 84162 85223 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_03930 85334 85846 gene locus_tag LOCUS_03940 85334 85846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 85897 86556 gene locus_tag LOCUS_03950 85897 86556 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_03950 87127 86543 gene locus_tag LOCUS_03960 87127 86543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 87384 87920 gene locus_tag LOCUS_03970 87384 87920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 88739 87963 gene locus_tag LOCUS_03980 88739 87963 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_03980 90492 89050 gene locus_tag LOCUS_03990 90492 89050 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_03990 93610 90515 gene locus_tag LOCUS_04000 93610 90515 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_04000 93605 93530 gene locus_tag LOCUS_t00070 93605 93530 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 94354 93761 gene locus_tag LOCUS_04010 94354 93761 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_04010 94617 94351 gene locus_tag LOCUS_04020 94617 94351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 97589 94617 gene locus_tag LOCUS_04030 gene lacZ 97589 94617 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_04030 99785 97779 gene locus_tag LOCUS_04040 gene ygjK 99785 97779 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_04040 101551 100001 gene locus_tag LOCUS_04050 101551 100001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 102827 101811 gene locus_tag LOCUS_04060 gene murB 102827 101811 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_04060 102898 104007 gene locus_tag LOCUS_04070 102898 104007 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986993.1 protein_id gnl|my_center|LOCUS_04070 105398 104172 gene locus_tag LOCUS_04080 105398 104172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 106347 105622 gene locus_tag LOCUS_04090 106347 105622 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_04090 106505 109570 gene locus_tag LOCUS_04100 106505 109570 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_04100 109582 111369 gene locus_tag LOCUS_04110 109582 111369 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_04110 111852 113816 gene locus_tag LOCUS_04120 gene gyrB 111852 113816 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_04120 113986 114567 gene locus_tag LOCUS_04130 113986 114567 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_04130 114809 115177 gene locus_tag LOCUS_04140 114809 115177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 115233 116486 gene locus_tag LOCUS_04150 gene hemA 115233 116486 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_04150 116476 117414 gene locus_tag LOCUS_04160 gene hemC 116476 117414 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933094.1 protein_id gnl|my_center|LOCUS_04160 117545 118297 gene locus_tag LOCUS_04170 117545 118297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 118302 119294 gene locus_tag LOCUS_04180 gene hemB 118302 119294 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_04180 119419 120708 gene locus_tag LOCUS_04190 gene hemL 119419 120708 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712943.1 protein_id gnl|my_center|LOCUS_04190 120799 121827 gene locus_tag LOCUS_04200 gene hemE 120799 121827 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_04200 121989 123566 gene locus_tag LOCUS_04210 121989 123566 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_04210 123918 126131 gene locus_tag LOCUS_04220 123918 126131 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_04220 128083 128724 gene locus_tag LOCUS_04230 128083 128724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 129630 131630 gene locus_tag LOCUS_04240 129630 131630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 131630 132556 gene locus_tag LOCUS_04250 131630 132556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 133006 134289 gene locus_tag LOCUS_04260 133006 134289 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_04260 134472 135410 gene locus_tag LOCUS_04270 134472 135410 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_04270 135580 136146 gene locus_tag LOCUS_04280 135580 136146 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_04280 136214 136810 gene locus_tag LOCUS_04290 gene def 136214 136810 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_04290 136913 137488 gene locus_tag LOCUS_04300 136913 137488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 137551 138009 gene locus_tag LOCUS_04310 137551 138009 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_04310 138114 138620 gene locus_tag LOCUS_04320 138114 138620 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_04320 138681 139280 gene locus_tag LOCUS_04330 138681 139280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 139361 140125 gene locus_tag LOCUS_04340 gene map 139361 140125 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_04340 140244 140819 gene locus_tag LOCUS_04350 140244 140819 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_04350 140958 141488 gene locus_tag LOCUS_04360 140958 141488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 141624 142613 gene locus_tag LOCUS_04370 141624 142613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 142662 143258 gene locus_tag LOCUS_04380 142662 143258 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_04380 143318 143767 gene locus_tag LOCUS_04390 143318 143767 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943317.1 protein_id gnl|my_center|LOCUS_04390 143773 144507 gene locus_tag LOCUS_04400 143773 144507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 144659 146188 gene locus_tag LOCUS_04410 144659 146188 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_04410 146898 146251 gene locus_tag LOCUS_04420 146898 146251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 147736 147044 gene locus_tag LOCUS_04430 147736 147044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 150526 147749 gene locus_tag LOCUS_04440 150526 147749 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259718.1 protein_id gnl|my_center|LOCUS_04440 151201 150668 gene locus_tag LOCUS_04450 151201 150668 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464537.1 protein_id gnl|my_center|LOCUS_04450 152106 151330 gene locus_tag LOCUS_04460 gene cobA 152106 151330 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932082.1 protein_id gnl|my_center|LOCUS_04460 152969 152139 gene locus_tag LOCUS_04470 152969 152139 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926809.1 protein_id gnl|my_center|LOCUS_04470 153714 152974 gene locus_tag LOCUS_04480 153714 152974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 155416 153719 gene locus_tag LOCUS_04490 gene cysI 155416 153719 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_04490 157289 155499 gene locus_tag LOCUS_04500 157289 155499 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_04500 157754 157302 gene locus_tag LOCUS_04510 157754 157302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 158015 157785 gene locus_tag LOCUS_04520 158015 157785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 158632 158435 gene locus_tag LOCUS_04530 158632 158435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 159111 160367 gene locus_tag LOCUS_04540 159111 160367 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_04540 160388 163486 gene locus_tag LOCUS_04550 160388 163486 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_04550 163483 164712 gene locus_tag LOCUS_04560 163483 164712 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_04560 164868 168146 gene locus_tag LOCUS_04570 164868 168146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 169223 168150 gene locus_tag LOCUS_04580 gene dinB 169223 168150 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083683.1 protein_id gnl|my_center|LOCUS_04580 169860 173900 gene locus_tag LOCUS_04590 169860 173900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 174390 175115 gene locus_tag LOCUS_04600 174390 175115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 175187 175567 gene locus_tag LOCUS_04610 175187 175567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 175548 176162 gene locus_tag LOCUS_04620 175548 176162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 176217 177107 gene locus_tag LOCUS_04630 gene cas1 176217 177107 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_04630 177156 177494 gene locus_tag LOCUS_04640 gene cas2 177156 177494 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_04640 177811 179319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 179320 179619 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgatgtaaaacagctaagacttacaac 180677 179787 gene locus_tag LOCUS_04650 180677 179787 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_04650 180801 181493 gene locus_tag LOCUS_04660 180801 181493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 181691 182248 gene locus_tag LOCUS_04670 181691 182248 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919522.1 protein_id gnl|my_center|LOCUS_04670 182261 182818 gene locus_tag LOCUS_04680 182261 182818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 182802 183833 gene locus_tag LOCUS_04690 182802 183833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 184005 185117 gene locus_tag LOCUS_04700 184005 185117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 185089 186483 gene locus_tag LOCUS_04710 185089 186483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 188718 186583 gene locus_tag LOCUS_04720 188718 186583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 188889 189302 gene locus_tag LOCUS_04730 188889 189302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 189478 190134 gene locus_tag LOCUS_04740 189478 190134 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_04740 190127 190843 gene locus_tag LOCUS_04750 190127 190843 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_04750 190901 191629 gene locus_tag LOCUS_04760 190901 191629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 192045 193391 gene locus_tag LOCUS_04770 192045 193391 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_04770 193410 194714 gene locus_tag LOCUS_04780 193410 194714 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_04780 194776 195693 gene locus_tag LOCUS_04790 gene metA 194776 195693 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_04790 195827 196483 gene locus_tag LOCUS_04800 gene elbB 195827 196483 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754779.1 protein_id gnl|my_center|LOCUS_04800 198429 196498 gene locus_tag LOCUS_04810 198429 196498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 199084 199806 gene locus_tag LOCUS_04820 199084 199806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 200184 199792 gene locus_tag LOCUS_04830 200184 199792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 200899 200297 gene locus_tag LOCUS_04840 200899 200297 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_04840 200978 201610 gene locus_tag LOCUS_04850 gene pdxH 200978 201610 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107871.1 protein_id gnl|my_center|LOCUS_04850 201659 202546 gene locus_tag LOCUS_04860 201659 202546 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266961.1 protein_id gnl|my_center|LOCUS_04860 204306 202624 gene locus_tag LOCUS_04870 gene araB 204306 202624 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951845.1 protein_id gnl|my_center|LOCUS_04870 205023 204346 gene locus_tag LOCUS_04880 205023 204346 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_04880 205349 205435 gene locus_tag LOCUS_t00080 205349 205435 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 208115 205545 gene locus_tag LOCUS_04890 208115 205545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 210698 208257 gene locus_tag LOCUS_04900 210698 208257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 211820 210831 gene locus_tag LOCUS_04910 211820 210831 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_04910 213362 211875 gene locus_tag LOCUS_04920 213362 211875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04920 214223 213405 gene locus_tag LOCUS_04930 214223 213405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04930 214634 217561 gene locus_tag LOCUS_04940 214634 217561 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108785.1 protein_id gnl|my_center|LOCUS_04940 217794 219920 gene locus_tag LOCUS_04950 217794 219920 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_04950 221724 219925 gene locus_tag LOCUS_04960 221724 219925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023577041.1 protein_id gnl|my_center|LOCUS_04960 221997 222734 gene locus_tag LOCUS_04970 221997 222734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 223101 222859 gene locus_tag LOCUS_04980 223101 222859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 223277 223861 gene locus_tag LOCUS_04990 223277 223861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence07 1552 440 gene locus_tag LOCUS_05000 1552 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1764 1609 gene locus_tag LOCUS_05010 1764 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2871 2647 gene locus_tag LOCUS_05020 2871 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3557 2871 gene locus_tag LOCUS_05030 3557 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4342 3725 gene locus_tag LOCUS_05040 4342 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5444 6154 gene locus_tag LOCUS_05050 5444 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 7014 6346 gene locus_tag LOCUS_05060 7014 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 8929 6998 gene locus_tag LOCUS_05070 8929 6998 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_05070 9321 9848 gene locus_tag LOCUS_05080 9321 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9856 11355 gene locus_tag LOCUS_05090 9856 11355 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_05090 11601 12920 gene locus_tag LOCUS_05100 11601 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 12920 13504 gene locus_tag LOCUS_05110 12920 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13576 14253 gene locus_tag LOCUS_05120 13576 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 15659 14355 gene locus_tag LOCUS_05130 gene thrC 15659 14355 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_05130 16946 15720 gene locus_tag LOCUS_05140 16946 15720 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_05140 19599 17170 gene locus_tag LOCUS_05150 gene thrA 19599 17170 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_05150 20896 19871 gene locus_tag LOCUS_05160 gene recA 20896 19871 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_05160 21366 20902 gene locus_tag LOCUS_05170 gene bcp 21366 20902 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_05170 21519 22829 gene locus_tag LOCUS_05180 21519 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22826 23122 gene locus_tag LOCUS_05190 22826 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 23133 23606 gene locus_tag LOCUS_05200 23133 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 23606 24613 gene locus_tag LOCUS_05210 gene floA 23606 24613 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_05210 25853 25281 gene locus_tag LOCUS_05220 25853 25281 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_05220 26181 28103 gene locus_tag LOCUS_05230 26181 28103 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_05230 28186 29463 gene locus_tag LOCUS_05240 28186 29463 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_05240 29734 31815 gene locus_tag LOCUS_05250 29734 31815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 32488 31847 gene locus_tag LOCUS_05260 32488 31847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 32590 33489 gene locus_tag LOCUS_05270 32590 33489 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_05270 34156 33539 gene locus_tag LOCUS_05280 34156 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787597.1 protein_id gnl|my_center|LOCUS_05280 35116 34409 gene locus_tag LOCUS_05290 35116 34409 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_05290 35930 35346 gene locus_tag LOCUS_05300 35930 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 36129 37289 gene locus_tag LOCUS_05310 36129 37289 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_05310 38995 37343 gene locus_tag LOCUS_05320 gene recN 38995 37343 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_05320 39925 39014 gene locus_tag LOCUS_05330 39925 39014 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_05330 41183 39975 gene locus_tag LOCUS_05340 gene coaBC 41183 39975 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_05340 41534 41199 gene locus_tag LOCUS_05350 41534 41199 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_05350 42347 41541 gene locus_tag LOCUS_05360 gene bamD 42347 41541 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_05360 42558 43751 gene locus_tag LOCUS_05370 42558 43751 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_05370 44848 43850 gene locus_tag LOCUS_05380 gene trxB 44848 43850 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_05380 45070 45145 gene locus_tag LOCUS_t00090 45070 45145 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45701 46702 gene locus_tag LOCUS_05390 gene gshAB 45701 46702 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964848.1 protein_id gnl|my_center|LOCUS_05390 46787 48160 gene locus_tag LOCUS_05400 46787 48160 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_05400 48183 49928 gene locus_tag LOCUS_05410 48183 49928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_05410 49955 51733 gene locus_tag LOCUS_05420 49955 51733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_05420 52905 51988 gene locus_tag LOCUS_05430 52905 51988 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706652.1 protein_id gnl|my_center|LOCUS_05430 53085 53684 gene locus_tag LOCUS_05440 53085 53684 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_05440 55472 53796 gene locus_tag LOCUS_05450 gene asnB 55472 53796 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337015.1 protein_id gnl|my_center|LOCUS_05450 56945 55845 gene locus_tag LOCUS_05460 gene ychF 56945 55845 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_05460 57198 57743 gene locus_tag LOCUS_05470 57198 57743 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_05470 57800 58261 gene locus_tag LOCUS_05480 57800 58261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 58373 58840 gene locus_tag LOCUS_05490 58373 58840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142078.1 protein_id gnl|my_center|LOCUS_05490 60404 58890 gene locus_tag LOCUS_05500 gene hutH 60404 58890 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108449.1 protein_id gnl|my_center|LOCUS_05500 61911 60547 gene locus_tag LOCUS_05510 gene hisS 61911 60547 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_05510 62360 62004 gene locus_tag LOCUS_05520 62360 62004 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_05520 64500 62440 gene locus_tag LOCUS_05530 64500 62440 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_05530 65023 65784 gene locus_tag LOCUS_05540 65023 65784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 65893 66090 gene locus_tag LOCUS_05550 65893 66090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 66519 66806 gene locus_tag LOCUS_05560 66519 66806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 67217 68170 gene locus_tag LOCUS_05570 67217 68170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 70318 68147 gene locus_tag LOCUS_05580 70318 68147 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_05580 70988 70407 gene locus_tag LOCUS_05590 70988 70407 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_05590 71519 70989 gene locus_tag LOCUS_05600 71519 70989 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_05600 72293 71523 gene locus_tag LOCUS_05610 72293 71523 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_05610 72500 73582 gene locus_tag LOCUS_05620 72500 73582 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 protein_id gnl|my_center|LOCUS_05620 75150 73579 gene locus_tag LOCUS_05630 75150 73579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 75364 75261 gene locus_tag LOCUS_r00010 75364 75261 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence08 1228 482 gene locus_tag LOCUS_05640 1228 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2027 1230 gene locus_tag LOCUS_05650 2027 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2613 2014 gene locus_tag LOCUS_05660 2613 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3487 2615 gene locus_tag LOCUS_05670 3487 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3935 3480 gene locus_tag LOCUS_05680 3935 3480 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890647.1 protein_id gnl|my_center|LOCUS_05680 6523 4205 gene locus_tag LOCUS_05690 6523 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7203 6520 gene locus_tag LOCUS_05700 7203 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7936 7370 gene locus_tag LOCUS_05710 7936 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 8201 8055 gene locus_tag LOCUS_05720 8201 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence09 1340 516 gene locus_tag LOCUS_05730 1340 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2433 1525 gene locus_tag LOCUS_05740 2433 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3442 2609 gene locus_tag LOCUS_05750 3442 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105153.1 protein_id gnl|my_center|LOCUS_05750 5499 4510 gene locus_tag LOCUS_05760 5499 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6405 5602 gene locus_tag LOCUS_05770 6405 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6851 6411 gene locus_tag LOCUS_05780 6851 6411 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_05780 7457 6864 gene locus_tag LOCUS_05790 7457 6864 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_05790 7836 9908 gene locus_tag LOCUS_05800 7836 9908 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_05800 12052 9905 gene locus_tag LOCUS_05810 12052 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12472 12140 gene locus_tag LOCUS_05820 12472 12140 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356793.1 protein_id gnl|my_center|LOCUS_05820 12840 12475 gene locus_tag LOCUS_05830 12840 12475 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_05830 13322 12837 gene locus_tag LOCUS_05840 gene ispF 13322 12837 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_05840 14485 13319 gene locus_tag LOCUS_05850 gene porV 14485 13319 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_05850 18288 14602 gene locus_tag LOCUS_05860 gene porU 18288 14602 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_05860 18624 20078 gene locus_tag LOCUS_05870 gene gldJ 18624 20078 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_05870 20149 21444 gene locus_tag LOCUS_05880 20149 21444 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_05880 21838 21470 gene locus_tag LOCUS_05890 21838 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 22022 23431 gene locus_tag LOCUS_05900 22022 23431 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_05900 24451 23435 gene locus_tag LOCUS_05910 24451 23435 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_05910 25924 24461 gene locus_tag LOCUS_05920 25924 24461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_05920 27437 25992 gene locus_tag LOCUS_05930 27437 25992 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_05930 28568 27444 gene locus_tag LOCUS_05940 28568 27444 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_05940 28710 31655 gene locus_tag LOCUS_05950 28710 31655 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_05950 31997 32251 gene locus_tag LOCUS_05960 31997 32251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_05960 32325 33116 gene locus_tag LOCUS_05970 32325 33116 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_05970 34844 33153 gene locus_tag LOCUS_05980 34844 33153 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_05980 35226 35486 gene locus_tag LOCUS_05990 35226 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 36650 35532 gene locus_tag LOCUS_06000 36650 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 37791 36643 gene locus_tag LOCUS_06010 37791 36643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 38491 38318 gene locus_tag LOCUS_06020 38491 38318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 38740 38814 gene locus_tag LOCUS_t00100 38740 38814 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38922 39299 gene locus_tag LOCUS_06030 38922 39299 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_06030 39364 40845 gene locus_tag LOCUS_06040 39364 40845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 40848 42053 gene locus_tag LOCUS_06050 40848 42053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 42046 43233 gene locus_tag LOCUS_06060 42046 43233 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_06060 43307 44530 gene locus_tag LOCUS_06070 43307 44530 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_06070 44542 44763 gene locus_tag LOCUS_06080 44542 44763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 44835 45797 gene locus_tag LOCUS_06090 gene fmt 44835 45797 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_06090 46851 45910 gene locus_tag LOCUS_06100 46851 45910 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_06100 46945 47436 gene locus_tag LOCUS_06110 46945 47436 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_06110 48139 47441 gene locus_tag LOCUS_06120 48139 47441 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_06120 49047 48229 gene locus_tag LOCUS_06130 gene panB 49047 48229 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_06130 49237 50544 gene locus_tag LOCUS_06140 49237 50544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 51691 50582 gene locus_tag LOCUS_06150 51691 50582 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_06150 51918 53843 gene locus_tag LOCUS_06160 gene dnaK 51918 53843 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_06160 54841 53897 gene locus_tag LOCUS_06170 54841 53897 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_06170 54952 55416 gene locus_tag LOCUS_06180 54952 55416 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_06180 57300 55447 gene locus_tag LOCUS_06190 57300 55447 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_06190 57582 59792 gene locus_tag LOCUS_06200 57582 59792 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_06200 59849 60667 gene locus_tag LOCUS_06210 59849 60667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 60847 62301 gene locus_tag LOCUS_06220 gene xseA 60847 62301 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_06220 62291 62491 gene locus_tag LOCUS_06230 62291 62491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 63273 62641 gene locus_tag LOCUS_06240 63273 62641 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_06240 64081 63389 gene locus_tag LOCUS_06250 64081 63389 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_06250 64448 64939 gene locus_tag LOCUS_06260 64448 64939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 65659 65012 gene locus_tag LOCUS_06270 65659 65012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 66602 65682 gene locus_tag LOCUS_06280 66602 65682 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_06280 67649 66693 gene locus_tag LOCUS_06290 67649 66693 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_06290 69072 67699 gene locus_tag LOCUS_06300 69072 67699 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_06300 70285 69191 gene locus_tag LOCUS_06310 70285 69191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 70965 70399 gene locus_tag LOCUS_06320 70965 70399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 72065 71028 gene locus_tag LOCUS_06330 72065 71028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 72438 73583 gene locus_tag LOCUS_06340 72438 73583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 77943 74044 gene locus_tag LOCUS_06350 77943 74044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 79787 77952 gene locus_tag LOCUS_06360 79787 77952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 80183 81229 gene locus_tag LOCUS_06370 80183 81229 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704251.1 protein_id gnl|my_center|LOCUS_06370 81231 82169 gene locus_tag LOCUS_06380 81231 82169 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_06380 82566 82378 gene locus_tag LOCUS_06390 82566 82378 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544225.1 protein_id gnl|my_center|LOCUS_06390 82964 82758 gene locus_tag LOCUS_06400 82964 82758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 83255 84811 gene locus_tag LOCUS_06410 83255 84811 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_06410 85018 85446 gene locus_tag LOCUS_06420 85018 85446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 85876 85532 gene locus_tag LOCUS_06430 85876 85532 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_06430 86007 86549 gene locus_tag LOCUS_06440 86007 86549 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949045.1 protein_id gnl|my_center|LOCUS_06440 89026 86621 gene locus_tag LOCUS_06450 89026 86621 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_06450 89413 89847 gene locus_tag LOCUS_06460 89413 89847 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_06460 90455 89907 gene locus_tag LOCUS_06470 90455 89907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 91636 90671 gene locus_tag LOCUS_06480 91636 90671 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_06480 92730 91702 gene locus_tag LOCUS_06490 92730 91702 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_06490 93215 92745 gene locus_tag LOCUS_06500 93215 92745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 94209 93412 gene locus_tag LOCUS_06510 94209 93412 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_06510 95537 94236 gene locus_tag LOCUS_06520 gene mtaB 95537 94236 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_06520 96938 95601 gene locus_tag LOCUS_06530 96938 95601 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_06530 97065 98366 gene locus_tag LOCUS_06540 97065 98366 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_06540 98454 98529 gene locus_tag LOCUS_t00110 98454 98529 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 98941 99016 gene locus_tag LOCUS_t00120 98941 99016 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 99972 99193 gene locus_tag LOCUS_06550 99972 99193 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_06550 101246 100008 gene locus_tag LOCUS_06560 101246 100008 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407872.1 protein_id gnl|my_center|LOCUS_06560 102535 101291 gene locus_tag LOCUS_06570 gene nagA 102535 101291 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644997.1 protein_id gnl|my_center|LOCUS_06570 104141 102546 gene locus_tag LOCUS_06580 104141 102546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 104641 104138 gene locus_tag LOCUS_06590 104641 104138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 106010 104667 gene locus_tag LOCUS_06600 106010 104667 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_06600 107058 106030 gene locus_tag LOCUS_06610 107058 106030 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_06610 108416 107412 gene locus_tag LOCUS_06620 108416 107412 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_06620 110452 108734 gene locus_tag LOCUS_06630 110452 108734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 113734 110486 gene locus_tag LOCUS_06640 113734 110486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_06640 115010 114018 gene locus_tag LOCUS_06650 115010 114018 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765195.1 protein_id gnl|my_center|LOCUS_06650 115680 115102 gene locus_tag LOCUS_06660 115680 115102 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_06660 117427 116003 gene locus_tag LOCUS_06670 117427 116003 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_06670 118422 117484 gene locus_tag LOCUS_06680 118422 117484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 119542 118502 gene locus_tag LOCUS_06690 119542 118502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 120609 119539 gene locus_tag LOCUS_06700 120609 119539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 121813 120749 gene locus_tag LOCUS_06710 121813 120749 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_06710 122864 121827 gene locus_tag LOCUS_06720 122864 121827 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_06720 123988 122867 gene locus_tag LOCUS_06730 123988 122867 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_06730 125229 124000 gene locus_tag LOCUS_06740 125229 124000 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_06740 126646 125264 gene locus_tag LOCUS_06750 126646 125264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 128144 126726 gene locus_tag LOCUS_06760 128144 126726 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_06760 129500 128319 gene locus_tag LOCUS_06770 129500 128319 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_06770 130115 129585 gene locus_tag LOCUS_06780 130115 129585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 131612 130140 gene locus_tag LOCUS_06790 131612 130140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 133525 131813 gene locus_tag LOCUS_06800 133525 131813 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_06800 136975 133553 gene locus_tag LOCUS_06810 136975 133553 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_06810 138132 137164 gene locus_tag LOCUS_06820 138132 137164 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_06820 138856 138248 gene locus_tag LOCUS_06830 138856 138248 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_06830 140424 139120 gene locus_tag LOCUS_06840 140424 139120 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_06840 142341 140710 gene locus_tag LOCUS_06850 142341 140710 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_06850 143884 142424 gene locus_tag LOCUS_06860 143884 142424 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659530.1 protein_id gnl|my_center|LOCUS_06860 145056 143905 gene locus_tag LOCUS_06870 145056 143905 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_06870 148013 145089 gene locus_tag LOCUS_06880 148013 145089 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_06880 148911 148165 gene locus_tag LOCUS_06890 148911 148165 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_06890 150672 149188 gene locus_tag LOCUS_06900 150672 149188 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_06900 154076 150684 gene locus_tag LOCUS_06910 154076 150684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_06910 155305 154319 gene locus_tag LOCUS_06920 155305 154319 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_06920 155930 155382 gene locus_tag LOCUS_06930 155930 155382 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_06930 156141 158894 gene locus_tag LOCUS_06940 156141 158894 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467010.1 protein_id gnl|my_center|LOCUS_06940 159468 158938 gene locus_tag LOCUS_06950 159468 158938 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107608.1 protein_id gnl|my_center|LOCUS_06950 159866 162202 gene locus_tag LOCUS_06960 159866 162202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 162268 162894 gene locus_tag LOCUS_06970 gene recR 162268 162894 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_06970 162928 164895 gene locus_tag LOCUS_06980 162928 164895 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_06980 164892 165425 gene locus_tag LOCUS_06990 164892 165425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_06990 165919 165467 gene locus_tag LOCUS_07000 165919 165467 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_07000 166141 166911 gene locus_tag LOCUS_07010 166141 166911 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_07010 166927 167925 gene locus_tag LOCUS_07020 gene holA 166927 167925 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_07020 167933 168541 gene locus_tag LOCUS_07030 167933 168541 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_07030 168545 169036 gene locus_tag LOCUS_07040 gene gmhB 168545 169036 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694551.1 protein_id gnl|my_center|LOCUS_07040 169054 169860 gene locus_tag LOCUS_07050 169054 169860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 170509 169916 gene locus_tag LOCUS_07060 170509 169916 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763511.1 protein_id gnl|my_center|LOCUS_07060 170963 170661 gene locus_tag LOCUS_07070 170963 170661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 172697 171060 gene locus_tag LOCUS_07080 gene pruA 172697 171060 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_07080 172877 174967 gene locus_tag LOCUS_07090 172877 174967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 176226 174964 gene locus_tag LOCUS_07100 176226 174964 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_07100 176444 177796 gene locus_tag LOCUS_07110 176444 177796 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_07110 177832 178989 gene locus_tag LOCUS_07120 177832 178989 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_07120 179009 179701 gene locus_tag LOCUS_07130 179009 179701 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_07130 179708 180358 gene locus_tag LOCUS_07140 179708 180358 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_07140 180380 180997 gene locus_tag LOCUS_07150 gene nqrE 180380 180997 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_07150 181079 182281 gene locus_tag LOCUS_07160 gene nqrF 181079 182281 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_07160 183003 182563 gene locus_tag LOCUS_07170 183003 182563 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_07170 183096 184856 gene locus_tag LOCUS_07180 gene aspS 183096 184856 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202848.1 protein_id gnl|my_center|LOCUS_07180 185301 184909 gene locus_tag LOCUS_07190 185301 184909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 185788 185318 gene locus_tag LOCUS_07200 185788 185318 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_07200 186281 185790 gene locus_tag LOCUS_07210 186281 185790 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_07210 186861 186406 gene locus_tag LOCUS_07220 186861 186406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 187691 186870 gene locus_tag LOCUS_07230 187691 186870 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_07230 187939 187851 gene locus_tag LOCUS_t00130 187939 187851 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 188988 188008 gene locus_tag LOCUS_07240 188988 188008 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_07240 189840 189076 gene locus_tag LOCUS_07250 189840 189076 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_07250 191307 189973 gene locus_tag LOCUS_07260 gene gdhA 191307 189973 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_07260 192923 191571 gene locus_tag LOCUS_07270 gene gdhA 192923 191571 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_07270 193096 193533 gene locus_tag LOCUS_07280 193096 193533 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_07280 194623 193874 gene locus_tag LOCUS_07290 gene kdsB 194623 193874 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_07290 195094 196326 gene locus_tag LOCUS_07300 195094 196326 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_07300 196343 196843 gene locus_tag LOCUS_07310 196343 196843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 196843 197454 gene locus_tag LOCUS_07320 196843 197454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_07320 197465 197818 gene locus_tag LOCUS_07330 gene secG 197465 197818 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_07330 198083 198361 gene locus_tag LOCUS_07340 198083 198361 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_07340 198395 200032 gene locus_tag LOCUS_07350 gene groL 198395 200032 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_07350 200952 200263 gene locus_tag LOCUS_07360 200952 200263 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_07360 201367 200903 gene locus_tag LOCUS_07370 201367 200903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 202344 201478 gene locus_tag LOCUS_07380 202344 201478 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584059.1 protein_id gnl|my_center|LOCUS_07380 203607 202408 gene locus_tag LOCUS_07390 203607 202408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_07390 203817 204599 gene locus_tag LOCUS_07400 gene rfbF 203817 204599 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_07400 204628 205191 gene locus_tag LOCUS_07410 gene rfbC 204628 205191 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_07410 205873 205268 gene locus_tag LOCUS_07420 205873 205268 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_07420 206116 206334 gene locus_tag LOCUS_07430 206116 206334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence10 498 319 gene locus_tag LOCUS_07440 498 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1088 2044 gene locus_tag LOCUS_07450 1088 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2177 2992 gene locus_tag LOCUS_07460 2177 2992 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107775.1 protein_id gnl|my_center|LOCUS_07460 3072 3569 gene locus_tag LOCUS_07470 3072 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3927 4187 gene locus_tag LOCUS_07480 3927 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4231 4641 gene locus_tag LOCUS_07490 4231 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5303 5626 gene locus_tag LOCUS_07500 5303 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6414 5698 gene locus_tag LOCUS_07510 6414 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766161.1 protein_id gnl|my_center|LOCUS_07510 6511 6356 gene locus_tag LOCUS_07520 6511 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11327 6612 gene locus_tag LOCUS_07530 11327 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 14567 11484 gene locus_tag LOCUS_07540 14567 11484 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_07540 15638 14580 gene locus_tag LOCUS_07550 15638 14580 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_07550 17150 15666 gene locus_tag LOCUS_07560 17150 15666 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760594.1 protein_id gnl|my_center|LOCUS_07560 20759 17427 gene locus_tag LOCUS_07570 20759 17427 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766164.1 protein_id gnl|my_center|LOCUS_07570 21723 20830 gene locus_tag LOCUS_07580 21723 20830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766165.1 protein_id gnl|my_center|LOCUS_07580 22712 22020 gene locus_tag LOCUS_07590 22712 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 23079 22699 gene locus_tag LOCUS_07600 23079 22699 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_07600 23878 23081 gene locus_tag LOCUS_07610 23878 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24835 24026 gene locus_tag LOCUS_07620 24835 24026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_07620 25372 26190 gene locus_tag LOCUS_07630 25372 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 26469 27197 gene locus_tag LOCUS_07640 26469 27197 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108269.1 protein_id gnl|my_center|LOCUS_07640 28203 27202 gene locus_tag LOCUS_07650 gene gldB 28203 27202 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_07650 29163 28336 gene locus_tag LOCUS_07660 29163 28336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 29468 30145 gene locus_tag LOCUS_07670 29468 30145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 30288 31931 gene locus_tag LOCUS_07680 30288 31931 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_07680 32078 32779 gene locus_tag LOCUS_07690 32078 32779 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_07690 35358 32872 gene locus_tag LOCUS_07700 35358 32872 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_07700 35932 35351 gene locus_tag LOCUS_07710 35932 35351 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_07710 36010 36888 gene locus_tag LOCUS_07720 36010 36888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 36891 37607 gene locus_tag LOCUS_07730 gene rsmI 36891 37607 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_07730 37695 38444 gene locus_tag LOCUS_07740 37695 38444 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_07740 39225 42383 gene locus_tag LOCUS_07750 39225 42383 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_07750 42403 43923 gene locus_tag LOCUS_07760 42403 43923 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_07760 44399 47563 gene locus_tag LOCUS_07770 44399 47563 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_07770 47585 49102 gene locus_tag LOCUS_07780 47585 49102 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_07780 49158 49865 gene locus_tag LOCUS_07790 49158 49865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 49884 50402 gene locus_tag LOCUS_07800 49884 50402 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_07800 50913 54080 gene locus_tag LOCUS_07810 50913 54080 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_07810 54098 55708 gene locus_tag LOCUS_07820 54098 55708 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_07820 57148 55967 gene locus_tag LOCUS_07830 57148 55967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_07830 58778 57231 gene locus_tag LOCUS_07840 gene dnaB 58778 57231 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_07840 59885 58908 gene locus_tag LOCUS_07850 59885 58908 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_07850 61048 59990 gene locus_tag LOCUS_07860 61048 59990 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_07860 61858 61052 gene locus_tag LOCUS_07870 61858 61052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 63006 62371 gene locus_tag LOCUS_07880 gene rsmG 63006 62371 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_07880 63687 63076 gene locus_tag LOCUS_07890 gene sigW 63687 63076 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_07890 64805 63678 gene locus_tag LOCUS_07900 64805 63678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 64945 66075 gene locus_tag LOCUS_07910 gene tgt 64945 66075 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761519.1 protein_id gnl|my_center|LOCUS_07910 66099 67187 gene locus_tag LOCUS_07920 66099 67187 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_07920 67390 68934 gene locus_tag LOCUS_07930 67390 68934 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_07930 68953 69273 gene locus_tag LOCUS_07940 68953 69273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 69586 69347 gene locus_tag LOCUS_07950 69586 69347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 70562 69708 gene locus_tag LOCUS_07960 gene ispE 70562 69708 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_07960 73443 70573 gene locus_tag LOCUS_07970 gene gcvP 73443 70573 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_07970 74171 73530 gene locus_tag LOCUS_07980 74171 73530 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_07980 74834 74178 gene locus_tag LOCUS_07990 74834 74178 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_07990 74969 75802 gene locus_tag LOCUS_08000 74969 75802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 75889 77304 gene locus_tag LOCUS_08010 75889 77304 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_08010 77898 77320 gene locus_tag LOCUS_08020 gene thpR 77898 77320 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_08020 78513 77923 gene locus_tag LOCUS_08030 78513 77923 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_08030 78629 79900 gene locus_tag LOCUS_08040 78629 79900 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_08040 80002 80538 gene locus_tag LOCUS_08050 80002 80538 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_08050 81026 80679 gene locus_tag LOCUS_08060 81026 80679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_08060 83522 81141 gene locus_tag LOCUS_08070 83522 81141 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_08070 84381 83590 gene locus_tag LOCUS_08080 84381 83590 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_08080 85866 84451 gene locus_tag LOCUS_08090 85866 84451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 87092 86031 gene locus_tag LOCUS_08100 87092 86031 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_08100 88245 87136 gene locus_tag LOCUS_08110 88245 87136 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_08110 89535 88378 gene locus_tag LOCUS_08120 gene gmd 89535 88378 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_08120 90870 89737 gene locus_tag LOCUS_08130 90870 89737 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264255.1 protein_id gnl|my_center|LOCUS_08130 91637 90996 gene locus_tag LOCUS_08140 91637 90996 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_08140 92466 91624 gene locus_tag LOCUS_08150 92466 91624 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_08150 93657 92572 gene locus_tag LOCUS_08160 93657 92572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 protein_id gnl|my_center|LOCUS_08160 94468 93938 gene locus_tag LOCUS_08170 94468 93938 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572205.1 protein_id gnl|my_center|LOCUS_08170 95705 95878 gene locus_tag LOCUS_08180 95705 95878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 96124 101775 gene locus_tag LOCUS_08190 96124 101775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 102610 101864 gene locus_tag LOCUS_08200 102610 101864 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_08200 103877 102621 gene locus_tag LOCUS_08210 103877 102621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 104508 103948 gene locus_tag LOCUS_08220 104508 103948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 105548 104505 gene locus_tag LOCUS_08230 105548 104505 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203057.1 protein_id gnl|my_center|LOCUS_08230 106510 105662 gene locus_tag LOCUS_08240 106510 105662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 107805 106537 gene locus_tag LOCUS_08250 107805 106537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203009.1 protein_id gnl|my_center|LOCUS_08250 108445 107819 gene locus_tag LOCUS_08260 108445 107819 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_08260 109695 108445 gene locus_tag LOCUS_08270 109695 108445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 110663 109722 gene locus_tag LOCUS_08280 110663 109722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 111785 110712 gene locus_tag LOCUS_08290 111785 110712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 112891 111929 gene locus_tag LOCUS_08300 112891 111929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_08300 114001 112925 gene locus_tag LOCUS_08310 114001 112925 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_08310 115568 114012 gene locus_tag LOCUS_08320 115568 114012 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_08320 116980 116174 gene locus_tag LOCUS_08330 116980 116174 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_08330 119932 117257 gene locus_tag LOCUS_08340 119932 117257 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109377.1 protein_id gnl|my_center|LOCUS_08340 122828 120099 gene locus_tag LOCUS_08350 122828 120099 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_08350 124249 122834 gene locus_tag LOCUS_08360 124249 122834 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_08360 125890 124376 gene locus_tag LOCUS_08370 125890 124376 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_08370 129292 125903 gene locus_tag LOCUS_08380 129292 125903 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_08380 130386 129397 gene locus_tag LOCUS_08390 130386 129397 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_08390 131025 130462 gene locus_tag LOCUS_08400 131025 130462 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681497.1 protein_id gnl|my_center|LOCUS_08400 132827 131217 gene locus_tag LOCUS_08410 132827 131217 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_08410 136242 132856 gene locus_tag LOCUS_08420 136242 132856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791110.1 protein_id gnl|my_center|LOCUS_08420 137462 136407 gene locus_tag LOCUS_08430 137462 136407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 138315 137719 gene locus_tag LOCUS_08440 138315 137719 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_08440 138993 139181 gene locus_tag LOCUS_08450 138993 139181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 139331 139255 gene locus_tag LOCUS_t00140 139331 139255 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 140001 139429 gene locus_tag LOCUS_08460 140001 139429 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_08460 140542 140165 gene locus_tag