>Feature sequence1 1 324 gene locus_tag LOCUS_00010 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1456 1707 gene locus_tag LOCUS_00020 1456 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1803 2090 gene locus_tag LOCUS_00030 1803 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00030 2097 2726 gene locus_tag LOCUS_00040 2097 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00040 2766 2849 gene locus_tag LOCUS_t00010 2766 2849 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2853 2927 gene locus_tag LOCUS_t00020 2853 2927 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3868 4002 gene locus_tag LOCUS_00050 3868 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00050 4045 4278 gene locus_tag LOCUS_00060 4045 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00060 4279 4437 gene locus_tag LOCUS_00070 4279 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00070 4678 4914 gene locus_tag LOCUS_00080 4678 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 5071 5226 gene locus_tag LOCUS_00090 5071 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5534 5779 gene locus_tag LOCUS_00100 5534 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6249 5866 gene locus_tag LOCUS_00110 6249 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00110 6876 6364 gene locus_tag LOCUS_00120 6876 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00120 7206 6991 gene locus_tag LOCUS_00130 gene rpmE 7206 6991 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 protein_id gnl|my_center|LOCUS_00130 7752 7270 gene locus_tag LOCUS_00140 7752 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00140 7920 7792 gene locus_tag LOCUS_00150 7920 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00150 8274 8116 gene locus_tag LOCUS_00160 8274 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00160 8354 8701 gene locus_tag LOCUS_00170 8354 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 9393 9076 gene locus_tag LOCUS_00180 9393 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00180 9930 9721 gene locus_tag LOCUS_00190 9930 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 10100 10360 gene locus_tag LOCUS_00200 10100 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 10552 10857 gene locus_tag LOCUS_00210 gene rpsJ 10552 10857 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918607.1 protein_id gnl|my_center|LOCUS_00210 10896 11363 gene locus_tag LOCUS_00220 10896 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00220 11370 11723 gene locus_tag LOCUS_00230 11370 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00230 11723 12028 gene locus_tag LOCUS_00240 11723 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00240 12065 12457 gene locus_tag LOCUS_00250 12065 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00250 12457 13071 gene locus_tag LOCUS_00260 12457 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 13124 13882 gene locus_tag LOCUS_00270 gene rplB 13124 13882 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183023.1 protein_id gnl|my_center|LOCUS_00270 14249 14926 gene locus_tag LOCUS_00280 14249 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 15421 15540 gene locus_tag LOCUS_00290 15421 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00290 16077 16562 gene locus_tag LOCUS_00300 16077 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 16562 17014 gene locus_tag LOCUS_00310 16562 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 17007 17375 gene locus_tag LOCUS_00320 gene rplN 17007 17375 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701315.1 protein_id gnl|my_center|LOCUS_00320 17375 17650 gene locus_tag LOCUS_00330 gene rplX 17375 17650 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_00330 17725 17970 gene locus_tag LOCUS_00340 17725 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00340 18290 18472 gene locus_tag LOCUS_00350 gene rpsN 18290 18472 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_00350 18478 18891 gene locus_tag LOCUS_00360 gene rpsH 18478 18891 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183034.1 protein_id gnl|my_center|LOCUS_00360 18904 19443 gene locus_tag LOCUS_00370 gene rplF 18904 19443 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166898.1 protein_id gnl|my_center|LOCUS_00370 19462 19809 gene locus_tag LOCUS_00380 gene rplR 19462 19809 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166897.1 protein_id gnl|my_center|LOCUS_00380 19809 20522 gene locus_tag LOCUS_00390 19809 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 20542 20976 gene locus_tag LOCUS_00400 gene rplO 20542 20976 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638079.1 protein_id gnl|my_center|LOCUS_00400 20976 21197 gene locus_tag LOCUS_00410 20976 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 21384 22115 gene locus_tag LOCUS_00420 21384 22115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00420 22194 22559 gene locus_tag LOCUS_00430 22194 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00430 22556 23251 gene locus_tag LOCUS_00440 22556 23251 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_00440 23238 23534 gene locus_tag LOCUS_00450 23238 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00450 23991 24206 gene locus_tag LOCUS_00460 gene infA 23991 24206 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567521.1 protein_id gnl|my_center|LOCUS_00460 24333 24707 gene locus_tag LOCUS_00470 gene rpsM 24333 24707 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 protein_id gnl|my_center|LOCUS_00470 25115 26083 gene locus_tag LOCUS_00480 25115 26083 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_00480 26299 26520 gene locus_tag LOCUS_00490 26299 26520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 26575 26772 gene locus_tag LOCUS_00500 gene rpmF 26575 26772 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_00500 27027 27221 gene locus_tag LOCUS_00510 27027 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 27526 27747 gene locus_tag LOCUS_00520 27526 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 28450 28590 gene locus_tag LOCUS_00530 28450 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 28759 29013 gene locus_tag LOCUS_00540 28759 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 29365 29523 gene locus_tag LOCUS_00550 29365 29523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 29761 30063 gene locus_tag LOCUS_00560 29761 30063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 30352 31131 gene locus_tag LOCUS_00570 30352 31131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 31195 31647 gene locus_tag LOCUS_00580 31195 31647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 31640 32188 gene locus_tag LOCUS_00590 31640 32188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 32195 32344 gene locus_tag LOCUS_00600 32195 32344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 32628 32404 gene locus_tag LOCUS_00610 32628 32404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 32618 32875 gene locus_tag LOCUS_00620 32618 32875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 32998 33135 gene locus_tag LOCUS_00630 32998 33135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 33274 33411 gene locus_tag LOCUS_00640 33274 33411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 33574 33924 gene locus_tag LOCUS_00650 33574 33924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00650 33928 34113 gene locus_tag LOCUS_00660 33928 34113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00660 34196 34606 gene locus_tag LOCUS_00670 34196 34606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 34811 35728 gene locus_tag LOCUS_00680 34811 35728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 36089 36586 gene locus_tag LOCUS_00690 36089 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 36966 36601 gene locus_tag LOCUS_00700 36966 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 36971 37270 gene locus_tag LOCUS_00710 36971 37270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 37286 38014 gene locus_tag LOCUS_00720 gene tpiA 37286 38014 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_00720 38274 38011 gene locus_tag LOCUS_00730 38274 38011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 38505 38305 gene locus_tag LOCUS_00740 38505 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 38736 38518 gene locus_tag LOCUS_00750 38736 38518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 39317 38736 gene locus_tag LOCUS_00760 39317 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 39482 39324 gene locus_tag LOCUS_00770 39482 39324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 39695 39525 gene locus_tag LOCUS_00780 39695 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 40391 39987 gene locus_tag LOCUS_00790 40391 39987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00790 41110 40472 gene locus_tag LOCUS_00800 gene deoC 41110 40472 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458726.1 protein_id gnl|my_center|LOCUS_00800 41445 41158 gene locus_tag LOCUS_00810 41445 41158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00810 42129 41518 gene locus_tag LOCUS_00820 42129 41518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00820 42011 42286 gene locus_tag LOCUS_00830 42011 42286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 42453 42241 gene locus_tag LOCUS_00840 42453 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00840 43171 42455 gene locus_tag LOCUS_00850 gene deoD 43171 42455 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_00850 43531 43232 gene locus_tag LOCUS_00860 43531 43232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 43885 43643 gene locus_tag LOCUS_00870 43885 43643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 44451 45254 gene locus_tag LOCUS_00880 44451 45254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 45239 46045 gene locus_tag LOCUS_00890 45239 46045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00890 46263 46099 gene locus_tag LOCUS_00900 46263 46099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 46282 46503 gene locus_tag LOCUS_00910 46282 46503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 46531 46659 gene locus_tag LOCUS_00920 46531 46659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 46705 47118 gene locus_tag LOCUS_00930 46705 47118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00930 47338 48930 gene locus_tag LOCUS_00940 gene ligA 47338 48930 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166932.