COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..6455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, frameshifted CDS 481..1122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 note possible pseudo, frameshifted CDS 1119..1901 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene trpA CDS 2051..2266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, frameshifted CDS 2307..2489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 3136..3336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 note possible pseudo, frameshifted CDS complement(4411..4770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 note possible pseudo, frameshifted CDS complement(4920..5702) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene trpA CDS complement(5706..6410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 sequence2 source 1..2218955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(2347..2421) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 rRNA complement(2626..4179) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(4512..5060) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene raiA CDS complement(5135..5803) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(5800..7101) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 7148..7777 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 7892..8821 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene cysK CDS complement(9391..9741) product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(9741..11138) product bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(11493..12161) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394891.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(12171..14297) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15093..15734) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(15721..16764) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(16761..17459) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene liaF CDS complement(17428..17670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(17645..19510) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene pknB CDS complement(19507..20250) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983660.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(20275..21594) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene rsmB CDS complement(21584..22519) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene fmt CDS complement(22768..25152) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(25438..25755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(25778..26392) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002997509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene gmk CDS 26605..27549 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 27592..28278 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(28760..28999) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene rpsR CDS complement(29066..29548) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609585.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(29560..29850) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene rpsF CDS complement(30146..30619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 note possible pseudo, frameshifted CDS complement(30624..30809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 note possible pseudo, frameshifted CDS complement(31043..31219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(31253..31513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(31547..31807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(32103..32327) product garvicin Q family class II bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(32555..33478) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(33493..35802) product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(35957..36124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(36154..36426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(36936..37172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 38888..40057 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene mutY CDS 40269..40697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(41019..41363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, internal stop codon CDS complement(41364..42545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 note possible pseudo, internal stop codon CDS complement(42900..43943) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(44319..44633) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene trxA CDS complement(44806..45009) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683375.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(45096..47333) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263707.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(47334..47780) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263708.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(48610..49293) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897853.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(49461..50009) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(50069..50422) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene rbfA CDS complement(51039..53801) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene infB CDS complement(53821..54123) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262601.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(54116..54412) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(54432..55748) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene nusA CDS complement(55904..56302) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041971671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rimP CDS complement(56851..58521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 tRNA complement(58993..59079) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(59250..59885) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene trmB CDS complement(59886..60677) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983385.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(60884..61930) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(61933..62658) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 62759..63178 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 63175..63465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(63787..65022) product biofilm formation/cell division transcriptional regulator BrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene brpA CDS complement(65031..65543) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(65536..65946) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene tsaE CDS complement(66198..67616) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 67841..68653 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 69350..70360 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 70378..71184 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 71200..72120 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 72134..72520 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 72854..73846 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 73879..74694 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 74709..75635 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 75876..76118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 76115..76369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 note possible pseudo, frameshifted CDS 76413..76907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 note possible pseudo, internal stop codon, frameshifted CDS complement(77348..79639) product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(80199..80555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 80766..81140 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 81586..82863 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene serS CDS complement(83122..83748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(84567..85337) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(85334..86197) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002280638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene accD CDS complement(86206..87591) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene accC CDS complement(88181..88603) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene fabZ CDS complement(88600..89076) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene accB CDS complement(89080..90312) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene fabF CDS complement(90358..91095) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene fabG CDS complement(91105..92025) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene fabD CDS complement(92094..93062) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene fabK CDS complement(93287..93511) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(93576..94550) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(94550..94984) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(95392..96183) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(96400..97044) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 97402..98772 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 99041..100276 product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene pbp3 CDS complement(100380..100778) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(100771..102114) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene cysS CDS complement(102229..102402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(102580..103164) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene cysE CDS complement(103176..103925) product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(103918..106395) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene pnp CDS complement(107416..110085) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene adhE CDS complement(110449..110718) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene rpsO CDS complement(110877..111782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(111875..113041) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 113131..113784 product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 113863..114477 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene def CDS complement(115174..115803) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 115981..117381 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(117709..117969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(118251..118442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(118618..118800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 119139..119828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(119958..120506) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(120628..121065) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(121384..121530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(121759..126165) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(126428..127699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(127841..128374) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 128692..129474 product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(129690..130832) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene tgt CDS complement(131148..133349) product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(133521..134312) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(134889..137150) product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene glgP CDS complement(137155..138648) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene malQ CDS 138823..139572 product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(139640..140158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 note possible pseudo, frameshifted CDS complement(140297..140926) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(141106..142398) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 142743..144998 product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene gshAB CDS complement(145103..145447) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 145654..146838 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(147376..147918) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene nusG CDS 148114..149250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 149495..150520 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(150862..151053) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497678.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene secE CDS complement(151079..151231) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene rpmG CDS complement(151519..153843) product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene pbp2a CDS 153927..154805 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(154812..155510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(155839..157464) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262148.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene groL CDS complement(157775..158059) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene groES CDS complement(158272..159069) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(159242..159637) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(159770..160516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(160534..161346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(161347..162261) product thiopeptide-type bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(162268..163863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(163922..164452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(164456..165526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(165544..168063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(168056..169147) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(169157..169870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(169870..170712) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(170738..172468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(172465..173241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(173336..173494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(173532..173690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(173854..174480) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(174502..174819) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(174812..175111) product DUF4651 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 175211..176278 product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene pepA CDS 176346..177116 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene proC CDS complement(177480..178142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(178633..179346) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(179846..180706) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(181003..181515) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(181793..182533) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rlmB CDS complement(182969..183550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(183666..184841) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(185115..186374) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene radA CDS complement(186908..187378) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(187388..187852) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 188644..189672 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 189743..190657 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene galU CDS 190853..191299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(191357..191815) product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(192210..193559) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(194774..194914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(195059..195409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(195399..195704) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(196057..196611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(196608..197081) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene tadA CDS complement(197081..197857) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(198262..200121) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(200193..201458) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene rseP CDS complement(201585..202379) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(202392..203147) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(203803..204159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 204455..205327 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene hslO CDS 205314..206294 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene dusB CDS 206348..207229 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 207242..208258 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(208364..209260) product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(210426..212873) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(212866..213333) product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene ctsR CDS complement(213730..214059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(214071..214478) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(214916..215956) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene tsf CDS complement(216210..216983) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene rpsB CDS complement(217176..219026) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(219151..220110) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 220350..221366 product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002282737.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene ptcA CDS 221441..222793 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 222830..223927 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene aguA CDS 223976..224932 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene arcC tRNA 225022..225093 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 225226..225792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(226229..228124) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(228607..230232) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene treC CDS complement(230376..232343) product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene treP CDS 233042..233755 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene treR CDS 233952..234158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 234151..234720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 234717..234950 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 234947..235135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(235230..237866) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(237876..238577) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 238777..239361 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(239693..242947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 tRNA 240750..240851 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(243330..247232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(247582..248025) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002910787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene dtd CDS complement(248086..250308) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(250537..251283) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(251290..252243) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene prmA CDS complement(252612..253484) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(253534..254004) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 254088..255368 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 tRNA 255634..255708 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 255764..256366 product DUF4947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 256714..257412 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene dapD CDS 257520..258647 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 258726..259265 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 259249..259935 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262525.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 260091..260822 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene yaaA CDS complement(260935..261534) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982219.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene nrdG CDS complement(261677..261844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 note possible pseudo, internal stop codon CDS complement(261863..262042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 note possible pseudo, internal stop codon CDS complement(262279..262416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(262438..262716) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 263047..263595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 note possible pseudo, internal stop codon, frameshifted CDS complement(263698..265905) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene nrdD CDS complement(266006..267610) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074689.