LOCUS_08470 140542 140165 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_08470 144096 140659 gene locus_tag LOCUS_08480 gene ileS 144096 140659 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_08480 144436 146196 gene locus_tag LOCUS_08490 144436 146196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 146591 149707 gene locus_tag LOCUS_08500 146591 149707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_08500 149764 151443 gene locus_tag LOCUS_08510 149764 151443 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 protein_id gnl|my_center|LOCUS_08510 151584 153938 gene locus_tag LOCUS_08520 151584 153938 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203497.1 protein_id gnl|my_center|LOCUS_08520 156500 154086 gene locus_tag LOCUS_08530 156500 154086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08530 158944 156551 gene locus_tag LOCUS_08540 158944 156551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_08540 161398 158969 gene locus_tag LOCUS_08550 161398 158969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08550 163749 161407 gene locus_tag LOCUS_08560 163749 161407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_08560 166254 163864 gene locus_tag LOCUS_08570 166254 163864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_08570 168588 166321 gene locus_tag LOCUS_08580 168588 166321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_08580 171082 168758 gene locus_tag LOCUS_08590 171082 168758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_08590 173700 171322 gene locus_tag LOCUS_08600 173700 171322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_08600 176111 173712 gene locus_tag LOCUS_08610 176111 173712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202844.1 protein_id gnl|my_center|LOCUS_08610 178525 176156 gene locus_tag LOCUS_08620 178525 176156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_08620 180810 178555 gene locus_tag LOCUS_08630 180810 178555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787751.1 protein_id gnl|my_center|LOCUS_08630 181748 181050 gene locus_tag LOCUS_08640 181748 181050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_08640 182177 181815 gene locus_tag LOCUS_08650 182177 181815 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_08650 183549 182293 gene locus_tag LOCUS_08660 183549 182293 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_08660 185063 183714 gene locus_tag LOCUS_08670 185063 183714 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786410.1 protein_id gnl|my_center|LOCUS_08670 185300 186667 gene locus_tag LOCUS_08680 185300 186667 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_08680 186664 188019 gene locus_tag LOCUS_08690 186664 188019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_08690 188207 188016 gene locus_tag LOCUS_08700 188207 188016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 188757 188260 gene locus_tag LOCUS_08710 188757 188260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 190537 188930 gene locus_tag LOCUS_08720 190537 188930 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_08720 190917 190585 gene locus_tag LOCUS_08730 190917 190585 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_08730 191448 190975 gene locus_tag LOCUS_08740 191448 190975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 192286 195000 gene locus_tag LOCUS_08750 192286 195000 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_08750 195181 197079 gene locus_tag LOCUS_08760 195181 197079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 197424 200666 gene locus_tag LOCUS_08770 197424 200666 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_08770 200868 201860 gene locus_tag LOCUS_08780 gene nadA 200868 201860 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_08780 202084 202779 gene locus_tag LOCUS_08790 202084 202779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_08790 203695 202772 gene locus_tag LOCUS_08800 203695 202772 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840143.1 protein_id gnl|my_center|LOCUS_08800 204706 203798 gene locus_tag LOCUS_08810 204706 203798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 205228 204779 gene locus_tag LOCUS_08820 205228 204779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 205724 205185 gene locus_tag LOCUS_08830 205724 205185 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_08830 207158 205818 gene locus_tag LOCUS_08840 207158 205818 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_08840 208564 207200 gene locus_tag LOCUS_08850 gene radA 208564 207200 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_08850 209052 208567 gene locus_tag LOCUS_08860 gene rfaE2 209052 208567 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_08860 209490 209140 gene locus_tag LOCUS_08870 209490 209140 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_08870 210344 209502 gene locus_tag LOCUS_08880 gene panC 210344 209502 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_08880 210499 211302 gene locus_tag LOCUS_08890 210499 211302 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_08890 211430 212701 gene locus_tag LOCUS_08900 211430 212701 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_08900 212742 214580 gene locus_tag LOCUS_08910 gene glmS 212742 214580 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_08910 214642 216507 gene locus_tag LOCUS_08920 214642 216507 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_08920 216518 217300 gene locus_tag LOCUS_08930 216518 217300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 217303 217596 gene locus_tag LOCUS_08940 217303 217596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 217989 217597 gene locus_tag LOCUS_08950 217989 217597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 218065 218421 gene locus_tag LOCUS_08960 218065 218421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 218666 220990 gene locus_tag LOCUS_08970 218666 220990 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_08970 221082 222002 gene locus_tag LOCUS_08980 221082 222002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_08980 222249 223358 gene locus_tag LOCUS_08990 222249 223358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 224409 224693 gene locus_tag LOCUS_09000 224409 224693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 225750 224761 gene locus_tag LOCUS_09010 gene mgrA 225750 224761 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_09010 225749 225955 gene locus_tag LOCUS_09020 225749 225955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 226598 225888 gene locus_tag LOCUS_09030 226598 225888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 227368 226613 gene locus_tag LOCUS_09040 227368 226613 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_09040 227836 227501 gene locus_tag LOCUS_09050 227836 227501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 228327 227944 gene locus_tag LOCUS_09060 228327 227944 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_09060 229337 228324 gene locus_tag LOCUS_09070 gene dusB 229337 228324 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_09070 232971 229531 gene locus_tag LOCUS_09080 232971 229531 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_09080 234158 233007 gene locus_tag LOCUS_09090 234158 233007 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_09090 235516 234170 gene locus_tag LOCUS_09100 235516 234170 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_09100 236132 235506 gene locus_tag LOCUS_09110 236132 235506 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_09110 237025 236354 gene locus_tag LOCUS_09120 237025 236354 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_09120 237282 237938 gene locus_tag LOCUS_09130 237282 237938 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_09130 239782 238127 gene locus_tag LOCUS_09140 239782 238127 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_09140 240702 239806 gene locus_tag LOCUS_09150 240702 239806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 241064 241753 gene locus_tag LOCUS_09160 241064 241753 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_09160 241772 243061 gene locus_tag LOCUS_09170 241772 243061 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_09170 244692 243139 gene locus_tag LOCUS_09180 244692 243139 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_09180 244991 244722 gene locus_tag LOCUS_09190 244991 244722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 245133 245843 gene locus_tag LOCUS_09200 gene pyrH 245133 245843 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_09200 245949 246512 gene locus_tag LOCUS_09210 gene frr 245949 246512 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_09210 246856 247554 gene locus_tag LOCUS_09220 246856 247554 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_09220 247558 248340 gene locus_tag LOCUS_09230 247558 248340 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809790.1 protein_id gnl|my_center|LOCUS_09230 248450 250354 gene locus_tag LOCUS_09240 gene dxs 248450 250354 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_09240 250533 251585 gene locus_tag LOCUS_09250 250533 251585 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_09250 251723 252265 gene locus_tag LOCUS_09260 251723 252265 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_09260 252278 252463 gene locus_tag LOCUS_09270 gene rpmF 252278 252463 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_09270 252712 253713 gene locus_tag LOCUS_09280 252712 253713 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_09280 253744 254211 gene locus_tag LOCUS_09290 253744 254211 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_09290 254431 254814 gene locus_tag LOCUS_09300 254431 254814 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_09300 254729 255007 gene locus_tag LOCUS_09310 254729 255007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 255004 255390 gene locus_tag LOCUS_09320 255004 255390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 255466 256572 gene locus_tag LOCUS_09330 gene atpB 255466 256572 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_09330 256598 256861 gene locus_tag LOCUS_09340 gene atpE 256598 256861 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_09340 256938 257432 gene locus_tag LOCUS_09350 256938 257432 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_09350 257437 257988 gene locus_tag LOCUS_09360 gene atpH 257437 257988 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_09360 258001 259578 gene locus_tag LOCUS_09370 gene atpA 258001 259578 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_09370 259634 260518 gene locus_tag LOCUS_09380 gene atpG 259634 260518 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_09380 261384 260629 gene locus_tag LOCUS_09390 261384 260629 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_09390 263345 261408 gene locus_tag LOCUS_09400 263345 261408 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_09400 263978 263364 gene locus_tag LOCUS_09410 263978 263364 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_09410 264423 264495 gene locus_tag LOCUS_t00150 264423 264495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 266374 264626 gene locus_tag LOCUS_09420 266374 264626 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_09420 266664 267107 gene locus_tag LOCUS_09430 266664 267107 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_09430 267147 267674 gene locus_tag LOCUS_09440 267147 267674 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_09440 267998 268456 gene locus_tag LOCUS_09450 gene rplM 267998 268456 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_09450 268459 268845 gene locus_tag LOCUS_09460 gene rpsI 268459 268845 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_09460 268960 269766 gene locus_tag LOCUS_09470 gene rpsB 268960 269766 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_09470 269801 270628 gene locus_tag LOCUS_09480 gene tsf 269801 270628 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_09480 271416 270697 gene locus_tag LOCUS_09490 271416 270697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 272170 271451 gene locus_tag LOCUS_09500 272170 271451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 273210 272443 gene locus_tag LOCUS_09510 273210 272443 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_09510 273412 273918 gene locus_tag LOCUS_09520 273412 273918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 274075 274320 gene locus_tag LOCUS_09530 274075 274320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 274434 274928 gene locus_tag LOCUS_09540 274434 274928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 276228 275071 gene locus_tag LOCUS_09550 276228 275071 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_09550 277044 276319 gene locus_tag LOCUS_09560 gene recO 277044 276319 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_09560 279340 277061 gene locus_tag LOCUS_09570 279340 277061 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_09570 280028 279447 gene locus_tag LOCUS_09580 280028 279447 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_09580 280135 280845 gene locus_tag LOCUS_09590 280135 280845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 281571 280885 gene locus_tag LOCUS_09600 281571 280885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_09600 283130 281781 gene locus_tag LOCUS_09610 283130 281781 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_09610 284678 283146 gene locus_tag LOCUS_09620 284678 283146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 285094 285789 gene locus_tag LOCUS_09630 285094 285789 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_09630 286666 285803 gene locus_tag LOCUS_09640 286666 285803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 289027 286673 gene locus_tag LOCUS_09650 289027 286673 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_09650 289789 289178 gene locus_tag LOCUS_09660 289789 289178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 290480 289791 gene locus_tag LOCUS_09670 290480 289791 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_09670 290810 292756 gene locus_tag LOCUS_09680 gene dnaG 290810 292756 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_09680 292769 293260 gene locus_tag LOCUS_09690 292769 293260 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767342.1 protein_id gnl|my_center|LOCUS_09690 293327 294364 gene locus_tag LOCUS_09700 293327 294364 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_09700 295485 294508 gene locus_tag LOCUS_09710 295485 294508 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_09710 296828 295635 gene locus_tag LOCUS_09720 296828 295635 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_09720 298416 297469 gene locus_tag LOCUS_09730 298416 297469 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258817.1 protein_id gnl|my_center|LOCUS_09730 298638 300872 gene locus_tag LOCUS_09740 gene katG 298638 300872 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_09740 301958 300945 gene locus_tag LOCUS_09750 301958 300945 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_09750 302957 302154 gene locus_tag LOCUS_09760 302957 302154 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_09760 303679 302969 gene locus_tag LOCUS_09770 303679 302969 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_09770 305334 303751 gene locus_tag LOCUS_09780 305334 303751 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_09780 306093 305413 gene locus_tag LOCUS_09790 gene pepE 306093 305413 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421788.1 protein_id gnl|my_center|LOCUS_09790 307106 306306 gene locus_tag LOCUS_09800 307106 306306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 308122 307208 gene locus_tag LOCUS_09810 308122 307208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 309304 308261 gene locus_tag LOCUS_09820 309304 308261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 309836 309351 gene locus_tag LOCUS_09830 309836 309351 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823962.1 protein_id gnl|my_center|LOCUS_09830 311509 309875 gene locus_tag LOCUS_09840 311509 309875 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_09840 311945 311520 gene locus_tag LOCUS_09850 311945 311520 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_09850 312484 312077 gene locus_tag LOCUS_09860 312484 312077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 312671 312587 gene locus_tag LOCUS_t00160 312671 312587 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 313207 312737 gene locus_tag LOCUS_09870 313207 312737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 314679 313312 gene locus_tag LOCUS_09880 314679 313312 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_09880 314860 315447 gene locus_tag LOCUS_09890 314860 315447 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_09890 315485 316492 gene locus_tag LOCUS_09900 315485 316492 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_09900 316513 318081 gene locus_tag LOCUS_09910 316513 318081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 318081 319655 gene locus_tag LOCUS_09920 318081 319655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 319652 322207 gene locus_tag LOCUS_09930 319652 322207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 323189 322212 gene locus_tag LOCUS_09940 323189 322212 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_09940 325554 323203 gene locus_tag LOCUS_09950 325554 323203 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_09950 325720 326175 gene locus_tag LOCUS_09960 gene dtd 325720 326175 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_09960 326316 326663 gene locus_tag LOCUS_09970 326316 326663 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_09970 326670 327500 gene locus_tag LOCUS_09980 gene deoC 326670 327500 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_09980 327646 328368 gene locus_tag LOCUS_09990 327646 328368 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816960.1 protein_id gnl|my_center|LOCUS_09990 329194 328373 gene locus_tag LOCUS_10000 gene murQ 329194 328373 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_10000 330050 329208 gene locus_tag LOCUS_10010 330050 329208 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_10010 330217 332694 gene locus_tag LOCUS_10020 330217 332694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 333072 332839 gene locus_tag LOCUS_10030 333072 332839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 333082 333858 gene locus_tag LOCUS_10040 333082 333858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 333924 336926 gene locus_tag LOCUS_10050 333924 336926 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_10050 336928 338766 gene locus_tag LOCUS_10060 336928 338766 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_10060 339254 342247 gene locus_tag LOCUS_10070 339254 342247 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_10070 342271 344157 gene locus_tag LOCUS_10080 342271 344157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 344187 345020 gene locus_tag LOCUS_10090 344187 345020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 345948 345169 gene locus_tag LOCUS_10100 345948 345169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 346534 347100 gene locus_tag LOCUS_10110 346534 347100 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_10110 347090 348385 gene locus_tag LOCUS_10120 347090 348385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 349364 348390 gene locus_tag LOCUS_10130 349364 348390 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_10130 349573 349878 gene locus_tag LOCUS_10140 349573 349878 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_10140 349979 350428 gene locus_tag LOCUS_10150 349979 350428 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_10150 350440 353223 gene locus_tag LOCUS_10160 gene polA 350440 353223 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_10160 354095 353739 gene locus_tag LOCUS_10170 354095 353739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 354731 354417 gene locus_tag LOCUS_10180 354731 354417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 357985 354731 gene locus_tag LOCUS_10190 357985 354731 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_10190 359090 357999 gene locus_tag LOCUS_10200 359090 357999 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_10200 360437 359106 gene locus_tag LOCUS_10210 360437 359106 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_10210 361607 360663 gene locus_tag LOCUS_10220 361607 360663 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_10220 361707 362681 gene locus_tag LOCUS_10230 361707 362681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 362700 363449 gene locus_tag LOCUS_10240 362700 363449 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_10240 363521 363901 gene locus_tag LOCUS_10250 gene rnpA 363521 363901 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_10250 365045 363954 gene locus_tag LOCUS_10260 365045 363954 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_10260 365941 365048 gene locus_tag LOCUS_10270 365941 365048 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_10270 368724 366244 gene locus_tag LOCUS_10280 368724 366244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 368815 370272 gene locus_tag LOCUS_10290 gene sacC 368815 370272 CDS product levanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398804.1 protein_id gnl|my_center|LOCUS_10290 370373 372526 gene locus_tag LOCUS_10300 gene rnr 370373 372526 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_10300 372612 373214 gene locus_tag LOCUS_10310 372612 373214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 373746 373288 gene locus_tag LOCUS_10320 373746 373288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 375145 373931 gene locus_tag LOCUS_10330 375145 373931 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_10330 375973 375146 gene locus_tag LOCUS_10340 375973 375146 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_10340 376314 375976 gene locus_tag LOCUS_10350 gene rbfA 376314 375976 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_10350 377787 376531 gene locus_tag LOCUS_10360 gene metK 377787 376531 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_10360 378481 378134 gene locus_tag LOCUS_10370 378481 378134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 379184 378591 gene locus_tag LOCUS_10380 379184 378591 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530472.1 protein_id gnl|my_center|LOCUS_10380 379582 379319 gene locus_tag LOCUS_10390 379582 379319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 379884 379651 gene locus_tag LOCUS_10400 379884 379651 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_10400 380959 380072 gene locus_tag LOCUS_10410 380959 380072 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769585.1 protein_id gnl|my_center|LOCUS_10410 381892 381017 gene locus_tag LOCUS_10420 381892 381017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 383581 381962 gene locus_tag LOCUS_10430 383581 381962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 384723 383767 gene locus_tag LOCUS_10440 384723 383767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 385827 385372 gene locus_tag LOCUS_10450 385827 385372 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188789631.1 protein_id gnl|my_center|LOCUS_10450 386777 385974 gene locus_tag LOCUS_10460 386777 385974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 386999 386811 gene locus_tag LOCUS_10470 386999 386811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 392804 387192 gene locus_tag LOCUS_10480 392804 387192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 393197 394735 gene locus_tag LOCUS_10490 393197 394735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 395556 394747 gene locus_tag LOCUS_10500 gene ilvE 395556 394747 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528132.1 protein_id gnl|my_center|LOCUS_10500 395806 398004 gene locus_tag LOCUS_10510 395806 398004 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_10510 398132 400165 gene locus_tag LOCUS_10520 gene metG 398132 400165 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_10520 402089 400284 gene locus_tag LOCUS_10530 402089 400284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 403610 402222 gene locus_tag LOCUS_10540 403610 402222 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_10540 405770 403626 gene locus_tag LOCUS_10550 405770 403626 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_10550 407638 405791 gene locus_tag LOCUS_10560 407638 405791 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_10560 409950 407635 gene locus_tag LOCUS_10570 409950 407635 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_10570 410633 409971 gene locus_tag LOCUS_10580 gene pgmB 410633 409971 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_10580 412212 410692 gene locus_tag LOCUS_10590 412212 410692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_10590 413667 412654 gene locus_tag LOCUS_10600 413667 412654 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_10600 414130 417099 gene locus_tag LOCUS_10610 414130 417099 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_10610 417119 418684 gene locus_tag LOCUS_10620 417119 418684 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_10620 418705 419793 gene locus_tag LOCUS_10630 418705 419793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 419796 421799 gene locus_tag LOCUS_10640 419796 421799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 421892 424633 gene locus_tag LOCUS_10650 421892 424633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 424729 425988 gene locus_tag LOCUS_10660 424729 425988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 426118 426597 gene locus_tag LOCUS_10670 426118 426597 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_10670 426654 427403 gene locus_tag LOCUS_10680 426654 427403 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_10680 427440 427784 gene locus_tag LOCUS_10690 427440 427784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 427800 429005 gene locus_tag LOCUS_10700 427800 429005 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_10700 430423 429062 gene locus_tag LOCUS_10710 430423 429062 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_10710 432081 430666 gene locus_tag LOCUS_10720 432081 430666 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_10720 432242 433426 gene locus_tag LOCUS_10730 432242 433426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 434218 433502 gene locus_tag LOCUS_10740 434218 433502 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_10740 434834 434238 gene locus_tag LOCUS_10750 434834 434238 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_10750 435786 434911 gene locus_tag LOCUS_10760 435786 434911 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_10760 436212 435796 gene locus_tag LOCUS_10770 436212 435796 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_10770 436377 437078 gene locus_tag LOCUS_10780 436377 437078 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_10780 438510 437326 gene locus_tag LOCUS_10790 438510 437326 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_10790 439398 438523 gene locus_tag LOCUS_10800 439398 438523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 441167 439395 gene locus_tag LOCUS_10810 441167 439395 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_10810 441610 441176 gene locus_tag LOCUS_10820 gene dut 441610 441176 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_10820 442823 441693 gene locus_tag LOCUS_10830 gene hemW 442823 441693 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_10830 443320 442874 gene locus_tag LOCUS_10840 443320 442874 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_10840 444694 443324 gene locus_tag LOCUS_10850 444694 443324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 445137 444697 gene locus_tag LOCUS_10860 gene rpiB 445137 444697 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_10860 446654 445188 gene locus_tag LOCUS_10870 446654 445188 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_10870 446952 448025 gene locus_tag LOCUS_10880 446952 448025 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_10880 449040 448012 gene locus_tag LOCUS_10890 gene ruvB 449040 448012 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_10890 449491 449102 gene locus_tag LOCUS_10900 449491 449102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 450008 453286 gene locus_tag LOCUS_10910 450008 453286 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_10910 453322 453702 gene locus_tag LOCUS_10920 453322 453702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 453680 454093 gene locus_tag LOCUS_10930 gene ybeY 453680 454093 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_10930 454146 456026 gene locus_tag LOCUS_10940 gene mnmG 454146 456026 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_10940 456060 456578 gene locus_tag LOCUS_10950 456060 456578 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_10950 456595 458415 gene locus_tag LOCUS_10960 gene uvrC 456595 458415 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_10960 459421 458480 gene locus_tag LOCUS_10970 gene rsgA 459421 458480 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_10970 459494 460261 gene locus_tag LOCUS_10980 459494 460261 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_10980 460568 460329 gene locus_tag LOCUS_10990 460568 460329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 460966 460565 gene locus_tag LOCUS_11000 460966 460565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 462101 461025 gene locus_tag LOCUS_11010 gene tdh 462101 461025 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_11010 463534 462212 gene locus_tag LOCUS_11020 463534 462212 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_11020 464074 463589 gene locus_tag LOCUS_11030 464074 463589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 464840 464334 gene locus_tag LOCUS_11040 464840 464334 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_11040 466405 464933 gene locus_tag LOCUS_11050 gene cysS 466405 464933 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_11050 467903 466503 gene locus_tag LOCUS_11060 gene fumC 467903 466503 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_11060 468047 469453 gene locus_tag LOCUS_11070 468047 469453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 470574 469543 gene locus_tag LOCUS_11080 gene selD 470574 469543 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 protein_id gnl|my_center|LOCUS_11080 471598 470546 gene locus_tag LOCUS_11090 gene mnmH 471598 470546 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_11090 472181 473341 gene locus_tag LOCUS_11100 472181 473341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 473338 473745 gene locus_tag LOCUS_11110 473338 473745 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_11110 473780 474529 gene locus_tag LOCUS_11120 473780 474529 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_11120 474604 478281 gene locus_tag LOCUS_11130 gene metH 474604 478281 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_11130 478352 478510 gene locus_tag LOCUS_11140 478352 478510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 478559 479512 gene locus_tag LOCUS_11150 gene metF 478559 479512 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_11150 480149 479673 gene locus_tag LOCUS_11160 480149 479673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 480987 480454 gene locus_tag LOCUS_11170 480987 480454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 481120 481551 gene locus_tag LOCUS_11180 481120 481551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 483775 481589 gene locus_tag LOCUS_11190 483775 481589 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_11190 484960 484076 gene locus_tag LOCUS_11200 484960 484076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 486079 485066 gene locus_tag LOCUS_11210 486079 485066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 486508 486236 gene locus_tag LOCUS_11220 486508 486236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 487717 486635 gene locus_tag LOCUS_11230 487717 486635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 489048 488857 gene locus_tag LOCUS_11240 489048 488857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 491117 489345 gene locus_tag LOCUS_11250 491117 489345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 491519 491145 gene locus_tag LOCUS_11260 491519 491145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 491879 492445 gene locus_tag LOCUS_11270 491879 492445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 492560 492931 gene locus_tag LOCUS_11280 492560 492931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 495582 493342 gene locus_tag LOCUS_11290 495582 493342 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_11290 495738 496772 gene locus_tag LOCUS_11300 495738 496772 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_11300 496868 497569 gene locus_tag LOCUS_11310 496868 497569 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_11310 497642 498055 gene locus_tag LOCUS_11320 497642 498055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 498542 498042 gene locus_tag LOCUS_11330 498542 498042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 500272 498827 gene locus_tag LOCUS_11340 gene rpoN 500272 498827 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_11340 501837 500401 gene locus_tag LOCUS_11350 gene asnS 501837 500401 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_11350 503005 502115 gene locus_tag LOCUS_11360 503005 502115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 503435 503818 gene locus_tag LOCUS_11370 503435 503818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 503953 505113 gene locus_tag LOCUS_11380 503953 505113 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_11380 505148 506143 gene locus_tag LOCUS_11390 505148 506143 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_11390 506229 507473 gene locus_tag LOCUS_11400 506229 507473 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_11400 507586 510165 gene locus_tag LOCUS_11410 507586 510165 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_11410 511271 510534 gene locus_tag LOCUS_11420 511271 510534 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038723.1 protein_id gnl|my_center|LOCUS_11420 511415 514273 gene locus_tag LOCUS_11430 511415 514273 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_11430 514568 517651 gene locus_tag LOCUS_11440 514568 517651 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_11440 517671 519200 gene locus_tag LOCUS_11450 517671 519200 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_11450 519238 521016 gene locus_tag LOCUS_11460 519238 521016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 521226 523478 gene locus_tag LOCUS_11470 gene bglX 521226 523478 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_11470 523496 524335 gene locus_tag LOCUS_11480 523496 524335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 524348 526126 gene locus_tag LOCUS_11490 524348 526126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 526128 526805 gene locus_tag LOCUS_11500 526128 526805 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_11500 528669 526807 gene locus_tag LOCUS_11510 528669 526807 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_11510 528958 529872 gene locus_tag LOCUS_11520 gene gldA 528958 529872 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_11520 529898 530899 gene locus_tag LOCUS_11530 529898 530899 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_11530 531284 530916 gene locus_tag LOCUS_11540 531284 530916 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761537.1 protein_id gnl|my_center|LOCUS_11540 533230 531350 gene locus_tag LOCUS_11550 533230 531350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 533744 534397 gene locus_tag LOCUS_11560 533744 534397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 535197 534421 gene locus_tag LOCUS_11570 535197 534421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 535351 535761 gene locus_tag LOCUS_11580 535351 535761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 536523 536200 gene locus_tag LOCUS_11590 536523 536200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 536898 536527 gene locus_tag LOCUS_11600 536898 536527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 537266 537066 gene locus_tag LOCUS_11610 537266 537066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 537687 538334 gene locus_tag LOCUS_11620 537687 538334 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_11620 538344 539159 gene locus_tag LOCUS_11630 538344 539159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_11630 539159 539686 gene locus_tag LOCUS_11640 gene cobO 539159 539686 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251080.1 protein_id gnl|my_center|LOCUS_11640 539792 540778 gene locus_tag LOCUS_11650 539792 540778 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_11650 540780 541595 gene locus_tag LOCUS_11660 540780 541595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_11660 542500 541772 gene locus_tag LOCUS_11670 542500 541772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 542719 543903 gene locus_tag LOCUS_11680 542719 543903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 544347 546503 gene locus_tag LOCUS_11690 544347 546503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926859.1 protein_id gnl|my_center|LOCUS_11690 546515 546913 gene locus_tag LOCUS_11700 546515 546913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 547005 547517 gene locus_tag LOCUS_11710 gene cobU 547005 547517 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_11710 547689 548699 gene locus_tag LOCUS_11720 gene cobT 547689 548699 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067582.1 protein_id gnl|my_center|LOCUS_11720 548893 549645 gene locus_tag LOCUS_11730 548893 549645 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_11730 549723 550310 gene locus_tag LOCUS_11740 gene cobC 549723 550310 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_11740 550414 551496 gene locus_tag LOCUS_11750 gene cobT 550414 551496 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_11750 551584 553065 gene locus_tag LOCUS_11760 551584 553065 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_11760 553428 554237 gene locus_tag LOCUS_11770 gene cbiB 553428 554237 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_11770 554663 554430 gene locus_tag LOCUS_11780 554663 554430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 555350 554754 gene locus_tag LOCUS_11790 555350 554754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 556602 555337 gene locus_tag LOCUS_11800 556602 555337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 556828 557451 gene locus_tag LOCUS_11810 556828 557451 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_11810 557586 558587 gene locus_tag LOCUS_11820 557586 558587 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_11820 559516 558629 gene locus_tag LOCUS_11830 559516 558629 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_11830 560508 559528 gene locus_tag LOCUS_11840 560508 559528 CDS product DUF1679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_11840 560618 561343 gene locus_tag LOCUS_11850 560618 561343 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_11850 561435 562037 gene locus_tag LOCUS_11860 561435 562037 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398109.1 protein_id gnl|my_center|LOCUS_11860 563154 562135 gene locus_tag LOCUS_11870 gene pheS 563154 562135 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_11870 564795 563443 gene locus_tag LOCUS_11880 564795 563443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 565613 564804 gene locus_tag LOCUS_11890 565613 564804 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_11890 566437 565613 gene locus_tag LOCUS_11900 566437 565613 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_11900 566629 567174 gene locus_tag LOCUS_11910 566629 567174 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 protein_id gnl|my_center|LOCUS_11910 567360 567596 gene locus_tag LOCUS_11920 567360 567596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 567708 568286 gene locus_tag LOCUS_11930 567708 568286 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_11930 568364 569062 gene locus_tag LOCUS_11940 568364 569062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 569075 570172 gene locus_tag LOCUS_11950 569075 570172 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_11950 570270 573656 gene locus_tag LOCUS_11960 570270 573656 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_11960 573674 575161 gene locus_tag LOCUS_11970 573674 575161 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_11970 575196 576131 gene locus_tag LOCUS_11980 575196 576131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 576196 577815 gene locus_tag LOCUS_11990 576196 577815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 578021 578776 gene locus_tag LOCUS_12000 578021 578776 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_12000 578936 579820 gene locus_tag LOCUS_12010 578936 579820 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_12010 580301 580089 gene locus_tag LOCUS_12020 580301 580089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 580658 580305 gene locus_tag LOCUS_12030 580658 580305 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_12030 581066 580704 gene locus_tag LOCUS_12040 581066 580704 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_12040 581238 582434 gene locus_tag LOCUS_12050 581238 582434 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_12050 582447 583649 gene locus_tag LOCUS_12060 582447 583649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 583668 586760 gene locus_tag LOCUS_12070 583668 586760 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444671.1 protein_id gnl|my_center|LOCUS_12070 587714 586815 gene locus_tag LOCUS_12080 587714 586815 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_12080 587831 588487 gene locus_tag LOCUS_12090 587831 588487 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_12090 590050 588674 gene locus_tag LOCUS_12100 590050 588674 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_12100 591478 590231 gene locus_tag LOCUS_12110 591478 590231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 591888 591496 gene locus_tag LOCUS_12120 591888 591496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 592238 591885 gene locus_tag LOCUS_12130 gene folX 592238 591885 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_12130 592975 592250 gene locus_tag LOCUS_12140 592975 592250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_12140 593180 594280 gene locus_tag LOCUS_12150 593180 594280 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_12150 594990 594382 gene locus_tag LOCUS_12160 594990 594382 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_12160 597232 595298 gene locus_tag LOCUS_12170 597232 595298 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_12170 598400 597339 gene locus_tag LOCUS_12180 gene rfbB 598400 597339 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_12180 600047 598473 gene locus_tag LOCUS_12190 600047 598473 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_12190 600509 601477 gene locus_tag LOCUS_12200 600509 601477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 601503 601742 gene locus_tag LOCUS_12210 601503 601742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 601765 603930 gene locus_tag LOCUS_12220 601765 603930 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_12220 603957 604310 gene locus_tag LOCUS_12230 603957 604310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 604368 604535 gene locus_tag LOCUS_12240 604368 604535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 604547 604693 gene locus_tag LOCUS_12250 604547 604693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 604674 604853 gene locus_tag LOCUS_12260 604674 604853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 604913 605590 gene locus_tag LOCUS_12270 604913 605590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 605635 606468 gene locus_tag LOCUS_12280 605635 606468 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298642.1 protein_id gnl|my_center|LOCUS_12280 607553 606525 gene locus_tag LOCUS_12290 gene galE 607553 606525 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_12290 607720 608637 gene locus_tag LOCUS_12300 607720 608637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 609696 608695 gene locus_tag LOCUS_12310 gene trpS 609696 608695 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_12310 610325 611701 gene locus_tag LOCUS_12320 610325 611701 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_12320 611871 612581 gene locus_tag LOCUS_12330 611871 612581 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_12330 613829 612657 gene locus_tag LOCUS_12340 613829 612657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 614452 613826 gene locus_tag LOCUS_12350 614452 613826 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_12350 615506 614553 gene locus_tag LOCUS_12360 615506 614553 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_12360 616261 615716 gene locus_tag LOCUS_12370 616261 615716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 616576 616283 gene locus_tag LOCUS_12380 616576 616283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 617105 616704 gene locus_tag LOCUS_12390 617105 616704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 617737 618663 gene locus_tag LOCUS_12400 617737 618663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 618728 619792 gene locus_tag LOCUS_12410 gene pstS 618728 619792 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_12410 619875 620669 gene locus_tag LOCUS_12420 gene pstC 619875 620669 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_12420 620677 621564 gene locus_tag LOCUS_12430 gene pstA 620677 621564 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_12430 621568 622347 gene locus_tag LOCUS_12440 gene pstB 621568 622347 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_12440 622443 623129 gene locus_tag LOCUS_12450 gene phoU 622443 623129 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880553.1 protein_id gnl|my_center|LOCUS_12450 623134 623823 gene locus_tag LOCUS_12460 623134 623823 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_12460 623942 625645 gene locus_tag LOCUS_12470 623942 625645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_12470 625972 626391 gene locus_tag LOCUS_12480 625972 626391 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972513.1 protein_id gnl|my_center|LOCUS_12480 627092 627517 gene locus_tag LOCUS_12490 627092 627517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 627514 628008 gene locus_tag LOCUS_12500 627514 628008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 628075 628854 gene locus_tag LOCUS_12510 628075 628854 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_12510 629341 628892 gene locus_tag LOCUS_12520 629341 628892 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_12520 629739 631631 gene locus_tag LOCUS_12530 gene pepF 629739 631631 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_12530 631878 632681 gene locus_tag LOCUS_12540 631878 632681 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_12540 632801 633940 gene locus_tag LOCUS_12550 632801 633940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 635288 634020 gene locus_tag LOCUS_12560 635288 634020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 635824 635390 gene locus_tag LOCUS_12570 635824 635390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 636254 635811 gene locus_tag LOCUS_12580 636254 635811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 636880 636458 gene locus_tag LOCUS_12590 636880 636458 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_12590 637314 636910 gene locus_tag LOCUS_12600 637314 636910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 638661 637441 gene locus_tag LOCUS_12610 638661 637441 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_12610 639312 639956 gene locus_tag LOCUS_12620 639312 639956 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_12620 640048 642153 gene locus_tag LOCUS_12630 640048 642153 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_12630 642320 642712 gene locus_tag LOCUS_12640 642320 642712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 642737 643201 gene locus_tag LOCUS_12650 642737 643201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 643702 643352 gene locus_tag LOCUS_12660 643702 643352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 645157 643982 gene locus_tag LOCUS_12670 645157 643982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 647953 645158 gene locus_tag LOCUS_12680 647953 645158 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_12680 647995 648141 gene locus_tag LOCUS_12690 647995 648141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 649491 648295 gene locus_tag LOCUS_12700 gene purT 649491 648295 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765861.1 protein_id gnl|my_center|LOCUS_12700 649726 650292 gene locus_tag LOCUS_12710 649726 650292 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784111.1 protein_id gnl|my_center|LOCUS_12710 650363 651106 gene locus_tag LOCUS_12720 650363 651106 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268503.1 protein_id gnl|my_center|LOCUS_12720 651596 651168 gene locus_tag LOCUS_12730 651596 651168 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_12730 651754 652413 gene locus_tag LOCUS_12740 651754 652413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 652982 652521 gene locus_tag LOCUS_12750 652982 652521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 654331 653135 gene locus_tag LOCUS_12760 654331 653135 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_12760 654542 655666 gene locus_tag LOCUS_12770 654542 655666 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_12770 658086 655693 gene locus_tag LOCUS_12780 658086 655693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 658308 659453 gene locus_tag LOCUS_12790 658308 659453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 659450 659914 gene locus_tag LOCUS_12800 gene gldH 659450 659914 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_12800 659920 660660 gene locus_tag LOCUS_12810 gene trmB 659920 660660 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_12810 660669 661001 gene locus_tag LOCUS_12820 660669 661001 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_12820 661015 662130 gene locus_tag LOCUS_12830 661015 662130 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_12830 662530 666129 gene locus_tag LOCUS_12840 662530 666129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 666215 667771 gene locus_tag LOCUS_12850 666215 667771 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_12850 668535 667768 gene locus_tag LOCUS_12860 668535 667768 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_12860 669273 668536 gene locus_tag LOCUS_12870 669273 668536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_12870 669514 670530 gene locus_tag LOCUS_12880 669514 670530 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_12880 671932 670583 gene locus_tag LOCUS_12890 gene gldK 671932 670583 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_12890 672910 672056 gene locus_tag LOCUS_12900 gene gldN 672910 672056 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_12900 674494 672914 gene locus_tag LOCUS_12910 gene gldM 674494 672914 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_12910 675524 674556 gene locus_tag LOCUS_12920 675524 674556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 676904 675546 gene locus_tag LOCUS_12930 gene gldK 676904 675546 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_12930 677873 676914 gene locus_tag LOCUS_12940 677873 676914 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_12940 679141 677987 gene locus_tag LOCUS_12950 679141 677987 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_12950 681676 679352 gene locus_tag LOCUS_12960 gene topA 681676 679352 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_12960 681975 684317 gene locus_tag LOCUS_12970 681975 684317 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_12970 685290 684397 gene locus_tag LOCUS_12980 685290 684397 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_12980 686336 685308 gene locus_tag LOCUS_12990 686336 685308 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_12990 687538 686504 gene locus_tag LOCUS_13000 687538 686504 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_13000 687819 687637 gene locus_tag LOCUS_13010 gene tatA 687819 687637 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_13010 689248 687905 gene locus_tag LOCUS_13020 gene rseP 689248 687905 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_13020 690428 689262 gene locus_tag LOCUS_13030 