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00940 49677 49811 gene locus_tag LOCUS_00950 49677 49811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 51030 50590 gene locus_tag LOCUS_00960 51030 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 51767 51108 gene locus_tag LOCUS_00970 51767 51108 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398802.1 protein_id gnl|my_center|LOCUS_00970 51937 52335 gene locus_tag LOCUS_00980 gene cdd 51937 52335 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830967.1 protein_id gnl|my_center|LOCUS_00980 52880 52638 gene locus_tag LOCUS_00990 52880 52638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 53522 53121 gene locus_tag LOCUS_01000 53522 53121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 53619 53497 gene locus_tag LOCUS_01010 53619 53497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 54088 53750 gene locus_tag LOCUS_01020 54088 53750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 54596 54450 gene locus_tag LOCUS_01030 54596 54450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01030 54797 54642 gene locus_tag LOCUS_01040 54797 54642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01040 54946 55218 gene locus_tag LOCUS_01050 54946 55218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01050 55234 55551 gene locus_tag LOCUS_01060 55234 55551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 55535 56506 gene locus_tag LOCUS_01070 gene ruvB 55535 56506 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583960.1 protein_id gnl|my_center|LOCUS_01070 56623 57147 gene locus_tag LOCUS_01080 56623 57147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 57316 58320 gene locus_tag LOCUS_01090 57316 58320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 58366 58527 gene locus_tag LOCUS_01100 58366 58527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 58666 59127 gene locus_tag LOCUS_01110 58666 59127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 59210 59881 gene locus_tag LOCUS_01120 59210 59881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01120 59924 60484 gene locus_tag LOCUS_01130 59924 60484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01130 60688 61218 gene locus_tag LOCUS_01140 60688 61218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01140 61270 61659 gene locus_tag LOCUS_01150 61270 61659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01150 61693 62136 gene locus_tag LOCUS_01160 61693 62136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01160 62184 62363 gene locus_tag LOCUS_01170 62184 62363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 62440 64314 gene locus_tag LOCUS_01180 62440 64314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01180 64423 64584 gene locus_tag LOCUS_01190 64423 64584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 65043 65426 gene locus_tag LOCUS_tm00010 65043 65426 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 65482 66366 gene locus_tag LOCUS_01200 65482 66366 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183064.1 protein_id gnl|my_center|LOCUS_01200 66904 66383 gene locus_tag LOCUS_01210 66904 66383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01210 67192 66971 gene locus_tag LOCUS_01220 67192 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01220 67993 67262 gene locus_tag LOCUS_01230 67993 67262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 68316 67993 gene locus_tag LOCUS_01240 68316 67993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 69738 68332 gene locus_tag LOCUS_01250 69738 68332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 70530 69898 gene locus_tag LOCUS_01260 70530 69898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01260 70809 70558 gene locus_tag LOCUS_01270 70809 70558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01270 71353 72678 gene locus_tag LOCUS_01280 gene ffh 71353 72678 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166607.1 protein_id gnl|my_center|LOCUS_01280 73122 72814 gene locus_tag LOCUS_01290 73122 72814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01290 73623 73922 gene locus_tag LOCUS_01300 73623 73922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01300 74183 74395 gene locus_tag LOCUS_01310 74183 74395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 74502 74678 gene locus_tag LOCUS_01320 74502 74678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 74745 76217 gene locus_tag LOCUS_01330 gene tkt 74745 76217 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862658.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01330 76651 76397 gene locus_tag LOCUS_01340 76651 76397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01340 77461 76940 gene locus_tag LOCUS_01350 77461 76940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01350 78178 77465 gene locus_tag LOCUS_01360 78178 77465 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556731.1 protein_id gnl|my_center|LOCUS_01360 78304 78534 gene locus_tag LOCUS_01370 78304 78534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 78611 78820 gene locus_tag LOCUS_01380 78611 78820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 79367 79672 gene locus_tag LOCUS_01390 79367 79672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 80083 80253 gene locus_tag LOCUS_01400 80083 80253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 80262 80483 gene locus_tag LOCUS_01410 80262 80483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 80518 80592 gene locus_tag LOCUS_t00030 80518 80592 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 81101 80793 gene locus_tag LOCUS_01420 81101 80793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 81980 81132 gene locus_tag LOCUS_01430 81980 81132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 83066 82125 gene locus_tag LOCUS_01440 83066 82125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 83320 83565 gene locus_tag LOCUS_01450 83320 83565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 84380 83703 gene locus_tag LOCUS_01460 84380 83703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 85226 84504 gene locus_tag LOCUS_01470 85226 84504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 85261 85464 gene locus_tag LOCUS_01480 85261 85464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 87080 85860 gene locus_tag LOCUS_01490 87080 85860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 87599 87081 gene locus_tag LOCUS_01500 87599 87081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 88766 88539 gene locus_tag LOCUS_01510 88766 88539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 89328 88780 gene locus_tag LOCUS_01520 89328 88780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01520 90084 89386 gene locus_tag LOCUS_01530 90084 89386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 90539 91234 gene locus_tag LOCUS_01540 90539 91234 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 protein_id gnl|my_center|LOCUS_01540 91422 91916 gene locus_tag LOCUS_01550 gene rpsD 91422 91916 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166475.