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(268173..268472) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(268487..268897) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene ruvX CDS complement(268903..269172) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(269330..269914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(270056..270400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 note possible pseudo, frameshifted CDS complement(270445..270870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 note possible pseudo, frameshifted CDS 270889..271218 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(271640..272326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(272469..273425) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene fabD CDS complement(273592..273828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(273870..274865) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(274887..275654) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene etfB CDS complement(275673..276812) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene acdA CDS complement(276826..277857) product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(277875..278105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(278136..278975) product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(278996..279763) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(279781..282102) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(282111..283415) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(283408..284169) product surfactin biosynthesis thioesterase SrfAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene srfAD CDS complement(284181..285032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(285044..286360) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene hemL CDS complement(286379..290305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(290351..306520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(306587..307057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(307299..308006) product mutanobactin A biosynthesis thioesterase MubT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene mubT CDS complement(308697..309584) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 310466..311647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 note possible pseudo, internal stop codon CDS 311648..311992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 note possible pseudo, internal stop codon CDS complement(312022..312363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 note possible pseudo, frameshifted CDS complement(312504..312860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 note possible pseudo, frameshifted CDS complement(313059..315362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(315364..316122) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 316524..316673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 note possible pseudo, internal stop codon, frameshifted CDS 316888..317022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 note possible pseudo, internal stop codon, frameshifted CDS 317117..317353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 note possible pseudo, frameshifted CDS 317382..317642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(317786..318346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 318472..319653 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(320584..321939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(321939..322307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(322582..322926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 note possible pseudo, frameshifted CDS complement(322971..323396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 note possible pseudo, frameshifted CDS complement(323506..323904) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene spx CDS 324113..324271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 note possible pseudo, internal stop codon CDS 324657..325070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 note possible pseudo, frameshifted CDS complement(325535..326683) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene recA CDS complement(326859..328130) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 329040..330953 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 331087..331476 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(331512..332063) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(332228..332818) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ruvA CDS complement(332986..333267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(333690..335645) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene mutL CDS complement(335962..338523) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene mutS CDS complement(338510..338863) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(338863..339291) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene argR CDS 339447..341138 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene argS CDS complement(341456..341815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(341854..342081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(342651..343592) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(343585..345333) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene aspS CDS complement(345523..345942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(345954..347234) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene hisS CDS 347548..347730 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene rpmF CDS 347746..347895 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene rpmG CDS 348177..348455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 348533..349552 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(349675..349920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 349998..350312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, internal stop codon, frameshifted CDS complement(350783..351190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 note possible pseudo, frameshifted CDS complement(351229..351960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 note possible pseudo, frameshifted CDS complement(352303..352602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(352748..353179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(353384..353695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(353777..353953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(354167..355960) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(356343..356972) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002503031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(357304..357918) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 358094..358420 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 358407..358979 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 358976..359854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(359916..362354) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 362485..363027 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(363757..364368) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene rpsD CDS complement(364753..365031) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(365037..366395) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene dnaB CDS complement(366536..366988) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rplI CDS complement(366990..368951) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(369034..370932) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene mnmG CDS complement(370969..371151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(371513..371674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(372158..373282) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene mnmA CDS complement(373422..375134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(375401..376039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(376196..377248) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(377385..378182) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(378175..379014) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(378990..379826) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(379830..380372) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene pgsA CDS complement(380384..381241) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(381301..382569) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(382571..383818) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 383898..384305 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene yaaA CDS 384308..385402 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene recF CDS complement(385614..387095) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene guaB CDS complement(387303..388328) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165475.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene trpS CDS 388501..390120 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958804.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 390181..392802 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 tRNA complement(392973..393046) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 393233..393308 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(393353..393832) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene rlmH CDS 394029..395237 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 395541..396314 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 396516..397904 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene dnaA CDS 398060..399196 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene dnaN CDS 399533..399724 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 399721..400602 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026216512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 400902..401450 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 401530..402645 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene ychF CDS 402720..403289 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene pth CDS 403282..406791 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene mfd CDS 406874..407146 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 407133..407507 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 407613..408911 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 408908..410176 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene tilS CDS 410173..410724 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene hpt CDS 410743..412743 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794527.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene ftsH CDS 413137..414534 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 rRNA 414892..416444 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA 416649..416723 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 rRNA 416990..419886 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 rRNA 420049..420156 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 420262..420336 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 420359..420431 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 420443..420515 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 420520..420603 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 420617..420689 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 420693..420764 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 420773..420860 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 420871..420944 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 420949..421022 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 421027..421102 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 421121..421196 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 421217..421306 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 421317..421390 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 421409..421483 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 421495..421567 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 421599..421674 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 421684..421755 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 421760..421849 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 421914..422744 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene mreC CDS 422746..423249 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene mreD CDS 423340..424659 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 424776..425744 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 425849..427024 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 427014..427769 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene recO CDS 427956..428954 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene plsX CDS 429060..429305 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 429295..429462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 430095..430997 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(432693..432923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 432925..433410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 433421..433996 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 434122..434547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 434540..435415 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 435418..436188 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 436191..437921 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 437957..438097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 438088..439431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 439731..440633 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 440969..441163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(441206..442081) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 442449..443159 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 443162..445471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 445601..446320 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 446517..450242 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 450383..451828 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene purF CDS 451994..453013 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene purM CDS 453013..453567 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene purN CDS 453564..454316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 454313..455860 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene purH CDS complement(456064..456606) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 456756..457277 product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 457603..458814 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 458973..459971 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 460202..461461 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene purD CDS 461458..461901 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 462024..463235 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 463247..463735 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene purE CDS 463722..464801 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002926478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene purK CDS 464915..465589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 465674..467836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 467826..468164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 468573..469787 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene purB CDS complement(470027..471400) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 rRNA 471729..473281 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA 473486..473560 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 rRNA 473757..476653 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 rRNA 476816..476923 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 477029..477103 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 477107..477179 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 477211..477286 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 477296..477367 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 477373..477462 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 477473..477546 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 477565..477639 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 477655..477737 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 477741..477813 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 477818..477892 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 477896..477969 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 477982..478065 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 478768..479394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 479625..480071 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene rplM CDS 480091..480483 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rpsI CDS 480765..481736 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene ruvB CDS 481845..482207 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754813.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 482186..482620 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074470.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 482617..484398 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 484495..485268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 485547..486236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 486464..487627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(487568..487726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 487752..489236 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene thrC CDS 489393..490700 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 490837..491625 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(491799..492254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 492306..492545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 492561..492869 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene rpsJ CDS 493108..493734 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rplC CDS 493758..494381 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rplD CDS 494381..494677 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 494695..495528 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986654.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rplB CDS 495626..495901 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262336.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rpsS CDS 495917..496261 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rplV CDS 496274..496927 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene rpsC CDS 496931..497344 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rplP CDS 497354..497560 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262332.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rpmC CDS 497588..497848 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene rpsQ CDS 497873..498241 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rplN CDS 498337..498642 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rplX CDS 498670..499212 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rplE CDS 499230..499415 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 499750..500148 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rpsH CDS 500583..501119 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rplF CDS 501220..501576 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rplR CDS 501594..502088 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rpsE CDS 502103..502285 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rpmD CDS 502420..502860 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rplO CDS 502876..504180 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene secY CDS 504499..505137 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 505253..505471 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene infA CDS 505631..505996 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene rpsM CDS 506014..506397 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpsK CDS 506449..507387 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 507408..507794 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rplQ rRNA 508288..509840 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA 510045..510119 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 rRNA 510316..513211 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 rRNA 513375..513482 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA 513492..513565 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 513919..514362 product zinc-dependent transcriptional regulator AdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene adcR CDS 514362..515066 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 515059..515865 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(516613..517869) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922558.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene tyrS CDS 517971..520373 product penicillin-binding protein PBP1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene pbp1b CDS 520759..521121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 521901..525482 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene rpoB CDS 525608..529246 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rpoC CDS 529560..531224 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 531329..532243 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598965.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 532254..533285 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 533296..534345 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 534342..535265 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(535502..537187) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 537318..537839 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 537852..538160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 538520..539119 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 539175..540356 product IS1182-like element ISLac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 note possible pseudo, internal stop codon CDS 540357..540701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 note possible pseudo, internal stop codon CDS complement(541269..541559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020412.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 541764..542486 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 542491..543636 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 543860..544480 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(544729..544920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 note possible pseudo, frameshifted CDS complement(544992..545204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(545361..546227) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 546338..547198 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054736140.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(547298..547660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 548001..548783 product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(548984..551368) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 551599..551976 product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 552136..553083 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene comGA CDS 553241..554050 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene comGB CDS 554047..554373 product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene comGC CDS 554384..554761 product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene comGD CDS 554733..555026 product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921722.