690428 689262 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_13030 691300 690437 gene locus_tag LOCUS_13040 691300 690437 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_13040 691338 691475 gene locus_tag LOCUS_13050 691338 691475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 691511 691584 gene locus_tag LOCUS_t00170 691511 691584 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 691636 691887 gene locus_tag LOCUS_13060 691636 691887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 692260 692952 gene locus_tag LOCUS_13070 692260 692952 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_13070 693615 693157 gene locus_tag LOCUS_13080 693615 693157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 695450 693630 gene locus_tag LOCUS_13090 695450 693630 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_13090 696055 695447 gene locus_tag LOCUS_13100 696055 695447 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_13100 696558 696055 gene locus_tag LOCUS_13110 696558 696055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 697166 696561 gene locus_tag LOCUS_13120 697166 696561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 698503 697193 gene locus_tag LOCUS_13130 698503 697193 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 protein_id gnl|my_center|LOCUS_13130 700275 698500 gene locus_tag LOCUS_13140 700275 698500 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_13140 700902 701369 gene locus_tag LOCUS_13150 700902 701369 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_13150 701526 705170 gene locus_tag LOCUS_13160 gene dnaE 701526 705170 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_13160 705216 705533 gene locus_tag LOCUS_13170 gene trxA 705216 705533 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_13170 706180 705635 gene locus_tag LOCUS_13180 706180 705635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 706435 707157 gene locus_tag LOCUS_13190 706435 707157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 707427 708359 gene locus_tag LOCUS_13200 gene prfB 707427 708359 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_13200 708349 708954 gene locus_tag LOCUS_13210 708349 708954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_13210 709010 711412 gene locus_tag LOCUS_13220 gene ppk1 709010 711412 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_13220 712219 711419 gene locus_tag LOCUS_13230 712219 711419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 712676 713878 gene locus_tag LOCUS_13240 712676 713878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 713875 714873 gene locus_tag LOCUS_13250 713875 714873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 714954 721067 gene locus_tag LOCUS_13260 714954 721067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 721266 724217 gene locus_tag LOCUS_13270 721266 724217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 724210 726114 gene locus_tag LOCUS_13280 724210 726114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 726272 727189 gene locus_tag LOCUS_13290 726272 727189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 727298 727654 gene locus_tag LOCUS_13300 727298 727654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 727777 743301 gene locus_tag LOCUS_13310 727777 743301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 743467 744846 gene locus_tag LOCUS_13320 743467 744846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 745414 745890 gene locus_tag LOCUS_13330 745414 745890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 745949 746461 gene locus_tag LOCUS_13340 745949 746461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 746515 747456 gene locus_tag LOCUS_13350 746515 747456 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_13350 747643 747715 gene locus_tag LOCUS_t00180 747643 747715 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 747743 747994 gene locus_tag LOCUS_13360 gene rpsT 747743 747994 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_13360 748107 748796 gene locus_tag LOCUS_13370 gene radC 748107 748796 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_13370 748806 750149 gene locus_tag LOCUS_13380 748806 750149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 750115 751026 gene locus_tag LOCUS_13390 750115 751026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 751011 751961 gene locus_tag LOCUS_13400 751011 751961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 751965 753032 gene locus_tag LOCUS_13410 751965 753032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 753079 753741 gene locus_tag LOCUS_13420 gene upp 753079 753741 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_13420 755126 753843 gene locus_tag LOCUS_13430 755126 753843 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_13430 755776 755282 gene locus_tag LOCUS_13440 gene folK 755776 755282 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_13440 755866 757638 gene locus_tag LOCUS_13450 gene sppA 755866 757638 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_13450 757730 758833 gene locus_tag LOCUS_13460 gene lpxK 757730 758833 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_13460 758772 759587 gene locus_tag LOCUS_13470 758772 759587 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_13470 759746 760042 gene locus_tag LOCUS_13480 759746 760042 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860072.1 protein_id gnl|my_center|LOCUS_13480 760266 761210 gene locus_tag LOCUS_13490 760266 761210 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_13490 761641 761820 gene locus_tag LOCUS_13500 761641 761820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 761783 762469 gene locus_tag LOCUS_13510 761783 762469 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_13510 762561 762995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 763780 763331 gene locus_tag LOCUS_13520 763780 763331 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_13520 763906 764571 gene locus_tag LOCUS_13530 gene fnrL 763906 764571 CDS product Crp/Fnr family transcriptional regulator FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720880.1 protein_id gnl|my_center|LOCUS_13530 765387 764629 gene locus_tag LOCUS_13540 765387 764629 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_13540 767168 765912 gene locus_tag LOCUS_13550 gene ilvA 767168 765912 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230803.1 protein_id gnl|my_center|LOCUS_13550 769766 767766 gene locus_tag LOCUS_13560 769766 767766 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_13560 769912 770514 gene locus_tag LOCUS_13570 769912 770514 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_13570 770583 771686 gene locus_tag LOCUS_13580 770583 771686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 771838 775110 gene locus_tag LOCUS_13590 771838 775110 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_13590 775210 776922 gene locus_tag LOCUS_13600 775210 776922 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_13600 779256 777067 gene locus_tag LOCUS_13610 779256 777067 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785391.1 protein_id gnl|my_center|LOCUS_13610 779663 781021 gene locus_tag LOCUS_13620 779663 781021 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_13620 781119 782183 gene locus_tag LOCUS_13630 781119 782183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 782188 783036 gene locus_tag LOCUS_13640 782188 783036 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 protein_id gnl|my_center|LOCUS_13640 783152 784057 gene locus_tag LOCUS_13650 783152 784057 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_13650 785040 784054 gene locus_tag LOCUS_13660 785040 784054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 786312 785296 gene locus_tag LOCUS_13670 786312 785296 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_13670 786821 788287 gene locus_tag LOCUS_13680 786821 788287 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_13680 788321 789637 gene locus_tag LOCUS_13690 788321 789637 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_13690 789843 790277 gene locus_tag LOCUS_13700 789843 790277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 790426 790986 gene locus_tag LOCUS_13710 790426 790986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 792324 791620 gene locus_tag LOCUS_13720 792324 791620 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_13720 792988 792455 gene locus_tag LOCUS_13730 792988 792455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 793214 794143 gene locus_tag LOCUS_13740 793214 794143 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_13740 795129 794137 gene locus_tag LOCUS_13750 795129 794137 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_13750 796242 795367 gene locus_tag LOCUS_13760 796242 795367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 797107 796256 gene locus_tag LOCUS_13770 gene prmC 797107 796256 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_13770 797143 798192 gene locus_tag LOCUS_13780 gene ribD 797143 798192 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_13780 798744 798343 gene locus_tag LOCUS_13790 798744 798343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 798845 800311 gene locus_tag LOCUS_13800 798845 800311 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_13800 800627 802096 gene locus_tag LOCUS_13810 800627 802096 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764821.1 protein_id gnl|my_center|LOCUS_13810 802099 802557 gene locus_tag LOCUS_13820 gene rimI 802099 802557 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107807.1 protein_id gnl|my_center|LOCUS_13820 803640 802543 gene locus_tag LOCUS_13830 803640 802543 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986314.1 protein_id gnl|my_center|LOCUS_13830 803639 803818 gene locus_tag LOCUS_13840 803639 803818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 803894 805060 gene locus_tag LOCUS_13850 803894 805060 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_13850 805152 806237 gene locus_tag LOCUS_13860 gene prfA 805152 806237 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_13860 806306 807139 gene locus_tag LOCUS_13870 gene pyrF 806306 807139 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_13870 807733 807209 gene locus_tag LOCUS_13880 807733 807209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 808040 808867 gene locus_tag LOCUS_13890 gene nagB 808040 808867 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_13890 809050 810351 gene locus_tag LOCUS_13900 809050 810351 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_13900 810344 811372 gene locus_tag LOCUS_13910 810344 811372 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_13910 811988 811443 gene locus_tag LOCUS_13920 811988 811443 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203194.1 protein_id gnl|my_center|LOCUS_13920 812499 811972 gene locus_tag LOCUS_13930 812499 811972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762576.1 protein_id gnl|my_center|LOCUS_13930 813759 812503 gene locus_tag LOCUS_13940 813759 812503 CDS product DUF4857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767083.1 protein_id gnl|my_center|LOCUS_13940 814466 813795 gene locus_tag LOCUS_13950 814466 813795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762573.1 protein_id gnl|my_center|LOCUS_13950 815363 814479 gene locus_tag LOCUS_13960 815363 814479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767082.1 protein_id gnl|my_center|LOCUS_13960 816914 815550 gene locus_tag LOCUS_13970 816914 815550 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_13970 817783 816917 gene locus_tag LOCUS_13980 817783 816917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 819960 817780 gene locus_tag LOCUS_13990 819960 817780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311265.1 protein_id gnl|my_center|LOCUS_13990 821405 820047 gene locus_tag LOCUS_14000 821405 820047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 822893 821676 gene locus_tag LOCUS_14010 822893 821676 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312956.1 protein_id gnl|my_center|LOCUS_14010 825799 822926 gene locus_tag LOCUS_14020 825799 822926 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005829323.1 protein_id gnl|my_center|LOCUS_14020 826374 826063 gene locus_tag LOCUS_14030 826374 826063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 826873 828495 gene locus_tag LOCUS_14040 826873 828495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 830052 828730 gene locus_tag LOCUS_14050 830052 828730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 830438 830707 gene locus_tag LOCUS_14060 gene rpsO 830438 830707 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_14060 830814 833093 gene locus_tag LOCUS_14070 gene pnp 830814 833093 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_14070 833145 833630 gene locus_tag LOCUS_14080 833145 833630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 833697 835802 gene locus_tag LOCUS_14090 833697 835802 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_14090 835881 836519 gene locus_tag LOCUS_14100 835881 836519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 836698 838371 gene locus_tag LOCUS_14110 836698 838371 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_14110 840615 838648 gene locus_tag LOCUS_14120 840615 838648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 842209 840758 gene locus_tag LOCUS_14130 842209 840758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 843117 842236 gene locus_tag LOCUS_14140 843117 842236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 843409 843819 gene locus_tag LOCUS_14150 843409 843819 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 protein_id gnl|my_center|LOCUS_14150 844097 844867 gene locus_tag LOCUS_14160 844097 844867 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_14160 845594 844971 gene locus_tag LOCUS_14170 845594 844971 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_14170 846665 845880 gene locus_tag LOCUS_14180 846665 845880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 848639 849004 gene locus_tag LOCUS_14190 848639 849004 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_14190 849344 850924 gene locus_tag LOCUS_14200 849344 850924 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_14200 852995 851820 gene locus_tag LOCUS_14210 852995 851820 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_14210 853217 854155 gene locus_tag LOCUS_14220 853217 854155 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_14220 854327 855322 gene locus_tag LOCUS_14230 854327 855322 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 protein_id gnl|my_center|LOCUS_14230 856125 855409 gene locus_tag LOCUS_14240 856125 855409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 856638 856210 gene locus_tag LOCUS_14250 856638 856210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 857028 858551 gene locus_tag LOCUS_14260 857028 858551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 858556 859236 gene locus_tag LOCUS_14270 858556 859236 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062021.1 protein_id gnl|my_center|LOCUS_14270 859401 859760 gene locus_tag LOCUS_14280 859401 859760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 859825 860889 gene locus_tag LOCUS_14290 859825 860889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 860923 861885 gene locus_tag LOCUS_14300 860923 861885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 864409 861998 gene locus_tag LOCUS_14310 864409 861998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 864863 866566 gene locus_tag LOCUS_14320 864863 866566 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 protein_id gnl|my_center|LOCUS_14320 866710 866635 gene locus_tag LOCUS_t00190 866710 866635 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 866940 869444 gene locus_tag LOCUS_14330 866940 869444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 869736 871268 gene locus_tag LOCUS_14340 869736 871268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 871283 872632 gene locus_tag LOCUS_14350 871283 872632 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921627.1 protein_id gnl|my_center|LOCUS_14350 872704 873672 gene locus_tag LOCUS_14360 872704 873672 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840860.1 protein_id gnl|my_center|LOCUS_14360 873669 875741 gene locus_tag LOCUS_14370 873669 875741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 875755 876009 gene locus_tag LOCUS_14380 875755 876009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 876686 877117 gene locus_tag LOCUS_14390 876686 877117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 878116 877175 gene locus_tag LOCUS_14400 878116 877175 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_14400 879426 878119 gene locus_tag LOCUS_14410 879426 878119 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_14410 880209 879517 gene locus_tag LOCUS_14420 880209 879517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 881333 880227 gene locus_tag LOCUS_14430 881333 880227 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768894.1 protein_id gnl|my_center|LOCUS_14430 881391 882668 gene locus_tag LOCUS_14440 881391 882668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_14440 882747 883886 gene locus_tag LOCUS_14450 882747 883886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 883883 884401 gene locus_tag LOCUS_14460 883883 884401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 885894 884398 gene locus_tag LOCUS_14470 885894 884398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 885967 888477 gene locus_tag LOCUS_14480 885967 888477 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_14480 888449 889330 gene locus_tag LOCUS_14490 888449 889330 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_14490 889462 889716 gene locus_tag LOCUS_14500 889462 889716 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_14500 889720 890502 gene locus_tag LOCUS_14510 889720 890502 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_14510 890553 891266 gene locus_tag LOCUS_14520 gene truB 890553 891266 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_14520 891316 892365 gene locus_tag LOCUS_14530 gene queA 891316 892365 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762821.1 protein_id gnl|my_center|LOCUS_14530 892540 893880 gene locus_tag LOCUS_14540 892540 893880 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_14540 896746 893996 gene locus_tag LOCUS_14550 896746 893996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 898122 896863 gene locus_tag LOCUS_14560 898122 896863 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_14560 898326 898907 gene locus_tag LOCUS_14570 898326 898907 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269926.1 protein_id gnl|my_center|LOCUS_14570 899017 900027 gene locus_tag LOCUS_14580 899017 900027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 900210 903620 gene locus_tag LOCUS_14590 900210 903620 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202214.1 protein_id gnl|my_center|LOCUS_14590 903739 905499 gene locus_tag LOCUS_14600 903739 905499 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785224.1 protein_id gnl|my_center|LOCUS_14600 905753 907675 gene locus_tag LOCUS_14610 905753 907675 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_14610 907859 908770 gene locus_tag LOCUS_14620 907859 908770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 911552 908883 gene locus_tag LOCUS_14630 911552 908883 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_14630 912204 911704 gene locus_tag LOCUS_14640 912204 911704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 912883 912206 gene locus_tag LOCUS_14650 912883 912206 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_14650 914515 912887 gene locus_tag LOCUS_14660 914515 912887 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_14660 915340 915495 gene locus_tag LOCUS_14670 915340 915495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 916567 915920 gene locus_tag LOCUS_14680 916567 915920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 924582 917113 gene locus_tag LOCUS_14690 gene sprA 924582 917113 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_14690 925242 924658 gene locus_tag LOCUS_14700 gene ruvA 925242 924658 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_14700 926355 925255 gene locus_tag LOCUS_14710 gene pdxA 926355 925255 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_14710 926997 926464 gene locus_tag LOCUS_14720 926997 926464 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_14720 927579 927079 gene locus_tag LOCUS_14730 927579 927079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 928432 927836 gene locus_tag LOCUS_14740 928432 927836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 929169 928597 gene locus_tag LOCUS_14750 929169 928597 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022892.1 protein_id gnl|my_center|LOCUS_14750 929300 929842 gene locus_tag LOCUS_14760 929300 929842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 930895 929873 gene locus_tag LOCUS_14770 gene rlmN 930895 929873 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_14770 931652 930972 gene locus_tag LOCUS_14780 931652 930972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 931883 932164 gene locus_tag LOCUS_14790 931883 932164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 932345 933076 gene locus_tag LOCUS_14800 932345 933076 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513090.1 protein_id gnl|my_center|LOCUS_14800 933178 934038 gene locus_tag LOCUS_14810 933178 934038 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797001.1 protein_id gnl|my_center|LOCUS_14810 934056 934826 gene locus_tag LOCUS_14820 934056 934826 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 protein_id gnl|my_center|LOCUS_14820 934801 935640 gene locus_tag LOCUS_14830 934801 935640 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759703.1 protein_id gnl|my_center|LOCUS_14830 936756 935914 gene locus_tag LOCUS_14840 936756 935914 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_14840 937202 938317 gene locus_tag LOCUS_14850 937202 938317 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_14850 939536 938535 gene locus_tag LOCUS_14860 939536 938535 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_14860 939812 940630 gene locus_tag LOCUS_14870 gene mscS 939812 940630 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_14870 940970 942376 gene locus_tag LOCUS_14880 940970 942376 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_14880 942400 942990 gene locus_tag LOCUS_14890 942400 942990 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_14890 943036 944028 gene locus_tag LOCUS_14900 gene trpD 943036 944028 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_14900 944066 944854 gene locus_tag LOCUS_14910 gene trpC 944066 944854 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_14910 944884 945486 gene locus_tag LOCUS_14920 944884 945486 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_14920 945519 946700 gene locus_tag LOCUS_14930 gene trpB 945519 946700 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_14930 946825 947613 gene locus_tag LOCUS_14940 gene trpA 946825 947613 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_14940 947828 948022 gene locus_tag LOCUS_14950 947828 948022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 950711 948150 gene locus_tag LOCUS_14960 950711 948150 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_14960 952269 951031 gene locus_tag LOCUS_14970 952269 951031 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_14970 952796 952326 gene locus_tag LOCUS_14980 gene rnhA 952796 952326 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_14980 954969 952891 gene locus_tag LOCUS_14990 954969 952891 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_14990 955576 957045 gene locus_tag LOCUS_15000 gene gltX 955576 957045 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_15000 957289 958779 gene locus_tag LOCUS_15010 957289 958779 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107543.1 protein_id gnl|my_center|LOCUS_15010 958811 959806 gene locus_tag LOCUS_15020 958811 959806 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859627.1 protein_id gnl|my_center|LOCUS_15020 959810 961009 gene locus_tag LOCUS_15030 959810 961009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_15030 961103 962290 gene locus_tag LOCUS_15040 961103 962290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_15040 964806 962587 gene locus_tag LOCUS_15050 964806 962587 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_15050 965710 965072 gene locus_tag LOCUS_15060 965710 965072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 967155 965707 gene locus_tag LOCUS_15070 967155 965707 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_15070 967318 968445 gene locus_tag LOCUS_15080 967318 968445 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_15080 968594 969211 gene locus_tag LOCUS_15090 968594 969211 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_15090 969544 970731 gene locus_tag LOCUS_15100 gene kbl 969544 970731 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_15100 971684 972340 gene locus_tag LOCUS_15110 971684 972340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 972537 974084 gene locus_tag LOCUS_15120 972537 974084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 974175 975026 gene locus_tag LOCUS_15130 974175 975026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 975033 975734 gene locus_tag LOCUS_15140 975033 975734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 975731 976246 gene locus_tag LOCUS_15150 975731 976246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 978072 976408 gene locus_tag LOCUS_15160 gene hcp 978072 976408 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_15160 979221 978331 gene locus_tag LOCUS_15170 979221 978331 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_15170 979302 979976 gene locus_tag LOCUS_15180 979302 979976 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_15180 980093 980866 gene locus_tag LOCUS_15190 gene pgeF 980093 980866 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109232.1 protein_id gnl|my_center|LOCUS_15190 980960 982222 gene locus_tag LOCUS_15200 980960 982222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 982357 983103 gene locus_tag LOCUS_15210 982357 983103 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_15210 984574 983105 gene locus_tag LOCUS_15220 984574 983105 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_15220 984978 984622 gene locus_tag LOCUS_15230 984978 984622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 985347 986594 gene locus_tag LOCUS_15240 985347 986594 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129252674.1 protein_id gnl|my_center|LOCUS_15240 986750 988027 gene locus_tag LOCUS_15250 986750 988027 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_15250 989467 988316 gene locus_tag LOCUS_15260 989467 988316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 989787 990359 gene locus_tag LOCUS_15270 989787 990359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 990519 991115 gene locus_tag LOCUS_15280 990519 991115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 992446 991112 gene locus_tag LOCUS_15290 992446 991112 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108842.1 protein_id gnl|my_center|LOCUS_15290 993336 992617 gene locus_tag LOCUS_15300 993336 992617 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_15300 993381 994085 gene locus_tag LOCUS_15310 993381 994085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 994560 995975 gene locus_tag LOCUS_15320 994560 995975 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_15320 996010 997116 gene locus_tag LOCUS_15330 996010 997116 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_15330 997162 998238 gene locus_tag LOCUS_15340 997162 998238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 999792 998377 gene locus_tag LOCUS_15350 999792 998377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 999929 1000942 gene locus_tag LOCUS_15360 999929 1000942 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_15360 1002237 1001017 gene locus_tag LOCUS_15370 gene hflX 1002237 1001017 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_15370 1003001 1002315 gene locus_tag LOCUS_15380 1003001 1002315 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_15380 1003813 1003130 gene locus_tag LOCUS_15390 1003813 1003130 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_15390 1005023 1004004 gene locus_tag LOCUS_15400 1005023 1004004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1005472 1006992 gene locus_tag LOCUS_15410 1005472 1006992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1006998 1007429 gene locus_tag LOCUS_15420 1006998 1007429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1007392 1007631 gene locus_tag LOCUS_15430 1007392 1007631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1007761 1007835 gene locus_tag LOCUS_t00200 1007761 1007835 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1008927 1007893 gene locus_tag LOCUS_15440 1008927 1007893 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766781.1 protein_id gnl|my_center|LOCUS_15440 1010002 1008929 gene locus_tag LOCUS_15450 1010002 1008929 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766782.1 protein_id gnl|my_center|LOCUS_15450 1010910 1009999 gene locus_tag LOCUS_15460 gene menA 1010910 1009999 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 protein_id gnl|my_center|LOCUS_15460 1011862 1011038 gene locus_tag LOCUS_15470 gene menB 1011862 1011038 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_15470 1013637 1011955 gene locus_tag LOCUS_15480 gene menD 1013637 1011955 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_15480 1014749 1013634 gene locus_tag LOCUS_15490 1014749 1013634 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760411.1 protein_id gnl|my_center|LOCUS_15490 1015176 1014742 gene locus_tag LOCUS_15500 1015176 1014742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1017414 1015309 gene locus_tag LOCUS_15510 1017414 1015309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1018929 1017595 gene locus_tag LOCUS_15520 1018929 1017595 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_15520 1019148 1019588 gene locus_tag LOCUS_15530 1019148 1019588 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_15530 1020405 1019653 gene locus_tag LOCUS_15540 1020405 1019653 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_15540 1023485 1020402 gene locus_tag LOCUS_15550 1023485 1020402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1025232 1023814 gene locus_tag LOCUS_15560 1025232 1023814 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_15560 1025364 1026470 gene locus_tag LOCUS_15570 1025364 1026470 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_15570 1026504 1027346 gene locus_tag LOCUS_15580 1026504 1027346 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_15580 1028683 1027613 gene locus_tag LOCUS_15590 1028683 1027613 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_15590 1029776 1028670 gene locus_tag LOCUS_15600 1029776 1028670 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_15600 1031373 1030390 gene locus_tag LOCUS_15610 1031373 1030390 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_15610 1032184 1031303 gene locus_tag LOCUS_15620 1032184 1031303 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_15620 1032674 1033762 gene locus_tag LOCUS_15630 1032674 1033762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1033737 1034501 gene locus_tag LOCUS_15640 1033737 1034501 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_15640 1034672 1037011 gene locus_tag LOCUS_15650 1034672 1037011 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765755.1 protein_id gnl|my_center|LOCUS_15650 1037240 1039120 gene locus_tag LOCUS_15660 gene mutA 1037240 1039120 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_15660 1039167 1039523 gene locus_tag LOCUS_15670 1039167 1039523 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_15670 1039571 1041724 gene locus_tag LOCUS_15680 gene scpA 1039571 1041724 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759796.1 protein_id gnl|my_center|LOCUS_15680 1043425 1041911 gene locus_tag LOCUS_15690 1043425 1041911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1043955 1043632 gene locus_tag LOCUS_15700 1043955 1043632 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968460.1 protein_id gnl|my_center|LOCUS_15700 1044859 1044269 gene locus_tag LOCUS_15710 1044859 1044269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1045355 1046044 gene locus_tag LOCUS_15720 1045355 1046044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1046201 1047367 gene locus_tag LOCUS_15730 1046201 1047367 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_15730 1048358 1047375 gene locus_tag LOCUS_15740 1048358 1047375 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_15740 1048662 1048420 gene locus_tag LOCUS_15750 1048662 1048420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1050194 1048680 gene locus_tag LOCUS_15760 gene atpD 1050194 1048680 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_15760 1051304 1050312 gene locus_tag LOCUS_15770 1051304 1050312 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_15770 1053613 1051301 gene locus_tag LOCUS_15780 1053613 1051301 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_15780 1053983 1054747 gene locus_tag LOCUS_15790 1053983 1054747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1054938 1055014 gene locus_tag LOCUS_t00210 1054938 1055014 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1055704 1055117 gene locus_tag LOCUS_15800 1055704 1055117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1056146 1057132 gene locus_tag LOCUS_15810 1056146 1057132 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_15810 1057139 1057879 gene locus_tag LOCUS_15820 1057139 1057879 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_15820 1058439 1057909 gene locus_tag LOCUS_15830 1058439 1057909 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_15830 1059858 1058518 gene locus_tag LOCUS_15840 1059858 1058518 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_15840 1061367 1059871 gene locus_tag LOCUS_15850 1061367 1059871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1062452 1061742 gene locus_tag LOCUS_15860 1062452 1061742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1063662 1062493 gene locus_tag LOCUS_15870 gene nrfD 1063662 1062493 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_15870 1064584 1063718 gene locus_tag LOCUS_15880 1064584 1063718 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_15880 1066294 1064630 gene locus_tag LOCUS_15890 1066294 1064630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1066753 1067751 gene locus_tag LOCUS_15900 1066753 1067751 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_15900 1068362 1067748 gene locus_tag LOCUS_15910 1068362 1067748 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_15910 1069946 1068429 gene locus_tag LOCUS_15920 1069946 1068429 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_15920 1070127 1070675 gene locus_tag LOCUS_15930 1070127 1070675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1070989 1071678 gene locus_tag LOCUS_15940 1070989 1071678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1071843 1073135 gene locus_tag LOCUS_15950 gene tyrS 1071843 1073135 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_15950 1073271 1074224 gene locus_tag LOCUS_15960 1073271 1074224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1074228 1075691 gene locus_tag LOCUS_15970 1074228 1075691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1076294 1075725 gene locus_tag LOCUS_15980 gene efp 1076294 1075725 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403696.1 protein_id gnl|my_center|LOCUS_15980 1077127 1076396 gene locus_tag LOCUS_15990 1077127 1076396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1077837 1077124 gene locus_tag LOCUS_16000 gene tsaB 1077837 1077124 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_16000 1077999 1078754 gene locus_tag LOCUS_16010 1077999 1078754 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_16010 1078983 1079171 gene locus_tag LOCUS_16020 1078983 1079171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1079164 1085520 gene locus_tag LOCUS_16030 1079164 1085520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1085619 1086398 gene locus_tag LOCUS_16040 1085619 1086398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1086480 1089623 gene locus_tag LOCUS_16050 1086480 1089623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1089906 1090841 gene locus_tag LOCUS_16060 1089906 1090841 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_16060 1090883 1092868 gene locus_tag LOCUS_16070 1090883 1092868 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_16070 1092954 1094552 gene locus_tag LOCUS_16080 1092954 1094552 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_16080 1095032 1095943 gene locus_tag LOCUS_16090 1095032 1095943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1096820 1096035 gene locus_tag LOCUS_16100 1096820 1096035 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963856.1 protein_id gnl|my_center|LOCUS_16100 1097271 1096840 gene locus_tag LOCUS_16110 1097271 1096840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1098069 1097578 gene locus_tag LOCUS_16120 1098069 1097578 CDS product DUF4625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784028.1 protein_id gnl|my_center|LOCUS_16120 1100780 1098441 gene locus_tag LOCUS_16130 1100780 1098441 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107767.1 protein_id gnl|my_center|LOCUS_16130 1101590 1102801 gene locus_tag LOCUS_16140 1101590 1102801 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_16140 1103191 1106190 gene locus_tag LOCUS_16150 1103191 1106190 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_16150 1106203 1107798 gene locus_tag LOCUS_16160 1106203 1107798 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784821.1 protein_id gnl|my_center|LOCUS_16160 1107962 1108768 gene locus_tag LOCUS_16170 1107962 1108768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1109070 1110428 gene locus_tag LOCUS_16180 1109070 1110428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1110458 1111903 gene locus_tag LOCUS_16190 1110458 1111903 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_16190 1111913 1113331 gene locus_tag LOCUS_16200 1111913 1113331 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766054.1 protein_id gnl|my_center|LOCUS_16200 1113390 1115222 gene locus_tag LOCUS_16210 1113390 1115222 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_16210 1115209 1115919 gene locus_tag LOCUS_16220 1115209 1115919 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_16220 1115959 1116894 gene locus_tag LOCUS_16230 1115959 1116894 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766063.1 protein_id gnl|my_center|LOCUS_16230 1116907 1118091 gene locus_tag LOCUS_16240 1116907 1118091 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_16240 1118167 1119309 gene locus_tag LOCUS_16250 1118167 1119309 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_16250 1119383 1121104 gene locus_tag LOCUS_16260 1119383 1121104 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_16260 1121565 1122266 gene locus_tag LOCUS_16270 1121565 1122266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1122984 1122259 gene locus_tag LOCUS_16280 1122984 1122259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1123348 1123275 gene locus_tag LOCUS_t00220 1123348 1123275 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1124004 1123483 gene locus_tag LOCUS_16290 1124004 1123483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793498.1 protein_id gnl|my_center|LOCUS_16290 1124612 1124106 gene locus_tag LOCUS_16300 1124612 1124106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1124819 1125343 gene locus_tag LOCUS_16310 1124819 1125343 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576049.1 protein_id gnl|my_center|LOCUS_16310 1126042 1125353 gene locus_tag LOCUS_16320 1126042 1125353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1126876 1126043 gene locus_tag LOCUS_16330 1126876 1126043 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_16330 1128344 1126854 gene locus_tag LOCUS_16340 1128344 1126854 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686168.1 protein_id gnl|my_center|LOCUS_16340 1128455 1129918 gene locus_tag LOCUS_16350 gene crtI 1128455 1129918 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_16350 1129915 1130559 gene locus_tag LOCUS_16360 1129915 1130559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1130559 1131248 gene locus_tag LOCUS_16370 1130559 1131248 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530149.1 protein_id gnl|my_center|LOCUS_16370 1131245 1131856 gene locus_tag LOCUS_16380 1131245 1131856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1131849 1132952 gene locus_tag LOCUS_16390 gene cruC 1131849 1132952 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_16390 1132973 1133668 gene locus_tag LOCUS_16400 1132973 1133668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1134630 1133680 gene locus_tag LOCUS_16410 1134630 1133680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1137141 1134787 gene locus_tag LOCUS_16420 1137141 1134787 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_16420 1138193 1137213 gene locus_tag LOCUS_16430 1138193 1137213 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_16430 1139080 1138235 gene locus_tag LOCUS_16440 1139080 1138235 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_16440 1139428 1140048 gene locus_tag LOCUS_16450 1139428 1140048 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_16450 1140121 1141317 gene locus_tag LOCUS_16460 1140121 1141317 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767176.1 protein_id gnl|my_center|LOCUS_16460 1141414 1144650 gene locus_tag LOCUS_16470 1141414 1144650 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_16470 1144670 1146202 gene locus_tag LOCUS_16480 1144670 1146202 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_16480 1146612 1147088 gene locus_tag LOCUS_16490 1146612 1147088 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919214.1 protein_id gnl|my_center|LOCUS_16490 1147189 1147707 gene locus_tag LOCUS_16500 gene tpx 1147189 1147707 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_16500 1148780 1147812 gene locus_tag LOCUS_16510 1148780 1147812 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_16510 1156583 1148799 gene locus_tag LOCUS_16520 1156583 1148799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1157279 1156587 gene locus_tag LOCUS_16530 1157279 1156587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1157508 1157299 gene locus_tag LOCUS_16540 1157508 1157299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1159353 1158196 gene locus_tag LOCUS_16550 1159353 1158196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1160598 1159618 gene locus_tag LOCUS_16560 1160598 1159618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1160753 1161735 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1165256 1165480 gene locus_tag LOCUS_16570 1165256 1165480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1166423 1166635 gene locus_tag LOCUS_16580 1166423 1166635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1166678 1166887 gene locus_tag LOCUS_16590 1166678 1166887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1168570 1167803 gene locus_tag LOCUS_16600 1168570 1167803 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_16600 1169606 1168578 gene locus_tag LOCUS_16610 1169606 1168578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1171201 1169819 gene locus_tag LOCUS_16620 1171201 1169819 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766603.1 protein_id gnl|my_center|LOCUS_16620 1173482 1171296 gene locus_tag LOCUS_16630 1173482 1171296 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766160.1 protein_id gnl|my_center|LOCUS_16630 1176588 1173469 gene locus_tag LOCUS_16640 1176588 1173469 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203255.1 protein_id gnl|my_center|LOCUS_16640 1177870 1176785 gene locus_tag LOCUS_16650 1177870 1176785 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203256.1 protein_id gnl|my_center|LOCUS_16650 1178318 1178872 gene locus_tag LOCUS_16660 1178318 1178872 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_16660 1179036 1180055 gene locus_tag LOCUS_16670 1179036 1180055 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681496.1 protein_id gnl|my_center|LOCUS_16670 1180195 1183701 gene locus_tag LOCUS_16680 1180195 1183701 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_16680 1183791 1185338 gene locus_tag LOCUS_16690 1183791 1185338 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_16690 1185388 1186650 gene locus_tag LOCUS_16700 1185388 1186650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence11 2772 673 gene locus_tag LOCUS_16710 gene feoB 2772 673 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_16710 3035 2775 gene locus_tag LOCUS_16720 3035 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3443 3844 gene locus_tag LOCUS_16730 3443 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4365 3841 gene locus_tag LOCUS_16740 4365 3841 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_16740 4735 5919 gene locus_tag LOCUS_16750 4735 5919 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_16750 7403 6087 gene locus_tag LOCUS_16760 7403 6087 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180983106.1 protein_id gnl|my_center|LOCUS_16760 9298 8258 gene locus_tag LOCUS_16770 9298 8258 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_16770 9371 10606 gene locus_tag LOCUS_16780 9371 10606 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_16780 11458 10628 gene locus_tag LOCUS_16790 gene yidA 11458 10628 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989393.1 protein_id gnl|my_center|LOCUS_16790 12362 11487 gene locus_tag LOCUS_16800 12362 11487 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_16800 12795 13511 gene locus_tag LOCUS_16810 gene dapB 12795 13511 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_16810 13525 14865 gene locus_tag LOCUS_16820 gene lepB 13525 14865 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_16820 14950 15282 gene locus_tag LOCUS_16830 14950 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 15288 15929 gene locus_tag LOCUS_16840 15288 15929 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_16840 16563 16138 gene locus_tag LOCUS_16850 16563 16138 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_16850 17404 16610 gene locus_tag LOCUS_16860 17404 16610 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_16860 17573 19639 gene locus_tag LOCUS_16870 17573 19639 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_16870 19688 20281 gene locus_tag LOCUS_16880 19688 20281 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_16880 20411 21457 gene locus_tag LOCUS_16890 20411 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 21544 24861 gene locus_tag LOCUS_16900 21544 24861 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_16900 24978 26675 gene locus_tag LOCUS_16910 24978 26675 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_16910 26765 28477 gene locus_tag LOCUS_16920 26765 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 28596 30248 gene locus_tag LOCUS_16930 28596 30248 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_16930 30379 31845 gene locus_tag LOCUS_16940 30379 31845 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_16940 32423 33613 gene locus_tag LOCUS_16950 32423 33613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037925.1 protein_id gnl|my_center|LOCUS_16950 33623 34849 gene locus_tag LOCUS_16960 33623 34849 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767787.1 protein_id gnl|my_center|LOCUS_16960 34846 35667 gene locus_tag LOCUS_16970 34846 35667 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763296.1 protein_id gnl|my_center|LOCUS_16970 35708 36577 gene locus_tag LOCUS_16980 35708 36577 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769585.1 protein_id gnl|my_center|LOCUS_16980 38902 36668 gene locus_tag LOCUS_16990 38902 36668 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_16990 39967 39047 gene locus_tag LOCUS_17000 39967 39047 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_17000 40934 40020 gene locus_tag LOCUS_17010 40934 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 41700 41098 gene locus_tag LOCUS_17020 41700 41098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 43476 42460 gene locus_tag LOCUS_17030 gene hemH 43476 42460 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_17030 44411 43512 gene locus_tag LOCUS_17040 gene hemF 44411 43512 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_17040 45781 44420 gene locus_tag LOCUS_17050 gene hemG 45781 44420 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202640.1 protein_id gnl|my_center|LOCUS_17050 47160 45784 gene locus_tag LOCUS_17060 gene hemN 47160 45784 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202641.1 protein_id gnl|my_center|LOCUS_17060 47558 48814 gene locus_tag LOCUS_17070 47558 48814 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_17070 49180 50346 gene locus_tag LOCUS_17080 49180 50346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 51136 50384 gene locus_tag LOCUS_17090 51136 50384 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_17090 51788 51246 gene locus_tag LOCUS_17100 51788 51246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 52254 52751 gene locus_tag LOCUS_17110 52254 52751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 54186 52831 gene locus_tag LOCUS_17120 54186 52831 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_17120 55226 54519 gene locus_tag LOCUS_17130 55226 54519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_17130 57226 55430 gene locus_tag LOCUS_17140 57226 55430 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_17140 57394 59235 gene locus_tag LOCUS_17150 57394 59235 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_17150 59555 59331 gene locus_tag LOCUS_17160 59555 59331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 60784 59552 gene locus_tag LOCUS_17170 60784 59552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 63310 60935 gene locus_tag LOCUS_17180 63310 60935 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_17180 64353 63463 gene locus_tag LOCUS_17190 64353 63463 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_17190 64686 66758 gene locus_tag LOCUS_17200 64686 66758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 68640 66829 gene locus_tag LOCUS_17210 68640 66829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 68946 70169 gene locus_tag LOCUS_17220 gene rocD 68946 70169 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_17220 71142 70564 gene locus_tag LOCUS_17230 71142 70564 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_17230 71840 71430 gene locus_tag LOCUS_17240 71840 71430 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_17240 72927 71857 gene locus_tag LOCUS_17250 72927 71857 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971151.1 protein_id gnl|my_center|LOCUS_17250 73236 73826 gene locus_tag LOCUS_17260 73236 73826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 73956 74384 gene locus_tag LOCUS_17270 73956 74384 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_17270 76031 74436 gene locus_tag LOCUS_17280 76031 74436 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_17280 78275 76329 gene locus_tag LOCUS_17290 78275 76329 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_17290 79690 78620 gene locus_tag LOCUS_17300 79690 78620 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474082.1 protein_id gnl|my_center|LOCUS_17300 79940 80461 gene locus_tag LOCUS_17310 79940 80461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 82687 80465 gene locus_tag LOCUS_17320 82687 80465 CDS product KamA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750166.1 protein_id gnl|my_center|LOCUS_17320 82900 83295 gene locus_tag LOCUS_17330 82900 83295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 83487 84524 gene locus_tag LOCUS_17340 83487 84524 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202970.1 protein_id gnl|my_center|LOCUS_17340 84761 85234 gene locus_tag LOCUS_17350 gene ybaK 84761 85234 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_17350 86361 85240 gene locus_tag LOCUS_17360 86361 85240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_17360 87629 86523 gene locus_tag LOCUS_17370 87629 86523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_17370 88426 87686 gene locus_tag LOCUS_17380 88426 87686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 89480 88572 gene locus_tag LOCUS_17390 89480 88572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 90447 89560 gene