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 92105 92572 gene locus_tag LOCUS_01560 92105 92572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 92849 93049 gene locus_tag LOCUS_01570 92849 93049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 93104 93238 gene locus_tag LOCUS_01580 93104 93238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 93290 93418 gene locus_tag LOCUS_01590 93290 93418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 93933 93697 gene locus_tag LOCUS_01600 93933 93697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 94242 93997 gene locus_tag LOCUS_01610 94242 93997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 94683 94264 gene locus_tag LOCUS_01620 94683 94264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 95445 95140 gene locus_tag LOCUS_01630 95445 95140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 95562 96218 gene locus_tag LOCUS_01640 95562 96218 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294164.1 protein_id gnl|my_center|LOCUS_01640 96416 96769 gene locus_tag LOCUS_01650 96416 96769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01650 98955 97165 gene locus_tag LOCUS_01660 98955 97165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 99330 99109 gene locus_tag LOCUS_01670 99330 99109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 99657 99406 gene locus_tag LOCUS_01680 99657 99406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 100222 99926 gene locus_tag LOCUS_01690 100222 99926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 100579 100241 gene locus_tag LOCUS_01700 100579 100241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01700 101029 100724 gene locus_tag LOCUS_01710 101029 100724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 101521 101258 gene locus_tag LOCUS_01720 101521 101258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 102163 101642 gene locus_tag LOCUS_01730 102163 101642 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_01730 102484 102239 gene locus_tag LOCUS_01740 102484 102239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 102607 102485 gene locus_tag LOCUS_01750 102607 102485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 102895 102704 gene locus_tag LOCUS_01760 102895 102704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 103023 102901 gene locus_tag LOCUS_01770 103023 102901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 103407 103332 gene locus_tag LOCUS_t00040 103407 103332 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 103999 104553 gene locus_tag LOCUS_01780 103999 104553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 104715 105155 gene locus_tag LOCUS_01790 gene mraZ 104715 105155 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_01790 105275 105961 gene locus_tag LOCUS_01800 105275 105961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01800 106055 106756 gene locus_tag LOCUS_01810 106055 106756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 106778 107149 gene locus_tag LOCUS_01820 106778 107149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 107172 108332 gene locus_tag LOCUS_01830 gene ftsZ 107172 108332 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166766.1 protein_id gnl|my_center|LOCUS_01830 108423 109094 gene locus_tag LOCUS_01840 108423 109094 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_01840 109427 109236 gene locus_tag LOCUS_01850 109427 109236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 109360 109644 gene locus_tag LOCUS_01860 109360 109644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01860 109644 110060 gene locus_tag LOCUS_01870 gene rpsI 109644 110060 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_01870 110100 110176 gene locus_tag LOCUS_t00050 110100 110176 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 110365 110529 gene locus_tag LOCUS_01880 110365 110529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 110737 112923 gene locus_tag LOCUS_01890 110737 112923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 113170 113328 gene locus_tag LOCUS_01900 113170 113328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 113359 113898 gene locus_tag LOCUS_01910 113359 113898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 113978 114298 gene locus_tag LOCUS_01920 113978 114298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 114410 114613 gene locus_tag LOCUS_01930 114410 114613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 115589 116323 gene locus_tag LOCUS_01940 115589 116323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 116425 116736 gene locus_tag LOCUS_01950 116425 116736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 116932 117102 gene locus_tag LOCUS_01960 116932 117102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 117127 117267 gene locus_tag LOCUS_01970 117127 117267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 117340 117495 gene locus_tag LOCUS_01980 117340 117495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 117519 117827 gene locus_tag LOCUS_01990 117519 117827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 118023 118196 gene locus_tag LOCUS_02000 118023 118196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 118221 118361 gene locus_tag LOCUS_02010 118221 118361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 118449 118589 gene locus_tag LOCUS_02020 118449 118589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 118613 118927 gene locus_tag LOCUS_02030 118613 118927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 119117 119305 gene locus_tag LOCUS_02040 119117 119305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 119743 120051 gene locus_tag LOCUS_02050 119743 120051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 120256 120414 gene locus_tag LOCUS_02060 120256 120414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 120853 121497 gene locus_tag LOCUS_02070 120853 121497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166519.1 protein_id gnl|my_center|LOCUS_02070 121761 122156 gene locus_tag LOCUS_02080 121761 122156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 122622 123020 gene locus_tag LOCUS_02090 122622 123020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 123930 123511 gene locus_tag LOCUS_02100 123930 123511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02100 124758 124390 gene locus_tag LOCUS_02110 124758 124390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02110 125072 125737 gene locus_tag LOCUS_02120 125072 125737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02120 125898 126155 gene locus_tag LOCUS_02130 125898 126155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 126384 127547 gene locus_tag LOCUS_02140 126384 127547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 127620 128153 gene locus_tag LOCUS_02150 127620 128153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02150 128361 128732 gene locus_tag LOCUS_02160 128361 128732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02160 129426 129692 gene locus_tag LOCUS_02170 129426 129692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 129779 129970 gene locus_tag LOCUS_02180 129779 129970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 130214 130753 gene locus_tag LOCUS_02190 130214 130753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 131219 131398 gene locus_tag LOCUS_02200 131219 131398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 131666 132025 gene locus_tag LOCUS_02210 131666 132025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 132438 132983 gene locus_tag LOCUS_02220 132438 132983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 133368 133751 gene locus_tag LOCUS_02230 133368 133751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 134664 135023 gene locus_tag LOCUS_02240 134664 135023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 135400 135684 gene locus_tag LOCUS_02250 135400 135684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 135931 136503 gene locus_tag LOCUS_02260 135931 136503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 136702 137007 gene locus_tag LOCUS_02270 136702 137007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 137416 137847 gene locus_tag LOCUS_02280 137416 137847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 137985 138368 gene locus_tag LOCUS_02290 137985 138368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 138718 139053 gene locus_tag LOCUS_02300 138718 139053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 139120 139473 gene locus_tag LOCUS_02310 139120 139473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 139697 140731 gene locus_tag LOCUS_02320 139697 140731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 140735 140950 gene locus_tag LOCUS_02330 140735 140950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 140937 142058 gene locus_tag LOCUS_02340 140937 142058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 142077 142253 gene locus_tag LOCUS_02350 142077 142253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 142266 142634 gene locus_tag LOCUS_02360 142266 142634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 142845 143045 gene locus_tag LOCUS_02370 142845 143045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 143582 144568 gene locus_tag LOCUS_02380 143582 144568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 144743 145180 gene locus_tag LOCUS_02390 144743 145180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02390 145352 145480 gene locus_tag LOCUS_02400 145352 145480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02400 145511 145687 gene locus_tag LOCUS_02410 145511 145687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 146120 146389 gene locus_tag LOCUS_02420 146120 146389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02420 147087 146638 gene locus_tag LOCUS_02430 147087 146638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 147137 147553 gene locus_tag LOCUS_02440 147137 147553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02440 149000 148578 gene locus_tag LOCUS_02450 149000 148578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 149305 149000 gene locus_tag LOCUS_02460 gene rplU 149305 149000 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166743.1 protein_id gnl|my_center|LOCUS_02460 149522 149788 gene locus_tag LOCUS_02470 gene rpsO 149522 149788 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_02470 149900 150211 gene locus_tag LOCUS_02480 149900 150211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 