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene comGE CDS 555010..555447 product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene comGF CDS 555425..555886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 555989..556249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(556546..558807) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(558804..560441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(560517..560699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 560807..561760 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 561823..563019 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 563497..564402 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 565090..565881 product sulfur-containing amino acid ABC transporter permease TcyL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399112.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene tcyL CDS 565874..566707 product sulfur-containing amino acid ABC transporter substrate-binding protein TcyK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene tcyK CDS 567087..568115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 568430..568909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 note possible pseudo, frameshifted CDS 569056..569322 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 569334..570671 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263409.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 570838..571245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(571426..571827) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(571824..572057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 572331..572624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 572728..573423 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 573416..574186 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 574375..574926 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 575086..576120 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene hrcA CDS 576142..576693 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263416.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene grpE CDS 577063..578889 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene dnaK CDS 578907..579149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 579365..580504 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene dnaJ CDS 580728..581474 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene truA CDS 581467..582228 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 582218..582697 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 582697..583260 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(583423..584271) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 584696..585979 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene tig CDS 586400..586981 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene rpoE CDS 587274..588878 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(589307..589456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 tRNA 589854..589941 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 590128..591009 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 591356..591751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 592138..592326 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rpmB CDS 592519..592884 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 592884..594554 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 594807..596510 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 596503..596985 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene ilvN CDS 597160..598182 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene ilvC CDS 598460..600961 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene leuS rRNA 601514..603067 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA 603272..603346 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 rRNA 603543..606438 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 rRNA 606602..606709 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA 606719..606792 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 607146..607340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 607707..608888 product IS1182-like element ISLac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 note possible pseudo, internal stop codon CDS 608889..609233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 note possible pseudo, internal stop codon CDS 609559..610755 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 610756..612492 product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(612577..612762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 613280..615913 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene polA CDS 616063..616503 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 617024..617479 product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene perR CDS 617731..618981 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ilvA CDS 619273..620163 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025168872.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(620297..621712) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene brnQ CDS complement(622085..622825) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(622825..624369) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 624990..625178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 625183..627102 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 627291..628157 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 628409..629209 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene mecA CDS 629213..630376 product rhamnose-glucose polysaccharide biosynthesis protein RgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rgpG CDS 631183..631953 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114502.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene sufC CDS 632088..633350 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene sufD CDS 633372..634598 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 634585..635022 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 635131..636843 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 637286..637780 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 637894..638640 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 639031..639684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(639734..640126) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 640238..640783 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 640870..642324 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene gltX CDS 642995..643795 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene pnuC CDS 643792..644526 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 644938..645687 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 646797..647987 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 648295..649695 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene argH CDS complement(650039..652489) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 652941..653276 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene rnpA CDS 653933..654733 product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 654861..655991 product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(656352..656720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008808817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(656805..657731) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(658000..658863) product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 659181..660035 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 660050..660898 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007122532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 661600..662055 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 662064..662477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 662586..662720 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002885866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene rpmH CDS 663441..664979 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene dltA CDS 664976..666238 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene dltB CDS 666314..666553 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene dltC CDS 666546..667814 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene dltD CDS 668206..668706 product YehR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 669348..670118 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 670105..670683 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rnmV CDS 670683..671459 product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 671494..671877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 671943..672563 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(672697..672975) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 673097..673624 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 673646..674164 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 674296..674889 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(674958..675272) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 675371..675985 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289703.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 676039..676914 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene rsmA CDS 676951..677358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 tRNA complement(677396..677485) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(677613..677697) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 678170..679042 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene rsgA CDS 679055..679714 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene rpe CDS 679707..680342 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 680339..681616 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 681606..682544 product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 682665..683456 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene purR CDS 683695..684108 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene rpsL CDS 684129..684599 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893865.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene rpsG CDS 684913..686994 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905422.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene fusA CDS 687229..688242 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260670.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene gap CDS 688442..689638 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(689875..690912) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 691050..691508 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262634.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 691758..692285 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262487.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 692492..692863 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 692932..694278 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene glnA CDS 694623..695246 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(695825..697516) product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rnjA CDS complement(697518..697748) product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 697997..698683 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene tsaB CDS 698661..699101 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene rimI CDS 699135..700154 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene tsaD CDS 700490..701188 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 701175..701501 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 701529..702179 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene nth CDS 702233..702442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 note possible pseudo, frameshifted CDS 702539..703261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 note possible pseudo, frameshifted CDS complement(703552..704676) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680058.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 705062..705298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 705337..705573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 706914..707426 product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 707489..708079 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 708246..708965 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(709052..709351) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 710215..711552 product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene pepC CDS complement(711607..713853) product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene pbp1a CDS complement(713850..714455) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene recU CDS 714531..715055 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 715145..715483 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263050.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene gpsB CDS 715945..717099 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 717111..718595 product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(719110..719598) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 719903..721510 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 721745..722329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 note possible pseudo, frameshifted CDS 722317..722736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 note possible pseudo, internal stop codon, frameshifted CDS 723094..725079 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene tkt CDS 725218..725592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 726419..727183 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 727180..728784 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922559.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 728825..729637 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922558.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene proB CDS 729747..730997 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 731562..732512 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene rsmH CDS 732521..732856 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262088.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene ftsL CDS 732860..735118 product penicillin-binding protein PBP2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene pbp2X CDS 735120..736133 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene mraY CDS 736237..737580 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 737913..738746 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 738872..739780 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 739780..740523 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 740701..740883 product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 741118..742035 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene trxB CDS 742213..743607 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 743879..745336 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 745444..746268 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262098.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene nadE CDS 746490..747182 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(747742..750018) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922642.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 750237..751109 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(751443..752330) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051848376.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 752443..753195 product CppA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 753192..754112 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 754112..754657 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(754827..757160) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene pflB CDS 757398..758495 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene dinB CDS 758813..759271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 note possible pseudo, internal stop codon CDS 759347..759994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 note possible pseudo, internal stop codon CDS 759995..760339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 note possible pseudo, internal stop codon CDS complement(760527..761006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(761047..761520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(761523..764072) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(764199..764843) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene lepB CDS complement(764859..765782) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rnhC CDS 765958..766266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 766270..766788 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 767487..769829 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 769896..770309 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 770363..771178 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(771630..771845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(771818..772081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(773000..773362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(773400..773651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 774081..775229 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene nagA CDS 776033..776452 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 776454..776909 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 776902..777327 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 777769..778683 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene glyQ CDS 778685..780724 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene glyS CDS 781459..781716 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(781968..782453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 782617..782973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 note possible pseudo, frameshifted CDS 783029..783307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 note possible pseudo, frameshifted CDS 783690..786515 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene uvrA CDS 787100..788605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 788568..788753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 789085..790584 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 790581..791285 product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584718.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 791391..792458 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 792468..792923 product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 793081..793641 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene efp CDS 793844..794230 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 794223..794642 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene nusB CDS complement(794985..795947) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(795951..797387) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 797623..799587 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 799733..800620 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 800814..801764 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294263.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene manA CDS 802038..804569 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene secA CDS 805031..806062 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 806064..807122 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027207.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 807378..807731 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene acpS CDS 807769..808872 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625941.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene alr CDS 809252..811285 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene recG CDS complement(811364..811726) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 811813..812160 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(812223..813188) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 813254..814669 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(814910..815359) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 815610..816824 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 817259..818044 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene codY CDS 818123..818674 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(818837..819394) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 819515..820216 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262181.