locus_tag LOCUS_17400 90447 89560 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107324.1 protein_id gnl|my_center|LOCUS_17400 91731 90469 gene locus_tag LOCUS_17410 91731 90469 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_17410 92388 91780 gene locus_tag LOCUS_17420 92388 91780 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_17420 92639 93451 gene locus_tag LOCUS_17430 92639 93451 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_17430 93461 93973 gene locus_tag LOCUS_17440 93461 93973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 94971 94036 gene locus_tag LOCUS_17450 94971 94036 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760419.1 protein_id gnl|my_center|LOCUS_17450 96359 95085 gene locus_tag LOCUS_17460 96359 95085 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_17460 97594 96356 gene locus_tag LOCUS_17470 97594 96356 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_17470 98497 97598 gene locus_tag LOCUS_17480 98497 97598 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107858.1 protein_id gnl|my_center|LOCUS_17480 99574 98732 gene locus_tag LOCUS_17490 99574 98732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 100601 99804 gene locus_tag LOCUS_17500 gene cdaA 100601 99804 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_17500 101479 100598 gene locus_tag LOCUS_17510 gene folP 101479 100598 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_17510 101435 101626 gene locus_tag LOCUS_17520 101435 101626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 101589 102131 gene locus_tag LOCUS_17530 101589 102131 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_17530 102137 103285 gene locus_tag LOCUS_17540 102137 103285 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_17540 103380 105479 gene locus_tag LOCUS_17550 103380 105479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 105695 106942 gene locus_tag LOCUS_17560 105695 106942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 108762 107104 gene locus_tag LOCUS_17570 108762 107104 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_17570 110139 108910 gene locus_tag LOCUS_17580 110139 108910 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_17580 110789 110238 gene locus_tag LOCUS_17590 110789 110238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 111610 110798 gene locus_tag LOCUS_17600 111610 110798 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_17600 111858 113012 gene locus_tag LOCUS_17610 111858 113012 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905594.1 protein_id gnl|my_center|LOCUS_17610 113571 113029 gene locus_tag LOCUS_17620 113571 113029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 113991 113770 gene locus_tag LOCUS_17630 113991 113770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 114317 115762 gene locus_tag LOCUS_17640 114317 115762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_17640 118870 115784 gene locus_tag LOCUS_17650 gene ccsA 118870 115784 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_17650 120545 119043 gene locus_tag LOCUS_17660 120545 119043 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_17660 121324 120668 gene locus_tag LOCUS_17670 121324 120668 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545712.1 protein_id gnl|my_center|LOCUS_17670 122097 121327 gene locus_tag LOCUS_17680 122097 121327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 122742 122323 gene locus_tag LOCUS_17690 122742 122323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 123646 122765 gene locus_tag LOCUS_17700 123646 122765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 124050 123670 gene locus_tag LOCUS_17710 124050 123670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 125219 124134 gene locus_tag LOCUS_17720 125219 124134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 126037 125312 gene locus_tag LOCUS_17730 126037 125312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 126511 126302 gene locus_tag LOCUS_17740 126511 126302 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129656.1 protein_id gnl|my_center|LOCUS_17740 126783 126613 gene locus_tag LOCUS_17750 126783 126613 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_17750 127694 126840 gene locus_tag LOCUS_17760 127694 126840 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_17760 128024 127782 gene locus_tag LOCUS_17770 128024 127782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 128683 128090 gene locus_tag LOCUS_17780 128683 128090 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_17780 128942 131644 gene locus_tag LOCUS_17790 gene uvrA 128942 131644 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_17790 131808 133601 gene locus_tag LOCUS_17800 131808 133601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 134207 135562 gene locus_tag LOCUS_17810 134207 135562 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_17810 136993 135647 gene locus_tag LOCUS_17820 136993 135647 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_17820 137111 137659 gene locus_tag LOCUS_17830 137111 137659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 137984 138916 gene locus_tag LOCUS_17840 137984 138916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 139972 138986 gene locus_tag LOCUS_17850 139972 138986 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_17850 140703 140032 gene locus_tag LOCUS_17860 140703 140032 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_17860 140845 141819 gene locus_tag LOCUS_17870 140845 141819 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_17870 141854 142417 gene locus_tag LOCUS_17880 141854 142417 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694272.1 protein_id gnl|my_center|LOCUS_17880 142580 142948 gene locus_tag LOCUS_17890 142580 142948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 143163 144026 gene locus_tag LOCUS_17900 143163 144026 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_17900 144158 144727 gene locus_tag LOCUS_17910 gene gmk 144158 144727 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_17910 144806 145378 gene locus_tag LOCUS_17920 gene nadD 144806 145378 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_17920 145701 146237 gene locus_tag LOCUS_17930 145701 146237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 146219 147409 gene locus_tag LOCUS_17940 146219 147409 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456088.1 protein_id gnl|my_center|LOCUS_17940 147393 148190 gene locus_tag LOCUS_17950 gene moaA 147393 148190 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_17950 148208 148663 gene locus_tag LOCUS_17960 gene moaC 148208 148663 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_17960 148685 149629 gene locus_tag LOCUS_17970 148685 149629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 149786 150592 gene locus_tag LOCUS_17980 gene kdsA 149786 150592 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_17980 150700 151110 gene locus_tag LOCUS_17990 150700 151110 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_17990 152393 151107 gene locus_tag LOCUS_18000 152393 151107 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_18000 153459 154145 gene locus_tag LOCUS_18010 153459 154145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 154657 154965 gene locus_tag LOCUS_18020 154657 154965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 155106 155864 gene locus_tag LOCUS_18030 155106 155864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 156172 156561 gene locus_tag LOCUS_18040 156172 156561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 156754 157686 gene locus_tag LOCUS_18050 156754 157686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 157840 158907 gene locus_tag LOCUS_18060 157840 158907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 158900 159484 gene locus_tag LOCUS_18070 158900 159484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 160235 161431 gene locus_tag LOCUS_18080 160235 161431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 161406 162482 gene locus_tag LOCUS_18090 161406 162482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 162576 163454 gene locus_tag LOCUS_18100 162576 163454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 163662 163465 gene locus_tag LOCUS_18110 163662 163465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 163822 167094 gene locus_tag LOCUS_18120 163822 167094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 168030 169439 gene locus_tag LOCUS_18130 168030 169439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 169543 170607 gene locus_tag LOCUS_18140 169543 170607 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672294.1 protein_id gnl|my_center|LOCUS_18140 172491 170764 gene locus_tag LOCUS_18150 172491 170764 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_18150 175945 172514 gene locus_tag LOCUS_18160 175945 172514 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_18160 177210 176107 gene locus_tag LOCUS_18170 177210 176107 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_18170 177862 177266 gene locus_tag LOCUS_18180 177862 177266 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_18180 179439 178162 gene locus_tag LOCUS_18190 179439 178162 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_18190 180243 179449 gene locus_tag LOCUS_18200 180243 179449 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_18200 181512 180271 gene locus_tag LOCUS_18210 181512 180271 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 protein_id gnl|my_center|LOCUS_18210 182414 181572 gene locus_tag LOCUS_18220 gene kduI 182414 181572 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_18220 183575 182421 gene locus_tag LOCUS_18230 183575 182421 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_18230 183736 184764 gene locus_tag LOCUS_18240 183736 184764 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_18240 185087 185848 gene locus_tag LOCUS_18250 185087 185848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 185838 186929 gene locus_tag LOCUS_18260 185838 186929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 187635 187015 gene locus_tag LOCUS_18270 187635 187015 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237109.1 protein_id gnl|my_center|LOCUS_18270 188472 187699 gene locus_tag LOCUS_18280 188472 187699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 188819 189958 gene locus_tag LOCUS_18290 188819 189958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_18290 190037 190744 gene locus_tag LOCUS_18300 190037 190744 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_18300 190881 191234 gene locus_tag LOCUS_18310 gene rpsF 190881 191234 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_18310 191238 191507 gene locus_tag LOCUS_18320 gene rpsR 191238 191507 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_18320 191526 191975 gene locus_tag LOCUS_18330 gene rplI 191526 191975 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_18330 192772 192050 gene locus_tag LOCUS_18340 192772 192050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 192931 193980 gene locus_tag LOCUS_18350 192931 193980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_18350 194914 194060 gene locus_tag LOCUS_18360 194914 194060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 197133 195145 gene locus_tag LOCUS_18370 197133 195145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 197389 198495 gene locus_tag LOCUS_18380 197389 198495 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_18380 198550 202110 gene locus_tag LOCUS_18390 gene nifJ 198550 202110 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_18390 202801 202220 gene locus_tag LOCUS_18400 202801 202220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 203136 203840 gene locus_tag LOCUS_18410 203136 203840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18410 203850 204143 gene locus_tag LOCUS_18420 203850 204143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 204683 204324 gene locus_tag LOCUS_18430 204683 204324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 205352 204795 gene locus_tag LOCUS_18440 205352 204795 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765028.1 protein_id gnl|my_center|LOCUS_18440 206235 205483 gene locus_tag LOCUS_18450 206235 205483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_18450 207435 206335 gene locus_tag LOCUS_18460 207435 206335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 207915 207694 gene locus_tag LOCUS_18470 207915 207694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 208884 210398 gene locus_tag LOCUS_18480 208884 210398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 210914 211549 gene locus_tag LOCUS_18490 gene catB 210914 211549 CDS product type B chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073960.1 protein_id gnl|my_center|LOCUS_18490 211650 212246 gene locus_tag LOCUS_18500 211650 212246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 213773 212382 gene locus_tag LOCUS_18510 213773 212382 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_18510 214174 213800 gene locus_tag LOCUS_18520 214174 213800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 215595 214486 gene locus_tag LOCUS_18530 215595 214486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 216385 215729 gene locus_tag LOCUS_18540 216385 215729 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530074.1 protein_id gnl|my_center|LOCUS_18540 217371 216382 gene locus_tag LOCUS_18550 217371 216382 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_18550 218601 217402 gene locus_tag LOCUS_18560 218601 217402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 219214 218630 gene locus_tag LOCUS_18570 219214 218630 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_18570 219916 219245 gene locus_tag LOCUS_18580 219916 219245 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_18580 221058 220207 gene locus_tag LOCUS_18590 221058 220207 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_18590 221242 222147 gene locus_tag LOCUS_18600 221242 222147 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_18600 222181 223680 gene locus_tag LOCUS_18610 222181 223680 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_18610 223700 224785 gene locus_tag LOCUS_18620 223700 224785 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_18620 224807 226798 gene locus_tag LOCUS_18630 224807 226798 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_18630 226806 227804 gene locus_tag LOCUS_18640 226806 227804 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_18640 227943 228689 gene locus_tag LOCUS_18650 227943 228689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 229083 230069 gene locus_tag LOCUS_18660 229083 230069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 230079 232082 gene locus_tag LOCUS_18670 230079 232082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 232084 233880 gene locus_tag LOCUS_18680 232084 233880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 234331 234134 gene locus_tag LOCUS_18690 234331 234134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 234679 235791 gene locus_tag LOCUS_18700 234679 235791 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_18700 236474 236932 gene locus_tag LOCUS_18710 236474 236932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 238115 236955 gene locus_tag LOCUS_18720 238115 236955 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096621.1 protein_id gnl|my_center|LOCUS_18720 239198 238191 gene locus_tag LOCUS_18730 239198 238191 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203177.1 protein_id gnl|my_center|LOCUS_18730 240944 239202 gene locus_tag LOCUS_18740 240944 239202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 243352 241034 gene locus_tag LOCUS_18750 243352 241034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 245704 243536 gene locus_tag LOCUS_18760 245704 243536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 247098 245812 gene locus_tag LOCUS_18770 247098 245812 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640236.1 protein_id gnl|my_center|LOCUS_18770 248783 247248 gene locus_tag LOCUS_18780 248783 247248 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830048.1 protein_id gnl|my_center|LOCUS_18780 250610 248910 gene locus_tag LOCUS_18790 250610 248910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 254081 250629 gene locus_tag LOCUS_18800 254081 250629 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_18800 254802 254299 gene locus_tag LOCUS_18810 254802 254299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 256035 254845 gene locus_tag LOCUS_18820 256035 254845 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_18820 258328 256355 gene locus_tag LOCUS_18830 258328 256355 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_18830 258921 259862 gene locus_tag LOCUS_18840 258921 259862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 260032 263322 gene locus_tag LOCUS_18850 260032 263322 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_18850 263335 264996 gene locus_tag LOCUS_18860 263335 264996 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_18860 265084 266409 gene locus_tag LOCUS_18870 265084 266409 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_18870 266626 266973 gene locus_tag LOCUS_18880 266626 266973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 267066 268028 gene locus_tag LOCUS_18890 267066 268028 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_18890 268495 268938 gene locus_tag LOCUS_18900 268495 268938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 269013 270239 gene locus_tag LOCUS_18910 269013 270239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 270290 271717 gene locus_tag LOCUS_18920 270290 271717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 271884 272432 gene locus_tag LOCUS_18930 271884 272432 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_18930 272958 274547 gene locus_tag LOCUS_18940 272958 274547 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_18940 275524 275937 gene locus_tag LOCUS_18950 275524 275937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 276083 276499 gene locus_tag LOCUS_18960 276083 276499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 277895 277143 gene locus_tag LOCUS_18970 277895 277143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 278449 278105 gene locus_tag LOCUS_18980 278449 278105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence12 <1 980 gene locus_tag LOCUS_18990 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767035.1:alpha-L-fucosidase 1044 3422 gene locus_tag LOCUS_19000 1044 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 3538 5490 gene locus_tag LOCUS_19010 3538 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6886 7020 gene locus_tag LOCUS_19020 6886 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 7154 8038 gene locus_tag LOCUS_19030 7154 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 8201 8902 gene locus_tag LOCUS_19040 8201 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9112 11517 gene locus_tag LOCUS_19050 9112 11517 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_19050 11529 12587 gene locus_tag LOCUS_19060 11529 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 12771 13922 gene locus_tag LOCUS_19070 12771 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 15030 14035 gene locus_tag LOCUS_19080 15030 14035 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_19080 15996 15076 gene locus_tag LOCUS_19090 gene rbsK 15996 15076 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_19090 16246 17721 gene locus_tag LOCUS_19100 16246 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 17827 20541 gene locus_tag LOCUS_19110 17827 20541 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_19110 20719 21216 gene locus_tag LOCUS_19120 20719 21216 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_19120 21323 22282 gene locus_tag LOCUS_19130 21323 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 22453 25818 gene locus_tag LOCUS_19140 22453 25818 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_19140 25805 27277 gene locus_tag LOCUS_19150 25805 27277 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_19150 27453 29795 gene locus_tag LOCUS_19160 27453 29795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 29808 32240 gene locus_tag LOCUS_19170 29808 32240 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_19170 32230 33450 gene locus_tag LOCUS_19180 32230 33450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 33454 36573 gene locus_tag LOCUS_19190 33454 36573 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_19190 36586 37080 gene locus_tag LOCUS_19200 36586 37080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 37091 38686 gene locus_tag LOCUS_19210 37091 38686 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_19210 38696 39919 gene locus_tag LOCUS_19220 38696 39919 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_19220 39909 41072 gene locus_tag LOCUS_19230 39909 41072 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_19230 41156 42193 gene locus_tag LOCUS_19240 41156 42193 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121661.1 protein_id gnl|my_center|LOCUS_19240 42205 43272 gene locus_tag LOCUS_19250 42205 43272 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_19250 43311 44426 gene locus_tag LOCUS_19260 43311 44426 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_19260 44592 46097 gene locus_tag LOCUS_19270 44592 46097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 46191 46781 gene locus_tag LOCUS_19280 46191 46781 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_19280 46864 48096 gene locus_tag LOCUS_19290 46864 48096 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_19290 48180 51452 gene locus_tag LOCUS_19300 48180 51452 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_19300 51385 53076 gene locus_tag LOCUS_19310 51385 53076 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_19310 53287 53763 gene locus_tag LOCUS_19320 53287 53763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_19320 54689 53820 gene locus_tag LOCUS_19330 54689 53820 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_19330 55529 54780 gene locus_tag LOCUS_19340 55529 54780 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_19340 57352 55541 gene locus_tag LOCUS_19350 57352 55541 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_19350 58232 57405 gene locus_tag LOCUS_19360 58232 57405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 59324 58293 gene locus_tag LOCUS_19370 59324 58293 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_19370 60332 59337 gene locus_tag LOCUS_19380 60332 59337 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_19380 61332 60340 gene locus_tag LOCUS_19390 61332 60340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_19390 62220 61339 gene locus_tag LOCUS_19400 62220 61339 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_19400 63357 62362 gene locus_tag LOCUS_19410 63357 62362 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_19410 63522 64304 gene locus_tag LOCUS_19420 gene truA 63522 64304 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_19420 64614 66224 gene locus_tag LOCUS_19430 64614 66224 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_19430 66319 66900 gene locus_tag LOCUS_19440 66319 66900 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_19440 67087 68523 gene locus_tag LOCUS_19450 67087 68523 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_19450 69052 68618 gene locus_tag LOCUS_19460 69052 68618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 69720 69133 gene locus_tag LOCUS_19470 69720 69133 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_19470 70394 69843 gene locus_tag LOCUS_19480 70394 69843 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_19480 71420 70569 gene locus_tag LOCUS_19490 71420 70569 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_19490 71843 72181 gene locus_tag LOCUS_19500 71843 72181 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_19500 73101 72319 gene locus_tag LOCUS_19510 73101 72319 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_19510 73858 73109 gene locus_tag LOCUS_19520 gene pflA 73858 73109 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202364.1 protein_id gnl|my_center|LOCUS_19520 76155 73939 gene locus_tag LOCUS_19530 gene pflB 76155 73939 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766750.1 protein_id gnl|my_center|LOCUS_19530 76583 78124 gene locus_tag LOCUS_19540 76583 78124 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_19540 78572 78175 gene locus_tag LOCUS_tm00010 78572 78175 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 78752 79954 gene locus_tag LOCUS_19550 78752 79954 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_19550 80386 79955 gene locus_tag LOCUS_19560 80386 79955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 80905 80498 gene locus_tag LOCUS_19570 80905 80498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 81351 80914 gene locus_tag LOCUS_19580 81351 80914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 82076 81348 gene locus_tag LOCUS_19590 82076 81348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 82240 82314 gene locus_tag LOCUS_t00230 82240 82314 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 82600 83559 gene locus_tag LOCUS_19600 82600 83559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 83543 84106 gene locus_tag LOCUS_19610 83543 84106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 85234 84149 gene locus_tag LOCUS_19620 85234 84149 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474082.1 protein_id gnl|my_center|LOCUS_19620 85935 85297 gene locus_tag LOCUS_19630 85935 85297 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160069703.1 protein_id gnl|my_center|LOCUS_19630 86286 87500 gene locus_tag LOCUS_19640 gene gluP 86286 87500 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785331.1 protein_id gnl|my_center|LOCUS_19640 87888 90173 gene locus_tag LOCUS_19650 87888 90173 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_19650 90354 93689 gene locus_tag LOCUS_19660 90354 93689 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_19660 93821 94387 gene locus_tag LOCUS_19670 93821 94387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 94452 95522 gene locus_tag LOCUS_19680 94452 95522 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766780.1 protein_id gnl|my_center|LOCUS_19680 95632 99069 gene locus_tag LOCUS_19690 95632 99069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_19690 99077 100882 gene locus_tag LOCUS_19700 99077 100882 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_19700 101532 102953 gene locus_tag LOCUS_19710 101532 102953 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841307.1 protein_id gnl|my_center|LOCUS_19710 103958 103215 gene locus_tag LOCUS_19720 103958 103215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 104487 105074 gene locus_tag LOCUS_19730 104487 105074 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_19730 105361 106368 gene locus_tag LOCUS_19740 105361 106368 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_19740 106467 109934 gene locus_tag LOCUS_19750 106467 109934 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_19750 109958 111739 gene locus_tag LOCUS_19760 109958 111739 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_19760 112145 112846 gene locus_tag LOCUS_19770 112145 112846 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_19770 112857 114146 gene locus_tag LOCUS_19780 112857 114146 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_19780 114535 115962 gene locus_tag LOCUS_19790 114535 115962 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_19790 116324 116028 gene locus_tag LOCUS_19800 116324 116028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 116404 117870 gene locus_tag LOCUS_19810 116404 117870 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_19810 117956 119890 gene locus_tag LOCUS_19820 117956 119890 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_19820 119949 121370 gene locus_tag LOCUS_19830 119949 121370 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_19830 121470 122672 gene locus_tag LOCUS_19840 121470 122672 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_19840 122902 124347 gene locus_tag LOCUS_19850 122902 124347 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841307.1 protein_id gnl|my_center|LOCUS_19850 124747 127011 gene locus_tag LOCUS_19860 124747 127011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 127305 128573 gene locus_tag LOCUS_19870 127305 128573 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_19870 128654 132052 gene locus_tag LOCUS_19880 128654 132052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 134303 132300 gene locus_tag LOCUS_19890 134303 132300 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_19890 135040 134315 gene locus_tag LOCUS_19900 135040 134315 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_19900 135319 135044 gene locus_tag LOCUS_19910 135319 135044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 137054 135582 gene locus_tag LOCUS_19920 137054 135582 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_19920 138552 137116 gene locus_tag LOCUS_19930 138552 137116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 138648 140123 gene locus_tag LOCUS_19940 gene proS 138648 140123 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_19940 140199 140882 gene locus_tag LOCUS_19950 140199 140882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 140886 142112 gene locus_tag LOCUS_19960 gene pepT 140886 142112 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_19960 142105 143430 gene locus_tag LOCUS_19970 gene tilS 142105 143430 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_19970 143580 144713 gene locus_tag LOCUS_19980 143580 144713 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_19980 144731 145225 gene locus_tag LOCUS_19990 144731 145225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 146377 145505 gene locus_tag LOCUS_20000 146377 145505 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_20000 146753 147217 gene locus_tag LOCUS_20010 146753 147217 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797529.1 protein_id gnl|my_center|LOCUS_20010 147353 148324 gene locus_tag LOCUS_20020 147353 148324 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_20020 148484 151777 gene locus_tag LOCUS_20030 148484 151777 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_20030 151797 153464 gene locus_tag LOCUS_20040 151797 153464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 153551 155809 gene locus_tag LOCUS_20050 153551 155809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202044.1 protein_id gnl|my_center|LOCUS_20050 155809 158235 gene locus_tag LOCUS_20060 155809 158235 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_20060 158353 158517 gene locus_tag LOCUS_20070 158353 158517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 158551 159114 gene locus_tag LOCUS_20080 158551 159114 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948694.1 protein_id gnl|my_center|LOCUS_20080 159179 161575 gene locus_tag LOCUS_20090 159179 161575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 161572 163176 gene locus_tag LOCUS_20100 161572 163176 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_20100 163262 164842 gene locus_tag LOCUS_20110 163262 164842 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_20110 164956 167361 gene locus_tag LOCUS_20120 164956 167361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 167427 169673 gene locus_tag LOCUS_20130 167427 169673 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_20130 169759 172065 gene locus_tag LOCUS_20140 169759 172065 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203126.1 protein_id gnl|my_center|LOCUS_20140 172101 173516 gene locus_tag LOCUS_20150 172101 173516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 173637 175427 gene locus_tag LOCUS_20160 173637 175427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_20160 175523 177580 gene locus_tag LOCUS_20170 175523 177580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 181137 177823 gene locus_tag LOCUS_20180 181137 177823 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_20180 182068 185091 gene locus_tag LOCUS_20190 182068 185091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_20190 185175 186824 gene locus_tag LOCUS_20200 185175 186824 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 protein_id gnl|my_center|LOCUS_20200 187007 189121 gene locus_tag LOCUS_20210 187007 189121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 189127 192276 gene locus_tag LOCUS_20220 189127 192276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 192287 194176 gene locus_tag LOCUS_20230 192287 194176 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766740.1 protein_id gnl|my_center|LOCUS_20230 194190 197078 gene locus_tag LOCUS_20240 194190 197078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 197197 199071 gene locus_tag LOCUS_20250 197197 199071 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_20250 199465 200283 gene locus_tag LOCUS_20260 199465 200283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_20260 200338 201558 gene locus_tag LOCUS_20270 gene uxuA 200338 201558 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_20270 202979 202362 gene locus_tag LOCUS_20280 202979 202362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 203605 203156 gene locus_tag LOCUS_20290 203605 203156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 205159 203762 gene locus_tag LOCUS_20300 gene mnmE 205159 203762 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_20300 206056 205172 gene locus_tag LOCUS_20310 206056 205172 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_20310 206298 207419 gene locus_tag LOCUS_20320 206298 207419 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105217984.1 protein_id gnl|my_center|LOCUS_20320 207677 208423 gene locus_tag LOCUS_20330 gene fabG 207677 208423 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_20330 208505 209362 gene locus_tag LOCUS_20340 208505 209362 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_20340 209626 211521 gene locus_tag LOCUS_20350 209626 211521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 211639 212685 gene locus_tag LOCUS_20360 211639 212685 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_20360 213073 212711 gene locus_tag LOCUS_20370 213073 212711 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458981.1 protein_id gnl|my_center|LOCUS_20370 213156 213710 gene locus_tag LOCUS_20380 213156 213710 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_20380 213725 214279 gene locus_tag LOCUS_20390 213725 214279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789211.1 protein_id gnl|my_center|LOCUS_20390 215179 214400 gene locus_tag LOCUS_20400 215179 214400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 217802 215385 gene locus_tag LOCUS_20410 217802 215385 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_20410 219616 218081 gene locus_tag LOCUS_20420 219616 218081 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_20420 220137 219628 gene locus_tag LOCUS_20430 220137 219628 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766266.1 protein_id gnl|my_center|LOCUS_20430 221664 220150 gene locus_tag LOCUS_20440 gene accC 221664 220150 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_20440 221867 224497 gene locus_tag LOCUS_20450 221867 224497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 224668 225933 gene locus_tag LOCUS_20460 224668 225933 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_20460 226389 227441 gene locus_tag LOCUS_20470 226389 227441 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013216.1 protein_id gnl|my_center|LOCUS_20470 227448 228443 gene locus_tag LOCUS_20480 227448 228443 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 protein_id gnl|my_center|LOCUS_20480 230984 228453 gene locus_tag LOCUS_20490 230984 228453 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_20490 231277 233811 gene locus_tag LOCUS_20500 gene gyrA 231277 233811 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_20500 233873 235093 gene locus_tag LOCUS_20510 233873 235093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 236232 235753 gene locus_tag LOCUS_20520 236232 235753 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_20520 236890 236384 gene locus_tag LOCUS_20530 236890 236384 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766151.1 protein_id gnl|my_center|LOCUS_20530 238945 236903 gene locus_tag LOCUS_20540 238945 236903 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766152.1 protein_id gnl|my_center|LOCUS_20540 240304 238970 gene locus_tag LOCUS_20550 240304 238970 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_20550 240943 240491 gene locus_tag LOCUS_20560 240943 240491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 242344 241037 gene locus_tag LOCUS_20570 242344 241037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 243279 242368 gene locus_tag LOCUS_20580 243279 242368 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_20580 244082 243273 gene locus_tag LOCUS_20590 244082 243273 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_20590 244588 244172 gene locus_tag LOCUS_20600 244588 244172 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_20600 245589 246791 gene locus_tag LOCUS_20610 245589 246791 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_20610 249653 246783 gene locus_tag LOCUS_20620 249653 246783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_20620 250627 249935 gene locus_tag LOCUS_20630 250627 249935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 250806 251741 gene locus_tag LOCUS_20640 250806 251741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 252001 254004 gene locus_tag LOCUS_20650 252001 254004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_20650 254183 255148 gene locus_tag LOCUS_20660 254183 255148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 256226 255417 gene locus_tag LOCUS_20670 gene lgt 256226 255417 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_20670 259559 256239 gene locus_tag LOCUS_20680 gene secA 259559 256239 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_20680 259933 260115 gene locus_tag LOCUS_20690 259933 260115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 260647 260177 gene locus_tag LOCUS_20700 260647 260177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 262022 260883 gene locus_tag LOCUS_20710 262022 260883 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_20710 262735 262205 gene locus_tag LOCUS_20720 262735 262205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 263471 262887 gene locus_tag LOCUS_20730 263471 262887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 264212 263628 gene locus_tag LOCUS_20740 264212 263628 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_20740 264469 264660 gene locus_tag LOCUS_20750 264469 264660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 265643 264690 gene locus_tag LOCUS_20760 265643 264690 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_20760 267165 265900 gene locus_tag LOCUS_20770 gene odhB 267165 265900 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_20770 269905 267173 gene locus_tag LOCUS_20780 269905 267173 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_20780 270253 271245 gene locus_tag LOCUS_20790 270253 271245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 272648 271356 gene locus_tag LOCUS_20800 gene rimO 272648 271356 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_20800 273763 272813 gene locus_tag LOCUS_20810 gene ftsY 273763 272813 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_20810 274628 273858 gene locus_tag LOCUS_20820 274628 273858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 274726 276033 gene locus_tag LOCUS_20830 274726 276033 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764634.1 protein_id gnl|my_center|LOCUS_20830 276039 276818 gene locus_tag LOCUS_20840 276039 276818 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804815.1 protein_id gnl|my_center|LOCUS_20840 277074 276922 gene locus_tag LOCUS_20850 277074 276922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 277266 277084 gene locus_tag LOCUS_20860 gene rpmG 277266 277084 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_20860 277520 277278 gene locus_tag LOCUS_20870 gene rpmB 277520 277278 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_20870 277819 278463 gene locus_tag LOCUS_20880 277819 278463 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_20880 278565 279383 gene locus_tag LOCUS_20890 278565 279383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 279398 279874 gene locus_tag LOCUS_20900 279398 279874 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_20900 280651 279980 gene locus_tag LOCUS_20910 gene ribB 280651 279980 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047977.1 protein_id gnl|my_center|LOCUS_20910 282299 281058 gene locus_tag LOCUS_20920 gene codB 282299 281058 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 protein_id gnl|my_center|LOCUS_20920 283319 282324 gene locus_tag LOCUS_20930 283319 282324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 285023 283761 gene locus_tag LOCUS_20940 285023 283761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 286465 285098 gene locus_tag LOCUS_20950 286465 285098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 288056 286485 gene locus_tag LOCUS_20960 288056 286485 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_20960 291670 288122 gene locus_tag LOCUS_20970 291670 288122 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_20970 292943 291768 gene locus_tag LOCUS_20980 292943 291768 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_20980 293621 293049 gene locus_tag LOCUS_20990 293621 293049 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_20990 294142 295062 gene locus_tag LOCUS_21000 294142 295062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 295830 295030 gene locus_tag LOCUS_21010 295830 295030 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_21010 297039 296053 gene locus_tag LOCUS_21020 297039 296053 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_21020 298162 297941 gene locus_tag LOCUS_21030 298162 297941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 299067 298267 gene locus_tag LOCUS_21040 299067 298267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 299377 299141 gene locus_tag LOCUS_21050 299377 299141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 299652 300341 gene locus_tag LOCUS_21060 299652 300341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 300807 302708 gene locus_tag LOCUS_21070 gene ftsH 300807 302708 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931821.1 protein_id gnl|my_center|LOCUS_21070 304171 302726 gene locus_tag LOCUS_21080 304171 302726 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_21080 305354 304317 gene locus_tag LOCUS_21090 305354 304317 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902656.1 protein_id gnl|my_center|LOCUS_21090 306006 305365 gene locus_tag LOCUS_21100 306006 305365 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_21100 306972 306097 gene locus_tag LOCUS_21110 gene hchA 306972 306097 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093269.1 protein_id gnl|my_center|LOCUS_21110 308162 307203 gene locus_tag LOCUS_21120 308162 307203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 309041 309373 gene locus_tag LOCUS_21130 309041 309373 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_21130 309385 311628 gene locus_tag LOCUS_21140 309385 311628 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_21140 312208 313194 gene locus_tag LOCUS_21150 312208 313194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 313205 315610 gene locus_tag LOCUS_21160 313205 315610 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_21160 315642 317822 gene locus_tag LOCUS_21170 315642 317822 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_21170 318085 318777 gene locus_tag LOCUS_21180 318085 318777 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_21180 318814 319023 gene locus_tag LOCUS_21190 318814 319023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 320159 319122 gene locus_tag LOCUS_21200 320159 319122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 321535 322536 gene locus_tag LOCUS_21210 321535 322536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 322571 323332 gene locus_tag LOCUS_21220 322571 323332 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_21220 323705 323433 gene locus_tag LOCUS_21230 323705 323433 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_21230 325216 324032 gene locus_tag LOCUS_21240 325216 324032 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_21240 325791 325219 gene locus_tag LOCUS_21250 325791 325219 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_21250 326420 325794 gene locus_tag LOCUS_21260 326420 325794 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_21260 328393 326477 gene locus_tag LOCUS_21270 328393 326477 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_21270 328552 330024 gene locus_tag LOCUS_21280 gene guaB 328552 330024 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_21280 330074 332035 gene locus_tag LOCUS_21290 330074 332035 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_21290 332032 332883 gene locus_tag LOCUS_21300 332032 332883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 332890 334233 gene locus_tag LOCUS_21310 332890 334233 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_21310 334382 335344 gene locus_tag LOCUS_21320 334382 335344 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_21320 335355 336887 gene locus_tag LOCUS_21330 335355 336887 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_21330 337149 336928 gene locus_tag LOCUS_21340 337149 336928 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_21340 337804 337238 gene locus_tag LOCUS_21350 337804 337238 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_21350 338514 337804 gene locus_tag LOCUS_21360 338514 337804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_21360 338750 340849 gene locus_tag LOCUS_21370 gene recG 338750 340849 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172726565.1 protein_id gnl|my_center|LOCUS_21370 341162 341578 gene locus_tag LOCUS_21380 341162 341578 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793421.1 protein_id gnl|my_center|LOCUS_21380 341584 342516 gene locus_tag LOCUS_21390 341584 342516 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_21390 342526 343857 gene locus_tag LOCUS_21400 gene rsxC 342526 343857 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_21400 343889 344872 gene locus_tag LOCUS_21410 343889 344872 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_21410 344872 345504 gene locus_tag LOCUS_21420 344872 345504 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_21420 345501 346085 gene locus_tag LOCUS_21430 345501 346085 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_21430 346097 346669 gene locus_tag LOCUS_21440 gene rsxA 346097 346669 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_21440 347539 347096 gene locus_tag LOCUS_21450 347539 347096 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_21450 350981 347634 gene locus_tag LOCUS_21460 350981 347634 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_21460 352554 351307 gene locus_tag LOCUS_21470 352554 351307 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139375234.1 protein_id gnl|my_center|LOCUS_21470 355303 352763 gene locus_tag LOCUS_21480 355303 352763 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence13 <1 974 gene locus_tag LOCUS_21490 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767035.1:alpha-L-fucosidase 1121 2656 gene locus_tag LOCUS_21500 1121 2656 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555683.1 protein_id gnl|my_center|LOCUS_21500 3099 4661 gene locus_tag LOCUS_21510 3099 4661 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_21510 4846 6690 gene locus_tag LOCUS_21520 4846 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 6863 8269 gene locus_tag LOCUS_21530 6863 8269 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_21530 8397 9953 gene locus_tag LOCUS_21540 8397 9953 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_21540 10433 10023 gene locus_tag LOCUS_21550 gene rnk 10433 10023 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_21550 11022 10609 gene locus_tag LOCUS_21560 gene rnk 11022 10609 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_21560 11323 12021 gene locus_tag LOCUS_21570 11323 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12863 12111 gene locus_tag LOCUS_21580 12863 12111 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_21580 12997 16239 gene locus_tag LOCUS_21590 12997 16239 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_21590 16354 17835 gene locus_tag LOCUS_21600 gene nanU 16354 17835 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_21600 18026 19621 gene locus_tag LOCUS_21610 18026 19621 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786655.1 protein_id gnl|my_center|LOCUS_21610 19713 21680 gene locus_tag LOCUS_21620 19713 21680 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_21620 21701 22627 gene locus_tag LOCUS_21630 21701 22627 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_21630 22632 23801 gene locus_tag LOCUS_21640 22632 23801 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_21640 24174 26843 gene locus_tag LOCUS_21650 24174 26843 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_21650 27751 26987 gene locus_tag LOCUS_21660 gene agaR 27751 26987 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423633.1 protein_id gnl|my_center|LOCUS_21660 28010 29575 gene locus_tag LOCUS_21670 28010 29575 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_21670 29703 30530 gene locus_tag LOCUS_21680 29703 30530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 30596 31831 gene locus_tag LOCUS_21690 30596 31831 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231439.1 protein_id gnl|my_center|LOCUS_21690 31851 33167 gene locus_tag LOCUS_21700 31851 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 33173 34045 gene locus_tag LOCUS_21710 33173 34045 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_21710 34051 35694 gene locus_tag LOCUS_21720 gene araB 34051 35694 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951864.1 protein_id gnl|my_center|LOCUS_21720 35704 37836 gene locus_tag LOCUS_21730 35704 37836 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_21730 37889 39223 gene locus_tag LOCUS_21740 37889 39223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883303.1 protein_id gnl|my_center|LOCUS_21740 39228 39929 gene locus_tag LOCUS_21750 39228 39929 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_21750 40101 41024 gene locus_tag LOCUS_21760 40101 41024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 41021 41662 gene locus_tag LOCUS_21770 41021 41662 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 protein_id gnl|my_center|LOCUS_21770 41758 42552 gene locus_tag LOCUS_21780 41758 42552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869614.1 protein_id gnl|my_center|LOCUS_21780 42590 43288 gene locus_tag LOCUS_21790 42590 43288 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_21790 43291 43962 gene locus_tag LOCUS_21800 43291 43962 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_21800 44070 44753 gene locus_tag LOCUS_21810 44070 44753 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_21810 44750 46681 gene locus_tag LOCUS_21820 44750 46681 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841441.1 protein_id gnl|my_center|LOCUS_21820 48807 46702 gene locus_tag LOCUS_21830 48807 46702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 49279 48932 gene locus_tag LOCUS_21840 49279 48932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 50548 49607 gene locus_tag LOCUS_21850 50548 49607 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_21850 50706 51317 gene locus_tag LOCUS_21860 50706 51317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 52821 51355 gene locus_tag LOCUS_21870 52821 51355 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_21870 52919 55069 gene locus_tag LOCUS_21880 gene htpG 52919 55069 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_21880 55670 55191 gene locus_tag LOCUS_21890 55670 55191 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_21890 57167 55890 gene locus_tag LOCUS_21900 57167 55890 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_21900 57339 58622 gene locus_tag LOCUS_21910 57339 58622 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_21910 59077 58739 gene locus_tag LOCUS_21920 59077 58739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 59327 59902 gene locus_tag LOCUS_21930 59327 59902 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_21930 59921 60346 gene locus_tag LOCUS_21940 59921 60346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 61328 60372 gene locus_tag LOCUS_21950 