150373 151275 gene locus_tag LOCUS_02490 150373 151275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 151452 151595 gene locus_tag LOCUS_02500 151452 151595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 151638 151928 gene locus_tag LOCUS_02510 151638 151928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 151929 152144 gene locus_tag LOCUS_02520 151929 152144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 152293 152880 gene locus_tag LOCUS_02530 152293 152880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 153484 153669 gene locus_tag LOCUS_02540 153484 153669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 154090 154281 gene locus_tag LOCUS_02550 154090 154281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 154499 154708 gene locus_tag LOCUS_02560 154499 154708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 155211 155014 gene locus_tag LOCUS_02570 155211 155014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 156343 155363 gene locus_tag LOCUS_02580 156343 155363 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831154.1 protein_id gnl|my_center|LOCUS_02580 156581 156345 gene locus_tag LOCUS_02590 156581 156345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02590 156619 156822 gene locus_tag LOCUS_02600 156619 156822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 157499 156780 gene locus_tag LOCUS_02610 157499 156780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02610 157658 157518 gene locus_tag LOCUS_02620 157658 157518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02620 157879 157658 gene locus_tag LOCUS_02630 157879 157658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 158347 157901 gene locus_tag LOCUS_02640 158347 157901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02640 158768 158319 gene locus_tag LOCUS_02650 158768 158319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 159466 159065 gene locus_tag LOCUS_02660 159466 159065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 161260 160220 gene locus_tag LOCUS_02670 161260 160220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 161548 161390 gene locus_tag LOCUS_02680 161548 161390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 161783 161708 gene locus_tag LOCUS_t00060 161783 161708 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 161863 161787 gene locus_tag LOCUS_t00070 161863 161787 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 161940 161865 gene locus_tag LOCUS_t00080 161940 161865 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 162037 161947 gene locus_tag LOCUS_t00090 162037 161947 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 162115 162039 gene locus_tag LOCUS_t00100 162115 162039 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 162220 162144 gene locus_tag LOCUS_t00110 162220 162144 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 162300 162228 gene locus_tag LOCUS_t00120 162300 162228 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 162383 162307 gene locus_tag LOCUS_t00130 162383 162307 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 163720 162569 gene locus_tag LOCUS_02690 gene obgE 163720 162569 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166623.1 protein_id gnl|my_center|LOCUS_02690 164335 164162 gene locus_tag LOCUS_02700 164335 164162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 164629 164450 gene locus_tag LOCUS_02710 164629 164450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 164757 164951 gene locus_tag LOCUS_02720 164757 164951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 165112 164963 gene locus_tag LOCUS_02730 165112 164963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 165209 165598 gene locus_tag LOCUS_02740 165209 165598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02740 165662 165805 gene locus_tag LOCUS_02750 165662 165805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02750 166221 166433 gene locus_tag LOCUS_02760 166221 166433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02760 166647 166940 gene locus_tag LOCUS_02770 166647 166940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 166895 167311 gene locus_tag LOCUS_02780 166895 167311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 167462 168022 gene locus_tag LOCUS_02790 167462 168022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 168200 168370 gene locus_tag LOCUS_02800 168200 168370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 168419 169480 gene locus_tag LOCUS_02810 168419 169480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 169565 169765 gene locus_tag LOCUS_02820 169565 169765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 169913 170593 gene locus_tag LOCUS_02830 169913 170593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 170702 171754 gene locus_tag LOCUS_02840 170702 171754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 172068 171868 gene locus_tag LOCUS_02850 172068 171868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 171983 172360 gene locus_tag LOCUS_02860 171983 172360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 172361 172645 gene locus_tag LOCUS_02870 172361 172645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 172778 173836 gene locus_tag LOCUS_02880 172778 173836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 174089 174631 gene locus_tag LOCUS_02890 174089 174631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02890 175287 174994 gene locus_tag LOCUS_02900 175287 174994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02900 175539 175390 gene locus_tag LOCUS_02910 175539 175390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02910 176243 176091 gene locus_tag LOCUS_02920 gene rpmG 176243 176091 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_02920 176555 176298 gene locus_tag LOCUS_02930 176555 176298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 176969 176730 gene locus_tag LOCUS_02940 176969 176730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02940 177645 177337 gene locus_tag LOCUS_02950 177645 177337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 178970 178365 gene locus_tag LOCUS_02960 178970 178365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 179345 179034 gene locus_tag LOCUS_02970 179345 179034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 179850 179359 gene locus_tag LOCUS_02980 179850 179359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 180321 179863 gene locus_tag LOCUS_02990 180321 179863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 180409 180858 gene locus_tag LOCUS_03000 180409 180858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03000 180904 181209 gene locus_tag LOCUS_03010 180904 181209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 181232 181504 gene locus_tag LOCUS_03020 181232 181504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 181697 182212 gene locus_tag LOCUS_03030 181697 182212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 182381 183013 gene locus_tag LOCUS_03040 182381 183013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 183597 183421 gene locus_tag LOCUS_03050 183597 183421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 184504 184307 gene locus_tag LOCUS_03060 184504 184307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 185110 184775 gene locus_tag LOCUS_03070 185110 184775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 185975 185097 gene locus_tag LOCUS_03080 gene truB 185975 185097 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183179.1 protein_id gnl|my_center|LOCUS_03080 186168 186084 gene locus_tag LOCUS_t00140 186168 186084 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 186247 186172 gene locus_tag LOCUS_t00150 186247 186172 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 186357 186749 gene locus_tag LOCUS_03090 186357 186749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03090 187081 187560 gene locus_tag LOCUS_03100 187081 187560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 187551 187694 gene locus_tag LOCUS_03110 187551 187694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 188145 188783 gene locus_tag LOCUS_03120 188145 188783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 188916 188841 gene locus_tag LOCUS_t00160 188916 188841 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 188994 188919 gene locus_tag LOCUS_t00170 188994 188919 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 189072 188998 gene locus_tag LOCUS_t00180 189072 188998 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 189326 189589 gene locus_tag LOCUS_03130 gene rpsP 189326 189589 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439483.1 protein_id gnl|my_center|LOCUS_03130 189592 190194 gene locus_tag LOCUS_03140 gene trmD 189592 190194 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03140 190268 190648 gene locus_tag LOCUS_03150 gene rplS 190268 190648 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_03150 190743 192272 gene locus_tag LOCUS_03160 190743 192272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 192390 192695 gene locus_tag LOCUS_03170 192390 192695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 193268 192897 gene locus_tag LOCUS_03180 193268 192897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03180 194228 193590 gene locus_tag LOCUS_03190 194228 193590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03190 