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 820448..823081 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 824276..824578 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene gatC CDS 824578..826044 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene gatA CDS 826044..827486 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene gatB CDS 827668..828489 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 828502..829479 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 829661..830533 product DUF3114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(830727..831482) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene fabG CDS 831807..832715 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(832832..833104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 note possible pseudo, frameshifted CDS 833885..834022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 834187..834714 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 834714..835820 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene yqeH CDS 835835..836206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 836252..836563 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene yhbY CDS 836718..837350 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 837350..837943 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene yqeK CDS 837949..838431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 838449..838802 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rsfS CDS 838849..839586 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 839744..840646 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 840780..841880 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 841882..842127 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 842617..843444 product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 843936..846035 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 846173..846466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 846456..846779 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 847156..848001 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(848233..848607) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene dhaM CDS complement(848608..849186) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene dhaL CDS complement(849223..850212) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene dhaK CDS 850683..851402 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(851503..852864) product multidrug efflux MFS transporter MdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene mdeA CDS 853028..854125 product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 854669..855328 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 855592..856212 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene tmk CDS 856215..857078 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262682.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 857075..857875 product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene ricT CDS 857868..858188 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene yabA CDS 858192..859058 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rsmI CDS complement(859046..859258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 859444..860679 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 860750..861091 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 861442..864108 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene acnA CDS 864163..865281 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 865286..866467 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene icd CDS 866762..867856 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene serC CDS 867895..868443 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 868775..869956 product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 870025..870258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 870255..870740 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 871004..871360 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 871761..872624 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 873333..874358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 874333..875241 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 875248..875988 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703143.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 876287..876727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(876827..877657) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 877899..879155 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(879212..879565) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 879847..880272 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene rplK CDS 880367..881056 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene rplA CDS 881220..881951 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene pyrH CDS 881970..882527 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene frr CDS 882592..883449 product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene cvfB CDS 883833..884660 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152903.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 884809..885696 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 886292..887353 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 887350..888042 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 889088..889840 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 889842..891797 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 891906..892571 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 892568..893509 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 893736..894422 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 note possible pseudo, internal stop codon CDS complement(894465..894671) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(894768..895166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 note possible pseudo, frameshifted CDS complement(895746..895901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(895901..896137) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(896242..897732) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene lysS CDS 897995..899158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 899180..899662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 899945..900673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 900774..901679 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 901820..902629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 note possible pseudo, frameshifted CDS 902617..904521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 note possible pseudo, frameshifted CDS 904726..905961 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene sstT CDS 906192..907034 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 907050..907598 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 907601..909283 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 909273..910103 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(910196..910867) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(910883..912256) product potassium uptake transporter channel subunit KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032459855.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene ktrB CDS complement(912275..912988) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rsmG CDS 913928..914479 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 914489..915385 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene htpX CDS 915716..916252 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 916313..917002 product response regulator GcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene gcrR CDS 917149..917646 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985941.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene nrdR CDS 917633..918802 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 918803..919702 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene dnaI CDS 919788..919955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 920016..921326 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene der CDS complement(921414..922007) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 922131..925226 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 925305..925955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 926110..927441 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene murC CDS 928070..928561 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 928957..930816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 930926..931408 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene greA CDS 931633..931923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 931980..932501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(932712..933512) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene yidC CDS complement(934021..934299) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 934339..935097 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 935136..935639 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 935689..936393 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(936654..937319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(937454..937630) product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 937701..938588 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene miaA CDS 938733..940865 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 940852..941289 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 941436..941702 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 941783..942712 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene hprK CDS 942712..943506 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene lgt CDS 943541..943942 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 943942..944361 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 944827..945630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(945711..946019) product DUF3270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 946220..947149 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 947286..948026 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 948529..949179 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 949176..951407 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 951582..952442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 953247..953642 product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 953947..954987 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene holA CDS 955099..956130 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 956356..956964 product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene sodA CDS 957538..958584 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 958948..959775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(960302..961330) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene queA CDS 961724..962428 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene nagB CDS 962544..962987 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 962987..963367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 963385..964224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 964244..965221 product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(965223..965618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(965611..966213) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021358883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 966373..966864 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 966974..967981 product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 967971..969776 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene pepF CDS 969817..970344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 970307..970525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 970704..972551 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983847.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene typA CDS 972687..972989 product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 973308..974663 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene murD CDS 974666..975739 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516700.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 975780..976994 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(977725..978447) product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene lrgB CDS complement(978471..978917) product holin-like protein LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene lrgA CDS complement(979193..979927) product two-component system response regulator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene lytR CDS complement(979905..981650) product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene lytS CDS 982078..983556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 983908..985452 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 986306..986704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 986828..987676 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 987663..987938 product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 987928..988572 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 988902..991361 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(991545..993326) product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(994053..994910) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002281358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 995125..996249 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene queG CDS 996451..997431 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097677707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene prfB CDS 997863..998555 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ftsE CDS 998548..999462 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene ftsX CDS 1000215..1001600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1001621..1003345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1003464..1005068 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1005065..1005604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1005613..1006401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1006410..1007228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1007230..1007463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1007476..1009002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1009241..1009957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1010064..1010633 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1010755..1011516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 note possible pseudo, frameshifted CDS complement(1011767..1012030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 note possible pseudo, frameshifted CDS 1012351..1013343 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene asnA CDS 1013484..1014572 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1014987..1015526 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rsmD CDS 1015516..1016007 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene coaD CDS 1015994..1017082 product S16 family serine protease SepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene sepM CDS 1017646..1018269 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 1018271..1019398 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124990.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene rlmN CDS 1019391..1019921 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 1020376..1022118 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1022108..1023859 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1024839..1026365) product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1026829..1027287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1027559..1028401 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1028394..1029236 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1029214..1029810 product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806954.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1030465..1030740 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1030807..1030992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1031461..1032396) product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263253.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1032709..1033011 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1033014..1034897 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1035124..1035816 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1036225..1038390 product penicillin-binding protein PBP2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene pbp2b CDS 1038465..1039061 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene recR CDS complement(1039088..1039387) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1039520..1040686 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1040729..1041289) product NAD(P)H-dependent oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene mdaB CDS complement(1041286..1041882) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1042475..1045465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 note possible pseudo, internal stop codon CDS 1045562..1046839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 note possible pseudo, internal stop codon CDS 1046839..1047705 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene cas1 CDS 1047717..1048046 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene cas2 CDS 1048036..1048707 product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene csn2 repeat_region 1048962..1049129 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagagctgtgttgtttcgaatggttccaaaac CDS 1049311..1050114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1050550..1051017 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1051018..1052256 product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 1052409..1053455 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1054173..1055126 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1055327..1055890) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1056246..1057610 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1057625..1058305 product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1058567..1060228 product ribonuclease J2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263099.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rnjB CDS 1060340..1061125 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1061239..1061955 product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1061972..1062331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1062471..1064411 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1064834..1065802 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922238.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1066016..1067014 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1067224..1068612 product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1068795..1070573 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene lpdA CDS 1070683..1071675 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1071902..1073812 product GbpC/Spa domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1074543..1076351 product GbpC/Spa domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1076518..1076733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1076972..1078891 product GbpC/Spa domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1079089..1079877) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222749.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1079877..1081220) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1081492..1082253 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1082253..1083380 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1083555..1083785) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131476.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1084084..1084941 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene cdaA CDS 1084931..1085920 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1085973..1087325 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene glmM CDS 1087602..1088330 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1088716..1090029 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020750251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene obgE CDS 1090245..1090433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1090447..1091952) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1092333..1093073) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1093073..1095268) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1095445..1097436 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261961.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene uvrB CDS 1097606..1098331 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1098341..1098805 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1098995..1099816 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1099952..1100128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1100219..1100563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 note possible pseudo, internal stop codon CDS complement(1100564..1101745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 note possible pseudo, internal stop codon CDS complement(1102111..1102491) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene mscL CDS 1102711..1104504 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene dnaG CDS 1104513..1105622 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene rpoD CDS 1106201..1106536 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1106552..1107478 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1107585..1108436 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene rfbD CDS 1108783..1109937 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1109927..1110886 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1110896..1111708 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1111708..1112928 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1112955..1113995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1113999..1115753 product rhamnose-glucose polysaccharide assembly protein RgpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene rgpF CDS 1115758..1118259 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1119792..1120478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 note possible pseudo, frameshifted CDS 1120462..1120740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 note possible pseudo, frameshifted CDS 1120880..1122262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1123311..1123610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 note possible pseudo, frameshifted CDS 1123897..1124025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 note possible pseudo, internal stop codon CDS 1124071..1124370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 note possible pseudo, internal stop codon CDS 1124611..1126479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1126698..1127846 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1128296..1128616) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1128628..1129077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1129352..1130005) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1130192..1131844) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1132319..1133500 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1133500..1136703 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1137337..1138341 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene trpX CDS 1138659..1139522 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1139519..1140277 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1140586..1143930 product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rexB CDS 1143930..1147595 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene addA CDS 1147891..1149507 product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene gtfA CDS 1149504..1151672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1151875..1152048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1152062..1152994 product HindIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 1152972..1153862 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1154086..1155219 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene hemW CDS 1155674..1156411 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1156528..1157292 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1157293..1157940 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1158101..1158517 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene ndk CDS 1158683..1160509 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene lepA CDS 1160653..1161021 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1161211..1163850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1163981..1164484 product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1164712..1165368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1165370..1166050 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene cmk CDS 1166283..1166750 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene infC CDS 1166787..1166987 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene rpmI CDS 1167037..1167396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1167743..1169032 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1169236..1170519 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene aroA CDS 1170512..1170988 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1170985..1171809 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837156.