61328 60372 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_21950 62425 61502 gene locus_tag LOCUS_21960 62425 61502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 62583 62897 gene locus_tag LOCUS_21970 62583 62897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 63707 63096 gene locus_tag LOCUS_21980 63707 63096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 64307 63927 gene locus_tag LOCUS_21990 64307 63927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 65778 64411 gene locus_tag LOCUS_22000 65778 64411 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 protein_id gnl|my_center|LOCUS_22000 66777 66118 gene locus_tag LOCUS_22010 66777 66118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 67932 67231 gene locus_tag LOCUS_22020 67932 67231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 68667 67999 gene locus_tag LOCUS_22030 68667 67999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 69708 69130 gene locus_tag LOCUS_22040 69708 69130 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193598.1 protein_id gnl|my_center|LOCUS_22040 70619 69897 gene locus_tag LOCUS_22050 70619 69897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 71231 70641 gene locus_tag LOCUS_22060 71231 70641 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681215.1 protein_id gnl|my_center|LOCUS_22060 71701 71312 gene locus_tag LOCUS_22070 71701 71312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 72544 71825 gene locus_tag LOCUS_22080 72544 71825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 73240 72620 gene locus_tag LOCUS_22090 73240 72620 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814942.1 protein_id gnl|my_center|LOCUS_22090 74513 74151 gene locus_tag LOCUS_22100 74513 74151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 75306 74608 gene locus_tag LOCUS_22110 75306 74608 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_22110 76002 75391 gene locus_tag LOCUS_22120 76002 75391 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_22120 76726 76067 gene locus_tag LOCUS_22130 gene mnmD 76726 76067 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_22130 76867 77481 gene locus_tag LOCUS_22140 76867 77481 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_22140 79036 77588 gene locus_tag LOCUS_22150 79036 77588 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_22150 80383 79049 gene locus_tag LOCUS_22160 gene trkA 80383 79049 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_22160 81990 80512 gene locus_tag LOCUS_22170 81990 80512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 83160 82600 gene locus_tag LOCUS_22180 gene def 83160 82600 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_22180 83579 83157 gene locus_tag LOCUS_22190 gene ruvX 83579 83157 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_22190 84385 83993 gene locus_tag LOCUS_22200 84385 83993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 85142 84609 gene locus_tag LOCUS_22210 gene pncA 85142 84609 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_22210 86591 85170 gene locus_tag LOCUS_22220 86591 85170 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957965.1 protein_id gnl|my_center|LOCUS_22220 86917 87342 gene locus_tag LOCUS_22230 86917 87342 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_22230 90181 87470 gene locus_tag LOCUS_22240 gene ppdK 90181 87470 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_22240 91000 93588 gene locus_tag LOCUS_22250 gene clpB 91000 93588 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_22250 94095 93718 gene locus_tag LOCUS_22260 94095 93718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 94310 94089 gene locus_tag LOCUS_22270 94310 94089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 94415 95506 gene locus_tag LOCUS_22280 gene gcvT 94415 95506 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764743.1 protein_id gnl|my_center|LOCUS_22280 95754 96503 gene locus_tag LOCUS_22290 95754 96503 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_22290 96536 96727 gene locus_tag LOCUS_22300 96536 96727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 96780 97856 gene locus_tag LOCUS_22310 gene serC 96780 97856 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_22310 97973 98929 gene locus_tag LOCUS_22320 97973 98929 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_22320 99087 100337 gene locus_tag LOCUS_22330 99087 100337 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_22330 103654 100418 gene locus_tag LOCUS_22340 gene carB 103654 100418 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_22340 104761 103670 gene locus_tag LOCUS_22350 gene carA 104761 103670 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_22350 105012 105494 gene locus_tag LOCUS_22360 105012 105494 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_22360 105514 106227 gene locus_tag LOCUS_22370 105514 106227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 106373 107566 gene locus_tag LOCUS_22380 106373 107566 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_22380 107582 108550 gene locus_tag LOCUS_22390 gene argC 107582 108550 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_22390 108554 109705 gene locus_tag LOCUS_22400 108554 109705 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_22400 109718 110515 gene locus_tag LOCUS_22410 gene proC 109718 110515 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_22410 110527 111618 gene locus_tag LOCUS_22420 gene proB 110527 111618 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_22420 111758 113008 gene locus_tag LOCUS_22430 111758 113008 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_22430 113137 114087 gene locus_tag LOCUS_22440 113137 114087 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_22440 114160 114936 gene locus_tag LOCUS_22450 gene argB 114160 114936 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_22450 115663 115004 gene locus_tag LOCUS_22460 115663 115004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 116491 118281 gene locus_tag LOCUS_22470 116491 118281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 118394 118657 gene locus_tag LOCUS_22480 118394 118657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 118872 119525 gene locus_tag LOCUS_22490 118872 119525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 120688 119609 gene locus_tag LOCUS_22500 120688 119609 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_22500 121819 120713 gene locus_tag LOCUS_22510 121819 120713 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_22510 122282 121812 gene locus_tag LOCUS_22520 122282 121812 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_22520 123648 122329 gene locus_tag LOCUS_22530 gene gntT 123648 122329 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369355.1 protein_id gnl|my_center|LOCUS_22530 124918 123914 gene locus_tag LOCUS_22540 124918 123914 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_22540 126221 124911 gene locus_tag LOCUS_22550 126221 124911 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_22550 128396 126966 gene locus_tag LOCUS_22560 128396 126966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 130571 128679 gene locus_tag LOCUS_22570 gene speA 130571 128679 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_22570 131803 130751 gene locus_tag LOCUS_22580 gene arsB 131803 130751 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_22580 132178 131807 gene locus_tag LOCUS_22590 132178 131807 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_22590 132621 132283 gene locus_tag LOCUS_22600 132621 132283 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_22600 133050 134438 gene locus_tag LOCUS_22610 133050 134438 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_22610 136543 134636 gene locus_tag LOCUS_22620 136543 134636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 139632 136555 gene locus_tag LOCUS_22630 139632 136555 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_22630 140975 139734 gene locus_tag LOCUS_22640 140975 139734 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_22640 143521 141710 gene locus_tag LOCUS_22650 143521 141710 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_22650 146975 143586 gene locus_tag LOCUS_22660 146975 143586 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_22660 148252 147044 gene locus_tag LOCUS_22670 148252 147044 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454586.1 protein_id gnl|my_center|LOCUS_22670 148400 148239 gene locus_tag LOCUS_22680 148400 148239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 150247 148850 gene locus_tag LOCUS_22690 150247 148850 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_22690 152063 150363 gene locus_tag LOCUS_22700 152063 150363 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_22700 155178 152083 gene locus_tag LOCUS_22710 155178 152083 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714627.1 protein_id gnl|my_center|LOCUS_22710 156469 155225 gene locus_tag LOCUS_22720 156469 155225 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_22720 157329 156940 gene locus_tag LOCUS_22730 157329 156940 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818669.1 protein_id gnl|my_center|LOCUS_22730 157519 158343 gene locus_tag LOCUS_22740 gene surE 157519 158343 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_22740 158343 158645 gene locus_tag LOCUS_22750 158343 158645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 159318 159040 gene locus_tag LOCUS_22760 159318 159040 CDS product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057927.1 protein_id gnl|my_center|LOCUS_22760 159509 160642 gene locus_tag LOCUS_22770 gene lpxB 159509 160642 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_22770 160682 163096 gene locus_tag LOCUS_22780 160682 163096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 163227 164357 gene locus_tag LOCUS_22790 gene dnaN 163227 164357 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_22790 164474 165277 gene locus_tag LOCUS_22800 164474 165277 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_22800 165328 165942 gene locus_tag LOCUS_22810 165328 165942 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_22810 167867 166323 gene locus_tag LOCUS_22820 167867 166323 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_22820 169344 167983 gene locus_tag LOCUS_22830 169344 167983 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_22830 170486 169443 gene locus_tag LOCUS_22840 170486 169443 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_22840 171358 170525 gene locus_tag LOCUS_22850 171358 170525 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_22850 172412 171459 gene locus_tag LOCUS_22860 172412 171459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 174023 172791 gene locus_tag LOCUS_22870 gene hydF 174023 172791 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_22870 174434 174216 gene locus_tag LOCUS_22880 174434 174216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 175943 174543 gene locus_tag LOCUS_22890 175943 174543 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_22890 177376 175979 gene locus_tag LOCUS_22900 gene hydG 177376 175979 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_22900 177635 177381 gene locus_tag LOCUS_22910 177635 177381 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_22910 177986 178525 gene locus_tag LOCUS_22920 177986 178525 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_22920 178604 179590 gene locus_tag LOCUS_22930 178604 179590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 179670 183044 gene locus_tag LOCUS_22940 179670 183044 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_22940 183074 184510 gene locus_tag LOCUS_22950 183074 184510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 184741 186069 gene locus_tag LOCUS_22960 184741 186069 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_22960 186153 186467 gene locus_tag LOCUS_22970 186153 186467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 186867 188765 gene locus_tag LOCUS_22980 186867 188765 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_22980 188950 190260 gene locus_tag LOCUS_22990 188950 190260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 190492 191787 gene locus_tag LOCUS_23000 190492 191787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 191813 193027 gene locus_tag LOCUS_23010 191813 193027 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_23010 193311 194528 gene locus_tag LOCUS_23020 193311 194528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 194636 195235 gene locus_tag LOCUS_23030 194636 195235 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_23030 195462 196478 gene locus_tag LOCUS_23040 195462 196478 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766780.1 protein_id gnl|my_center|LOCUS_23040 196635 199964 gene locus_tag LOCUS_23050 196635 199964 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_23050 199991 201580 gene locus_tag LOCUS_23060 199991 201580 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_23060 201799 203373 gene locus_tag LOCUS_23070 201799 203373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 203478 205019 gene locus_tag LOCUS_23080 203478 205019 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 protein_id gnl|my_center|LOCUS_23080 205355 205939 gene locus_tag LOCUS_23090 205355 205939 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_23090 206010 207038 gene locus_tag LOCUS_23100 206010 207038 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_23100 207190 210504 gene locus_tag LOCUS_23110 207190 210504 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_23110 210528 212012 gene locus_tag LOCUS_23120 210528 212012 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_23120 212268 213236 gene locus_tag LOCUS_23130 212268 213236 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762717.1 protein_id gnl|my_center|LOCUS_23130 213476 214795 gene locus_tag LOCUS_23140 213476 214795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 214826 215410 gene locus_tag LOCUS_23150 214826 215410 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_23150 215852 216904 gene locus_tag LOCUS_23160 215852 216904 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766780.1 protein_id gnl|my_center|LOCUS_23160 217117 220506 gene locus_tag LOCUS_23170 217117 220506 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_23170 220555 222252 gene locus_tag LOCUS_23180 220555 222252 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_23180 222389 224518 gene locus_tag LOCUS_23190 222389 224518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 224788 225471 gene locus_tag LOCUS_23200 224788 225471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 225549 226130 gene locus_tag LOCUS_23210 225549 226130 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_23210 226194 227174 gene locus_tag LOCUS_23220 226194 227174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 227430 230744 gene locus_tag LOCUS_23230 227430 230744 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303190.1 protein_id gnl|my_center|LOCUS_23230 230896 232641 gene locus_tag LOCUS_23240 230896 232641 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109220.1 protein_id gnl|my_center|LOCUS_23240 232710 234293 gene locus_tag LOCUS_23250 232710 234293 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_23250 234486 236774 gene locus_tag LOCUS_23260 234486 236774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 237028 238233 gene locus_tag LOCUS_23270 237028 238233 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_23270 238346 239437 gene locus_tag LOCUS_23280 238346 239437 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_23280 239882 239472 gene locus_tag LOCUS_23290 239882 239472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 240990 239977 gene locus_tag LOCUS_23300 240990 239977 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_23300 241220 242554 gene locus_tag LOCUS_23310 241220 242554 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713980.1 protein_id gnl|my_center|LOCUS_23310 243827 242619 gene locus_tag LOCUS_23320 243827 242619 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_23320 245347 244049 gene locus_tag LOCUS_23330 245347 244049 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188734295.1 protein_id gnl|my_center|LOCUS_23330 246839 245367 gene locus_tag LOCUS_23340 246839 245367 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_23340 247029 252350 gene locus_tag LOCUS_23350 247029 252350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 252369 253217 gene locus_tag LOCUS_23360 gene lgt 252369 253217 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_23360 253600 253289 gene locus_tag LOCUS_23370 gene trxA 253600 253289 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_23370 253811 253584 gene locus_tag LOCUS_23380 253811 253584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 254011 253938 gene locus_tag LOCUS_t00240 254011 253938 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 254116 254033 gene locus_tag LOCUS_t00250 254116 254033 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 254316 254242 gene locus_tag LOCUS_t00260 254316 254242 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 254632 255183 gene locus_tag LOCUS_23390 254632 255183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 255302 256255 gene locus_tag LOCUS_23400 255302 256255 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_23400 257129 256287 gene locus_tag LOCUS_23410 257129 256287 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_23410 258326 257265 gene locus_tag LOCUS_23420 258326 257265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 258569 259909 gene locus_tag LOCUS_23430 258569 259909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447207.1 protein_id gnl|my_center|LOCUS_23430 259999 261447 gene locus_tag LOCUS_23440 259999 261447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 262166 261444 gene locus_tag LOCUS_23450 262166 261444 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_23450 262169 262354 gene locus_tag LOCUS_23460 262169 262354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 262347 263732 gene locus_tag LOCUS_23470 262347 263732 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_23470 264155 263769 gene locus_tag LOCUS_23480 264155 263769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 264412 265545 gene locus_tag LOCUS_23490 264412 265545 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_23490 266864 265542 gene locus_tag LOCUS_23500 266864 265542 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_23500 268686 267046 gene locus_tag LOCUS_23510 gene sulP 268686 267046 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_23510 270445 268889 gene locus_tag LOCUS_23520 270445 268889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 271500 270877 gene locus_tag LOCUS_23530 271500 270877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 271560 272015 gene locus_tag LOCUS_23540 271560 272015 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574503.1 protein_id gnl|my_center|LOCUS_23540 274029 274337 gene locus_tag LOCUS_23550 274029 274337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 274339 275559 gene locus_tag LOCUS_23560 274339 275559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence14 810 1 gene locus_tag LOCUS_23570 810 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2458 953 gene locus_tag LOCUS_23580 2458 953 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_23580 3897 2587 gene locus_tag LOCUS_23590 3897 2587 CDS product DUF1735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107270.1 protein_id gnl|my_center|LOCUS_23590 5829 4000 gene locus_tag LOCUS_23600 5829 4000 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107269.1 protein_id gnl|my_center|LOCUS_23600 9056 5841 gene locus_tag LOCUS_23610 9056 5841 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_23610 10511 9339 gene locus_tag LOCUS_23620 10511 9339 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_23620 11199 10609 gene locus_tag LOCUS_23630 11199 10609 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_23630 12307 11501 gene locus_tag LOCUS_23640 gene thiD 12307 11501 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_23640 13325 12324 gene locus_tag LOCUS_23650 gene thiL 13325 12324 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816909.1 protein_id gnl|my_center|LOCUS_23650 14039 13392 gene locus_tag LOCUS_23660 gene tenA 14039 13392 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 protein_id gnl|my_center|LOCUS_23660 14673 14044 gene locus_tag LOCUS_23670 gene thiE 14673 14044 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482839.1 protein_id gnl|my_center|LOCUS_23670 15470 14676 gene locus_tag LOCUS_23680 gene thiM 15470 14676 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_23680 17427 15754 gene locus_tag LOCUS_23690 17427 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 18777 17548 gene locus_tag LOCUS_23700 18777 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 19193 19876 gene locus_tag LOCUS_23710 gene aqpZ 19193 19876 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460095.1 protein_id gnl|my_center|LOCUS_23710 19952 20452 gene locus_tag LOCUS_23720 19952 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 20545 21849 gene locus_tag LOCUS_23730 20545 21849 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_23730 22195 22968 gene locus_tag LOCUS_23740 22195 22968 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_23740 23033 24082 gene locus_tag LOCUS_23750 gene rsgA 23033 24082 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107648.1 protein_id gnl|my_center|LOCUS_23750 24747 25655 gene locus_tag LOCUS_23760 24747 25655 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205484.1 protein_id gnl|my_center|LOCUS_23760 25717 26493 gene locus_tag LOCUS_23770 25717 26493 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_23770 27275 27200 gene locus_tag LOCUS_t00270 27275 27200 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27571 28374 gene locus_tag LOCUS_23780 27571 28374 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_23780 28380 28790 gene locus_tag LOCUS_23790 gene ybgC 28380 28790 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091290.1 protein_id gnl|my_center|LOCUS_23790 29418 28780 gene locus_tag LOCUS_23800 29418 28780 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_23800 29659 30519 gene locus_tag LOCUS_23810 29659 30519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 30519 31049 gene locus_tag LOCUS_23820 30519 31049 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_23820 31042 32826 gene locus_tag LOCUS_23830 31042 32826 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_23830 34630 32903 gene locus_tag LOCUS_23840 gene rho 34630 32903 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_23840 34994 35860 gene locus_tag LOCUS_23850 34994 35860 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_23850 35935 36588 gene locus_tag LOCUS_23860 gene rpe 35935 36588 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_23860 39204 36835 gene locus_tag LOCUS_23870 gene feoB 39204 36835 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_23870 39435 40160 gene locus_tag LOCUS_23880 39435 40160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 40160 40456 gene locus_tag LOCUS_23890 40160 40456 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647661.1 protein_id gnl|my_center|LOCUS_23890 40522 40596 gene locus_tag LOCUS_t00280 40522 40596 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41578 42660 gene locus_tag LOCUS_23900 41578 42660 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201912.1 protein_id gnl|my_center|LOCUS_23900 42873 46292 gene locus_tag LOCUS_23910 42873 46292 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_23910 46305 48200 gene locus_tag LOCUS_23920 46305 48200 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107269.1 protein_id gnl|my_center|LOCUS_23920 48264 49586 gene locus_tag LOCUS_23930 48264 49586 CDS product DUF1735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109174.1 protein_id gnl|my_center|LOCUS_23930 49722 52262 gene locus_tag LOCUS_23940 49722 52262 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798674.1 protein_id gnl|my_center|LOCUS_23940 52294 53589 gene locus_tag LOCUS_23950 52294 53589 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_23950 54199 53525 gene locus_tag LOCUS_23960 54199 53525 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_23960 55156 54512 gene locus_tag LOCUS_23970 55156 54512 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_23970 55438 56217 gene locus_tag LOCUS_23980 gene mazG 55438 56217 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_23980 56496 56260 gene locus_tag LOCUS_23990 56496 56260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 57407 56577 gene locus_tag LOCUS_24000 57407 56577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 57485 58609 gene locus_tag LOCUS_24010 57485 58609 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_24010 58840 60183 gene locus_tag LOCUS_24020 58840 60183 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_24020 60426 60268 gene locus_tag LOCUS_24030 60426 60268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 61608 60490 gene locus_tag LOCUS_24040 61608 60490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24040 61938 62405 gene locus_tag LOCUS_24050 61938 62405 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_24050 63159 62395 gene locus_tag LOCUS_24060 gene rlmB 63159 62395 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_24060 65110 63161 gene locus_tag LOCUS_24070 65110 63161 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799194.1 protein_id gnl|my_center|LOCUS_24070 65343 66752 gene locus_tag LOCUS_24080 gene rlmD 65343 66752 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_24080 66805 67572 gene locus_tag LOCUS_24090 gene yaaA 66805 67572 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_24090 68643 67678 gene locus_tag LOCUS_24100 gene rfaD 68643 67678 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_24100 69012 69635 gene locus_tag LOCUS_24110 gene folE 69012 69635 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_24110 69877 70707 gene locus_tag LOCUS_24120 69877 70707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 70809 73973 gene locus_tag LOCUS_24130 70809 73973 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_24130 75089 73977 gene locus_tag LOCUS_24140 75089 73977 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_24140 76061 75201 gene locus_tag LOCUS_24150 76061 75201 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_24150 77622 76177 gene locus_tag LOCUS_24160 77622 76177 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_24160 78020 79957 gene locus_tag LOCUS_24170 78020 79957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 80514 79975 gene locus_tag LOCUS_24180 80514 79975 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026207845.1 protein_id gnl|my_center|LOCUS_24180 81563 80616 gene locus_tag LOCUS_24190 81563 80616 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_24190 82558 81560 gene locus_tag LOCUS_24200 82558 81560 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_24200 84135 82669 gene locus_tag LOCUS_24210 gene dacB 84135 82669 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_24210 84235 84618 gene locus_tag LOCUS_24220 gene crcB 84235 84618 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_24220 84986 85312 gene locus_tag LOCUS_24230 84986 85312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 85415 85741 gene locus_tag LOCUS_24240 85415 85741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 85958 87301 gene locus_tag LOCUS_24250 85958 87301 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_24250 87651 87298 gene locus_tag LOCUS_24260 87651 87298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 88002 88367 gene locus_tag LOCUS_24270 88002 88367 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_24270 90391 88364 gene locus_tag LOCUS_24280 90391 88364 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_24280 91265 90474 gene locus_tag LOCUS_24290 91265 90474 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_24290 93725 91269 gene locus_tag LOCUS_24300 93725 91269 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_24300 93782 94195 gene locus_tag LOCUS_24310 93782 94195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 94859 94206 gene locus_tag LOCUS_24320 94859 94206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 95079 96317 gene locus_tag LOCUS_24330 95079 96317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 98634 96442 gene locus_tag LOCUS_24340 98634 96442 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_24340 98823 99887 gene locus_tag LOCUS_24350 98823 99887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 100037 101986 gene locus_tag LOCUS_24360 gene thrS 100037 101986 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_24360 102050 102571 gene locus_tag LOCUS_24370 gene infC 102050 102571 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_24370 102897 103241 gene locus_tag LOCUS_24380 gene rplT 102897 103241 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_24380 103862 103323 gene locus_tag LOCUS_24390 103862 103323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 104114 105370 gene locus_tag LOCUS_24400 104114 105370 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_24400 105499 107292 gene locus_tag LOCUS_24410 gene argS 105499 107292 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_24410 107733 109061 gene locus_tag LOCUS_24420 gene ffh 107733 109061 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_24420 109082 109957 gene locus_tag LOCUS_24430 gene folD 109082 109957 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_24430 110047 110862 gene locus_tag LOCUS_24440 110047 110862 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_24440 110979 111371 gene locus_tag LOCUS_24450 110979 111371 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_24450 112165 111425 gene locus_tag LOCUS_24460 gene djlA 112165 111425 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_24460 112745 112158 gene locus_tag LOCUS_24470 gene coaE 112745 112158 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_24470 113655 112750 gene locus_tag LOCUS_24480 113655 112750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 114130 113816 gene locus_tag LOCUS_24490 gene yajC 114130 113816 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_24490 114577 114143 gene locus_tag LOCUS_24500 114577 114143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 115536 114574 gene locus_tag LOCUS_24510 gene nusB 115536 114574 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_24510 116326 115604 gene locus_tag LOCUS_24520 116326 115604 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759973.1 protein_id gnl|my_center|LOCUS_24520 117349 116327 gene locus_tag LOCUS_24530 117349 116327 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_24530 117412 117606 gene locus_tag LOCUS_24540 117412 117606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 117767 119071 gene locus_tag LOCUS_24550 117767 119071 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_24550 119712 119170 gene locus_tag LOCUS_24560 119712 119170 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_24560 119931 121034 gene locus_tag LOCUS_24570 119931 121034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 121190 121696 gene locus_tag LOCUS_24580 121190 121696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 121808 122320 gene locus_tag LOCUS_24590 121808 122320 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_24590 122380 124602 gene locus_tag LOCUS_24600 122380 124602 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_24600 124811 125308 gene locus_tag LOCUS_24610 124811 125308 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_24610 125894 125298 gene locus_tag LOCUS_24620 125894 125298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 126043 126321 gene locus_tag LOCUS_24630 126043 126321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 127876 126311 gene locus_tag LOCUS_24640 127876 126311 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_24640 129519 127873 gene locus_tag LOCUS_24650 129519 127873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 130260 129712 gene locus_tag LOCUS_24660 130260 129712 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_24660 131087 130257 gene locus_tag LOCUS_24670 131087 130257 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_24670 131728 131096 gene locus_tag LOCUS_24680 131728 131096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_24680 131819 133243 gene locus_tag LOCUS_24690 131819 133243 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_24690 134579 133296 gene locus_tag LOCUS_24700 134579 133296 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_24700 135667 134738 gene locus_tag LOCUS_24710 135667 134738 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_24710 136035 135682 gene locus_tag LOCUS_24720 136035 135682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 137955 136084 gene locus_tag LOCUS_24730 gene rpsA 137955 136084 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_24730 138308 139267 gene locus_tag LOCUS_24740 138308 139267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_24740 139343 140224 gene locus_tag LOCUS_24750 gene rfbA 139343 140224 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_24750 140240 140788 gene locus_tag LOCUS_24760 gene rfbC 140240 140788 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_24760 140897 141772 gene locus_tag LOCUS_24770 gene rfbD 140897 141772 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_24770 141776 143524 gene locus_tag LOCUS_24780 141776 143524 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_24780 143550 144302 gene locus_tag LOCUS_24790 143550 144302 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_24790 144710 144435 gene locus_tag LOCUS_24800 144710 144435 CDS product DUF4884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767421.1 protein_id gnl|my_center|LOCUS_24800 146075 145017 gene locus_tag LOCUS_24810 146075 145017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 146952 146068 gene locus_tag LOCUS_24820 146952 146068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 147607 149601 gene locus_tag LOCUS_24830 147607 149601 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_24830 149598 150755 gene locus_tag LOCUS_24840 149598 150755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 150773 152068 gene locus_tag LOCUS_24850 150773 152068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 152097 153419 gene locus_tag LOCUS_24860 152097 153419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 154336 153461 gene locus_tag LOCUS_24870 154336 153461 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_24870 154994 154398 gene locus_tag LOCUS_24880 154994 154398 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_24880 155752 155003 gene locus_tag LOCUS_24890 155752 155003 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105293.1 protein_id gnl|my_center|LOCUS_24890 156664 155792 gene locus_tag LOCUS_24900 156664 155792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214567418.1 protein_id gnl|my_center|LOCUS_24900 157426 156986 gene locus_tag LOCUS_24910 157426 156986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 157853 157365 gene locus_tag LOCUS_24920 157853 157365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 158202 157990 gene locus_tag LOCUS_24930 158202 157990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 158607 158257 gene locus_tag LOCUS_24940 158607 158257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 159376 158840 gene locus_tag LOCUS_24950 159376 158840 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991904.1 protein_id gnl|my_center|LOCUS_24950 160658 159567 gene locus_tag LOCUS_24960 160658 159567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 160765 161079 gene locus_tag LOCUS_24970 160765 161079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 161245 161979 gene locus_tag LOCUS_24980 161245 161979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 162599 162069 gene locus_tag LOCUS_24990 162599 162069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 163557 162694 gene locus_tag LOCUS_25000 163557 162694 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067012.1 protein_id gnl|my_center|LOCUS_25000 164218 163745 gene locus_tag LOCUS_25010 164218 163745 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_25010 164964 164386 gene locus_tag LOCUS_25020 164964 164386 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_25020 165093 165899 gene locus_tag LOCUS_25030 165093 165899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 165938 167110 gene locus_tag LOCUS_25040 165938 167110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 168454 167249 gene locus_tag LOCUS_25050 168454 167249 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_25050 168937 170391 gene locus_tag LOCUS_25060 168937 170391 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_25060 170580 171152 gene locus_tag LOCUS_25070 170580 171152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 171216 172382 gene locus_tag LOCUS_25080 171216 172382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 172454 173026 gene locus_tag LOCUS_25090 172454 173026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 173084 173464 gene locus_tag LOCUS_25100 173084 173464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 173843 173448 gene locus_tag LOCUS_25110 173843 173448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 175388 174189 gene locus_tag LOCUS_25120 175388 174189 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_25120 175730 176437 gene locus_tag LOCUS_25130 175730 176437 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_25130 176983 176609 gene locus_tag LOCUS_25140 176983 176609 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_25140 178103 177132 gene locus_tag LOCUS_25150 178103 177132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 179723 178287 gene locus_tag LOCUS_25160 179723 178287 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_25160 180122 181165 gene locus_tag LOCUS_25170 180122 181165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 181311 181895 gene locus_tag LOCUS_25180 181311 181895 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_25180 181984 182976 gene locus_tag LOCUS_25190 181984 182976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 183117 186473 gene locus_tag LOCUS_25200 183117 186473 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_25200 186498 188075 gene locus_tag LOCUS_25210 186498 188075 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_25210 188171 190414 gene locus_tag LOCUS_25220 188171 190414 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_25220 190592 192880 gene locus_tag LOCUS_25230 190592 192880 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_25230 192917 193237 gene locus_tag LOCUS_25240 192917 193237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 195477 193861 gene locus_tag LOCUS_25250 195477 193861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 195788 196168 gene locus_tag LOCUS_25260 195788 196168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765457.1 protein_id gnl|my_center|LOCUS_25260 196117 197022 gene locus_tag LOCUS_25270 196117 197022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25270 197789 197067 gene locus_tag LOCUS_25280 197789 197067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 198347 197847 gene locus_tag LOCUS_25290 198347 197847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 199724 198354 gene locus_tag LOCUS_25300 199724 198354 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_25300 202745 199734 gene locus_tag LOCUS_25310 202745 199734 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_25310 205612 202802 gene locus_tag LOCUS_25320 205612 202802 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_25320 206172 206903 gene locus_tag LOCUS_25330 206172 206903 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766589.1 protein_id gnl|my_center|LOCUS_25330 206947 207885 gene locus_tag LOCUS_25340 206947 207885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 207968 209062 gene locus_tag LOCUS_25350 207968 209062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766592.1 protein_id gnl|my_center|LOCUS_25350 209043 211436 gene locus_tag LOCUS_25360 209043 211436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 211511 214096 gene locus_tag LOCUS_25370 211511 214096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 214167 215456 gene locus_tag LOCUS_25380 214167 215456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 215616 217346 gene locus_tag LOCUS_25390 215616 217346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 217521 218819 gene locus_tag LOCUS_25400 217521 218819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 218798 221959 gene locus_tag LOCUS_25410 218798 221959 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108138.1 protein_id gnl|my_center|LOCUS_25410 222092 224725 gene locus_tag LOCUS_25420 222092 224725 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_25420 224978 226447 gene locus_tag LOCUS_25430 224978 226447 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_25430 226480 228108 gene locus_tag LOCUS_25440 226480 228108 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_25440 228456 229985 gene locus_tag LOCUS_25450 gene guaA 228456 229985 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_25450 230604 232217 gene locus_tag LOCUS_25460 230604 232217 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_25460 232222 232818 gene locus_tag LOCUS_25470 gene pnuC 232222 232818 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_25470 232815 233342 gene locus_tag LOCUS_25480 232815 233342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 233531 234469 gene locus_tag LOCUS_25490 gene cysK 233531 234469 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582454.1 protein_id gnl|my_center|LOCUS_25490 234459 235388 gene locus_tag LOCUS_25500 234459 235388 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_25500 235400 236539 gene locus_tag LOCUS_25510 235400 236539 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_25510 236856 236725 gene locus_tag LOCUS_25520 236856 236725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 237087 239849 gene locus_tag LOCUS_25530 237087 239849 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136338670.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence15 <1 3259 gene locus_tag LOCUS_25540 <1 3259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 3271 4218 gene locus_tag LOCUS_25550 3271 4218 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_25550 4239 6077 gene locus_tag LOCUS_25560 4239 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 6675 6166 gene locus_tag LOCUS_25570 6675 6166 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073448.1 protein_id gnl|my_center|LOCUS_25570 7468 6701 gene locus_tag LOCUS_25580 7468 6701 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_25580 9479 7680 gene locus_tag LOCUS_25590 9479 7680 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_25590 10178 9483 gene locus_tag LOCUS_25600 10178 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 11167 10175 gene locus_tag LOCUS_25610 gene obgE 11167 10175 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_25610 11825 11253 gene locus_tag LOCUS_25620 11825 11253 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_25620 12403 11864 gene locus_tag LOCUS_25630 gene hpt 12403 11864 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_25630 12512 13018 gene locus_tag LOCUS_25640 gene purE 12512 13018 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_25640 13099 13914 gene locus_tag LOCUS_25650 13099 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 13911 15914 gene locus_tag LOCUS_25660 13911 15914 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_25660 15963 17090 gene locus_tag LOCUS_25670 15963 17090 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_25670 17267 17740 gene locus_tag LOCUS_25680 17267 17740 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765910.1 protein_id gnl|my_center|LOCUS_25680 19010 17790 gene locus_tag LOCUS_25690 19010 17790 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_25690 20761 19040 gene locus_tag LOCUS_25700 gene recJ 20761 19040 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_25700 21067 22788 gene locus_tag LOCUS_25710 gene lysS 21067 22788 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_25710 22807 23802 gene locus_tag LOCUS_25720 22807 23802 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_25720 23808 25151 gene locus_tag LOCUS_25730 23808 25151 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_25730 25508 25990 gene locus_tag LOCUS_25740 25508 25990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 26094 26984 gene locus_tag LOCUS_25750 26094 26984 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_25750 27021 27590 gene locus_tag LOCUS_25760 27021 27590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 27699 29927 gene locus_tag LOCUS_25770 27699 29927 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_25770 30105 30317 gene locus_tag LOCUS_25780 30105 30317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 30600 31487 gene locus_tag LOCUS_25790 30600 31487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 32774 32328 gene locus_tag LOCUS_25800 gene tnpA 32774 32328 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_25800 34534 34998 gene locus_tag LOCUS_25810 34534 34998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 35548 37104 gene locus_tag LOCUS_25820 35548 37104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 37257 37895 gene locus_tag LOCUS_25830 37257 37895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 37965 38609 gene locus_tag LOCUS_25840 37965 38609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 38705 39532 gene locus_tag LOCUS_25850 38705 39532 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_25850 39655 40071 gene locus_tag LOCUS_25860 39655 40071 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905082.1 protein_id gnl|my_center|LOCUS_25860 40273 40758 gene locus_tag LOCUS_25870 40273 40758 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_25870 42297 40963 gene locus_tag LOCUS_25880 42297 40963 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_25880 43568 42438 gene locus_tag LOCUS_25890 43568 42438 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_25890 44974 43712 gene locus_tag LOCUS_25900 44974 43712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_25900 46242 44992 gene locus_tag LOCUS_25910 46242 44992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_25910 46980 46255 gene locus_tag LOCUS_25920 46980 46255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_25920 48953 47304 gene locus_tag LOCUS_25930 48953 47304 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230581.1 protein_id gnl|my_center|LOCUS_25930 49807 48953 gene locus_tag LOCUS_25940 49807 48953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 51234 49963 gene locus_tag LOCUS_25950 gene purD 51234 49963 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 protein_id gnl|my_center|LOCUS_25950 51905 51258 gene locus_tag LOCUS_25960 51905 51258 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_25960 54964 51905 gene locus_tag LOCUS_25970 54964 51905 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_25970 55241 55489 gene locus_tag LOCUS_25980 55241 55489 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_25980 55486 55896 gene locus_tag LOCUS_25990 55486 55896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 55896 56594 gene locus_tag LOCUS_26000 55896 56594 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_26000 56836 62088 gene locus_tag LOCUS_26010 56836 62088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 62585 62145 gene locus_tag LOCUS_26020 gene rirA 62585 62145 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527122.1 protein_id gnl|my_center|LOCUS_26020 63331 62609 gene locus_tag LOCUS_26030 gene ric 63331 62609 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_26030 63520 65736 gene locus_tag LOCUS_26040 63520 65736 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_26040 65883 66263 gene locus_tag LOCUS_26050 65883 66263 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_26050 67712 66357 gene locus_tag LOCUS_26060 67712 66357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_26060 67761 68420 gene locus_tag LOCUS_26070 67761 68420 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_26070 68558 69733 gene locus_tag LOCUS_26080 68558 69733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 70399 71043 gene locus_tag LOCUS_26090 70399 71043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 72403 71102 gene locus_tag LOCUS_26100 72403 71102 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_26100 74020 72593 gene locus_tag LOCUS_26110 gene rodA 74020 72593 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_26110 75848 74025 gene locus_tag LOCUS_26120 gene mrdA 75848 74025 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_26120 76359 75853 gene locus_tag LOCUS_26130 gene mreD 76359 75853 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_26130 77029 76352 gene locus_tag LOCUS_26140 gene mreC 77029 76352 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_26140 78236 77214 gene locus_tag LOCUS_26150 78236 77214 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_26150 79874 78285 gene locus_tag LOCUS_26160 gene purH 79874 78285 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762746.1 protein_id gnl|my_center|LOCUS_26160 80207 81460 gene locus_tag LOCUS_26170 80207 81460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_26170 82478 81498 gene locus_tag LOCUS_26180 82478 81498 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_26180 83308 82490 gene locus_tag LOCUS_26190 gene rimK 83308 82490 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_26190 83941 83489 gene locus_tag LOCUS_26200 83941 83489 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_26200 85306 83948 gene locus_tag LOCUS_26210 gene mgtE 85306 83948 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760927.1 protein_id gnl|my_center|LOCUS_26210 86093 85317 gene locus_tag LOCUS_26220 gene rsmA 86093 85317 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_26220 86234 87277 gene locus_tag LOCUS_26230 86234 87277 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_26230 87493 88626 gene locus_tag LOCUS_26240 87493 88626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_26240 88770 89402 gene locus_tag LOCUS_26250 88770 89402 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_26250 90696 89392 gene locus_tag LOCUS_26260 90696 89392 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_26260 92819 90843 gene locus_tag LOCUS_26270 92819 90843 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_26270 93238 94023 gene locus_tag LOCUS_26280 93238 94023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_26280 94038 94766 gene locus_tag LOCUS_26290 94038 94766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_26290 94779 95726 gene locus_tag LOCUS_26300 94779 95726 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_26300 95892 98309 gene locus_tag LOCUS_26310 95892 98309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 98349 99704 gene locus_tag LOCUS_26320 98349 99704 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_26320 99767 100198 gene locus_tag LOCUS_26330 99767 100198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 100376 100915 gene locus_tag LOCUS_26340 100376 100915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 101345 101527 gene locus_tag LOCUS_26350 101345 101527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 101562 101849 gene locus_tag LOCUS_26360 101562 101849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 101880 102248 gene locus_tag LOCUS_26370 101880 102248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 102245 102475 gene locus_tag LOCUS_26380 102245 102475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 102630 103508 gene locus_tag LOCUS_26390 102630 103508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 103554 104045 gene locus_tag LOCUS_26400 103554 104045 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_26400 104303 106138 gene locus_tag LOCUS_26410 104303 106138 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_26410 106192 108816 gene locus_tag LOCUS_26420 106192 108816 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_26420 108816 109325 gene locus_tag LOCUS_26430 108816 109325 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_26430 109318 110082 gene locus_tag LOCUS_26440 109318 110082 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_26440 111101 110904 gene locus_tag LOCUS_26450 111101 110904 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082425.1 protein_id gnl|my_center|LOCUS_26450 111451 111116 gene locus_tag LOCUS_26460 111451 111116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 