194495 194274 gene locus_tag LOCUS_03200 194495 194274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03200 194903 194748 gene locus_tag LOCUS_03210 194903 194748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03210 195046 194924 gene locus_tag LOCUS_03220 195046 194924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03220 195391 195083 gene locus_tag LOCUS_03230 195391 195083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03230 195835 195419 gene locus_tag LOCUS_03240 gene rpsL 195835 195419 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008362393.1 protein_id gnl|my_center|LOCUS_03240 196329 196174 gene locus_tag LOCUS_03250 196329 196174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 196803 196330 gene locus_tag LOCUS_03260 196803 196330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 197091 196819 gene locus_tag LOCUS_03270 197091 196819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 197597 197109 gene locus_tag LOCUS_03280 197597 197109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 197969 197811 gene locus_tag LOCUS_03290 197969 197811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 199033 198137 gene locus_tag LOCUS_03300 199033 198137 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_03300 199069 199416 gene locus_tag LOCUS_03310 199069 199416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 199973 199680 gene locus_tag LOCUS_03320 199973 199680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 200213 200085 gene locus_tag LOCUS_03330 200213 200085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 201463 200537 gene locus_tag LOCUS_03340 201463 200537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03340 201991 201488 gene locus_tag LOCUS_03350 201991 201488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03350 202159 202001 gene locus_tag LOCUS_03360 202159 202001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03360 203380 202262 gene locus_tag LOCUS_03370 gene dnaJ 203380 202262 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_03370 203653 203928 gene locus_tag LOCUS_03380 203653 203928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 204309 204163 gene locus_tag LOCUS_03390 204309 204163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 204867 204472 gene locus_tag LOCUS_03400 204867 204472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 205951 204869 gene locus_tag LOCUS_03410 gene prfA 205951 204869 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166352.1 protein_id gnl|my_center|LOCUS_03410 206005 206079 gene locus_tag LOCUS_t00190 206005 206079 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 206351 206157 gene locus_tag LOCUS_03420 206351 206157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 206774 206376 gene locus_tag LOCUS_03430 206774 206376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03430 207452 207180 gene locus_tag LOCUS_03440 207452 207180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03440 207590 207456 gene locus_tag LOCUS_03450 207590 207456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03450 208489 207824 gene locus_tag LOCUS_03460 208489 207824 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989364.1 protein_id gnl|my_center|LOCUS_03460 208997 208788 gene locus_tag LOCUS_03470 208997 208788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 209335 209036 gene locus_tag LOCUS_03480 209335 209036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 210402 209656 gene locus_tag LOCUS_03490 210402 209656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03490 211320 210556 gene locus_tag LOCUS_03500 211320 210556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03500 211593 211396 gene locus_tag LOCUS_03510 211593 211396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03510 212433 211624 gene locus_tag LOCUS_03520 212433 211624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03520 212940 212689 gene locus_tag LOCUS_03530 212940 212689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03530 213285 212986 gene locus_tag LOCUS_03540 213285 212986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 213873 213700 gene locus_tag LOCUS_03550 213873 213700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 214211 214059 gene locus_tag LOCUS_03560 214211 214059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 215000 214338 gene locus_tag LOCUS_03570 215000 214338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03570 216488 215283 gene locus_tag LOCUS_03580 216488 215283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03580 216989 216606 gene locus_tag LOCUS_03590 216989 216606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 217658 217119 gene locus_tag LOCUS_03600 217658 217119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03600 218172 217801 gene locus_tag LOCUS_03610 gene rplL 218172 217801 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_03610 218693 218193 gene locus_tag LOCUS_03620 gene rplJ 218693 218193 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597181.1 protein_id gnl|my_center|LOCUS_03620 219942 219052 gene locus_tag LOCUS_03630 gene ychF 219942 219052 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03630 220749 220303 gene locus_tag LOCUS_03640 220749 220303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 221019 220789 gene locus_tag LOCUS_03650 221019 220789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 221012 221203 gene locus_tag LOCUS_03660 221012 221203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 221767 221627 gene locus_tag LOCUS_03670 221767 221627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 222181 221993 gene locus_tag LOCUS_03680 222181 221993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 222385 222203 gene locus_tag LOCUS_03690 222385 222203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 222924 222520 gene locus_tag LOCUS_03700 222924 222520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 223025 223210 gene locus_tag LOCUS_03710 223025 223210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 223401 223282 gene locus_tag LOCUS_03720 223401 223282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 223870 223412 gene locus_tag LOCUS_03730 223870 223412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03730 224389 224228 gene locus_tag LOCUS_03740 224389 224228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 224553 224768 gene locus_tag LOCUS_03750 224553 224768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 226076 224883 gene locus_tag LOCUS_03760 gene tuf 226076 224883 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040568.1 protein_id gnl|my_center|LOCUS_03760 226862 226260 gene locus_tag LOCUS_03770 226862 226260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 227248 227087 gene locus_tag LOCUS_03780 227248 227087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 227344 227760 gene locus_tag LOCUS_03790 227344 227760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03790 227936 227643 gene locus_tag LOCUS_03800 227936 227643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 227872 228300 gene locus_tag LOCUS_03810 227872 228300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03810 228660 229184 gene locus_tag LOCUS_03820 228660 229184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03820 229383 229745 gene locus_tag LOCUS_03830 229383 229745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03830 229806 230000 gene locus_tag LOCUS_03840 229806 230000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 230346 230098 gene locus_tag LOCUS_03850 230346 230098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 231009 230356 gene locus_tag LOCUS_03860 231009 230356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 232230 231103 gene locus_tag LOCUS_03870 232230 231103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 232395 233012 gene locus_tag LOCUS_03880 232395 233012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 233813 233562 gene locus_tag LOCUS_03890 233813 233562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 234203 233865 gene locus_tag LOCUS_03900 234203 233865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 234772 234605 gene locus_tag LOCUS_03910 234772 234605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 234982 234773 gene locus_tag LOCUS_03920 234982 234773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 235126 235386 gene locus_tag LOCUS_03930 gene rpsT 235126 235386 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_03930 235592 235467 gene locus_tag LOCUS_03940 235592 235467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 235994 235662 gene locus_tag LOCUS_03950 235994 235662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 236720 236547 gene locus_tag LOCUS_03960 236720 236547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 236859 237440 gene locus_tag LOCUS_03970 236859 237440 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405033.1 protein_id gnl|my_center|LOCUS_03970 237520 237445 gene locus_tag LOCUS_t00200 237520 237445 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 238276 237683 gene locus_tag LOCUS_03980 238276 237683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03980 239159 238269 gene locus_tag LOCUS_03990 239159 238269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 239359 239159 gene locus_tag