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene pheA CDS 1171843..1173282 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1173367..1174728 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene rlmD CDS 1175011..1175466 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1175533..1176000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 note possible pseudo, internal stop codon CDS 1176004..1176387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 note possible pseudo, internal stop codon CDS 1176639..1177100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1177323..1178381 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1178392..1178829 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1179487..1179738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1179882..1180169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1180485..1182038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1182056..1182601 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1182891..1183421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 note possible pseudo, internal stop codon CDS 1183670..1183795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 note possible pseudo, frameshifted CDS 1184135..1184464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 note possible pseudo, frameshifted CDS 1184506..1185027 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1185039..1185341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1185362..1185967 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1186185..1186940 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1187163..1187627 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1187709..1189466 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1189691..1190188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 note possible pseudo, internal stop codon CDS 1190276..1190620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 note possible pseudo, internal stop codon CDS 1190712..1191233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1191395..1192396 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene galE CDS 1192634..1194247 product glucan 1,6-alpha-glucosidase DexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene dexB CDS 1194556..1195065 product DinB family glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375627.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene gst CDS 1195088..1196437 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1196991..1197755) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1198016..1198444 product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene lacA CDS 1198472..1198987 product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene lacB CDS 1199127..1200107 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene lacD CDS 1200385..1201218 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1201241..1201555 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1201558..1203264 product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1203279..1204682 product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene lacG CDS 1204761..1205657 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1205674..1205943 product DUF3884 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1206238..1207524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1207703..1208422 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1208486..1208887) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1208982..1210130) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1210381..1210827) product DUF1694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1211145..1212446 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene eno CDS 1213466..1214473 product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1214489..1215358 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1215371..1216063 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1216072..1216746 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1216756..1217520 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1218378..1218806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 note possible pseudo, frameshifted CDS complement(1218833..1219264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 note possible pseudo, frameshifted CDS complement(1219414..1220532) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1220752..1221354 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1221372..1222775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1222941..1223852 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1223942..1224706 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262177.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1224940..1225458 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012130838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene tpx CDS 1225675..1226151 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1226151..1226921 product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1227099..1227692 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1228213..1232856 product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836622.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1233056..1233310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1233342..1233581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1233578..1233877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1234057..1235412 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1235591..1239688 product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1240000..1244517 product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1244772..1245236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 note possible pseudo, internal stop codon CDS complement(1245246..1245452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 note possible pseudo, internal stop codon CDS 1245916..1246236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1246363..1246593 product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1246595..1248001 product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1248383..1249228 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene truB CDS 1249234..1250151 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1250669..1250947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1251000..1251218 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1251208..1251978 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1252631..1256521 product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1256621..1257937 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1258071..1258943 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1259130..1260065 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene pstC CDS 1260055..1260942 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene pstA CDS 1260954..1261757 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene pstB CDS 1261769..1262527 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene pstB CDS 1262561..1263220 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262211.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene phoU CDS 1263460..1266006 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1266240..1266914 product three-component system response regulator CiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ciaR CDS 1266916..1268289 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1268501..1268734) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene rpsT CDS complement(1268802..1269722) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene coaA CDS 1269787..1270377 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1270374..1271651 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1271661..1272323 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene deoC CDS 1272310..1272729 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1272789..1273847 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1274174..1275709 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1275702..1276766 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1276763..1277716 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1277945..1280143 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene pulA CDS 1280294..1282174 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene glgB CDS 1282245..1283384 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262950.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1283374..1284507 product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene glgD CDS 1284504..1285937 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene glgA CDS 1285963..1288359 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1289668..1290819 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1290819..1291457 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1291457..1292392 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1292393..1293058 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1293362..1294732 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1295062..1296051) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1296257..1298746 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197090491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene gyrA CDS 1298733..1299509 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1300094..1301812) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1301959..1302531) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1302515..1303069) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595814.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene coaC CDS complement(1303062..1303748) product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1303925..1305595 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1306400..1307719 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1307995..1309479 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene cls CDS 1309804..1310370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 note possible pseudo, frameshifted CDS 1310354..1310989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 note possible pseudo, internal stop codon, frameshifted CDS 1310990..1311334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 note possible pseudo, internal stop codon CDS complement(1311475..1312209) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003077559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1312317..1312841 product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1313100..1314176 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263802.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1314508..1315455 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene dapA CDS 1315632..1315970 product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1316023..1317315) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1317436..1317945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1318159..1319010 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene ylqF CDS 1318997..1319764 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1319795..1319974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1319990..1320151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1320134..1320370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 note possible pseudo, internal stop codon CDS 1320412..1321899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1322097..1322936 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene dprA CDS 1323242..1325386 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene topA CDS 1325550..1326929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1327237..1327734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1328703..1329542 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1329747..1330418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 note possible pseudo, internal stop codon, frameshifted CDS 1330519..1330683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1330800..1331327 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1332021..1332524 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1332690..1333871 product IS1182-like element ISLac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 note possible pseudo, internal stop codon CDS 1333872..1334216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 note possible pseudo, internal stop codon CDS 1334338..1335081 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1335084..1336430 product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1336548..1337321) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1337334..1339481) product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1339802..1340017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1340182..1340481 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1341101..1341292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1341320..1341520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1341690..1341926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1341958..1342368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1342411..1343433 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1343841..1344020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1344047..1344226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1344264..1344641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1344808..1345104 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1346268..1346732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1347153..1348304 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1348310..1349014 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1349024..1350268 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1351326..1351967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1351951..1352796 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1352861..1353673 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1354019..1354366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1354465..1354776 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1354938..1355210 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene rpsP CDS 1355222..1355461 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1356050..1356694 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1356691..1357224 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1357256..1358233 product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 tRNA 1358522..1358595 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(1359075..1359278) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1359331..1359648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 note possible pseudo, frameshifted CDS 1360369..1360890 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene rimM CDS 1360874..1361620 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene trmD CDS 1361613..1362611 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1363060..1363755 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1364088..1364801 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1364798..1365709 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene pfkB CDS 1365706..1367685 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1367775..1368470 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene radC CDS complement(1368618..1369253) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1369511..1370149) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1370275..1370622) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1370627..1371748) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1371750..1372715) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1372894..1373466) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1373595..1374260 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1374235..1375077 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1375074..1375985 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1375982..1376971 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257093.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene pta CDS 1377250..1378002 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1378536..1378922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1379069..1379914 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1380174..1381064 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1381258..1382166) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1382156..1383340) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836446.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1384043..1384882 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1385532..1385879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 note possible pseudo, internal stop codon, frameshifted CDS 1385961..1386119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 note possible pseudo, internal stop codon CDS 1386197..1386715 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1386730..1386900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1386922..1388154 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene clpX CDS 1388164..1388763 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene yihA CDS 1389438..1390811 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1390842..1391789 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene mmuM CDS 1392099..1392599 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene rplJ CDS 1392672..1393043 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene rplL CDS 1393518..1393739 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1393744..1394859 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1395474..1395782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1395665..1396045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 note possible pseudo, frameshifted CDS 1396711..1396932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1396916..1397389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 note possible pseudo, frameshifted CDS 1397432..1398880 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1398898..1399689 product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1399996..1401108 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene glf CDS 1401113..1401982 product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1402041..1403261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1403316..1404323 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1404328..1405479 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1405466..1406458 product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1406464..1407525 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1407570..1408604 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1408601..1409608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1409971..1410258 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1410248..1410598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1410591..1411748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1411776..1412246 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1412497..1413246 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1413230..1415779 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene mprF CDS 1416184..1417323 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1417444..1417800) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1418035..1418913 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene mvk CDS 1418895..1419839 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene mvaD CDS 1419832..1420830 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1420827..1421831 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene fni CDS 1421976..1422200 product DUF4649 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1422299..1422952) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1422924..1423388) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1423558..1423812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1423842..1424315 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1424440..1425159 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1425268..1425471 product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1425552..1426259 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1426485..1426850 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1426840..1427145 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001819358.