113168 111849 gene locus_tag LOCUS_26470 113168 111849 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_26470 114607 113891 gene locus_tag LOCUS_26480 114607 113891 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_26480 114887 116215 gene locus_tag LOCUS_26490 114887 116215 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257804.1 protein_id gnl|my_center|LOCUS_26490 116277 117638 gene locus_tag LOCUS_26500 gene lpdA 116277 117638 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_26500 117673 118062 gene locus_tag LOCUS_26510 117673 118062 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_26510 118199 120670 gene locus_tag LOCUS_26520 118199 120670 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_26520 120883 121413 gene locus_tag LOCUS_26530 120883 121413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 121499 122233 gene locus_tag LOCUS_26540 121499 122233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 122557 123009 gene locus_tag LOCUS_26550 122557 123009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030561.1 protein_id gnl|my_center|LOCUS_26550 123101 123829 gene locus_tag LOCUS_26560 123101 123829 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878919.1 protein_id gnl|my_center|LOCUS_26560 123908 124924 gene locus_tag LOCUS_26570 123908 124924 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_26570 125060 126322 gene locus_tag LOCUS_26580 125060 126322 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 protein_id gnl|my_center|LOCUS_26580 126315 126839 gene locus_tag LOCUS_26590 126315 126839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 126952 128181 gene locus_tag LOCUS_26600 126952 128181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 128320 130287 gene locus_tag LOCUS_26610 128320 130287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 130370 131641 gene locus_tag LOCUS_26620 130370 131641 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853214.1 protein_id gnl|my_center|LOCUS_26620 131723 132388 gene locus_tag LOCUS_26630 131723 132388 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_26630 132667 133245 gene locus_tag LOCUS_26640 132667 133245 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_26640 133274 134443 gene locus_tag LOCUS_26650 133274 134443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 134521 137805 gene locus_tag LOCUS_26660 134521 137805 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_26660 137999 139177 gene locus_tag LOCUS_26670 137999 139177 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_26670 139342 142389 gene locus_tag LOCUS_26680 139342 142389 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_26680 142423 143973 gene locus_tag LOCUS_26690 142423 143973 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_26690 144313 145959 gene locus_tag LOCUS_26700 144313 145959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 146021 147448 gene locus_tag LOCUS_26710 146021 147448 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_26710 148091 147537 gene locus_tag LOCUS_26720 148091 147537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 148758 148084 gene locus_tag LOCUS_26730 148758 148084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 149956 148751 gene locus_tag LOCUS_26740 149956 148751 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_26740 150227 150781 gene locus_tag LOCUS_26750 150227 150781 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_26750 150778 152226 gene locus_tag LOCUS_26760 150778 152226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 154176 152353 gene locus_tag LOCUS_26770 154176 152353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 154457 155986 gene locus_tag LOCUS_26780 154457 155986 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_26780 156609 155989 gene locus_tag LOCUS_26790 156609 155989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 157207 158853 gene locus_tag LOCUS_26800 157207 158853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 158899 161457 gene locus_tag LOCUS_26810 158899 161457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 161881 162630 gene locus_tag LOCUS_26820 161881 162630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 162644 163936 gene locus_tag LOCUS_26830 162644 163936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 164998 164030 gene locus_tag LOCUS_26840 164998 164030 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107586.1 protein_id gnl|my_center|LOCUS_26840 166332 165034 gene locus_tag LOCUS_26850 166332 165034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_26850 168606 166357 gene locus_tag LOCUS_26860 168606 166357 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_26860 169037 169969 gene locus_tag LOCUS_26870 169037 169969 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_26870 169975 172839 gene locus_tag LOCUS_26880 gene uvrA 169975 172839 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_26880 172859 174574 gene locus_tag LOCUS_26890 172859 174574 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_26890 174995 175594 gene locus_tag LOCUS_26900 174995 175594 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_26900 175646 176263 gene locus_tag LOCUS_26910 175646 176263 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_26910 176305 177603 gene locus_tag LOCUS_26920 176305 177603 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_26920 177610 178674 gene locus_tag LOCUS_26930 177610 178674 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_26930 178714 181833 gene locus_tag LOCUS_26940 178714 181833 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_26940 181886 182179 gene locus_tag LOCUS_26950 181886 182179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_26950 183608 182301 gene locus_tag LOCUS_26960 183608 182301 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_26960 183866 184465 gene locus_tag LOCUS_26970 183866 184465 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_26970 184602 185279 gene locus_tag LOCUS_26980 184602 185279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 185635 185276 gene locus_tag LOCUS_26990 185635 185276 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_26990 185918 186496 gene locus_tag LOCUS_27000 gene sodB 185918 186496 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366881.1 protein_id gnl|my_center|LOCUS_27000 186524 186700 gene locus_tag LOCUS_27010 186524 186700 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937335.1 protein_id gnl|my_center|LOCUS_27010 188608 186743 gene locus_tag LOCUS_27020 188608 186743 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_27020 190121 188736 gene locus_tag LOCUS_27030 gene xylE 190121 188736 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_27030 191528 190203 gene locus_tag LOCUS_27040 gene xylA 191528 190203 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_27040 193018 191693 gene locus_tag LOCUS_27050 193018 191693 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_27050 194554 193076 gene locus_tag LOCUS_27060 194554 193076 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_27060 195663 194668 gene locus_tag LOCUS_27070 195663 194668 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107685.1 protein_id gnl|my_center|LOCUS_27070 195983 196549 gene locus_tag LOCUS_27080 195983 196549 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_27080 197578 196667 gene locus_tag LOCUS_27090 197578 196667 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_27090 197902 198498 gene locus_tag LOCUS_27100 197902 198498 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_27100 198568 199779 gene locus_tag LOCUS_27110 198568 199779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 201222 199786 gene locus_tag LOCUS_27120 201222 199786 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_27120 201992 201606 gene locus_tag LOCUS_27130 201992 201606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 202256 202762 gene locus_tag LOCUS_27140 202256 202762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 202787 203227 gene locus_tag LOCUS_27150 202787 203227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 203266 203652 gene locus_tag LOCUS_27160 203266 203652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 203873 204121 gene locus_tag LOCUS_27170 203873 204121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 205377 204373 gene locus_tag LOCUS_27180 205377 204373 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_27180 205783 206493 gene locus_tag LOCUS_27190 205783 206493 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_27190 206640 207827 gene locus_tag LOCUS_27200 206640 207827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 209797 207938 gene locus_tag LOCUS_27210 gene glaB 209797 207938 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_27210 211456 209990 gene locus_tag LOCUS_27220 211456 209990 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_27220 211544 211990 gene locus_tag LOCUS_27230 211544 211990 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105215.1 protein_id gnl|my_center|LOCUS_27230 213350 212121 gene locus_tag LOCUS_27240 gene aroA 213350 212121 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_27240 214387 213368 gene locus_tag LOCUS_27250 gene aroB 214387 213368 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_27250 214532 214981 gene locus_tag LOCUS_27260 214532 214981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 215031 216137 gene locus_tag LOCUS_27270 gene dprA 215031 216137 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_27270 216255 217568 gene locus_tag LOCUS_27280 216255 217568 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_27280 219287 217617 gene locus_tag LOCUS_27290 219287 217617 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_27290 220033 219470 gene locus_tag LOCUS_27300 220033 219470 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_27300 221404 220067 gene locus_tag LOCUS_27310 221404 220067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 222410 221475 gene locus_tag LOCUS_27320 222410 221475 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_27320 223641 222529 gene locus_tag LOCUS_27330 223641 222529 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_27330 224542 223766 gene locus_tag LOCUS_27340 224542 223766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 225343 224675 gene locus_tag LOCUS_27350 225343 224675 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_27350 226271 225390 gene locus_tag LOCUS_27360 226271 225390 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_27360 226799 226275 gene locus_tag LOCUS_27370 226799 226275 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_27370 226931 227455 gene locus_tag LOCUS_27380 gene yjjX 226931 227455 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261320.1 protein_id gnl|my_center|LOCUS_27380 227760 227452 gene locus_tag LOCUS_27390 227760 227452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 228142 227798 gene locus_tag LOCUS_27400 228142 227798 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_27400 229574 228243 gene locus_tag LOCUS_27410 gene miaB 229574 228243 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_27410 229892 230383 gene locus_tag LOCUS_27420 229892 230383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 230376 232274 gene locus_tag LOCUS_27430 230376 232274 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_27430 233303 232344 gene locus_tag LOCUS_27440 233303 232344 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_27440 234222 233380 gene locus_tag LOCUS_27450 234222 233380 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_27450 234531 234986 gene locus_tag LOCUS_27460 gene mraZ 234531 234986 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869611.1 protein_id gnl|my_center|LOCUS_27460 234989 235891 gene locus_tag LOCUS_27470 gene rsmH 234989 235891 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_27470 235888 236256 gene locus_tag LOCUS_27480 235888 236256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 236256 238373 gene locus_tag LOCUS_27490 236256 238373 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_27490 238373 239830 gene locus_tag LOCUS_27500 238373 239830 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_27500 239840 241090 gene locus_tag LOCUS_27510 gene mraY 239840 241090 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_27510 241092 242429 gene locus_tag LOCUS_27520 gene murD 241092 242429 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_27520 242501 243700 gene locus_tag LOCUS_27530 242501 243700 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_27530 243702 244802 gene locus_tag LOCUS_27540 gene murG 243702 244802 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_27540 244803 246188 gene locus_tag LOCUS_27550 gene murC 244803 246188 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_27550 246181 246930 gene locus_tag LOCUS_27560 246181 246930 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_27560 246936 248234 gene locus_tag LOCUS_27570 gene ftsA 246936 248234 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_27570 248255 249526 gene locus_tag LOCUS_27580 248255 249526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 249548 250969 gene locus_tag LOCUS_27590 249548 250969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 251021 251473 gene locus_tag LOCUS_27600 251021 251473 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_27600 256399 251552 gene locus_tag LOCUS_27610 256399 251552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 257464 256892 gene locus_tag LOCUS_27620 257464 256892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 258310 257588 gene locus_tag LOCUS_27630 258310 257588 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_27630 259425 258319 gene locus_tag LOCUS_27640 259425 258319 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_27640 259651 260040 gene locus_tag LOCUS_27650 259651 260040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 261066 260092 gene locus_tag LOCUS_27660 261066 260092 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_27660 261764 261075 gene locus_tag LOCUS_27670 261764 261075 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_27670 262143 263930 gene locus_tag LOCUS_27680 gene lepA 262143 263930 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_27680 265970 264084 gene locus_tag LOCUS_27690 265970 264084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 267406 266294 gene locus_tag LOCUS_27700 gene ald 267406 266294 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_27700 267696 268871 gene locus_tag LOCUS_27710 267696 268871 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_27710 271172 268989 gene locus_tag LOCUS_27720 gene recQ 271172 268989 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_27720 271401 272267 gene locus_tag LOCUS_27730 gene tatC 271401 272267 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_27730 272324 273046 gene locus_tag LOCUS_27740 gene lptB 272324 273046 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_27740 273137 273218 gene locus_tag LOCUS_t00290 273137 273218 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 273361 274716 gene locus_tag LOCUS_27750 gene tig 273361 274716 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_27750 274852 275523 gene locus_tag LOCUS_27760 gene clpP 274852 275523 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_27760 275550 276764 gene locus_tag LOCUS_27770 gene clpX 275550 276764 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_27770 276823 277443 gene locus_tag LOCUS_27780 276823 277443 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787813.1 protein_id gnl|my_center|LOCUS_27780 277440 278225 gene locus_tag LOCUS_27790 277440 278225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_27790 278355 279365 gene locus_tag LOCUS_27800 278355 279365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_27800 280680 279367 gene locus_tag LOCUS_27810 280680 279367 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_27810 280830 281492 gene locus_tag LOCUS_27820 gene ung 280830 281492 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_27820 282655 281504 gene locus_tag LOCUS_27830 282655 281504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 283094 282666 gene locus_tag LOCUS_27840 283094 282666 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 protein_id gnl|my_center|LOCUS_27840 284768 283101 gene locus_tag LOCUS_27850 284768 283101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 286365 285283 gene locus_tag LOCUS_27860 286365 285283 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_27860 287144 286371 gene locus_tag LOCUS_27870 287144 286371 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_27870 288423 287254 gene locus_tag LOCUS_27880 288423 287254 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 protein_id gnl|my_center|LOCUS_27880 288570 289505 gene locus_tag LOCUS_27890 288570 289505 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_27890 289619 291037 gene locus_tag LOCUS_27900 gene ahcY 289619 291037 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_27900 291088 291519 gene locus_tag LOCUS_27910 291088 291519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 291901 291527 gene locus_tag LOCUS_27920 291901 291527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 292030 292452 gene locus_tag LOCUS_27930 292030 292452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 292603 293076 gene locus_tag LOCUS_27940 gene greA 292603 293076 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_27940 293087 293482 gene locus_tag LOCUS_27950 293087 293482 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_27950 293724 294572 gene locus_tag LOCUS_27960 293724 294572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 295127 294573 gene locus_tag LOCUS_27970 gene ruvC 295127 294573 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_27970 296416 295127 gene locus_tag LOCUS_27980 296416 295127 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_27980 297379 296441 gene locus_tag LOCUS_27990 297379 296441 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_27990 299236 297404 gene locus_tag LOCUS_28000 299236 297404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 299698 300513 gene locus_tag LOCUS_28010 gene lipA 299698 300513 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_28010 300556 301224 gene locus_tag LOCUS_28020 gene lipB 300556 301224 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_28020 301238 301885 gene locus_tag LOCUS_28030 301238 301885 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 protein_id gnl|my_center|LOCUS_28030 301887 302132 gene locus_tag LOCUS_28040 301887 302132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 302606 302136 gene locus_tag LOCUS_28050 302606 302136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 303146 302610 gene locus_tag LOCUS_28060 303146 302610 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 protein_id gnl|my_center|LOCUS_28060 303563 306190 gene locus_tag LOCUS_28070 303563 306190 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_28070 306402 307895 gene locus_tag LOCUS_28080 306402 307895 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_28080 307942 309330 gene locus_tag LOCUS_28090 gene glmM 307942 309330 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_28090 309572 310966 gene locus_tag LOCUS_28100 309572 310966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 310982 312355 gene locus_tag LOCUS_28110 310982 312355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_28110 312372 313856 gene locus_tag LOCUS_28120 312372 313856 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_28120 313862 315094 gene locus_tag LOCUS_28130 313862 315094 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_28130 315303 317477 gene locus_tag LOCUS_28140 315303 317477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 319305 317629 gene locus_tag LOCUS_28150 319305 317629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 319697 320623 gene locus_tag LOCUS_28160 gene mdh 319697 320623 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760830.1 protein_id gnl|my_center|LOCUS_28160 320687 321121 gene locus_tag LOCUS_28170 320687 321121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 321575 322720 gene locus_tag LOCUS_28180 321575 322720 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_28180 322907 323338 gene locus_tag LOCUS_28190 322907 323338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 323448 326444 gene locus_tag LOCUS_28200 gene secDF 323448 326444 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_28200 326567 326992 gene locus_tag LOCUS_28210 326567 326992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 327020 328051 gene locus_tag LOCUS_28220 327020 328051 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_28220 328088 328741 gene locus_tag LOCUS_28230 328088 328741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_28230 328746 329519 gene locus_tag LOCUS_28240 328746 329519 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_28240 329864 331204 gene locus_tag LOCUS_28250 gene nhaA 329864 331204 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_28250 331710 332528 gene locus_tag LOCUS_28260 331710 332528 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261226.1 protein_id gnl|my_center|LOCUS_28260 333019 332525 gene locus_tag LOCUS_28270 333019 332525 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_28270 333185 333865 gene locus_tag LOCUS_28280 333185 333865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 333918 335273 gene locus_tag LOCUS_28290 gene miaB 333918 335273 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_28290 335270 336574 gene locus_tag LOCUS_28300 gene mtaB 335270 336574 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_28300 336801 338366 gene locus_tag LOCUS_28310 336801 338366 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_28310 338381 339187 gene locus_tag LOCUS_28320 338381 339187 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088598.1 protein_id gnl|my_center|LOCUS_28320 339187 341166 gene locus_tag LOCUS_28330 339187 341166 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768562.1 protein_id gnl|my_center|LOCUS_28330 341183 342340 gene locus_tag LOCUS_28340 341183 342340 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_28340 342344 343357 gene locus_tag LOCUS_28350 gene fni 342344 343357 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599487.1 protein_id gnl|my_center|LOCUS_28350 343344 344657 gene locus_tag LOCUS_28360 343344 344657 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_28360 344650 345573 gene locus_tag LOCUS_28370 344650 345573 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143470457.1 protein_id gnl|my_center|LOCUS_28370 345583 346635 gene locus_tag LOCUS_28380 gene mvaD 345583 346635 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_28380 346622 347533 gene locus_tag LOCUS_28390 346622 347533 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_28390 348756 347632 gene locus_tag LOCUS_28400 gene ricT 348756 347632 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_28400 348903 349325 gene locus_tag LOCUS_28410 348903 349325 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_28410 349562 350767 gene locus_tag LOCUS_28420 349562 350767 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_28420 350946 353528 gene locus_tag LOCUS_28430 gene mutS 350946 353528 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_28430 353653 353726 gene locus_tag LOCUS_t00300 353653 353726 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 353743 353829 gene locus_tag LOCUS_t00310 353743 353829 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 353844 353917 gene locus_tag LOCUS_t00320 353844 353917 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 354017 354268 gene locus_tag LOCUS_28440 354017 354268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 354928 356358 gene locus_tag LOCUS_28450 354928 356358 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798358.1 protein_id gnl|my_center|LOCUS_28450 357071 356433 gene locus_tag LOCUS_28460 357071 356433 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_28460 358291 357071 gene locus_tag LOCUS_28470 358291 357071 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_28470 358462 358536 gene locus_tag LOCUS_t00330 358462 358536 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 359736 358630 gene locus_tag LOCUS_28480 359736 358630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 360585 359740 gene locus_tag LOCUS_28490 gene yhdJ 360585 359740 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258895.1 protein_id gnl|my_center|LOCUS_28490 361062 360670 gene locus_tag LOCUS_28500 361062 360670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 361936 361052 gene locus_tag LOCUS_28510 361936 361052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 362543 362229 gene locus_tag LOCUS_28520 362543 362229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 363914 362691 gene locus_tag LOCUS_28530 363914 362691 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_28530 364335 364973 gene locus_tag LOCUS_28540 364335 364973 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_28540 365091 366191 gene locus_tag LOCUS_28550 365091 366191 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766780.1 protein_id gnl|my_center|LOCUS_28550 366337 369798 gene locus_tag LOCUS_28560 366337 369798 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763977.1 protein_id gnl|my_center|LOCUS_28560 369813 371570 gene locus_tag LOCUS_28570 369813 371570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 371856 374372 gene locus_tag LOCUS_28580 371856 374372 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_28580 374648 376180 gene locus_tag LOCUS_28590 gene gpmI 374648 376180 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108817.1 protein_id gnl|my_center|LOCUS_28590 376211 376828 gene locus_tag LOCUS_28600 376211 376828 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_28600 378280 376910 gene locus_tag LOCUS_28610 378280 376910 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_28610 379134 378343 gene locus_tag LOCUS_28620 379134 378343 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021858.1 protein_id gnl|my_center|LOCUS_28620 380138 379197 gene locus_tag LOCUS_28630 380138 379197 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_28630 382054 380774 gene locus_tag LOCUS_28640 382054 380774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 383375 382434 gene locus_tag LOCUS_28650 383375 382434 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_28650 384997 383519 gene locus_tag LOCUS_28660 384997 383519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_28660 385710 385015 gene locus_tag LOCUS_28670 385710 385015 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_28670 385908 386369 gene locus_tag LOCUS_28680 385908 386369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 388116 386422 gene locus_tag LOCUS_28690 388116 386422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 389285 388113 gene locus_tag LOCUS_28700 389285 388113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 392052 389272 gene locus_tag LOCUS_28710 392052 389272 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_28710 392761 392057 gene locus_tag LOCUS_28720 392761 392057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 394718 393069 gene locus_tag LOCUS_28730 394718 393069 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_28730 394979 395635 gene locus_tag LOCUS_28740 394979 395635 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 protein_id gnl|my_center|LOCUS_28740 395715 396104 gene locus_tag LOCUS_28750 395715 396104 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723119.1 protein_id gnl|my_center|LOCUS_28750 396127 398013 gene locus_tag LOCUS_28760 396127 398013 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_28760 399462 398095 gene locus_tag LOCUS_28770 399462 398095 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_28770 401987 399813 gene locus_tag LOCUS_28780 gene yccS 401987 399813 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706489.1 protein_id gnl|my_center|LOCUS_28780 403648 402107 gene locus_tag LOCUS_28790 403648 402107 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403298.1 protein_id gnl|my_center|LOCUS_28790 404305 403829 gene locus_tag LOCUS_28800 404305 403829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 405359 404355 gene locus_tag LOCUS_28810 405359 404355 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_28810 405573 406295 gene locus_tag LOCUS_28820 405573 406295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 408791 406677 gene locus_tag LOCUS_28830 408791 406677 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_28830 410158 408887 gene locus_tag LOCUS_28840 410158 408887 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_28840 410686 410165 gene locus_tag LOCUS_28850 410686 410165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 412316 410733 gene locus_tag LOCUS_28860 412316 410733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_28860 413530 412400 gene locus_tag LOCUS_28870 413530 412400 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_28870 414398 413664 gene locus_tag LOCUS_28880 414398 413664 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_28880 415266 414418 gene locus_tag LOCUS_28890 gene nadC 415266 414418 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_28890 416834 415263 gene locus_tag LOCUS_28900 gene nadB 416834 415263 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_28900 417278 418447 gene locus_tag LOCUS_28910 417278 418447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 418431 421637 gene locus_tag LOCUS_28920 418431 421637 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_28920 421645 422967 gene locus_tag LOCUS_28930 421645 422967 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_28930 423219 423055 gene locus_tag LOCUS_28940 423219 423055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 424545 423526 gene locus_tag LOCUS_28950 gene yiaK 424545 423526 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 protein_id gnl|my_center|LOCUS_28950 425243 424557 gene locus_tag LOCUS_28960 425243 424557 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864370.1 protein_id gnl|my_center|LOCUS_28960 426330 425536 gene locus_tag LOCUS_28970 426330 425536 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_28970 426734 427777 gene locus_tag LOCUS_28980 426734 427777 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_28980 428559 427849 gene locus_tag LOCUS_28990 428559 427849 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_28990 429926 428562 gene locus_tag LOCUS_29000 429926 428562 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100623.1 protein_id gnl|my_center|LOCUS_29000 430134 431222 gene locus_tag LOCUS_29010 430134 431222 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_29010 431324 432454 gene locus_tag LOCUS_29020 gene meaB 431324 432454 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_29020 432451 433548 gene locus_tag LOCUS_29030 432451 433548 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_29030 433701 435092 gene locus_tag LOCUS_29040 gene lpdA 433701 435092 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_29040 435813 435250 gene locus_tag LOCUS_29050 435813 435250 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_29050 436933 435806 gene locus_tag LOCUS_29060 436933 435806 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_29060 438301 437039 gene locus_tag LOCUS_29070 gene lysA 438301 437039 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_29070 439550 438690 gene locus_tag LOCUS_29080 gene dapF 439550 438690 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_29080 441186 440962 gene locus_tag LOCUS_29090 441186 440962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 441170 441325 gene locus_tag LOCUS_29100 441170 441325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 441335 442114 gene locus_tag LOCUS_29110 441335 442114 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_29110 442269 443498 gene locus_tag LOCUS_29120 442269 443498 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_29120 443881 444693 gene locus_tag LOCUS_29130 443881 444693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 445037 445855 gene locus_tag LOCUS_29140 445037 445855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 445894 446376 gene locus_tag LOCUS_29150 445894 446376 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_29150 446387 447070 gene locus_tag LOCUS_29160 446387 447070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 447057 449495 gene locus_tag LOCUS_29170 447057 449495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 449672 450556 gene locus_tag LOCUS_29180 gene era 449672 450556 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_29180 450641 451948 gene locus_tag LOCUS_29190 gene der 450641 451948 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_29190 452060 453643 gene locus_tag LOCUS_29200 452060 453643 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_29200 455439 453736 gene locus_tag LOCUS_29210 455439 453736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 456357 455590 gene locus_tag LOCUS_29220 456357 455590 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_29220 457386 456457 gene locus_tag LOCUS_29230 457386 456457 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_29230 457784 457392 gene locus_tag LOCUS_29240 457784 457392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 458065 458538 gene locus_tag LOCUS_29250 gene rlmH 458065 458538 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_29250 458627 462286 gene locus_tag LOCUS_29260 458627 462286 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_29260 463083 462493 gene locus_tag LOCUS_29270 463083 462493 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_29270 463569 463153 gene locus_tag LOCUS_29280 gene arfB 463569 463153 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_29280 464466 463594 gene locus_tag LOCUS_29290 464466 463594 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_29290 465150 464482 gene locus_tag LOCUS_29300 465150 464482 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_29300 467170 465305 gene locus_tag LOCUS_29310 gene mutL 467170 465305 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760778.1 protein_id gnl|my_center|LOCUS_29310 467395 467180 gene locus_tag LOCUS_29320 467395 467180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 468387 467575 gene locus_tag LOCUS_29330 468387 467575 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_29330 468625 470163 gene locus_tag LOCUS_29340 468625 470163 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_29340 470418 475976 gene locus_tag LOCUS_29350 470418 475976 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_29350 476179 476559 gene locus_tag LOCUS_29360 476179 476559 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_29360 477153 479282 gene locus_tag LOCUS_29370 gene pbpC 477153 479282 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_29370 479964 479299 gene locus_tag LOCUS_29380 479964 479299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 480235 480864 gene locus_tag LOCUS_29390 480235 480864 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_29390 481407 480913 gene locus_tag LOCUS_29400 gene dfrA 481407 480913 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_29400 482215 481421 gene locus_tag LOCUS_29410 482215 481421 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_29410 483289 482381 gene locus_tag LOCUS_29420 gene xylF 483289 482381 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_29420 484990 483569 gene locus_tag LOCUS_29430 484990 483569 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_29430 485628 485044 gene locus_tag LOCUS_29440 485628 485044 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_29440 485899 486210 gene locus_tag LOCUS_29450 485899 486210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 486229 486495 gene locus_tag LOCUS_29460 gene rpmA 486229 486495 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_29460 486597 487871 gene locus_tag LOCUS_29470 gene serS 486597 487871 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_29470 489921 487954 gene locus_tag LOCUS_29480 489921 487954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 490595 490053 gene locus_tag LOCUS_29490 490595 490053 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_29490 491219 490599 gene locus_tag LOCUS_29500 491219 490599 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_29500 491663 492799 gene locus_tag LOCUS_29510 gene sucC 491663 492799 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765647.1 protein_id gnl|my_center|LOCUS_29510 492818 493699 gene locus_tag LOCUS_29520 gene sucD 492818 493699 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_29520 494471 493755 gene locus_tag LOCUS_29530 494471 493755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 496430 494664 gene locus_tag LOCUS_29540 496430 494664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 497618 496746 gene locus_tag LOCUS_29550 497618 496746 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_29550 498529 497621 gene locus_tag LOCUS_29560 498529 497621 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_29560 498743 499474 gene locus_tag LOCUS_29570 498743 499474 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_29570 500463 499579 gene locus_tag LOCUS_29580 500463 499579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 500637 501149 gene locus_tag LOCUS_29590 500637 501149 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_29590 501121 502008 gene locus_tag LOCUS_29600 501121 502008 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_29600 502015 504525 gene locus_tag LOCUS_29610 502015 504525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 504666 505364 gene locus_tag LOCUS_29620 504666 505364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 505434 506342 gene locus_tag LOCUS_29630 505434 506342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 507007 506339 gene locus_tag LOCUS_29640 507007 506339 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_29640 508095 507031 gene locus_tag LOCUS_29650 508095 507031 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_29650 508740 508177 gene locus_tag LOCUS_29660 508740 508177 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073479.1 protein_id gnl|my_center|LOCUS_29660 509096 511009 gene locus_tag LOCUS_29670 gene acs 509096 511009 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_29670 511281 514748 gene locus_tag LOCUS_29680 511281 514748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_29680 514901 515845 gene locus_tag LOCUS_29690 514901 515845 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_29690 517720 516041 gene locus_tag LOCUS_29700 517720 516041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 519634 518033 gene locus_tag LOCUS_29710 519634 518033 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_29710 519722 521233 gene locus_tag LOCUS_29720 519722 521233 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_29720 521359 522462 gene locus_tag LOCUS_29730 521359 522462 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_29730 522862 524328 gene locus_tag LOCUS_29740 522862 524328 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_29740 525388 524411 gene locus_tag LOCUS_29750 525388 524411 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 protein_id gnl|my_center|LOCUS_29750 526644 525568 gene locus_tag LOCUS_29760 gene orr 526644 525568 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_29760 528926 527043 gene locus_tag LOCUS_29770 528926 527043 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_29770 530675 529236 gene locus_tag LOCUS_29780 530675 529236 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_29780 530998 530684 gene locus_tag LOCUS_29790 530998 530684 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_29790 532137 531010 gene locus_tag LOCUS_29800 532137 531010 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_29800 532435 533037 gene locus_tag LOCUS_29810 532435 533037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 533785 533081 gene locus_tag LOCUS_29820 533785 533081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 535752 533947 gene locus_tag LOCUS_29830 gene typA 535752 533947 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_29830 536175 536324 gene locus_tag LOCUS_29840 536175 536324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 537234 536350 gene locus_tag LOCUS_29850 537234 536350 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_29850 541584 537328 gene locus_tag LOCUS_29860 541584 537328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 542891 541638 gene locus_tag LOCUS_29870 542891 541638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_29870 543404 542898 gene locus_tag LOCUS_29880 543404 542898 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_29880 543936 543415 gene locus_tag LOCUS_29890 543936 543415 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_29890 544468 543947 gene locus_tag LOCUS_29900 544468 543947 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_29900 544590 545069 gene locus_tag LOCUS_29910 544590 545069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 545862 545071 gene locus_tag LOCUS_29920 545862 545071 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_29920 546634 546032 gene locus_tag LOCUS_29930 gene hisIE 546634 546032 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_29930 547807 546641 gene locus_tag LOCUS_29940 547807 546641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 548614 547862 gene locus_tag LOCUS_29950 gene hisF 548614 547862 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_29950 549069 548707 gene locus_tag LOCUS_29960 549069 548707 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_29960 549920 549156 gene locus_tag LOCUS_29970 gene hisA 549920 549156 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_29970 550600 549986 gene locus_tag LOCUS_29980 gene hisH 550600 549986 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_29980 550972 550607 gene locus_tag LOCUS_29990 550972 550607 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963769.1 protein_id gnl|my_center|LOCUS_29990 551549 551019 gene locus_tag LOCUS_30000 551549 551019 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 protein_id gnl|my_center|LOCUS_30000 552483 551599 gene locus_tag LOCUS_30010 gene purU 552483 551599 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_30010 553703 552579 gene locus_tag LOCUS_30020 gene hisB 553703 552579 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_30020 554776 553745 gene locus_tag LOCUS_30030 gene hisC 554776 553745 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_30030 556150 554858 gene locus_tag LOCUS_30040 gene hisD 556150 554858 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_30040 557132 556275 gene locus_tag LOCUS_30050 gene hisG 557132 556275 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_30050 557558 558649 gene locus_tag LOCUS_30060 557558 558649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 559924 558761 gene locus_tag LOCUS_30070 gene dnaJ 559924 558761 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_30070 560551 559940 gene locus_tag LOCUS_30080 560551 559940 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_30080 561238 560714 gene locus_tag LOCUS_30090 561238 560714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 562667 561360 gene locus_tag LOCUS_30100 gene murA 562667 561360 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_30100 563299 562682 gene locus_tag LOCUS_30110 563299 562682 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_30110 565806 563491 gene locus_tag LOCUS_30120 565806 563491 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_30120 566077 567357 gene locus_tag LOCUS_30130 566077 567357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 569689 567533 gene locus_tag LOCUS_30140 569689 567533 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_30140 570089 570409 gene locus_tag LOCUS_30150 570089 570409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 570539 572728 gene locus_tag LOCUS_30160 570539 572728 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_30160 572815 574128 gene locus_tag LOCUS_30170 572815 574128 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_30170 574394 574768 gene locus_tag LOCUS_30180 gene rpsL 574394 574768 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_30180 574885 575361 gene locus_tag LOCUS_30190 gene rpsG 574885 575361 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_30190 575425 577536 gene locus_tag LOCUS_30200 gene fusA 575425 577536 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_30200 577558 577863 gene locus_tag LOCUS_30210 gene rpsJ 577558 577863 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_30210 577885 578502 gene locus_tag LOCUS_30220 gene rplC 577885 578502 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_30220 578502 579131 gene locus_tag LOCUS_30230 gene rplD 578502 579131 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_30230 579144 579434 gene locus_tag LOCUS_30240 gene rplW 579144 579434 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_30240 579444 580268 gene locus_tag LOCUS_30250 gene rplB 579444 580268 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_30250 580284 580550 gene locus_tag LOCUS_30260 gene rpsS 580284 580550 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762037.1 protein_id gnl|my_center|LOCUS_30260 580587 581000 gene locus_tag LOCUS_30270 gene rplV 580587 581000 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_30270 581011 581730 gene locus_tag LOCUS_30280 gene rpsC 581011 581730 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_30280 581757 582191 gene locus_tag LOCUS_30290 gene rplP 581757 582191 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_30290 582194 582397 gene locus_tag LOCUS_30300 gene rpmC 582194 582397 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 protein_id gnl|my_center|LOCUS_30300 582408 582665 gene locus_tag LOCUS_30310 gene rpsQ 582408 582665 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_30310 582668 583033 gene locus_tag LOCUS_30320 gene rplN 582668 583033 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_30320 583033 583374 gene locus_tag LOCUS_30330 gene rplX 583033 583374 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_30330 583374 583931 gene locus_tag LOCUS_30340 gene rplE 583374 583931 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_30340 583935 584204 gene locus_tag LOCUS_30350 gene rpsN 583935 584204 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_30350 584223 584630 gene locus_tag LOCUS_30360 gene rpsH 584223 584630 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_30360 584646 585203 gene locus_tag LOCUS_30370 gene rplF 584646 585203 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_30370 585218 585574 gene locus_tag LOCUS_30380 gene rplR 585218 585574 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_30380 585574 586095 gene locus_tag LOCUS_30390 gene rpsE 585574 586095 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_30390 586101 586280 gene locus_tag LOCUS_30400 gene rpmD 586101 586280 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_30400 586301 586747 gene locus_tag LOCUS_30410 gene rplO 586301 586747 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_30410 586752 588095 gene locus_tag LOCUS_30420 gene secY 586752 588095 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_30420 588140 588361 gene locus_tag LOCUS_30430 gene infA 588140 588361 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_30430 588517 588894 gene locus_tag LOCUS_30440 gene rpsM 588517 588894 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_30440 588906 589295 gene locus_tag LOCUS_30450 gene rpsK 588906 589295 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_30450 589314 589922 gene locus_tag LOCUS_30460 gene rpsD 589314 589922 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_30460 589981 590934 gene locus_tag LOCUS_30470 589981 590934 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_30470 590941 591495 gene locus_tag LOCUS_30480 590941 591495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 592704 591556 gene locus_tag LOCUS_30490 592704 591556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 592888 593568 gene locus_tag LOCUS_30500 592888 593568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 594005 593640 gene locus_tag LOCUS_30510 594005 593640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 594144 595829 gene locus_tag LOCUS_30520 gene ettA 594144 595829 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_30520 597601 595931 gene locus_tag LOCUS_30530 597601 595931 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_30530 600965 597612 gene locus_tag LOCUS_30540 600965 597612 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_30540 602117 601116 gene locus_tag LOCUS_30550 602117 601116 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_30550 602922 602194 gene locus_tag LOCUS_30560 602922 602194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 603170 604456 gene locus_tag LOCUS_30570 603170 604456 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_30570 604499 607000 gene locus_tag LOCUS_30580 gene priA 604499 607000 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108457.1 protein_id gnl|my_center|LOCUS_30580 607186 608187 gene locus_tag LOCUS_30590 gene rfaE1 607186 608187 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_30590 608305 609105 gene locus_tag LOCUS_30600 608305 609105 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_30600 609121 609993 gene locus_tag LOCUS_30610 609121 609993 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_30610 610017 610619 gene locus_tag LOCUS_30620 610017 610619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 610623 612245 gene locus_tag LOCUS_30630 610623 612245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 612315 613691 gene locus_tag LOCUS_30640 612315 613691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964011.1 protein_id gnl|my_center|LOCUS_30640 613663 615183 gene locus_tag LOCUS_30650 613663 615183 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_30650 615322 616236 gene locus_tag LOCUS_30660 615322 616236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 616653 616243 gene locus_tag LOCUS_30670 616653 616243 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_30670 617052 616870 gene locus_tag LOCUS_30680 617052 616870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 617226 619055 gene locus_tag LOCUS_30690 gene ilvD 617226 619055 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_30690 619080 620780 gene locus_tag LOCUS_30700 gene ilvB 619080 620780 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_30700 620815 621357 gene locus_tag LOCUS_30710 gene ilvN 620815 621357 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_30710 621610 622608 gene locus_tag LOCUS_30720 gene gap 621610 622608 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_30720 623678 622686 gene locus_tag LOCUS_30730 623678 622686 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141824.1 protein_id gnl|my_center|LOCUS_30730 623849 624736 gene locus_tag LOCUS_30740 623849 624736 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_30740 624987 626462 gene locus_tag LOCUS_30750 gene ilvC 624987 626462 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_30750 626729 627829 gene locus_tag LOCUS_30760 626729 627829 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_30760 628131 628943 gene locus_tag LOCUS_30770 628131 628943 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_30770 629178 629591 gene locus_tag LOCUS_30780 629178 629591 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 protein_id gnl|my_center|LOCUS_30780 629928 629581 gene locus_tag LOCUS_30790 629928 629581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 630484 629930 gene locus_tag LOCUS_30800 630484 629930 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_30800 630851 630495 gene locus_tag LOCUS_30810 630851 630495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 631455 632957 gene locus_tag LOCUS_30820 631455 632957 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789851.1 protein_id gnl|my_center|LOCUS_30820 632989 634389 gene locus_tag LOCUS_30830 gene leuC 632989 634389 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_30830 634456 634836 gene locus_tag LOCUS_30840 634456 634836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 634882 635466 gene locus_tag LOCUS_30850 gene leuD 634882 635466 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_30850 635479 637023 gene locus_tag LOCUS_30860 635479 637023 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_30860 637196 638260 gene locus_tag LOCUS_30870 gene leuB 637196 638260 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_30870 638411 639076 gene locus_tag LOCUS_30880 638411 639076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 639622 639170 gene locus_tag LOCUS_30890 639622 639170 