LOCUS_04000 239359 239159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 239803 239537 gene locus_tag LOCUS_04010 239803 239537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04010 240404 239814 gene locus_tag LOCUS_04020 gene recR 240404 239814 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_04020 240700 240407 gene locus_tag LOCUS_04030 240700 240407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 241752 240841 gene locus_tag LOCUS_04040 241752 240841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 242658 241771 gene locus_tag LOCUS_04050 242658 241771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04050 242735 243010 gene locus_tag LOCUS_04060 242735 243010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 243038 243292 gene locus_tag LOCUS_04070 243038 243292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 243926 244063 gene locus_tag LOCUS_04080 243926 244063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 245602 244310 gene locus_tag LOCUS_04090 245602 244310 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166794.1 protein_id gnl|my_center|LOCUS_04090 245916 245767 gene locus_tag LOCUS_04100 245916 245767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04100 245885 246085 gene locus_tag LOCUS_04110 245885 246085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 247224 246139 gene locus_tag LOCUS_04120 247224 246139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 247396 247226 gene locus_tag LOCUS_04130 247396 247226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 247810 247598 gene locus_tag LOCUS_04140 247810 247598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 248470 248003 gene locus_tag LOCUS_04150 248470 248003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04150 248815 248636 gene locus_tag LOCUS_04160 248815 248636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 249241 248912 gene locus_tag LOCUS_04170 249241 248912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 249584 249312 gene locus_tag LOCUS_04180 249584 249312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 250368 249784 gene locus_tag LOCUS_04190 250368 249784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 250707 250432 gene locus_tag LOCUS_04200 250707 250432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 251235 250720 gene locus_tag LOCUS_04210 251235 250720 CDS product DUF2714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166799.1 protein_id gnl|my_center|LOCUS_04210 251605 251324 gene locus_tag LOCUS_04220 251605 251324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 251895 252131 gene locus_tag LOCUS_04230 251895 252131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 252706 252509 gene locus_tag LOCUS_04240 252706 252509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 252997 253497 gene locus_tag LOCUS_04250 252997 253497 CDS product DUF2714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166799.1 protein_id gnl|my_center|LOCUS_04250 254106 254486 gene locus_tag LOCUS_04260 254106 254486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04260 254675 254965 gene locus_tag LOCUS_04270 254675 254965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04270 255542 255393 gene locus_tag LOCUS_04280 255542 255393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 256196 255759 gene locus_tag LOCUS_04290 256196 255759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 256466 256290 gene locus_tag LOCUS_04300 256466 256290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 257432 256749 gene locus_tag LOCUS_04310 257432 256749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 257799 257443 gene locus_tag LOCUS_04320 257799 257443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 258808 258542 gene locus_tag LOCUS_04330 258808 258542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 259222 258833 gene locus_tag LOCUS_04340 259222 258833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 259840 259421 gene locus_tag LOCUS_04350 259840 259421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 259830 259961 gene locus_tag LOCUS_04360 259830 259961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 260368 260132 gene locus_tag LOCUS_04370 260368 260132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 260732 260382 gene locus_tag LOCUS_04380 260732 260382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04380 261722 260979 gene locus_tag LOCUS_04390 261722 260979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04390 262622 261789 gene locus_tag LOCUS_04400 262622 261789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04400 262875 262657 gene locus_tag LOCUS_04410 262875 262657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 263166 262885 gene locus_tag LOCUS_04420 263166 262885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04420 263607 263455 gene locus_tag LOCUS_04430 263607 263455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04430 263955 263761 gene locus_tag LOCUS_04440 263955 263761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04440 264663 264238 gene locus_tag LOCUS_04450 264663 264238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04450 264563 264913 gene locus_tag LOCUS_04460 264563 264913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 265173 265310 gene locus_tag LOCUS_04470 265173 265310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 265856 266278 gene locus_tag LOCUS_04480 gene rplK 265856 266278 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167140.1 protein_id gnl|my_center|LOCUS_04480 266299 266991 gene locus_tag LOCUS_04490 gene rplA 266299 266991 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167141.1 protein_id gnl|my_center|LOCUS_04490 267302 267613 gene locus_tag LOCUS_04500 267302 267613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 268351 269064 gene locus_tag LOCUS_04510 268351 269064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 269233 269364 gene locus_tag LOCUS_04520 269233 269364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 269398 270303 gene locus_tag LOCUS_04530 269398 270303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 270454 270621 gene locus_tag LOCUS_04540 270454 270621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 271013 271309 gene locus_tag LOCUS_04550 271013 271309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04550 271313 271684 gene locus_tag LOCUS_04560 271313 271684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04560 271685 272215 gene locus_tag LOCUS_04570 271685 272215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04570 272621 272232 gene locus_tag LOCUS_04580 272621 272232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04580 273314 272637 gene locus_tag LOCUS_04590 273314 272637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04590 273602 273420 gene locus_tag LOCUS_04600 273602 273420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04600 273682 274398 gene locus_tag LOCUS_04610 273682 274398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 274667 275917 gene locus_tag LOCUS_04620 gene tig 274667 275917 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_04620 276288 276473 gene locus_tag LOCUS_04630 276288 276473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04630 276507 277274 gene locus_tag LOCUS_04640 276507 277274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04640 277359 277694 gene locus_tag LOCUS_04650 277359 277694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04650 277875 278015 gene locus_tag LOCUS_04660 277875 278015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 278016 278210 gene locus_tag LOCUS_04670 278016 278210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 278229 278417 gene locus_tag LOCUS_04680 278229 278417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 278469 278657 gene locus_tag LOCUS_04690 278469 278657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 279498 278851 gene locus_tag LOCUS_04700 279498 278851 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04700 280191 281417 gene locus_tag LOCUS_04710 280191 281417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 281706 281900 gene locus_tag LOCUS_04720 281706 281900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04720 281904 282029 gene locus_tag LOCUS_04730 281904 282029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 282054 283475 gene locus_tag LOCUS_04740 282054 283475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04740 283512 284654 gene locus_tag LOCUS_04750 283512 284654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04750 284937 285236 gene locus_tag LOCUS_04760 284937 285236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04760 285333 285485 gene locus_tag LOCUS_04770 285333 285485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04770 285624 286331 gene locus_tag LOCUS_04780 285624 286331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04780 286352 286427 gene locus_tag LOCUS_t00210 286352 286427 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 287225 287419 gene locus_tag LOCUS_04790 287225 287419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 288048 288200 gene locus_tag LOCUS_04800 288048 288200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 288810 289037 gene locus_tag LOCUS_04810 288810 289037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04810 289246 288995 gene