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1427420..1429258 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1429373..1430644) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1430768..1432054 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1432056..1432916 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene thrB CDS 1432909..1433820 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene rarD CDS 1434004..1435263 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1435302..1435865 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133588.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene folE CDS 1435869..1436669 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene folP CDS 1436673..1437032 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene folB CDS 1437029..1437514 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene folK CDS 1437850..1438752 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene murB CDS 1439069..1440223 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1440207..1441007 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1441004..1441780 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712712.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1441773..1442846 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1443468..1443698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 note possible pseudo, frameshifted CDS 1443704..1444000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 note possible pseudo, frameshifted CDS complement(1444217..1444399) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1444836..1445069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 note possible pseudo, internal stop codon, frameshifted CDS 1445095..1445838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 note possible pseudo, internal stop codon, frameshifted CDS 1445932..1446576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1446942..1447535 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068144.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1447532..1448611 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene prfA CDS 1448608..1449438 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene prmC CDS 1449431..1450030 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084873038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1450047..1450496 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1450656..1451906 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1451908..1452885 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 1452887..1453492 product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1453494..1455221 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1455218..1456942 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1458559..1459890 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene trmFO CDS 1460438..1461580 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 1462019..1462645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1463187..1463840 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene queC CDS 1463840..1464286 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene queD CDS 1464271..1464999 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene queE CDS 1465084..1465578 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene queF CDS complement(1465724..1466794) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene xerS CDS complement(1467107..1467352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1467423..1468997) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene ffh CDS complement(1469023..1469355) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402071.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1469523..1470284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1470801..1471499) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262275.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1471627..1473165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1473339..1474892 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene guaA CDS 1475061..1476236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1476462..1476602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 note possible pseudo, internal stop codon CDS 1476768..1477043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 note possible pseudo, internal stop codon, frameshifted CDS 1477159..1477380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 note possible pseudo, frameshifted CDS complement(1477664..1479418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1479699..1480133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1480290..1480601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1480594..1481670 product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1481673..1482290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006268963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1482470..1483057 product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1483047..1483238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1483252..1484460 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775621.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1484694..1485686) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1485865..1486566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 note possible pseudo, internal stop codon CDS complement(1487018..1488430) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene sufB CDS complement(1488588..1489700) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene leuC note possible pseudo, frameshifted CDS complement(1489651..1489992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 note possible pseudo, frameshifted CDS complement(1490193..1490480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1490598..1491164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1491253..1492203) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene nrdF CDS complement(1492215..1493171) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene nrdF CDS complement(1493222..1495399) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene nrdE CDS complement(1495386..1495880) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene nrdI CDS 1496044..1496709 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1496805..1497161 product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1497311..1498726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1499284..1500465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1500605..1500910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1500971..1502212) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1502205..1502900) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1502901..1503518) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1503888..1504292) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1504345..1504971) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1504968..1505723) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1505730..1506644) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1506634..1507269) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964782.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1507780..1509204) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1509508..1511256) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1511246..1513075) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1513083..1513511) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1513738..1515837 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1516230..1517018) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1516999..1517847) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1517852..1518292) product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1518282..1518734) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1518962..1519345 product DUF3021 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1519485..1520837) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene gdhA CDS 1521061..1521570 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1522158..1523909) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1523923..1525728) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1526063..1527043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 note possible pseudo, frameshifted CDS complement(1526991..1527950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted CDS complement(1528121..1529326) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1529323..1530090) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene dapB CDS complement(1530157..1531011) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262892.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1531013..1531387) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000452063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1531673..1532194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178080.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1532336..1533295) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene hemH CDS complement(1533531..1534970) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1535180..1535782) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1535797..1536375) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1536386..1536898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 note possible pseudo, frameshifted CDS complement(1536943..1537722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 note possible pseudo, frameshifted CDS complement(1537995..1538378) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1538548..1538862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 note possible pseudo, internal stop codon CDS complement(1538920..1539351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 note possible pseudo, internal stop codon CDS complement(1539507..1539923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1540246..1540539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1541594..1544773) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262009.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene carB CDS complement(1545447..1546538) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1546733..1547659) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1547665..1548927) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1548983..1549504) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823056.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene pyrR CDS complement(1549907..1550803) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1550787..1551251) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene lspA CDS complement(1551354..1552259) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1552587..1553282) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764011.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1553535..1554473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1554582..1555538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1555760..1556758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1557209..1558567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1558717..1560597) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1560584..1561339) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1562026..1563015) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1563005..1563691) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1564258..1569051) product glucosyltransferase GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene gtfB CDS complement(1569221..1570336) product ISAs1-like element IS1548 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1570786..1571079) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261998.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene rpmA CDS complement(1571103..1571435) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1571445..1571759) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene rplU CDS complement(1572080..1573258) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1573485..1574027) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1574042..1575268) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene thiI CDS complement(1575314..1576459) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1576625..1577161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1577164..1578411 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990257.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1578498..1579850) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene gorA CDS complement(1580600..1580860) product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1580876..1581037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1581179..1582975) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene uvrC CDS 1583164..1587393 product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1587555..1587809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 note possible pseudo, frameshifted CDS complement(1587964..1588611) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1588605..1589303) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1589709..1590410) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164405296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1590643..1591497) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1591611..1592039) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1592130..1592279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 note possible pseudo, frameshifted CDS complement(1592382..1592675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 note possible pseudo, frameshifted CDS complement(1592880..1593308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1593526..1594659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 tRNA complement(1594934..1595006) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 1595256..1595465 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1595950..1596384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1596406..1596723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1596895..1598046) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1598182..1598817 product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1598907..1600268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1600265..1601437) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1601929..1602396) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1602412..1602780) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1602837..1603277) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1603612..1603950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1604018..1604701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1604911..1606146 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene fabF CDS 1606300..1606734 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1607073..1607387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 note possible pseudo, internal stop codon, frameshifted CDS complement(1607477..1607911) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene msrB CDS complement(1607921..1608556) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1608769..1610028) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1610324..1611511) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837180.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene metK CDS complement(1612027..1612590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 note possible pseudo, frameshifted CDS complement(1612562..1612804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 note possible pseudo, frameshifted CDS complement(1612852..1613040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1613123..1614724) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1614887..1615105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1615563..1617092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1617120..1618247) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1618261..1618851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1618860..1620401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1620518..1621369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1621507..1621965) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1622068..1622571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1622568..1623680) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1623931..1624194) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1624195..1624416) product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1624539..1625783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 note possible pseudo, internal stop codon CDS complement(1625829..1627535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 note possible pseudo, internal stop codon CDS 1627801..1628742 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene birA CDS complement(1628717..1628938) product DUF3272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895701.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1629182..1630882) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene dnaX CDS complement(1630882..1631379) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836852.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1631548..1632222) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1632401..1632979) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1633444..1634019) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1634027..1634830) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1635458..1636243) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1636352..1636945) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene leuD CDS complement(1636959..1638347) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene leuC CDS complement(1638614..1639651) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene leuB CDS complement(1639698..1641251) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1641643..1642059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1642429..1643055) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene udk CDS 1643258..1644340 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1644499..1644840) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1644853..1645956) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1646089..1647255) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene aroC CDS complement(1647256..1648323) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261933.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene aroB CDS complement(1648404..1649270) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261932.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1649260..1649916) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene aroD CDS complement(1649944..1651104) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1651222..1653375 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922138.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1653640..1654287) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1654426..1654740) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265591.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene hisE CDS complement(1654857..1655177) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene hisI CDS complement(1655174..1655932) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene hisF CDS complement(1655936..1656655) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603770.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene hisA CDS complement(1656633..1657259) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene hisH CDS complement(1657261..1657845) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene hisB CDS complement(1658044..1658691) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene serB CDS complement(1658678..1659961) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene hisD CDS complement(1659958..1660605) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene hisG CDS complement(1660602..1661576) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263172.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1661603..1662652) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene hisC CDS complement(1663950..1665977) product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263401.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1666632..1666808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 1666780..1667007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 note possible pseudo, internal stop codon, frameshifted CDS complement(1667582..1670353) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1670524..1675233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1675777..1679589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1679967..1682333) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene pheT CDS complement(1682443..1682964) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1682990..1684033) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene pheS CDS complement(1685119..1685997) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1686447..1686638) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1686638..1687906) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene murA CDS complement(1688456..1688875) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1688888..1690294) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene atpD CDS complement(1690346..1691224) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1691237..1692742) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene atpA CDS complement(1692758..1693294) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1693294..1693791) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene atpF CDS complement(1693809..1694522) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene atpB CDS complement(1694557..1694763) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1695032..1696060) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922116.