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_30890 640797 640063 gene locus_tag LOCUS_30900 gene rluF 640797 640063 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_30900 641085 641963 gene locus_tag LOCUS_30910 641085 641963 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_30910 642817 642008 gene locus_tag LOCUS_30920 642817 642008 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845312.1 protein_id gnl|my_center|LOCUS_30920 643225 642869 gene locus_tag LOCUS_30930 643225 642869 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108047.1 protein_id gnl|my_center|LOCUS_30930 643672 643316 gene locus_tag LOCUS_30940 643672 643316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 644458 643691 gene locus_tag LOCUS_30950 644458 643691 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766786.1 protein_id gnl|my_center|LOCUS_30950 645204 644773 gene locus_tag LOCUS_30960 645204 644773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 645527 648496 gene locus_tag LOCUS_30970 645527 648496 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_30970 648918 648556 gene locus_tag LOCUS_30980 648918 648556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 649448 648924 gene locus_tag LOCUS_30990 649448 648924 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_30990 649702 649466 gene locus_tag LOCUS_31000 649702 649466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 649850 650446 gene locus_tag LOCUS_31010 649850 650446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 650504 651472 gene locus_tag LOCUS_31020 650504 651472 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_31020 654007 651533 gene locus_tag LOCUS_31030 654007 651533 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_31030 654324 654848 gene locus_tag LOCUS_31040 654324 654848 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_31040 654860 655270 gene locus_tag LOCUS_31050 654860 655270 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731152.1 protein_id gnl|my_center|LOCUS_31050 655938 655330 gene locus_tag LOCUS_31060 655938 655330 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_31060 657241 655946 gene locus_tag LOCUS_31070 657241 655946 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_31070 657783 657475 gene locus_tag LOCUS_31080 gene groES 657783 657475 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726504.1 protein_id gnl|my_center|LOCUS_31080 658292 657792 gene locus_tag LOCUS_31090 gene trxA 658292 657792 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_31090 658879 658289 gene locus_tag LOCUS_31100 658879 658289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 659053 659733 gene locus_tag LOCUS_31110 659053 659733 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764239.1 protein_id gnl|my_center|LOCUS_31110 659883 661976 gene locus_tag LOCUS_31120 659883 661976 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_31120 663597 662089 gene locus_tag LOCUS_31130 663597 662089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 665038 664310 gene locus_tag LOCUS_31140 gene pgl 665038 664310 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_31140 666579 665071 gene locus_tag LOCUS_31150 gene zwf 666579 665071 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626064.1 protein_id gnl|my_center|LOCUS_31150 667276 666650 gene locus_tag LOCUS_31160 667276 666650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 667842 667276 gene locus_tag LOCUS_31170 gene gldD 667842 667276 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_31170 669184 667847 gene locus_tag LOCUS_31180 669184 667847 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_31180 669647 669204 gene locus_tag LOCUS_31190 669647 669204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 670826 669777 gene locus_tag LOCUS_31200 gene mutY 670826 669777 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_31200 670970 671257 gene locus_tag LOCUS_31210 670970 671257 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_31210 671485 673035 gene locus_tag LOCUS_31220 671485 673035 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_31220 673254 675278 gene locus_tag LOCUS_31230 673254 675278 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_31230 675620 676150 gene locus_tag LOCUS_31240 675620 676150 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_31240 676270 676581 gene locus_tag LOCUS_31250 676270 676581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 676587 677390 gene locus_tag LOCUS_31260 676587 677390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 677557 677922 gene locus_tag LOCUS_31270 677557 677922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 678725 678348 gene locus_tag LOCUS_31280 678725 678348 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_31280 679760 678738 gene locus_tag LOCUS_31290 679760 678738 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_31290 680458 679760 gene locus_tag LOCUS_31300 680458 679760 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_31300 680847 680461 gene locus_tag LOCUS_31310 680847 680461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 681127 680888 gene locus_tag LOCUS_31320 681127 680888 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_31320 681481 681182 gene locus_tag LOCUS_31330 681481 681182 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_31330 681664 682713 gene locus_tag LOCUS_31340 681664 682713 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_31340 682819 685695 gene locus_tag LOCUS_31350 682819 685695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 685698 686684 gene locus_tag LOCUS_31360 685698 686684 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_31360 688570 687152 gene locus_tag LOCUS_31370 688570 687152 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_31370 693140 688617 gene locus_tag LOCUS_31380 gene gltB 693140 688617 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_31380 694793 693462 gene locus_tag LOCUS_31390 gene argH 694793 693462 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_31390 695014 696639 gene locus_tag LOCUS_31400 695014 696639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 696696 698360 gene locus_tag LOCUS_31410 696696 698360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 698433 700067 gene locus_tag LOCUS_31420 698433 700067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 700466 701116 gene locus_tag LOCUS_31430 700466 701116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_31430 701188 701634 gene locus_tag LOCUS_31440 701188 701634 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_31440 701662 702879 gene locus_tag LOCUS_31450 701662 702879 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_31450 703100 703543 gene locus_tag LOCUS_31460 703100 703543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 705712 703694 gene locus_tag LOCUS_31470 gene uvrB 705712 703694 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_31470 706808 705810 gene locus_tag LOCUS_31480 706808 705810 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_31480 707748 707140 gene locus_tag LOCUS_31490 707748 707140 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_31490 709994 708141 gene locus_tag LOCUS_31500 709994 708141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 711079 710483 gene locus_tag LOCUS_31510 711079 710483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783531.1 protein_id gnl|my_center|LOCUS_31510 711580 711098 gene locus_tag LOCUS_31520 711580 711098 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783529.1 protein_id gnl|my_center|LOCUS_31520 711836 712150 gene locus_tag LOCUS_31530 711836 712150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 712325 712711 gene locus_tag LOCUS_31540 712325 712711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 712901 713197 gene locus_tag LOCUS_31550 712901 713197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 714558 713266 gene locus_tag LOCUS_31560 714558 713266 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_31560 715125 714742 gene locus_tag LOCUS_31570 715125 714742 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_31570 716412 715252 gene locus_tag LOCUS_31580 716412 715252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 717611 716838 gene locus_tag LOCUS_31590 gene map 717611 716838 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_31590 717707 718447 gene locus_tag LOCUS_31600 717707 718447 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_31600 719532 718600 gene locus_tag LOCUS_31610 gene miaA 719532 718600 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_31610 719586 720170 gene locus_tag LOCUS_31620 719586 720170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 720160 720618 gene locus_tag LOCUS_31630 gene smpB 720160 720618 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_31630 720721 721698 gene locus_tag LOCUS_31640 720721 721698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 722471 721749 gene locus_tag LOCUS_31650 722471 721749 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_31650 723079 722474 gene locus_tag LOCUS_31660 gene udk 723079 722474 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_31660 723202 723501 gene locus_tag LOCUS_31670 723202 723501 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_31670 723523 724503 gene locus_tag LOCUS_31680 723523 724503 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_31680 724610 725197 gene locus_tag LOCUS_31690 gene yihA 724610 725197 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_31690 725359 726297 gene locus_tag LOCUS_31700 725359 726297 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_31700 726408 727016 gene locus_tag LOCUS_31710 726408 727016 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_31710 726991 727668 gene locus_tag LOCUS_31720 gene pth 726991 727668 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_31720 727670 728050 gene locus_tag LOCUS_31730 727670 728050 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_31730 728053 728595 gene locus_tag LOCUS_31740 728053 728595 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_31740 728999 728592 gene locus_tag LOCUS_31750 728999 728592 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_31750 730024 728996 gene locus_tag LOCUS_31760 730024 728996 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766270.1 protein_id gnl|my_center|LOCUS_31760 730217 730894 gene locus_tag LOCUS_31770 730217 730894 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_31770 730887 731810 gene locus_tag LOCUS_31780 730887 731810 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_31780 732218 733411 gene locus_tag LOCUS_31790 732218 733411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 733997 734086 gene locus_tag LOCUS_t00340 733997 734086 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 734101 734176 gene locus_tag LOCUS_t00350 734101 734176 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 734691 736166 gene locus_tag LOCUS_31800 734691 736166 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_31800 736404 736808 gene locus_tag LOCUS_31810 736404 736808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 737154 737564 gene locus_tag LOCUS_31820 737154 737564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 738039 738515 gene locus_tag LOCUS_31830 738039 738515 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963082.1 protein_id gnl|my_center|LOCUS_31830 738580 738981 gene locus_tag LOCUS_31840 738580 738981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 739088 739639 gene locus_tag LOCUS_31850 739088 739639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 739898 740140 gene locus_tag LOCUS_31860 739898 740140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 740488 741483 gene locus_tag LOCUS_31870 740488 741483 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706810.1 protein_id gnl|my_center|LOCUS_31870 743770 741530 gene locus_tag LOCUS_31880 743770 741530 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_31880 745380 744067 gene locus_tag LOCUS_31890 745380 744067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 747253 745892 gene locus_tag LOCUS_31900 747253 745892 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_31900 747918 747394 gene locus_tag LOCUS_31910 747918 747394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 748504 747986 gene locus_tag LOCUS_31920 748504 747986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 749203 750330 gene locus_tag LOCUS_31930 749203 750330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 750990 751850 gene locus_tag LOCUS_31940 750990 751850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 751934 755038 gene locus_tag LOCUS_31950 751934 755038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 756966 755311 gene locus_tag LOCUS_31960 756966 755311 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_31960 760457 758040 gene locus_tag LOCUS_31970 760457 758040 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_31970 761109 761765 gene locus_tag LOCUS_31980 761109 761765 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_31980 763049 761859 gene locus_tag LOCUS_31990 763049 761859 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_31990 763048 763230 gene locus_tag LOCUS_32000 763048 763230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 763272 763835 gene locus_tag LOCUS_32010 763272 763835 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681497.1 protein_id gnl|my_center|LOCUS_32010 763940 764884 gene locus_tag LOCUS_32020 763940 764884 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202057.1 protein_id gnl|my_center|LOCUS_32020 765089 768478 gene locus_tag LOCUS_32030 765089 768478 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763977.1 protein_id gnl|my_center|LOCUS_32030 768548 770245 gene locus_tag LOCUS_32040 768548 770245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 770471 771820 gene locus_tag LOCUS_32050 770471 771820 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_32050 772026 774509 gene locus_tag LOCUS_32060 772026 774509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 774587 775444 gene locus_tag LOCUS_32070 774587 775444 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_32070 775479 776888 gene locus_tag LOCUS_32080 775479 776888 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_32080 776897 777619 gene locus_tag LOCUS_32090 776897 777619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 777846 779873 gene locus_tag LOCUS_32100 777846 779873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 779934 782729 gene locus_tag LOCUS_32110 779934 782729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 782862 785321 gene locus_tag LOCUS_32120 782862 785321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108901.1 protein_id gnl|my_center|LOCUS_32120 785552 786115 gene locus_tag LOCUS_32130 785552 786115 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 protein_id gnl|my_center|LOCUS_32130 786542 786141 gene locus_tag LOCUS_32140 786542 786141 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_32140 786864 793235 gene locus_tag LOCUS_32150 786864 793235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 793265 794455 gene locus_tag LOCUS_32160 793265 794455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 794735 796216 gene locus_tag LOCUS_32170 794735 796216 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_32170 796332 796538 gene locus_tag LOCUS_32180 796332 796538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 796483 797052 gene locus_tag LOCUS_32190 796483 797052 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_32190 797184 798167 gene locus_tag LOCUS_32200 797184 798167 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_32200 798364 801618 gene locus_tag LOCUS_32210 798364 801618 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_32210 801630 803102 gene locus_tag LOCUS_32220 gene nanU 801630 803102 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_32220 803363 804376 gene locus_tag LOCUS_32230 803363 804376 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_32230 804518 807382 gene locus_tag LOCUS_32240 804518 807382 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_32240 807400 808719 gene locus_tag LOCUS_32250 807400 808719 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_32250 808730 811444 gene locus_tag LOCUS_32260 808730 811444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 811475 812779 gene locus_tag LOCUS_32270 811475 812779 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_32270 812793 814169 gene locus_tag LOCUS_32280 812793 814169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 814193 814885 gene locus_tag LOCUS_32290 814193 814885 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_32290 814908 815711 gene locus_tag LOCUS_32300 814908 815711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_32300 815711 816769 gene locus_tag LOCUS_32310 815711 816769 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_32310 816861 817925 gene locus_tag LOCUS_32320 816861 817925 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_32320 818620 819009 gene locus_tag LOCUS_32330 818620 819009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 819070 820617 gene locus_tag LOCUS_32340 819070 820617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 820614 822041 gene locus_tag LOCUS_32350 820614 822041 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_32350 822118 824178 gene locus_tag LOCUS_32360 822118 824178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 824243 825466 gene locus_tag LOCUS_32370 824243 825466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 825471 826640 gene locus_tag LOCUS_32380 825471 826640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 826801 828816 gene locus_tag LOCUS_32390 826801 828816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 828936 830300 gene locus_tag LOCUS_32400 828936 830300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 830499 831161 gene locus_tag LOCUS_32410 830499 831161 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_32410 831250 831909 gene locus_tag LOCUS_32420 831250 831909 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947229.1 protein_id gnl|my_center|LOCUS_32420 832037 832462 gene locus_tag LOCUS_32430 832037 832462 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_32430 832556 833737 gene locus_tag LOCUS_32440 832556 833737 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_32440 833748 835541 gene locus_tag LOCUS_32450 833748 835541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 835745 836221 gene locus_tag LOCUS_32460 835745 836221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 836647 837636 gene locus_tag LOCUS_32470 836647 837636 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_32470 837664 838410 gene locus_tag LOCUS_32480 837664 838410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 838424 839533 gene locus_tag LOCUS_32490 838424 839533 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_32490 840521 839661 gene locus_tag LOCUS_32500 840521 839661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32500 841106 840588 gene locus_tag LOCUS_32510 841106 840588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32510 844498 841181 gene locus_tag LOCUS_32520 844498 841181 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_32520 846716 844656 gene locus_tag LOCUS_32530 846716 844656 CDS product Sip1-related alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785073.1 protein_id gnl|my_center|LOCUS_32530 849966 846754 gene locus_tag LOCUS_32540 849966 846754 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_32540 852746 849978 gene locus_tag LOCUS_32550 852746 849978 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_32550 854218 852839 gene locus_tag LOCUS_32560 854218 852839 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_32560 854501 855370 gene locus_tag LOCUS_32570 854501 855370 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_32570 859930 856478 gene locus_tag LOCUS_32580 859930 856478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 861306 860431 gene locus_tag LOCUS_32590 861306 860431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 863226 861346 gene locus_tag LOCUS_32600 863226 861346 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788911.1 protein_id gnl|my_center|LOCUS_32600 866589 863248 gene locus_tag LOCUS_32610 866589 863248 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203145.1 protein_id gnl|my_center|LOCUS_32610 867763 866744 gene locus_tag LOCUS_32620 867763 866744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 868432 867842 gene locus_tag LOCUS_32630 868432 867842 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_32630 868626 870452 gene locus_tag LOCUS_32640 868626 870452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 870856 871467 gene locus_tag LOCUS_32650 870856 871467 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_32650 871609 872592 gene locus_tag LOCUS_32660 871609 872592 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_32660 872751 876047 gene locus_tag LOCUS_32670 872751 876047 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_32670 876060 877589 gene locus_tag LOCUS_32680 876060 877589 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_32680 877601 879775 gene locus_tag LOCUS_32690 877601 879775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 879902 881200 gene locus_tag LOCUS_32700 879902 881200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 881193 882422 gene locus_tag LOCUS_32710 881193 882422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 882440 884674 gene locus_tag LOCUS_32720 882440 884674 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168127696.1 protein_id gnl|my_center|LOCUS_32720 885946 884753 gene locus_tag LOCUS_32730 885946 884753 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_32730 887121 885943 gene locus_tag LOCUS_32740 887121 885943 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_32740 889143 887317 gene locus_tag LOCUS_32750 889143 887317 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_32750 889295 890179 gene locus_tag LOCUS_32760 889295 890179 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_32760 891710 890286 gene locus_tag LOCUS_32770 891710 890286 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_32770 893540 891936 gene locus_tag LOCUS_32780 893540 891936 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107596.1 protein_id gnl|my_center|LOCUS_32780 897254 893568 gene locus_tag LOCUS_32790 897254 893568 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_32790 898425 897394 gene locus_tag LOCUS_32800 898425 897394 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_32800 899296 898712 gene locus_tag LOCUS_32810 899296 898712 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_32810 900358 899453 gene locus_tag LOCUS_32820 900358 899453 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_32820 900642 900983 gene locus_tag LOCUS_32830 900642 900983 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_32830 901123 902631 gene locus_tag LOCUS_32840 gene glpK 901123 902631 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_32840 902773 904341 gene locus_tag LOCUS_32850 902773 904341 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_32850 904386 905882 gene locus_tag LOCUS_32860 gene glpK 904386 905882 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404221.1 protein_id gnl|my_center|LOCUS_32860 905910 906647 gene locus_tag LOCUS_32870 905910 906647 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_32870 906794 908185 gene locus_tag LOCUS_32880 gene glpT 906794 908185 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705541.1 protein_id gnl|my_center|LOCUS_32880 908209 909138 gene locus_tag LOCUS_32890 908209 909138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 909176 909943 gene locus_tag LOCUS_32900 909176 909943 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_32900 910312 911703 gene locus_tag LOCUS_32910 910312 911703 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_32910 912239 911859 gene locus_tag LOCUS_32920 912239 911859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 913169 912321 gene locus_tag LOCUS_32930 913169 912321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 913323 913901 gene locus_tag LOCUS_32940 913323 913901 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_32940 913980 914969 gene locus_tag LOCUS_32950 913980 914969 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_32950 915272 918559 gene locus_tag LOCUS_32960 915272 918559 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_32960 918585 920306 gene locus_tag LOCUS_32970 918585 920306 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_32970 920515 922092 gene locus_tag LOCUS_32980 920515 922092 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767894.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence16 60 1565 gene locus_tag LOCUS_32990 60 1565 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_32990 1708 2517 gene locus_tag LOCUS_33000 1708 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2785 4572 gene locus_tag LOCUS_33010 2785 4572 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479087.1 protein_id gnl|my_center|LOCUS_33010 4757 5359 gene locus_tag LOCUS_33020 4757 5359 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763953.1 protein_id gnl|my_center|LOCUS_33020 5476 6465 gene locus_tag LOCUS_33030 5476 6465 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_33030 6617 10027 gene locus_tag LOCUS_33040 6617 10027 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_33040 10051 11667 gene locus_tag LOCUS_33050 10051 11667 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_33050 11953 13326 gene locus_tag LOCUS_33060 11953 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 13538 14548 gene locus_tag LOCUS_33070 13538 14548 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_33070 14611 16188 gene locus_tag LOCUS_33080 14611 16188 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_33080 16341 17345 gene locus_tag LOCUS_33090 16341 17345 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_33090 17348 19435 gene locus_tag LOCUS_33100 17348 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 19467 20498 gene locus_tag LOCUS_33110 19467 20498 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_33110 21178 20627 gene locus_tag LOCUS_33120 21178 20627 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_33120 21988 21191 gene locus_tag LOCUS_33130 21988 21191 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_33130 23087 21993 gene locus_tag LOCUS_33140 23087 21993 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_33140 24071 23496 gene locus_tag LOCUS_33150 24071 23496 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_33150 25399 24083 gene locus_tag LOCUS_33160 25399 24083 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_33160 26337 25813 gene locus_tag LOCUS_33170 gene fldA 26337 25813 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705429.1 protein_id gnl|my_center|LOCUS_33170 27193 26354 gene locus_tag LOCUS_33180 27193 26354 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_33180 28149 27721 gene locus_tag LOCUS_33190 28149 27721 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_33190 29457 28159 gene locus_tag LOCUS_33200 29457 28159 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_33200 31060 29474 gene locus_tag LOCUS_33210 31060 29474 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_33210 31622 31443 gene locus_tag LOCUS_33220 31622 31443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877459.1 protein_id gnl|my_center|LOCUS_33220 32071 31622 gene locus_tag LOCUS_33230 32071 31622 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_33230 33395 32082 gene locus_tag LOCUS_33240 33395 32082 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786583.1 protein_id gnl|my_center|LOCUS_33240 34652 33432 gene locus_tag LOCUS_33250 34652 33432 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108770.1 protein_id gnl|my_center|LOCUS_33250 35215 35709 gene locus_tag LOCUS_33260 gene nrfH 35215 35709 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_33260 35722 37236 gene locus_tag LOCUS_33270 gene nrfA 35722 37236 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_33270 37337 38557 gene locus_tag LOCUS_33280 37337 38557 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_33280 38752 40002 gene locus_tag LOCUS_33290 38752 40002 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107763.1 protein_id gnl|my_center|LOCUS_33290 39989 40792 gene locus_tag LOCUS_33300 gene ccsA 39989 40792 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_33300 40920 42449 gene locus_tag LOCUS_33310 40920 42449 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_33310 43279 42527 gene locus_tag LOCUS_33320 43279 42527 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_33320 43813 43418 gene locus_tag LOCUS_33330 43813 43418 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_33330 44144 45490 gene locus_tag LOCUS_33340 44144 45490 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_33340 45842 48058 gene locus_tag LOCUS_33350 45842 48058 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_33350 48304 49824 gene locus_tag LOCUS_33360 48304 49824 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_33360 50285 49884 gene locus_tag LOCUS_33370 50285 49884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 52262 50289 gene locus_tag LOCUS_33380 52262 50289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 52814 52350 gene locus_tag LOCUS_33390 52814 52350 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_33390 52813 52992 gene locus_tag LOCUS_33400 52813 52992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 53171 53635 gene locus_tag LOCUS_33410 gene nuoE 53171 53635 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_33410 53642 54829 gene locus_tag LOCUS_33420 53642 54829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 54848 56638 gene locus_tag LOCUS_33430 54848 56638 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_33430 58299 58499 gene locus_tag LOCUS_33440 58299 58499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 58887 60419 gene locus_tag LOCUS_33450 58887 60419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence17 151 894 gene locus_tag LOCUS_33460 151 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1056 1817 gene locus_tag LOCUS_33470 1056 1817 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_33470 2032 3303 gene locus_tag LOCUS_33480 2032 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3888 3436 gene locus_tag LOCUS_33490 3888 3436 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_33490 5397 4189 gene locus_tag LOCUS_33500 5397 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 5636 6943 gene locus_tag LOCUS_33510 5636 6943 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_33510 6997 7506 gene locus_tag LOCUS_33520 6997 7506 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966535.1 protein_id gnl|my_center|LOCUS_33520 8630 7539 gene locus_tag LOCUS_33530 gene hydE 8630 7539 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_33530 8915 9484 gene locus_tag LOCUS_33540 8915 9484 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_33540 9762 10688 gene locus_tag LOCUS_33550 9762 10688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_33550 10693 12015 gene locus_tag LOCUS_33560 10693 12015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_33560 12187 13161 gene locus_tag LOCUS_33570 gene cysK 12187 13161 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_33570 13344 14216 gene locus_tag LOCUS_33580 13344 14216 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_33580 14507 15067 gene locus_tag LOCUS_33590 14507 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 15253 16773 gene locus_tag LOCUS_33600 15253 16773 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_33600 18407 16902 gene locus_tag LOCUS_33610 18407 16902 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_33610 18877 18521 gene locus_tag LOCUS_33620 18877 18521 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990834.1 protein_id gnl|my_center|LOCUS_33620 19133 20047 gene locus_tag LOCUS_33630 19133 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 20123 21037 gene locus_tag LOCUS_33640 20123 21037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 21088 22251 gene locus_tag LOCUS_33650 21088 22251 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_33650 22671 23417 gene locus_tag LOCUS_33660 22671 23417 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_33660 24517 25404 gene locus_tag LOCUS_33670 24517 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 26881 25406 gene locus_tag LOCUS_33680 26881 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 27019 29286 gene locus_tag LOCUS_33690 27019 29286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 29440 31617 gene locus_tag LOCUS_33700 29440 31617 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_33700 31668 32153 gene locus_tag LOCUS_33710 gene coaD 31668 32153 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_33710 32128 33567 gene locus_tag LOCUS_33720 32128 33567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 34359 33715 gene locus_tag LOCUS_33730 34359 33715 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_33730 34394 35026 gene locus_tag LOCUS_33740 gene pyrE 34394 35026 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_33740 35101 35550 gene locus_tag LOCUS_33750 35101 35550 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_33750 35644 36342 gene locus_tag LOCUS_33760 35644 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 36339 36941 gene locus_tag LOCUS_33770 36339 36941 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_33770 37107 37391 gene locus_tag LOCUS_33780 37107 37391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 37588 38259 gene locus_tag LOCUS_33790 37588 38259 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_33790 38262 38945 gene locus_tag LOCUS_33800 38262 38945 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_33800 40323 38968 gene locus_tag LOCUS_33810 gene gntU 40323 38968 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_33810 41203 40436 gene locus_tag LOCUS_33820 41203 40436 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_33820 41396 41773 gene locus_tag LOCUS_33830 gene rsfS 41396 41773 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_33830 41779 43806 gene locus_tag LOCUS_33840 gene ftsH 41779 43806 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_33840 43817 44452 gene locus_tag LOCUS_33850 43817 44452 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_33850 44462 44668 gene locus_tag LOCUS_33860 44462 44668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 44665 45477 gene locus_tag LOCUS_33870 44665 45477 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_33870 45656 46312 gene locus_tag LOCUS_33880 45656 46312 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_33880 46312 47061 gene locus_tag LOCUS_33890 gene pssA 46312 47061 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_33890 48503 47376 gene locus_tag LOCUS_33900 gene cydB 48503 47376 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_33900 50074 48503 gene locus_tag LOCUS_33910 50074 48503 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786918.1 protein_id gnl|my_center|LOCUS_33910 50306 50082 gene locus_tag LOCUS_33920 50306 50082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 50866 53136 gene locus_tag LOCUS_33930 50866 53136 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_33930 53291 53500 gene locus_tag LOCUS_33940 53291 53500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 53506 55662 gene locus_tag LOCUS_33950 gene ccoN 53506 55662 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_33950 55666 55845 gene locus_tag LOCUS_33960 55666 55845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 55864 56511 gene locus_tag LOCUS_33970 55864 56511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 56544 57956 gene locus_tag LOCUS_33980 gene ccoG 56544 57956 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_33980 57969 58418 gene locus_tag LOCUS_33990 57969 58418 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_33990 58415 59137 gene locus_tag LOCUS_34000 58415 59137 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_34000 59362 60162 gene locus_tag LOCUS_34010 59362 60162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 60175 61791 gene locus_tag LOCUS_34020 gene ctaD 60175 61791 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939102.1 protein_id gnl|my_center|LOCUS_34020 61809 62426 gene locus_tag LOCUS_34030 61809 62426 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_34030 62438 62725 gene locus_tag LOCUS_34040 62438 62725 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939100.1 protein_id gnl|my_center|LOCUS_34040 62731 63675 gene locus_tag LOCUS_34050 62731 63675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 63672 64547 gene locus_tag LOCUS_34060 63672 64547 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939098.1 protein_id gnl|my_center|LOCUS_34060 64607 65083 gene locus_tag LOCUS_34070 64607 65083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 65225 65530 gene locus_tag LOCUS_34080 65225 65530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 65855 66250 gene locus_tag LOCUS_34090 65855 66250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 67483 66323 gene locus_tag LOCUS_34100 67483 66323 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_34100 68077 67508 gene locus_tag LOCUS_34110 68077 67508 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_34110 68590 68102 gene locus_tag LOCUS_34120 68590 68102 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_34120 70023 68596 gene locus_tag LOCUS_34130 gene nrfD 70023 68596 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_34130 72993 70048 gene locus_tag LOCUS_34140 72993 70048 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_34140 74137 73025 gene locus_tag LOCUS_34150 74137 73025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 75551 74439 gene locus_tag LOCUS_34160 75551 74439 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_34160 75734 76489 gene locus_tag LOCUS_34170 75734 76489 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_34170 76489 77256 gene locus_tag LOCUS_34180 76489 77256 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921829.1 protein_id gnl|my_center|LOCUS_34180 79693 77264 gene locus_tag LOCUS_34190 gene lon 79693 77264 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_34190 80981 79797 gene locus_tag LOCUS_34200 80981 79797 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_34200 81322 81059 gene locus_tag LOCUS_34210 81322 81059 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_34210 82578 81403 gene locus_tag LOCUS_34220 82578 81403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679144.1 protein_id gnl|my_center|LOCUS_34220 83806 82640 gene locus_tag LOCUS_34230 83806 82640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_34230 84862 84089 gene locus_tag LOCUS_34240 84862 84089 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_34240 85653 84973 gene locus_tag LOCUS_34250 85653 84973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 86959 85655 gene locus_tag LOCUS_34260 86959 85655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 87732 87109 gene locus_tag LOCUS_34270 87732 87109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 88387 87782 gene locus_tag LOCUS_34280 88387 87782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 88946 88431 gene locus_tag LOCUS_34290 88946 88431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 89930 88989 gene locus_tag LOCUS_34300 gene nrfD 89930 88989 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_34300 90474 89941 gene locus_tag LOCUS_34310 90474 89941 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_34310 92714 90471 gene locus_tag LOCUS_34320 92714 90471 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_34320 93444 92929 gene locus_tag LOCUS_34330 gene mobA 93444 92929 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633519.1 protein_id gnl|my_center|LOCUS_34330 93589 93663 gene locus_tag LOCUS_t00360 93589 93663 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 94672 93761 gene locus_tag LOCUS_34340 94672 93761 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_34340 96925 94817 gene locus_tag LOCUS_34350 96925 94817 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_34350 97390 99753 gene locus_tag LOCUS_34360 97390 99753 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_34360 99764 100768 gene locus_tag LOCUS_34370 99764 100768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 100925 103378 gene locus_tag LOCUS_34380 gene pheT 100925 103378 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107364.1 protein_id gnl|my_center|LOCUS_34380 103532 104431 gene locus_tag LOCUS_34390 103532 104431 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268573.1 protein_id gnl|my_center|LOCUS_34390 104609 105244 gene locus_tag LOCUS_34400 104609 105244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 105266 105586 gene locus_tag LOCUS_34410 105266 105586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 105723 106718 gene locus_tag LOCUS_34420 105723 106718 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_34420 106869 107768 gene locus_tag LOCUS_34430 106869 107768 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_34430 107810 108316 gene locus_tag LOCUS_34440 107810 108316 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_34440 108504 108995 gene locus_tag LOCUS_34450 108504 108995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 109051 111507 gene locus_tag LOCUS_34460 109051 111507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 111663 112142 gene locus_tag LOCUS_34470 111663 112142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 112327 113679 gene locus_tag LOCUS_34480 112327 113679 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_34480 113839 114768 gene locus_tag LOCUS_34490 113839 114768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 114808 115725 gene locus_tag LOCUS_34500 114808 115725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 115999 116871 gene locus_tag LOCUS_34510 115999 116871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 117013 117555 gene locus_tag LOCUS_34520 117013 117555 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_34520 117512 118060 gene locus_tag LOCUS_34530 117512 118060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 118148 118648 gene locus_tag LOCUS_34540 118148 118648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 118991 118722 gene locus_tag LOCUS_34550 118991 118722 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_34550 119269 119356 gene locus_tag LOCUS_t00370 119269 119356 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 119868 122249 gene locus_tag LOCUS_34560 119868 122249 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_34560 122314 122916 gene locus_tag LOCUS_34570 122314 122916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34570 122932 123426 gene locus_tag LOCUS_34580 122932 123426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34580 125910 123622 gene locus_tag LOCUS_34590 gene bglX 125910 123622 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_34590 126944 125949 gene locus_tag LOCUS_34600 126944 125949 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767200.1 protein_id gnl|my_center|LOCUS_34600 128766 126946 gene locus_tag LOCUS_34610 128766 126946 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_34610 131191 128804 gene locus_tag LOCUS_34620 131191 128804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 132783 131437 gene locus_tag LOCUS_34630 132783 131437 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_34630 134142 133039 gene locus_tag LOCUS_34640 134142 133039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 135698 134157 gene locus_tag LOCUS_34650 135698 134157 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_34650 138740 135720 gene locus_tag LOCUS_34660 138740 135720 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_34660 138966 139178 gene locus_tag LOCUS_34670 138966 139178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 139175 142012 gene locus_tag LOCUS_34680 139175 142012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_34680 142099 142172 gene locus_tag LOCUS_t00380 142099 142172 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 142248 142973 gene locus_tag LOCUS_34690 142248 142973 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_34690 143206 143406 gene locus_tag LOCUS_34700 143206 143406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 143570 144856 gene locus_tag LOCUS_34710 143570 144856 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_34710 144930 145490 gene locus_tag LOCUS_34720 144930 145490 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_34720 145636 146880 gene locus_tag LOCUS_34730 gene fabF 145636 146880 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_34730 147706 146936 gene locus_tag LOCUS_34740 147706 146936 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_34740 149652 147829 gene locus_tag LOCUS_34750 149652 147829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_34750 151033 149684 gene locus_tag LOCUS_34760 gene purB 151033 149684 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_34760 151323 153629 gene locus_tag LOCUS_34770 151323 153629 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_34770 154640 153822 gene locus_tag LOCUS_34780 154640 153822 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_34780 155049 154882 gene locus_tag LOCUS_34790 155049 154882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence18 1105 176 gene locus_tag LOCUS_34800 1105 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence19 299 33 gene locus_tag LOCUS_34810 299 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 1928 1059 gene locus_tag LOCUS_34820 1928 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458844.1 protein_id gnl|my_center|LOCUS_34820 2547 2056 gene locus_tag LOCUS_34830 2547 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2929 3099 gene locus_tag LOCUS_34840 2929 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 3327 3695 gene locus_tag LOCUS_34850 3327 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 4317 6968 gene locus_tag LOCUS_34860 gene leuS 4317 6968 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_34860 8193 7000 gene locus_tag LOCUS_34870 8193 7000 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104155.1 protein_id gnl|my_center|LOCUS_34870 10810 8183 gene locus_tag LOCUS_34880 10810 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 11107 11976 gene locus_tag LOCUS_34890 11107 11976 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_34890 12090 13340 gene locus_tag LOCUS_34900 12090 13340 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_34900 14022 13453 gene locus_tag LOCUS_34910 gene purN 14022 13453 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_34910 14211 14447 gene locus_tag LOCUS_34920 14211 14447 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_34920 14468 15709 gene locus_tag LOCUS_34930 gene fabF 14468 15709 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_34930 15714 16451 gene locus_tag LOCUS_34940 gene rnc 15714 16451 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108787.1 protein_id gnl|my_center|LOCUS_34940 16797 18398 gene locus_tag LOCUS_34950 16797 18398 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_34950 18358 19044 gene locus_tag LOCUS_34960 18358 19044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_34960 20323 19196 gene locus_tag LOCUS_34970 20323 19196 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_34970 20451 21215 gene locus_tag LOCUS_34980 20451 21215 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_34980 23263 21245 gene locus_tag LOCUS_34990 23263 21245 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_34990 23680 24417 gene locus_tag LOCUS_35000 23680 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 24957 24487 gene locus_tag LOCUS_35010 gene queF 24957 24487 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_35010 25673 25002 gene locus_tag LOCUS_35020 gene queC 25673 25002 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786207.1 protein_id gnl|my_center|LOCUS_35020 26353 25673 gene locus_tag LOCUS_35030 26353 25673 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_35030 26577 26978 gene locus_tag LOCUS_35040 gene nikR 26577 26978 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_35040 27016 27855 gene locus_tag LOCUS_35050 gene larE 27016 27855 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_35050 27859 29034 gene locus_tag LOCUS_35060 gene larC 27859 29034 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_35060 29031 29771 gene locus_tag LOCUS_35070 gene larB 29031 29771 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964094.1 protein_id gnl|my_center|LOCUS_35070 29843 30538 gene locus_tag LOCUS_35080 29843 30538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_35080 30934 32172 gene locus_tag LOCUS_35090 30934 32172 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_35090 32823 32278 gene locus_tag LOCUS_35100 32823 32278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 33548 32958 gene locus_tag LOCUS_35110 33548 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 36195 33838 gene locus_tag LOCUS_35120 36195 33838 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_35120 37058 36192 gene locus_tag LOCUS_35130 37058 36192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 38077 37115 gene locus_tag LOCUS_35140 38077 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 39007 39717 gene locus_tag LOCUS_35150 39007 39717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 41497 39845 gene locus_tag LOCUS_35160 41497 39845 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108477.1 protein_id gnl|my_center|LOCUS_35160 42102 41527 gene locus_tag LOCUS_35170 42102 41527 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761981.1 protein_id gnl|my_center|LOCUS_35170 45282 42697 gene locus_tag LOCUS_35180 45282 42697 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_35180 46768 45413 gene locus_tag LOCUS_35190 46768 45413 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_35190 48074 46782 gene locus_tag LOCUS_35200 48074 46782 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_35200 50136 48190 gene locus_tag LOCUS_35210 50136 48190 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_35210 51256 50243 gene locus_tag LOCUS_35220 51256 50243 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_35220 53269 51257 gene locus_tag LOCUS_35230 53269 51257 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107440.1 protein_id gnl|my_center|LOCUS_35230 53462 55417 gene locus_tag LOCUS_35240 53462 55417 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_35240 56442 55516 gene locus_tag LOCUS_35250 gene queG 56442 55516 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_35250 56827 56522 gene locus_tag LOCUS_35260 56827 56522 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_35260 57262 56840 gene locus_tag LOCUS_35270 57262 56840 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_35270 57525 58100 gene locus_tag LOCUS_35280 57525 58100 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_35280 58179 58832 gene locus_tag LOCUS_35290 58179 58832 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_35290 58937 59155 gene locus_tag LOCUS_35300 58937 59155 CDS product DUF6132 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788321.1 protein_id gnl|my_center|LOCUS_35300 59142 59447 gene locus_tag LOCUS_35310 gene trxA 59142 59447 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_35310 60385 59678 gene locus_tag LOCUS_35320 60385 59678 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_35320 60870 61841 gene locus_tag LOCUS_35330 60870 61841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 62140 61844 gene locus_tag LOCUS_35340 62140 61844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 64627 62249 gene locus_tag LOCUS_35350 64627 62249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 66140 64920 gene locus_tag LOCUS_35360 66140 64920 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_35360 67676 66315 gene locus_tag LOCUS_35370 gene sufD 67676 66315 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_35370 68422 67682 gene locus_tag LOCUS_35380 gene sufC 68422 67682 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_35380 69943 68498 gene locus_tag LOCUS_35390 gene sufB 69943 68498 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_35390 70090 71139 gene locus_tag LOCUS_35400 gene thiL 70090 71139 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_35400 72149 71367 gene locus_tag LOCUS_35410 gene lpxA 72149 71367 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_35410 73564 72176 gene locus_tag LOCUS_35420 73564 72176 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_35420 74632 73586 gene locus_tag LOCUS_35430 gene lpxD 74632 73586 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_35430 75926 74670 gene locus_tag LOCUS_35440 75926 74670 