locus_tag LOCUS_04820 289246 288995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 289494 289781 gene locus_tag LOCUS_04830 289494 289781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 290239 289913 gene locus_tag LOCUS_04840 290239 289913 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_04840 290375 290244 gene locus_tag LOCUS_04850 290375 290244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 290558 290415 gene locus_tag LOCUS_04860 290558 290415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 291077 290853 gene locus_tag LOCUS_04870 291077 290853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 291668 291390 gene locus_tag LOCUS_04880 291668 291390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 292052 291762 gene locus_tag LOCUS_04890 292052 291762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 292990 292067 gene locus_tag LOCUS_04900 292990 292067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 293542 293381 gene locus_tag LOCUS_04910 293542 293381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 293977 293855 gene locus_tag LOCUS_04920 293977 293855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 294205 294005 gene locus_tag LOCUS_04930 294205 294005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 294671 295012 gene locus_tag LOCUS_04940 294671 295012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 296787 295819 gene locus_tag LOCUS_04950 296787 295819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 297113 296838 gene locus_tag LOCUS_04960 297113 296838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 297413 297171 gene locus_tag LOCUS_04970 297413 297171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 297905 297582 gene locus_tag LOCUS_04980 297905 297582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 298313 298029 gene locus_tag LOCUS_04990 298313 298029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 298595 298323 gene locus_tag LOCUS_05000 298595 298323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 298991 298614 gene locus_tag LOCUS_05010 298991 298614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 299216 299007 gene locus_tag LOCUS_05020 299216 299007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 300104 299343 gene locus_tag LOCUS_05030 300104 299343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05030 302027 300138 gene locus_tag LOCUS_05040 302027 300138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 302549 302265 gene locus_tag LOCUS_05050 302549 302265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 303533 303027 gene locus_tag LOCUS_05060 303533 303027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 304301 304128 gene locus_tag LOCUS_05070 304301 304128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 304862 304422 gene locus_tag LOCUS_05080 304862 304422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 305222 304941 gene locus_tag LOCUS_05090 305222 304941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 306140 305457 gene locus_tag LOCUS_05100 gene rsmG 306140 305457 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476459.1 protein_id gnl|my_center|LOCUS_05100 306873 306115 gene locus_tag LOCUS_05110 306873 306115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 307682 307287 gene locus_tag LOCUS_05120 307682 307287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05120 308102 307911 gene locus_tag LOCUS_05130 308102 307911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 308152 309507 gene locus_tag LOCUS_05140 gene gpmI 308152 309507 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874985.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05140 309592 309726 gene locus_tag LOCUS_05150 309592 309726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 310106 309750 gene locus_tag LOCUS_05160 310106 309750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 310553 310170 gene locus_tag LOCUS_05170 310553 310170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 311092 310652 gene locus_tag LOCUS_05180 311092 310652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 312508 312317 gene locus_tag LOCUS_05190 312508 312317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 312739 312557 gene locus_tag LOCUS_05200 312739 312557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05200 313638 312739 gene locus_tag LOCUS_05210 313638 312739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 314040 313654 gene locus_tag LOCUS_05220 314040 313654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05220 314643 314272 gene locus_tag LOCUS_05230 314643 314272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05230 315143 314808 gene locus_tag LOCUS_05240 315143 314808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05240 315989 315252 gene locus_tag LOCUS_05250 315989 315252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05250 316358 316044 gene locus_tag LOCUS_05260 316358 316044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 316894 316586 gene locus_tag LOCUS_05270 316894 316586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 317278 316982 gene locus_tag LOCUS_05280 317278 316982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 317466 317726 gene locus_tag LOCUS_05290 317466 317726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 318123 317962 gene locus_tag LOCUS_05300 318123 317962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 319351 319151 gene locus_tag LOCUS_05310 319351 319151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 320106 319477 gene locus_tag LOCUS_05320 320106 319477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05320 320385 320140 gene locus_tag LOCUS_05330 320385 320140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05330 320688 320506 gene locus_tag LOCUS_05340 320688 320506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05340 321314 320931 gene locus_tag LOCUS_05350 321314 320931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 321518 321360 gene locus_tag LOCUS_05360 321518 321360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 321746 321531 gene locus_tag LOCUS_05370 321746 321531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 322435 321920 gene locus_tag LOCUS_05380 322435 321920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05380 322837 322538 gene locus_tag LOCUS_05390 322837 322538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05390 323119 322970 gene locus_tag LOCUS_05400 323119 322970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 323461 324021 gene locus_tag LOCUS_05410 323461 324021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 324202 324885 gene locus_tag LOCUS_05420 324202 324885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 325101 325292 gene locus_tag LOCUS_05430 325101 325292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 325389 326426 gene locus_tag LOCUS_05440 325389 326426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 326517 326915 gene locus_tag LOCUS_05450 326517 326915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 327117 328190 gene locus_tag LOCUS_05460 327117 328190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 328191 328649 gene locus_tag LOCUS_05470 328191 328649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 328683 328808 gene locus_tag LOCUS_05480 328683 328808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 329689 329168 gene locus_tag LOCUS_05490 329689 329168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05490 330310 330161 gene locus_tag LOCUS_05500 330310 330161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 330504 330677 gene locus_tag LOCUS_05510 330504 330677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 330684 331070 gene locus_tag LOCUS_05520 330684 331070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 331542 332063 gene locus_tag LOCUS_05530 331542 332063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05530 332548 332423 gene locus_tag LOCUS_05540 332548 332423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 333040 332582 gene locus_tag LOCUS_05550 333040 332582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 334432 333041 gene locus_tag LOCUS_05560 334432 333041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 335032 334634 gene locus_tag LOCUS_05570 335032 334634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 336205 335123 gene locus_tag LOCUS_05580 336205 335123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 336448 336257 gene locus_tag LOCUS_05590 336448 336257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 337171 336617 gene locus_tag LOCUS_05600 337171 336617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05600 337744 337499 gene locus_tag LOCUS_05610 337744 337499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 337972 337766 gene locus_tag LOCUS_05620 337972 337766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05620 338281 338829 gene locus_tag LOCUS_05630 338281 338829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05630 339016 339186 gene locus_tag LOCUS_05640 339016 339186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 339492 339953 gene locus_tag LOCUS_05650 339492 339953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05650 340335 340520 gene locus_tag LOCUS_05660 340335 340520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 340620 341099 gene locus_tag LOCUS_05670 