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1696070..1698091) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene ligA CDS complement(1699020..1699406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 note possible pseudo, internal stop codon CDS complement(1699521..1700021) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1700240..1700461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1700663..1700842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1700862..1701398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1701536..1701931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1702057..1702461 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1702558..1703277) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene budA CDS complement(1703349..1705022) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene alsS CDS complement(1705606..1706817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1706825..1707991) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1708000..1708482) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163512.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1708617..1709633 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1709759..1710289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 note possible pseudo, internal stop codon, frameshifted CDS 1710268..1710450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 note possible pseudo, internal stop codon, frameshifted CDS 1710639..1710830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836777.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1711119..1712228) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904722.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1712241..1713065) product ZIP family manganese transporter TmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene tmpA CDS complement(1713077..1713865) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1713855..1714541) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1714724..1715416) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1715426..1716370) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene metA CDS complement(1716474..1716992) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1717224..1717961) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263837.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1718024..1719304) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1719626..1720384) product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1720819..1721604 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262988.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1722732..1722878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1722865..1723563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 note possible pseudo, frameshifted CDS complement(1723520..1723741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1723876..1724634) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1724680..1726974) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene pcrA CDS complement(1727583..1728017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1728088..1729107) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1729337..1730971) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130367.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1731245..1732471 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1732619..1733980 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1733980..1734816 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1734990..1736126 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene ugpC CDS 1736662..1738035 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1738357..1739553 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1740468..1741316) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024379094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1741332..1741964) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1741974..1742615) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1742774..1743106) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1743292..1743525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1743598..1744407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1744452..1745219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1745396..1746556) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1746593..1747030) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1747033..1748988) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1749094..1750872) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1751229..1753040) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922374.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene glmS CDS complement(1753474..1754034) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984449.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene lepB CDS complement(1754303..1755805) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene pyk CDS complement(1755879..1756892) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262160.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene pfkA CDS complement(1756974..1760081) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1760264..1760638 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1760663..1761361 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1761373..1762158 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1762300..1763826 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1763908..1764543) product DUF3862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 tmRNA complement(1764586..1764931) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 1765007..1765609 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 tRNA complement(1765718..1765789) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(1766027..1767229) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene rpsA tRNA complement(1767344..1767418) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1767567..1767649) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(1767700..1767930) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037098.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1768114..1769136) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1769278..1771701) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene parC CDS complement(1772080..1773210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1773210..1775153) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene parE CDS 1775306..1775947 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene plsY CDS complement(1776101..1778680) product cell surface ecto-5'-nucleotidase Nt5e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002284146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene nt5e CDS complement(1778818..1780086) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1780202..1780855) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1780865..1781365) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1781376..1781723) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1781774..1782403) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene pyrE CDS complement(1782532..1783230) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene pyrF CDS complement(1783838..1784323) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1784348..1785286) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1785296..1786090) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1786232..1786696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1787067..1788113) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rfbB CDS complement(1788556..1789149) product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1789149..1790018) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263084.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene rfbA CDS 1790209..1791114 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1791853..1792356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 note possible pseudo, frameshifted CDS complement(1792368..1793231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 note possible pseudo, frameshifted CDS complement(1793222..1793881) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1793913..1794659) product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1794659..1795396) product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1795398..1796099) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1796246..1796707) product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1796728..1797492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1797494..1798201) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene deoD CDS complement(1798213..1799445) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1799442..1800149) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263214.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1800163..1800972) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1800986..1801555) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1801584..1802354) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1802367..1803578) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033130.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1803728..1804414) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene rpiA CDS 1804554..1805924 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene mnmE CDS complement(1806316..1806885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1807166..1807927) product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1807924..1808508) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263204.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1808655..1810064) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene pepV CDS complement(1810250..1811218) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1811238..1812098) product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1812223..1813503) product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene spxR CDS complement(1813500..1814135) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1814325..1816547) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene recJ CDS complement(1816544..1817317) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1817314..1818243) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene rnz CDS complement(1818300..1818953) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1818946..1820184) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene hflX CDS complement(1820489..1822213) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene ezrA CDS complement(1822485..1824437) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene gyrB CDS complement(1824439..1825035) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1825144..1826376) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1826439..1827425) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1827696..1827920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1828070..1828219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1828508..1830205) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene ilvD CDS complement(1830290..1830631) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1830841..1831296) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene nrdI tRNA complement(1831431..1831504) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(1831598..1832257) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1832553..1832888 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1832941..1833288) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene rplS CDS complement(1833387..1834574) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1834733..1834999) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1835060..1835710) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1836107..1836505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1837412..1838797) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene sufB CDS complement(1838939..1839382) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1839449..1840456) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene add CDS 1840644..1841435 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene yghU CDS 1841539..1842483 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1842467..1843414 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1843781..1844386 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1844402..1845616 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1845765..1846007 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710764.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1846367..1846675) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1846678..1847016) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352309.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1847028..1847783) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1848100..1849620) product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1850297..1851208) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene whiA CDS complement(1851205..1852182) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1852179..1853066) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene rapZ CDS complement(1853221..1853973) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1854153..1854530) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1854550..1855644) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1855827..1856342) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1856474..1857343 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1858469..1859815) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene asnS CDS complement(1859839..1860201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1860173..1860418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1860752..1861933) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1861930..1862409) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1862448..1864919) product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002274023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1865370..1866200 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1866349..1867053) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1867142..1868326) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1868483..1869121 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263539.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1869118..1869306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1869278..1871113) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1871130..1873367) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene metE CDS complement(1874196..1876877) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910746.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1877398..1877796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1878561..1879847) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1880206..1880598) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764120.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1881288..1882580 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1883718..1884527 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene yidA CDS 1884527..1885741 product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1885738..1886973 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1887266..1887430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1887733..1888101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1888168..1888953 product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1889466..1890224) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene tpiA CDS complement(1890325..1891059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1891297..1892055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1892177..1893607) product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene gapN CDS complement(1893919..1895652) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene ptsP CDS complement(1895657..1895920) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1896412..1896636 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1896719..1898878 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene nrdE CDS 1899290..1900249 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene nrdF CDS 1900481..1900843 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1900847..1901542 product antiholin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262574.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene cidB CDS complement(1901777..1902907) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1902965..1903699) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene argB CDS complement(1903724..1904917) product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261877.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene argJ CDS complement(1905093..1906115) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261878.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene argC CDS complement(1906368..1906892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1907126..1908781) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene recN CDS complement(1908795..1909265) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1909252..1910079) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1910072..1910938) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1910931..1911155) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1911130..1912473) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene xseA CDS complement(1912742..1913569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1913934..1914146) product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897227.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1914298..1915587) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1915912..1916220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1917113..1918120 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040804636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1918304..1919188) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1919344..1920966 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1920987..1922258 product citrate:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1922517..1924082) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1924402..1929099) product cell surface antigen I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene spaP CDS 1929821..1930393 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene thiT CDS complement(1930672..1931247) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1931630..1932805) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1932817..1933599) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1933746..1934303) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1934711..1935070) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1935072..1935494) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1935704..1938325) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene alaS CDS complement(1938638..1939135) product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1939593..1940066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(1940301..1941374) product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene prsA CDS complement(1941452..1942084) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1942291..1942488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1942754..1942882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1942982..1943698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1943695..1944354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1944366..1945220) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1945644..1948109) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1948259..1949041) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene trpA CDS complement(1949045..1950253) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene trpB CDS complement(1950250..1950831) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1950818..1951585) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene trpC CDS complement(1951582..1952586) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene trpD CDS complement(1952611..1953183) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1953183..1954547) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene trpE CDS complement(1954609..1954899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1956035..1957183) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1957382..1957876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 note possible pseudo, internal stop codon, frameshifted CDS complement(1957920..1958174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 note possible pseudo, frameshifted CDS complement(1958171..1958413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1958721..1959446) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1959461..1960015) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene scpB CDS complement(1960015..1960731) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1960721..1961482) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene xerD CDS complement(1961457..1961930) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1961927..1962424) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1962427..1963398) product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167813.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1963395..1964189) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene racE CDS complement(1964344..1964583) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1965238..1966482) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(1966601..1967797) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene tuf CDS complement(1968427..1969683) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1970469..1973273) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019267.