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785125.1 protein_id gnl|my_center|LOCUS_35440 76342 76803 gene locus_tag LOCUS_35450 gene rimP 76342 76803 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_35450 76816 78051 gene locus_tag LOCUS_35460 gene nusA 76816 78051 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_35460 78156 81131 gene locus_tag LOCUS_35470 gene infB 78156 81131 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_35470 81682 81302 gene locus_tag LOCUS_35480 gene gcvH 81682 81302 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_35480 81812 82234 gene locus_tag LOCUS_35490 gene tsaE 81812 82234 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_35490 82291 83499 gene locus_tag LOCUS_35500 82291 83499 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_35500 85638 83689 gene locus_tag LOCUS_35510 gene pulA 85638 83689 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_35510 86164 85640 gene locus_tag LOCUS_35520 86164 85640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 87103 86354 gene locus_tag LOCUS_35530 87103 86354 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_35530 88149 87100 gene locus_tag LOCUS_35540 88149 87100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 88966 88262 gene locus_tag LOCUS_35550 88966 88262 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_35550 89463 89068 gene locus_tag LOCUS_35560 89463 89068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 91320 89623 gene locus_tag LOCUS_35570 91320 89623 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_35570 91521 91871 gene locus_tag LOCUS_35580 gene folB 91521 91871 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_35580 92345 92416 gene locus_tag LOCUS_t00390 92345 92416 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 92690 93013 gene locus_tag LOCUS_35590 92690 93013 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545235.1 protein_id gnl|my_center|LOCUS_35590 93434 93769 gene locus_tag LOCUS_35600 93434 93769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 93858 94718 gene locus_tag LOCUS_35610 93858 94718 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_35610 94711 95586 gene locus_tag LOCUS_35620 94711 95586 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_35620 95537 96271 gene locus_tag LOCUS_35630 95537 96271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 96273 96938 gene locus_tag LOCUS_35640 96273 96938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 96952 97374 gene locus_tag LOCUS_35650 96952 97374 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_35650 99457 97397 gene locus_tag LOCUS_35660 99457 97397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 100676 99573 gene locus_tag LOCUS_35670 100676 99573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 102556 100703 gene locus_tag LOCUS_35680 102556 100703 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_35680 105240 102877 gene locus_tag LOCUS_35690 105240 102877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_35690 107121 105433 gene locus_tag LOCUS_35700 107121 105433 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_35700 110460 107134 gene locus_tag LOCUS_35710 110460 107134 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_35710 111630 110647 gene locus_tag LOCUS_35720 111630 110647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 112292 111687 gene locus_tag LOCUS_35730 112292 111687 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_35730 113536 112490 gene locus_tag LOCUS_35740 113536 112490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 116589 113752 gene locus_tag LOCUS_35750 116589 113752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 120007 116807 gene locus_tag LOCUS_35760 gene lacZ 120007 116807 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_35760 121949 120015 gene locus_tag LOCUS_35770 121949 120015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 123191 122106 gene locus_tag LOCUS_35780 123191 122106 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_35780 125138 123528 gene locus_tag LOCUS_35790 125138 123528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 126630 125155 gene locus_tag LOCUS_35800 126630 125155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 128007 126877 gene locus_tag LOCUS_35810 128007 126877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 129646 128051 gene locus_tag LOCUS_35820 129646 128051 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_35820 132591 129727 gene locus_tag LOCUS_35830 132591 129727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760974.1 protein_id gnl|my_center|LOCUS_35830 134340 132625 gene locus_tag LOCUS_35840 134340 132625 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_35840 137921 134409 gene locus_tag LOCUS_35850 137921 134409 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_35850 139333 138110 gene locus_tag LOCUS_35860 139333 138110 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_35860 140019 139420 gene locus_tag LOCUS_35870 140019 139420 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_35870 141910 140345 gene locus_tag LOCUS_35880 141910 140345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 143020 142016 gene locus_tag LOCUS_35890 143020 142016 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_35890 144199 143132 gene locus_tag LOCUS_35900 144199 143132 CDS product glycan-binding surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796119.1 protein_id gnl|my_center|LOCUS_35900 145980 144283 gene locus_tag LOCUS_35910 145980 144283 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992183.1 protein_id gnl|my_center|LOCUS_35910 149474 146001 gene locus_tag LOCUS_35920 149474 146001 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_35920 150698 149673 gene locus_tag LOCUS_35930 150698 149673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 151384 150779 gene locus_tag LOCUS_35940 151384 150779 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_35940 153011 151512 gene locus_tag LOCUS_35950 153011 151512 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_35950 154191 153013 gene locus_tag LOCUS_35960 154191 153013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 155571 154858 gene locus_tag LOCUS_35970 155571 154858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence20 2027 576 gene locus_tag LOCUS_35980 2027 576 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_35980 3116 2043 gene locus_tag LOCUS_35990 3116 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4960 3446 gene locus_tag LOCUS_36000 4960 3446 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_36000 8220 4960 gene locus_tag LOCUS_36010 8220 4960 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_36010 9445 8438 gene locus_tag LOCUS_36020 9445 8438 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_36020 10124 9537 gene locus_tag LOCUS_36030 10124 9537 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_36030 10730 10269 gene locus_tag LOCUS_36040 10730 10269 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_36040 10998 11318 gene locus_tag LOCUS_36050 10998 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 11390 13660 gene locus_tag LOCUS_36060 11390 13660 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_36060 14357 13710 gene locus_tag LOCUS_36070 14357 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 14656 14507 gene locus_tag LOCUS_36080 14656 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 15614 14691 gene locus_tag LOCUS_36090 15614 14691 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963695.1 protein_id gnl|my_center|LOCUS_36090 16239 15784 gene locus_tag LOCUS_36100 16239 15784 CDS product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_36100 16824 16333 gene locus_tag LOCUS_36110 16824 16333 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_36110 17705 17013 gene locus_tag LOCUS_36120 17705 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 18194 17760 gene locus_tag LOCUS_36130 18194 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 19684 18383 gene locus_tag LOCUS_36140 gene eno 19684 18383 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_36140 20123 22003 gene locus_tag LOCUS_36150 20123 22003 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_36150 23148 22078 gene locus_tag LOCUS_36160 23148 22078 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_36160 23323 23700 gene locus_tag LOCUS_36170 23323 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 23822 27628 gene locus_tag LOCUS_36180 23822 27628 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_36180 27625 28866 gene locus_tag LOCUS_36190 27625 28866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 28913 30814 gene locus_tag LOCUS_36200 28913 30814 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_36200 30962 30890 gene locus_tag LOCUS_t00400 30962 30890 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31061 31432 gene locus_tag LOCUS_36210 31061 31432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 32819 31617 gene locus_tag LOCUS_36220 32819 31617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 33956 33162 gene locus_tag LOCUS_36230 33956 33162 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_36230 34978 34253 gene locus_tag LOCUS_36240 34978 34253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_36240 35795 35073 gene locus_tag LOCUS_36250 35795 35073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 36090 36278 gene locus_tag LOCUS_36260 36090 36278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 37601 36591 gene locus_tag LOCUS_36270 37601 36591 CDS product IS110-like element IS1000A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229153.1 protein_id gnl|my_center|LOCUS_36270 38655 37843 gene locus_tag LOCUS_36280 38655 37843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 39646 38789 gene locus_tag LOCUS_36290 39646 38789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence21 224 760 gene locus_tag LOCUS_36300 224 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 1919 1368 gene locus_tag LOCUS_36310 1919 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3018 1912 gene locus_tag LOCUS_36320 3018 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 3533 3931 gene locus_tag LOCUS_36330 3533 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 4072 4830 gene locus_tag LOCUS_36340 gene tpiA 4072 4830 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_36340 5161 5673 gene locus_tag LOCUS_36350 5161 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 5861 7171 gene locus_tag LOCUS_36360 gene ablA 5861 7171 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_36360 7174 8013 gene locus_tag LOCUS_36370 gene ablB 7174 8013 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878594.1 protein_id gnl|my_center|LOCUS_36370 8006 8221 gene locus_tag LOCUS_36380 8006 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 8225 8446 gene locus_tag LOCUS_36390 8225 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 8446 9873 gene locus_tag LOCUS_36400 gene putP 8446 9873 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_36400 10214 10993 gene locus_tag LOCUS_36410 10214 10993 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_36410 10957 11460 gene locus_tag LOCUS_36420 10957 11460 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775131.1 protein_id gnl|my_center|LOCUS_36420 11536 11763 gene locus_tag LOCUS_36430 11536 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 12704 11850 gene locus_tag LOCUS_36440 12704 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 13005 14471 gene locus_tag LOCUS_36450 13005 14471 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146465.1 protein_id gnl|my_center|LOCUS_36450 14508 14924 gene locus_tag LOCUS_36460 14508 14924 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_36460 15028 15717 gene locus_tag LOCUS_36470 15028 15717 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_36470 16711 15764 gene locus_tag LOCUS_36480 16711 15764 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_36480 16954 18486 gene locus_tag LOCUS_36490 16954 18486 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_36490 18537 19955 gene locus_tag LOCUS_36500 18537 19955 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_36500 20021 20716 gene locus_tag LOCUS_36510 20021 20716 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_36510 21044 23305 gene locus_tag LOCUS_36520 21044 23305 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_36520 23327 24559 gene locus_tag LOCUS_36530 23327 24559 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963977.1 protein_id gnl|my_center|LOCUS_36530 24562 25830 gene locus_tag LOCUS_36540 gene icd 24562 25830 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830826.1 protein_id gnl|my_center|LOCUS_36540 25868 27187 gene locus_tag LOCUS_36550 25868 27187 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_36550 31346 28113 gene locus_tag LOCUS_36560 31346 28113 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_36560 32185 31481 gene locus_tag LOCUS_36570 32185 31481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_36570 33550 32324 gene locus_tag LOCUS_36580 33550 32324 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_36580 34792 33680 gene locus_tag LOCUS_36590 34792 33680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 36364 34796 gene locus_tag LOCUS_36600 36364 34796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 37480 36398 gene locus_tag LOCUS_36610 37480 36398 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_36610 40080 37711 gene locus_tag LOCUS_36620 gene nuoF 40080 37711 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_36620 42002 40086 gene locus_tag LOCUS_36630 42002 40086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 43292 42039 gene locus_tag LOCUS_36640 43292 42039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 43946 43350 gene locus_tag LOCUS_36650 43946 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 44130 43936 gene locus_tag LOCUS_36660 44130 43936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 45101 44127 gene locus_tag LOCUS_36670 45101 44127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_36670 46667 45246 gene locus_tag LOCUS_36680 46667 45246 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922154.1 protein_id gnl|my_center|LOCUS_36680 47913 46669 gene locus_tag LOCUS_36690 47913 46669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 49179 47956 gene locus_tag LOCUS_36700 49179 47956 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_36700 50863 49517 gene locus_tag LOCUS_36710 50863 49517 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_36710 51742 50891 gene locus_tag LOCUS_36720 51742 50891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 53151 51751 gene locus_tag LOCUS_36730 53151 51751 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_36730 53401 54573 gene locus_tag LOCUS_36740 53401 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 54686 56053 gene locus_tag LOCUS_36750 54686 56053 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860915.1 protein_id gnl|my_center|LOCUS_36750 58741 56249 gene locus_tag LOCUS_36760 58741 56249 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_36760 59184 58795 gene locus_tag LOCUS_36770 59184 58795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 60894 59230 gene locus_tag LOCUS_36780 60894 59230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 61095 61349 gene locus_tag LOCUS_36790 61095 61349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 61349 61555 gene locus_tag LOCUS_36800 61349 61555 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 protein_id gnl|my_center|LOCUS_36800 63687 61552 gene locus_tag LOCUS_36810 63687 61552 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_36810 64499 63840 gene locus_tag LOCUS_36820 64499 63840 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_36820 64750 64553 gene locus_tag LOCUS_36830 64750 64553 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_36830 64921 65334 gene locus_tag LOCUS_36840 64921 65334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 65580 65987 gene locus_tag LOCUS_36850 65580 65987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 66097 67785 gene locus_tag LOCUS_36860 gene ggt 66097 67785 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133817160.1 protein_id gnl|my_center|LOCUS_36860 67892 69175 gene locus_tag LOCUS_36870 67892 69175 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226917.1 protein_id gnl|my_center|LOCUS_36870 70831 69206 gene locus_tag LOCUS_36880 70831 69206 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_36880 72030 70888 gene locus_tag LOCUS_36890 72030 70888 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_36890 74454 72100 gene locus_tag LOCUS_36900 74454 72100 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530098.1 protein_id gnl|my_center|LOCUS_36900 75001 75531 gene locus_tag LOCUS_36910 75001 75531 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_36910 75704 77998 gene locus_tag LOCUS_36920 75704 77998 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_36920 78069 79223 gene locus_tag LOCUS_36930 78069 79223 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_36930 79354 80817 gene locus_tag LOCUS_36940 79354 80817 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_36940 81555 82757 gene locus_tag LOCUS_36950 gene wecC 81555 82757 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence22 759 1376 gene locus_tag LOCUS_36960 759 1376 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_36960 1397 2419 gene locus_tag LOCUS_36970 1397 2419 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791368.1 protein_id gnl|my_center|LOCUS_36970 2679 6074 gene locus_tag LOCUS_36980 2679 6074 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_36980 6155 7873 gene locus_tag LOCUS_36990 6155 7873 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_36990 7886 8749 gene locus_tag LOCUS_37000 7886 8749 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_37000 9272 10774 gene locus_tag LOCUS_37010 9272 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 10823 11734 gene locus_tag LOCUS_37020 10823 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 12551 11838 gene locus_tag LOCUS_37030 12551 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 12723 14180 gene locus_tag LOCUS_37040 12723 14180 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_37040 15255 14350 gene locus_tag LOCUS_37050 15255 14350 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_37050 16106 15588 gene locus_tag LOCUS_37060 16106 15588 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_37060 16321 18162 gene locus_tag LOCUS_37070 16321 18162 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_37070 18166 19236 gene locus_tag LOCUS_37080 18166 19236 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_37080 20025 19303 gene locus_tag LOCUS_37090 20025 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 20321 23302 gene locus_tag LOCUS_37100 20321 23302 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_37100 28657 23471 gene locus_tag LOCUS_37110 28657 23471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 29162 29875 gene locus_tag LOCUS_37120 29162 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 30848 29961 gene locus_tag LOCUS_37130 gene fabD 30848 29961 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_37130 32703 30994 gene locus_tag LOCUS_37140 32703 30994 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_37140 32848 33141 gene locus_tag LOCUS_37150 32848 33141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_37150 33157 33447 gene locus_tag LOCUS_37160 33157 33447 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_37160 33571 35121 gene locus_tag LOCUS_37170 gene rny 33571 35121 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_37170 36723 35407 gene locus_tag LOCUS_37180 36723 35407 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_37180 38335 36947 gene locus_tag LOCUS_37190 38335 36947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 38640 39374 gene locus_tag LOCUS_37200 gene folE 38640 39374 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962795.1 protein_id gnl|my_center|LOCUS_37200 39502 39852 gene locus_tag LOCUS_37210 39502 39852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 40103 41353 gene locus_tag LOCUS_37220 gene hutI 40103 41353 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_37220 41417 43108 gene locus_tag LOCUS_37230 41417 43108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 44084 43218 gene locus_tag LOCUS_37240 44084 43218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 44966 44097 gene locus_tag LOCUS_37250 44966 44097 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_37250 45142 45960 gene locus_tag LOCUS_37260 45142 45960 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_37260 46051 46533 gene locus_tag LOCUS_37270 46051 46533 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798782.1 protein_id gnl|my_center|LOCUS_37270 46829 46557 gene locus_tag LOCUS_37280 46829 46557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 48017 47025 gene locus_tag LOCUS_37290 48017 47025 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_37290 48217 48795 gene locus_tag LOCUS_37300 48217 48795 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_37300 48849 49265 gene locus_tag LOCUS_37310 48849 49265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 49289 49780 gene locus_tag LOCUS_37320 49289 49780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 50290 50787 gene locus_tag LOCUS_37330 50290 50787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 50808 51638 gene locus_tag LOCUS_37340 50808 51638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 52284 51703 gene locus_tag LOCUS_37350 52284 51703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 54513 52618 gene locus_tag LOCUS_37360 54513 52618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 55478 54570 gene locus_tag LOCUS_37370 gene cysD 55478 54570 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_37370 57397 55592 gene locus_tag LOCUS_37380 57397 55592 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073062727.1 protein_id gnl|my_center|LOCUS_37380 57637 57712 gene locus_tag LOCUS_t00410 57637 57712 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 58331 57861 gene locus_tag LOCUS_37390 58331 57861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 59444 58446 gene locus_tag LOCUS_37400 59444 58446 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_37400 60084 59509 gene locus_tag LOCUS_37410 60084 59509 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_37410 60462 60127 gene locus_tag LOCUS_37420 60462 60127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 61175 60690 gene locus_tag LOCUS_37430 61175 60690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 61528 61301 gene locus_tag LOCUS_37440 61528 61301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 61818 61579 gene locus_tag LOCUS_37450 61818 61579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 62704 62045 gene locus_tag LOCUS_37460 62704 62045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 63444 62932 gene locus_tag LOCUS_37470 63444 62932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 64326 63616 gene locus_tag LOCUS_37480 64326 63616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 64805 64329 gene locus_tag LOCUS_37490 64805 64329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 65620 64805 gene locus_tag LOCUS_37500 65620 64805 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_37500 66294 65806 gene locus_tag LOCUS_37510 66294 65806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 67373 68083 gene locus_tag LOCUS_37520 67373 68083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 69343 68363 gene locus_tag LOCUS_37530 69343 68363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 69628 73650 gene locus_tag LOCUS_37540 69628 73650 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460558.1 protein_id gnl|my_center|LOCUS_37540 73689 74165 gene locus_tag LOCUS_37550 73689 74165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 74181 75965 gene locus_tag LOCUS_37560 74181 75965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949135.1 protein_id gnl|my_center|LOCUS_37560 75959 77686 gene locus_tag LOCUS_37570 75959 77686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107304.1 protein_id gnl|my_center|LOCUS_37570 77755 78525 gene locus_tag LOCUS_37580 gene sufC 77755 78525 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_37580 78525 79742 gene locus_tag LOCUS_37590 78525 79742 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_37590 79911 80243 gene locus_tag LOCUS_37600 79911 80243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 80248 80865 gene locus_tag LOCUS_37610 80248 80865 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065519.1 protein_id gnl|my_center|LOCUS_37610 81684 80944 gene locus_tag LOCUS_37620 81684 80944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 83392 82121 gene locus_tag LOCUS_37630 83392 82121 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_37630 86133 83410 gene locus_tag LOCUS_37640 86133 83410 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_37640 87182 86154 gene locus_tag LOCUS_37650 gene rhaT 87182 86154 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_37650 87307 88170 gene locus_tag LOCUS_37660 87307 88170 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_37660 88410 88973 gene locus_tag LOCUS_37670 88410 88973 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_37670 89041 90063 gene locus_tag LOCUS_37680 89041 90063 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_37680 90204 93629 gene locus_tag LOCUS_37690 90204 93629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_37690 93642 95615 gene locus_tag LOCUS_37700 93642 95615 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109352.1 protein_id gnl|my_center|LOCUS_37700 95637 96530 gene locus_tag LOCUS_37710 95637 96530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 96844 97920 gene locus_tag LOCUS_37720 96844 97920 CDS product DUF4855 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767106.1 protein_id gnl|my_center|LOCUS_37720 98272 100374 gene locus_tag LOCUS_37730 98272 100374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 100661 101872 gene locus_tag LOCUS_37740 100661 101872 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_37740 102399 103625 gene locus_tag LOCUS_37750 102399 103625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 103768 106854 gene locus_tag LOCUS_37760 103768 106854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202219.1 protein_id gnl|my_center|LOCUS_37760 107084 108811 gene locus_tag LOCUS_37770 107084 108811 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_37770 108935 110605 gene locus_tag LOCUS_37780 108935 110605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 110771 112096 gene locus_tag LOCUS_37790 110771 112096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 112180 113109 gene locus_tag LOCUS_37800 112180 113109 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766063.1 protein_id gnl|my_center|LOCUS_37800 113233 115128 gene locus_tag LOCUS_37810 113233 115128 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303185.1 protein_id gnl|my_center|LOCUS_37810 117570 115189 gene locus_tag LOCUS_37820 117570 115189 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109053.1 protein_id gnl|my_center|LOCUS_37820 117905 120472 gene locus_tag LOCUS_37830 117905 120472 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_37830 120570 121994 gene locus_tag LOCUS_37840 120570 121994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 122080 123639 gene locus_tag LOCUS_37850 122080 123639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 123765 124739 gene locus_tag LOCUS_37860 123765 124739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 126102 124975 gene locus_tag LOCUS_37870 126102 124975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 126281 126547 gene locus_tag LOCUS_37880 126281 126547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence23 1056 2681 gene locus_tag LOCUS_37890 1056 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 2829 3638 gene locus_tag LOCUS_37900 2829 3638 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_37900 3713 4102 gene locus_tag LOCUS_37910 3713 4102 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904553.1 protein_id gnl|my_center|LOCUS_37910 4106 4729 gene locus_tag LOCUS_37920 4106 4729 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_37920 4836 5360 gene locus_tag LOCUS_37930 4836 5360 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405237.1 protein_id gnl|my_center|LOCUS_37930 5344 5886 gene locus_tag LOCUS_37940 5344 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 6067 9756 gene locus_tag LOCUS_37950 gene purL 6067 9756 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_37950 9919 10659 gene locus_tag LOCUS_37960 9919 10659 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_37960 10843 12870 gene locus_tag LOCUS_37970 10843 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 13432 12881 gene locus_tag LOCUS_37980 13432 12881 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_37980 14041 13535 gene locus_tag LOCUS_37990 14041 13535 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_37990 14653 16707 gene locus_tag LOCUS_38000 14653 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 17771 16773 gene locus_tag LOCUS_38010 17771 16773 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 protein_id gnl|my_center|LOCUS_38010 18742 17768 gene locus_tag LOCUS_38020 gene arcC 18742 17768 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_38020 19102 21525 gene locus_tag LOCUS_38030 19102 21525 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_38030 21543 22193 gene locus_tag LOCUS_38040 21543 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 23676 22246 gene locus_tag LOCUS_38050 gene pyk 23676 22246 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_38050 24179 23760 gene locus_tag LOCUS_38060 gene aroQ 24179 23760 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_38060 24332 25243 gene locus_tag LOCUS_38070 gene xerD 24332 25243 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_38070 25480 27081 gene locus_tag LOCUS_38080 gene pckA 25480 27081 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217613.1 protein_id gnl|my_center|LOCUS_38080 27872 27240 gene locus_tag LOCUS_38090 27872 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402939.1 protein_id gnl|my_center|LOCUS_38090 28396 27893 gene locus_tag LOCUS_38100 28396 27893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 29113 28442 gene locus_tag LOCUS_38110 29113 28442 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_38110 30372 29275 gene locus_tag LOCUS_38120 30372 29275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 30903 30385 gene locus_tag LOCUS_38130 30903 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 31359 30934 gene locus_tag LOCUS_38140 31359 30934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 33969 31741 gene locus_tag LOCUS_38150 33969 31741 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_38150 35018 34188 gene locus_tag LOCUS_38160 35018 34188 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_38160 35269 36366 gene locus_tag LOCUS_38170 35269 36366 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104158.1 protein_id gnl|my_center|LOCUS_38170 36353 37864 gene locus_tag LOCUS_38180 gene malQ 36353 37864 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_38180 38374 37934 gene locus_tag LOCUS_38190 38374 37934 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_38190 39277 38396 gene locus_tag LOCUS_38200 39277 38396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 40315 39506 gene locus_tag LOCUS_38210 40315 39506 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_38210 41054 40401 gene locus_tag LOCUS_38220 41054 40401 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_38220 41175 41840 gene locus_tag LOCUS_38230 41175 41840 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229294.1 protein_id gnl|my_center|LOCUS_38230 41854 42735 gene locus_tag LOCUS_38240 41854 42735 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_38240 42921 43727 gene locus_tag LOCUS_38250 42921 43727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 43733 44476 gene locus_tag LOCUS_38260 43733 44476 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_38260 44490 47171 gene locus_tag LOCUS_38270 44490 47171 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_38270 47214 47750 gene locus_tag LOCUS_38280 47214 47750 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_38280 47910 48419 gene locus_tag LOCUS_38290 47910 48419 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_38290 48495 49328 gene locus_tag LOCUS_38300 gene murI 48495 49328 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108947.1 protein_id gnl|my_center|LOCUS_38300 50400 49330 gene locus_tag LOCUS_38310 50400 49330 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_38310 51220 50624 gene locus_tag LOCUS_38320 gene nuoE 51220 50624 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_38320 52968 51217 gene locus_tag LOCUS_38330 52968 51217 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_38330 54776 52983 gene locus_tag LOCUS_38340 gene nuoF 54776 52983 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_38340 55184 54789 gene locus_tag LOCUS_38350 55184 54789 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_38350 55826 55278 gene locus_tag LOCUS_38360 55826 55278 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_38360 56566 55823 gene locus_tag LOCUS_38370 56566 55823 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_38370 57018 56668 gene locus_tag LOCUS_38380 57018 56668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 58381 57005 gene locus_tag LOCUS_38390 58381 57005 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_38390 58791 58381 gene locus_tag LOCUS_38400 58791 58381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 59139 58795 gene locus_tag LOCUS_38410 59139 58795 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081551.1 protein_id gnl|my_center|LOCUS_38410 59415 60344 gene locus_tag LOCUS_38420 59415 60344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 60344 61525 gene locus_tag LOCUS_38430 60344 61525 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_38430 62639 61626 gene locus_tag LOCUS_38440 62639 61626 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_38440 64000 62822 gene locus_tag LOCUS_38450 gene mnmA 64000 62822 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_38450 65403 64237 gene locus_tag LOCUS_38460 65403 64237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_38460 66059 65400 gene locus_tag LOCUS_38470 66059 65400 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682086.1 protein_id gnl|my_center|LOCUS_38470 66750 66052 gene locus_tag LOCUS_38480 66750 66052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_38480 68014 66797 gene locus_tag LOCUS_38490 68014 66797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_38490 69246 68026 gene locus_tag LOCUS_38500 69246 68026 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_38500 70145 69396 gene locus_tag LOCUS_38510 70145 69396 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_38510 70703 70152 gene locus_tag LOCUS_38520 70703 70152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 71003 72322 gene locus_tag LOCUS_38530 71003 72322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_38530 73423 72407 gene locus_tag LOCUS_38540 gene pfkA 73423 72407 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_38540 74625 73774 gene locus_tag LOCUS_38550 74625 73774 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108114.1 protein_id gnl|my_center|LOCUS_38550 75396 74689 gene locus_tag LOCUS_38560 gene cmk 75396 74689 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_38560 76536 75514 gene locus_tag LOCUS_38570 gene porQ 76536 75514 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_38570 77720 76662 gene locus_tag LOCUS_38580 77720 76662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 78761 78426 gene locus_tag LOCUS_38590 78761 78426 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_38590 83181 79105 gene locus_tag LOCUS_38600 83181 79105 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_38600 83810 86890 gene locus_tag LOCUS_38610 83810 86890 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_38610 87007 88755 gene locus_tag LOCUS_38620 87007 88755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 96031 89027 gene locus_tag LOCUS_38630 96031 89027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 97252 96092 gene locus_tag LOCUS_38640 97252 96092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 97901 97317 gene locus_tag LOCUS_38650 97901 97317 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_38650 98705 98977 gene locus_tag LOCUS_38660 98705 98977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 99086 100309 gene locus_tag LOCUS_38670 99086 100309 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966024.1 protein_id gnl|my_center|LOCUS_38670 100306 103383 gene locus_tag LOCUS_38680 100306 103383 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546332.1 protein_id gnl|my_center|LOCUS_38680 104760 105893 gene locus_tag LOCUS_38690 104760 105893 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295521.1 protein_id gnl|my_center|LOCUS_38690 106320 106000 gene locus_tag LOCUS_38700 106320 106000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 106453 107808 gene locus_tag LOCUS_38710 106453 107808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 108042 109325 gene locus_tag LOCUS_38720 108042 109325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 >Feature sequence24 362 991 gene locus_tag LOCUS_38730 362 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 2813 1101 gene locus_tag LOCUS_38740 2813 1101 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_38740 3876 2857 gene locus_tag LOCUS_38750 3876 2857 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_38750 4770 3895 gene locus_tag LOCUS_38760 4770 3895 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_38760 6739 5087 gene locus_tag LOCUS_38770 6739 5087 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_38770 7305 6739 gene locus_tag LOCUS_38780 7305 6739 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_38780 8706 7495 gene locus_tag LOCUS_38790 8706 7495 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788673.1 protein_id gnl|my_center|LOCUS_38790 10623 8722 gene locus_tag LOCUS_38800 10623 8722 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_38800 10935 10672 gene locus_tag LOCUS_38810 10935 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 11458 12789 gene locus_tag LOCUS_38820 11458 12789 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_38820 12934 13149 gene locus_tag LOCUS_38830 12934 13149 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_38830 13358 14641 gene locus_tag LOCUS_38840 13358 14641 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_38840 15015 14695 gene locus_tag LOCUS_38850 15015 14695 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_38850 19295 15018 gene locus_tag LOCUS_38860 gene rpoC 19295 15018 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_38860 23162 19350 gene locus_tag LOCUS_38870 gene rpoB 23162 19350 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_38870 23653 23273 gene locus_tag LOCUS_38880 gene rplL 23653 23273 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_38880 24209 23691 gene locus_tag LOCUS_38890 gene rplJ 24209 23691 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_38890 24919 24224 gene locus_tag LOCUS_38900 gene rplA 24919 24224 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_38900 25377 24934 gene locus_tag LOCUS_38910 gene rplK 25377 24934 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_38910 25948 25400 gene locus_tag LOCUS_38920 gene nusG 25948 25400 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_38920 26157 25966 gene locus_tag LOCUS_38930 gene secE 26157 25966 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_38930 27486 26299 gene locus_tag LOCUS_38940 gene tuf 27486 26299 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_38940 27601 27529 gene locus_tag LOCUS_t00420 27601 27529 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27735 27662 gene locus_tag LOCUS_t00430 27735 27662 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27834 27751 gene locus_tag LOCUS_t00440 27834 27751 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 27937 27863 gene locus_tag LOCUS_t00450 27937 27863 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 28404 28102 gene locus_tag LOCUS_38950 gene raiA 28404 28102 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_38950 29308 28424 gene locus_tag LOCUS_38960 gene xerC 29308 28424 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765425.1 protein_id gnl|my_center|LOCUS_38960 29548 29357 gene locus_tag LOCUS_38970 gene rpsU 29548 29357 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_38970 30607 29684 gene locus_tag LOCUS_38980 30607 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 32046 30685 gene locus_tag LOCUS_38990 32046 30685 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_38990 33298 32216 gene locus_tag LOCUS_39000 gene fbaA 33298 32216 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_39000 35752 33416 gene locus_tag LOCUS_39010 35752 33416 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_39010 35851 36621 gene locus_tag LOCUS_39020 35851 36621 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_39020 38668 37112 gene locus_tag LOCUS_39030 38668 37112 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_39030 39450 38671 gene locus_tag LOCUS_39040 39450 38671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 40257 39535 gene locus_tag LOCUS_39050 gene ubiE 40257 39535 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_39050 41294 40254 gene locus_tag LOCUS_39060 41294 40254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 41402 42160 gene locus_tag LOCUS_39070 41402 42160 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_39070 42169 43257 gene locus_tag LOCUS_39080 42169 43257 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_39080 43250 43960 gene locus_tag LOCUS_39090 43250 43960 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_39090 43960 45000 gene locus_tag LOCUS_39100 43960 45000 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_39100 44997 45698 gene locus_tag LOCUS_39110 44997 45698 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_39110 46766 46023 gene locus_tag LOCUS_39120 46766 46023 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_39120 55058 47628 gene locus_tag LOCUS_39130 55058 47628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 56947 57954 gene locus_tag LOCUS_39140 gene gap 56947 57954 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_39140 59411 58164 gene locus_tag LOCUS_39150 59411 58164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_39150 59733 60260 gene locus_tag LOCUS_39160 59733 60260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 60325 61230 gene locus_tag LOCUS_39170 gene miaA 60325 61230 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_39170 61227 61691 gene locus_tag LOCUS_39180 61227 61691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 61753 62898 gene locus_tag LOCUS_39190 61753 62898 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_39190 62891 63472 gene locus_tag LOCUS_39200 62891 63472 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400839.1 protein_id gnl|my_center|LOCUS_39200 63623 65869 gene locus_tag LOCUS_39210 63623 65869 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_39210 65938 66378 gene locus_tag LOCUS_39220 65938 66378 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_39220 66565 67842 gene locus_tag LOCUS_39230 66565 67842 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_39230 68292 69395 gene locus_tag LOCUS_39240 68292 69395 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384114.1 protein_id gnl|my_center|LOCUS_39240 71184 69373 gene locus_tag LOCUS_39250 71184 69373 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_39250 72046 71198 gene locus_tag LOCUS_39260 72046 71198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 73603 72053 gene locus_tag LOCUS_39270 73603 72053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 74778 73603 gene locus_tag LOCUS_39280 74778 73603 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_39280 75456 74782 gene locus_tag LOCUS_39290 75456 74782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 75798 76079 gene locus_tag LOCUS_39300 75798 76079 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722106.1 protein_id gnl|my_center|LOCUS_39300 76076 76522 gene locus_tag LOCUS_39310 76076 76522 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_39310 76750 78789 gene locus_tag LOCUS_39320 76750 78789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 78809 80719 gene locus_tag LOCUS_39330 78809 80719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 80830 81276 gene locus_tag LOCUS_39340 80830 81276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140845.1 protein_id gnl|my_center|LOCUS_39340 83779 81908 gene locus_tag LOCUS_39350 83779 81908 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_39350 86946 83932 gene locus_tag LOCUS_39360 gene ccsA 86946 83932 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_39360 87159 87431 gene locus_tag LOCUS_39370 87159 87431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 87494 87730 gene locus_tag LOCUS_39380 87494 87730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 90339 87796 gene locus_tag LOCUS_39390 gene alaS 90339 87796 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_39390 90723 91694 gene locus_tag LOCUS_39400 90723 91694 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_39400 91707 92045 gene locus_tag LOCUS_39410 91707 92045 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_39410 92095 93189 gene locus_tag LOCUS_39420 92095 93189 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_39420 93215 93985 gene locus_tag LOCUS_39430 93215 93985 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_39430 94396 94106 gene locus_tag LOCUS_39440 94396 94106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence25 1076 468 gene locus_tag LOCUS_39450 1076 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 2544 1621 gene locus_tag LOCUS_39460 2544 1621 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785992.1 protein_id gnl|my_center|LOCUS_39460 3424 2834 gene locus_tag LOCUS_39470 3424 2834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_39470 4688 3759 gene locus_tag LOCUS_39480 4688 3759 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486366.1 protein_id gnl|my_center|LOCUS_39480 5654 4767 gene locus_tag LOCUS_39490 5654 4767 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_39490 6831 6493 gene locus_tag LOCUS_39500 6831 6493 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_39500 9443 6951 gene locus_tag LOCUS_39510 9443 6951 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_39510 9668 10405 gene locus_tag LOCUS_39520 9668 10405 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_39520 11955 10468 gene locus_tag LOCUS_39530 11955 10468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_39530 13703 12204 gene locus_tag LOCUS_39540 13703 12204 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_39540 14017 14547 gene locus_tag LOCUS_39550 14017 14547 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_39550 17342 14877 gene locus_tag LOCUS_39560 17342 14877 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_39560 17562 18440 gene locus_tag LOCUS_39570 17562 18440 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_39570 19832 18552 gene locus_tag LOCUS_39580 19832 18552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_39580 21219 19921 gene locus_tag LOCUS_39590 21219 19921 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_39590 22452 21481 gene locus_tag LOCUS_39600 22452 21481 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_39600 23948 22503 gene locus_tag LOCUS_39610 23948 22503 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_39610 25460 23955 gene locus_tag LOCUS_39620 25460 23955 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_39620 26245 27339 gene locus_tag LOCUS_39630 26245 27339 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_39630 29002 27398 gene locus_tag LOCUS_39640 29002 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 29388 28999 gene locus_tag LOCUS_39650 29388 28999 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444454.1 protein_id gnl|my_center|LOCUS_39650 30099 29515 gene locus_tag LOCUS_39660 30099 29515 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_39660 33510 30244 gene locus_tag LOCUS_39670 gene mfd 33510 30244 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_39670 34143 33790 gene locus_tag LOCUS_39680 34143 33790 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_39680 34373 34714 gene locus_tag LOCUS_39690 34373 34714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 34882 35691 gene locus_tag LOCUS_39700 34882 35691 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930865.1 protein_id gnl|my_center|LOCUS_39700 35830 36699 gene locus_tag LOCUS_39710 35830 36699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_39710 37161 36721 gene locus_tag LOCUS_39720 37161 36721 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_39720 37282 37911 gene locus_tag LOCUS_39730 37282 37911 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_39730 37935 38747 gene locus_tag LOCUS_39740 gene ygiD 37935 38747 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_39740 39347 38757 gene locus_tag LOCUS_39750 39347 38757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 40710 39367 gene locus_tag LOCUS_39760 40710 39367 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_39760 41587 40847 gene locus_tag LOCUS_39770 41587 40847 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_39770 41825 42292 gene locus_tag LOCUS_39780 41825 42292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_39780 42336 42929 gene locus_tag LOCUS_39790 42336 42929 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_39790 43047 44024 gene locus_tag LOCUS_39800 43047 44024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 44236 47409 gene locus_tag LOCUS_39810 44236 47409 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_39810 47429 49015 gene locus_tag LOCUS_39820 47429 49015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 49200 51476 gene locus_tag LOCUS_39830 49200 51476 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_39830 51829 51503 gene locus_tag LOCUS_39840 51829 51503 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_39840 52289 52657 gene locus_tag LOCUS_39850 52289 52657 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_39850 54101 52704 gene locus_tag LOCUS_39860 54101 52704 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_39860 57267 54118 gene locus_tag LOCUS_39870 57267 54118 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_39870 58457 57294 gene locus_tag LOCUS_39880 58457 57294 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_39880 58953 58507 gene locus_tag LOCUS_39890 58953 58507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 59400 60659 gene locus_tag LOCUS_39900 59400 60659 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_39900 60667 64023 gene locus_tag LOCUS_39910 60667 64023 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090706773.1 protein_id gnl|my_center|LOCUS_39910 64041 66029 gene locus_tag LOCUS_39920 64041 66029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 66093 66395 gene locus_tag LOCUS_39930 66093 66395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 66710 68146 gene locus_tag LOCUS_39940 66710 68146 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_39940 68220 70148 gene locus_tag LOCUS_39950 68220 70148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 71431 70283 gene locus_tag LOCUS_39960 71431 70283 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_39960 71541 72245 gene locus_tag LOCUS_39970 gene modA 71541 72245 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073621.1 protein_id gnl|my_center|LOCUS_39970 72242 72943 gene locus_tag LOCUS_39980 gene modB 72242 72943 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073622.1 protein_id gnl|my_center|LOCUS_39980 72943 74034 gene locus_tag LOCUS_39990 gene modC 72943 74034 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972403.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence26 150 47 gene locus_tag LOCUS_r00020 150 47 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3138 261 gene locus_tag LOCUS_r00030 3138 261 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3489 3413 gene locus_tag LOCUS_t00460 3489 3413 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3672 3598 gene locus_tag LOCUS_t00470 3672 3598 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5330 3814 gene locus_tag LOCUS_r00040 5330 3814 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8