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene ppc CDS complement(1973765..1974139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1974157..1974468) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1974592..1978131) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene smc CDS complement(1978139..1978825) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene rnc CDS complement(1979159..1979959) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene pflA CDS complement(1980237..1980878) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1981705..1983042) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1983669..1984454 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1984473..1984682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 note possible pseudo, internal stop codon, frameshifted CDS complement(1984998..1985591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 note possible pseudo, internal stop codon, frameshifted CDS complement(1985584..1985844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 note possible pseudo, internal stop codon, frameshifted CDS complement(1987051..1987323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 note possible pseudo, frameshifted CDS complement(1988028..1988282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1988380..1988574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1988701..1988865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1988858..1989529) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1989774..1992302) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1992303..1994132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1994447..1994995) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1994992..1995387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1995393..1996319) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1996519..1996794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1996782..1997336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1997712..1998353) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1998375..1998944) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185837.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 1999657..1999866 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 2000123..2000563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905673.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2000762..2001310) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019793.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(2001821..2003176) product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2003359..2004996) product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(2004983..2005342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(2005683..2005979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2006049..2010497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(2010510..2010716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2010745..2012694) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069653754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2012695..2013216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(2013271..2014116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(2014116..2014385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(2014411..2015076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2015095..2017782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(2017894..2020275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2020256..2020597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2020578..2021000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2021065..2021286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2021276..2021530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2021572..2022321) product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922462.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2022367..2022948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(2023043..2023267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(2023401..2024534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(2024555..2024866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(2025175..2025759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2025762..2025902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(2025916..2026539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2026545..2027399) product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105158881.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(2027402..2027569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(2027582..2027707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(2027714..2027875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 2028267..2029616 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262566.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene trkA CDS 2029627..2031066 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2031140..2031892) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263787.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2031972..2032361 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2032480..2033289) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(2033282..2034643) product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene vicK CDS complement(2034636..2035343) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene yycF CDS 2035564..2036328 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2036321..2037163 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2037179..2037886 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2037901..2038551 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(2038769..2039056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2039163..2040212) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2040412..2040651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2040648..2040935 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(2041035..2042132) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2042283..2042633) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(2042614..2042910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(2043025..2045676) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(2045669..2046730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2046797..2047363) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2047666..2048427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(2048851..2049420) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899842.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2049776..2050114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(2050317..2050571) product DUF1912 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(2050612..2051556) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(2051553..2052317) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 tRNA complement(2052391..2052461) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(2052563..2052952) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262062.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2053028..2053993) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2053986..2054210) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2054443..2054967) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene dpr CDS 2055233..2055889 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2056166..2056489) product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2056513..2056800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2056935..2057777) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2057774..2058631) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2058917..2059063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027975737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(2059483..2061636) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene feoB CDS complement(2061638..2062114) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2062404..2063138) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2063135..2063827) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2064115..2064702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2064765..2064995) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2065224..2066198) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene argF CDS 2066409..2068706 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882549.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2068920..2069372 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 2069437..2069739 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2070069..2072819) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene ileS CDS complement(2073345..2074208) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2074355..2074543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2074555..2075340) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074526.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2075594..2076205) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2076215..2076892) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2076892..2078190) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene ftsZ CDS complement(2078210..2079592) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene ftsA CDS complement(2079829..2080518) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2080751..2081044) product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263612.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene macP CDS complement(2081058..2081609) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2081635..2083014) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073746.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene glmU CDS complement(2083048..2083224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2083311..2084045 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2084038..2084718 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2084772..2085737) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2085748..2086383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2086551..2087732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 note possible pseudo, internal stop codon CDS 2087733..2088077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 note possible pseudo, internal stop codon CDS complement(2088158..2088571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2089490..2091499) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene metG CDS 2091857..2093146 product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2093607..2094770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 2095080..2095208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2095214..2096119 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2096116..2096928 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2097360..2099045) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene ftsY CDS complement(2099173..2099991) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2099992..2100789) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2101099..2103381) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2103706..2104530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2104511..2104744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2104988..2105374) product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(2105355..2105867) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263318.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2106287..2106613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 note possible pseudo, internal stop codon CDS 2106683..2107144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 note possible pseudo, internal stop codon CDS 2107557..2108426 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2108580..2109695) product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129660.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2110302..2112002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2112422..2113273 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2113564..2114037 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2114040..2114408 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263324.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 2114430..2115062 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2115297..2116049) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2116206..2116619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2116616..2117029) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(2117162..2119117) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene thrS CDS 2119298..2119468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2119928..2121262) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(2121264..2122262) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908752.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(2122840..2123313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(2123490..2124953) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(2125638..2126639) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene ccpA CDS complement(2126856..2128505) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2128743..2129828 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2129955..2131496) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2132020..2132919) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2133384..2133710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 note possible pseudo, internal stop codon CDS 2133777..2134061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 note possible pseudo, internal stop codon CDS 2134100..2134489 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262786.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2134632..2135069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2135145..2136197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2136261..2136743) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene smpB CDS complement(2136812..2139214) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rnr CDS complement(2139696..2139932) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene secG CDS complement(2140123..2141295) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2141768..2142367) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene coaE CDS complement(2142364..2143185) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene mutM CDS complement(2143265..2143672) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(2143705..2144328) product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2145145..2145552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2145542..2146060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 note possible pseudo, frameshifted CDS complement(2146074..2147222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 note possible pseudo, internal stop codon CDS complement(2147610..2147981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2148370..2149155) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2149266..2150231) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene era CDS complement(2150268..2150672) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene dagK CDS complement(2150653..2151150) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935749.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene ybeY CDS 2151310..2152083 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836917.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(2152604..2153560) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2153688..2153903) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2153903..2154409) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438899.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene msrA CDS complement(2154730..2155098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2155359..2155667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2156202..2156942) product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2156951..2157640) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2157784..2158515) product tyrosine-protein phosphatase CpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(2158518..2159885) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2160874..2161350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2161753..2162463) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2162463..2163227) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185996.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2163227..2164180) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2164184..2165065) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2165112..2166299) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2166749..2167018) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262674.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2167067..2167516) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2167694..2168377) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2168361..2168546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 note possible pseudo, frameshifted CDS complement(2168700..2169080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2169126..2170136) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131244.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene gap CDS complement(2170203..2170634) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2170646..2171557) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2171682..2172155 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239964.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2172773..2173363) product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene clpP CDS complement(2173537..2174166) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene upp CDS complement(2174279..2175433) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521356.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(2176093..2177187) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262596.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2177426..2179054) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 2179389..2180840 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2181109..2181894 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018231.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2181918..2182847 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2182849..2183883 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2183880..2184884 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2184999..2185235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 note possible pseudo, frameshifted CDS complement(2185277..2185927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 note possible pseudo, frameshifted CDS complement(2185936..2186352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 note possible pseudo, internal stop codon CDS complement(2186425..2186634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 note possible pseudo, internal stop codon CDS complement(2186646..2187503) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004218965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2187861..2189456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2189428..2190228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2190230..2191291) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071540979.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2191305..2191580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2191827..2192474 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2192622..2193281) product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2193320..2193817) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2193868..2194203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2194210..2194791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(2194794..2195504) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(2195910..2196605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2196745..2197719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2198282..2199217) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027585.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2199300..2199941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2200106..2201221 product ISAs1-like element IS1548 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(2201383..2203545) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2203722..2204300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2204897..2206249) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene rlmD CDS 2206385..2207161 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770524.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene recX CDS 2207556..2208089 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 tRNA complement(2208196..2208268) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(2208282..2208365) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(2208370..2208442) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(2208454..2208526) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(2208549..2208623) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 rRNA complement(2208729..2208836) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA complement(2208999..2211894) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA complement(2212161..2212235) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 rRNA complement(2212440..2213993) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 tRNA complement(2214134..2214207) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA complement(2214212..2214285) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(2214296..2214383) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(2214392..2214463) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(2214467..2214539) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(2214553..2214636) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(2214641..2214713) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(2214725..2214797) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(2214820..2214894) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 rRNA complement(2215000..2215107) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA complement(2215270..2218164) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 tRNA complement(2218431..2218503) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 sequence3 source 1..6700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2145..2573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 note possible pseudo, frameshifted CDS complement(2781..3056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 3410..3652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 4544..6469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 note possible pseudo, internal stop codon, frameshifted