340620 341099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 342024 342416 gene locus_tag LOCUS_05680 342024 342416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05680 343151 342987 gene locus_tag LOCUS_05690 343151 342987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 343408 343551 gene locus_tag LOCUS_05700 343408 343551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 343880 343671 gene locus_tag LOCUS_05710 343880 343671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 344521 344742 gene locus_tag LOCUS_05720 344521 344742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 344843 345100 gene locus_tag LOCUS_05730 344843 345100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 345194 345676 gene locus_tag LOCUS_05740 345194 345676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 346979 346047 gene locus_tag LOCUS_05750 346979 346047 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874663.1 protein_id gnl|my_center|LOCUS_05750 347229 346981 gene locus_tag LOCUS_05760 347229 346981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05760 347604 347299 gene locus_tag LOCUS_05770 347604 347299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05770 348024 347638 gene locus_tag LOCUS_05780 348024 347638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05780 348727 348191 gene locus_tag LOCUS_05790 348727 348191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 349270 349016 gene locus_tag LOCUS_05800 349270 349016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05800 350134 349652 gene locus_tag LOCUS_05810 350134 349652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05810 350329 350198 gene locus_tag LOCUS_05820 350329 350198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05820 351703 350912 gene locus_tag LOCUS_05830 351703 350912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 352042 351716 gene locus_tag LOCUS_05840 352042 351716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 352999 352121 gene locus_tag LOCUS_05850 352999 352121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 353706 353083 gene locus_tag LOCUS_05860 353706 353083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 354479 354138 gene locus_tag LOCUS_05870 354479 354138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 354986 354816 gene locus_tag LOCUS_05880 354986 354816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 356626 355271 gene locus_tag LOCUS_05890 gene gatB 356626 355271 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183060.1 protein_id gnl|my_center|LOCUS_05890 357095 356682 gene locus_tag LOCUS_05900 357095 356682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05900 358010 357105 gene locus_tag LOCUS_05910 358010 357105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05910 358311 358003 gene locus_tag LOCUS_05920 358311 358003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 358547 358338 gene locus_tag LOCUS_05930 358547 358338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 359174 358557 gene locus_tag LOCUS_05940 359174 358557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 359541 359158 gene locus_tag LOCUS_05950 359541 359158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05950 359796 359581 gene locus_tag LOCUS_05960 359796 359581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 360637 359789 gene locus_tag LOCUS_05970 360637 359789 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_05970 361356 360652 gene locus_tag LOCUS_05980 361356 360652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 361818 361456 gene locus_tag LOCUS_05990 361818 361456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 362175 361879 gene locus_tag LOCUS_06000 362175 361879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 363354 362266 gene locus_tag LOCUS_06010 363354 362266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 363874 363722 gene locus_tag LOCUS_06020 363874 363722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 364432 363920 gene locus_tag LOCUS_06030 364432 363920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06030 364639 364436 gene locus_tag LOCUS_06040 364639 364436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06040 364873 364658 gene locus_tag LOCUS_06050 364873 364658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 365250 364912 gene locus_tag LOCUS_06060 365250 364912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06060 365790 365389 gene locus_tag LOCUS_06070 365790 365389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06070 366525 366139 gene locus_tag LOCUS_06080 366525 366139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06080 367210 366623 gene locus_tag LOCUS_06090 367210 366623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 367407 367805 gene locus_tag LOCUS_06100 367407 367805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06100 367869 368963 gene locus_tag LOCUS_06110 367869 368963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06110 369000 369179 gene locus_tag LOCUS_06120 369000 369179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 369980 369657 gene locus_tag LOCUS_06130 369980 369657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 370154 369981 gene locus_tag LOCUS_06140 370154 369981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 372087 370786 gene locus_tag LOCUS_06150 372087 370786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06150 372768 372100 gene locus_tag LOCUS_06160 372768 372100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06160 373017 372811 gene locus_tag LOCUS_06170 373017 372811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 373636 373785 gene locus_tag LOCUS_06180 373636 373785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 373867 374058 gene locus_tag LOCUS_06190 373867 374058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 374447 374372 gene locus_tag LOCUS_t00220 374447 374372 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 374690 375832 gene locus_tag LOCUS_06200 374690 375832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 376016 375924 gene locus_tag LOCUS_t00230 376016 375924 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 376448 376086 gene locus_tag LOCUS_06210 376448 376086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 376799 376464 gene locus_tag LOCUS_06220 376799 376464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 377056 376799 gene locus_tag LOCUS_06230 377056 376799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06230 377356 377111 gene locus_tag LOCUS_06240 377356 377111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 377665 377471 gene locus_tag LOCUS_06250 377665 377471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06250 378332 378937 gene locus_tag LOCUS_06260 378332 378937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06260 378953 379123 gene locus_tag LOCUS_06270 378953 379123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06270 379286 379561 gene locus_tag LOCUS_06280 379286 379561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06280 379837 379754 gene locus_tag LOCUS_t00240 379837 379754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 379891 380052 gene locus_tag LOCUS_06290 379891 380052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 380083 380376 gene locus_tag LOCUS_06300 380083 380376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06300 380531 382189 gene locus_tag LOCUS_06310 380531 382189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06310 382196 383287 gene locus_tag LOCUS_06320 382196 383287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06320 383679 383831 gene locus_tag LOCUS_06330 383679 383831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 384615 384851 gene locus_tag LOCUS_06340 384615 384851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 385539 385778 gene locus_tag LOCUS_06350 385539 385778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 386537 387133 gene locus_tag LOCUS_06360 386537 387133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 387185 387272 gene locus_tag LOCUS_t00250 387185 387272 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 387276 387351 gene locus_tag LOCUS_t00260 387276 387351 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 387942 387397 gene locus_tag LOCUS_06370 387942 387397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 388575 388405 gene locus_tag LOCUS_06380 388575 388405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 388607 388813 gene locus_tag LOCUS_06390 388607 388813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 389018 389290 gene locus_tag LOCUS_06400 389018 389290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 389339 389920 gene locus_tag LOCUS_06410 389339 389920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06410 389948 390520 gene locus_tag LOCUS_06420 389948 390520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06420 390614 390925 gene locus_tag LOCUS_06430 390614 390925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06430 390950 391291 gene locus_tag LOCUS_06440 390950 391291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06440 392211 391876 gene locus_tag LOCUS_06450 392211 391876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 392455 393318 gene locus_tag LOCUS_06460 392455 393318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06460 393322 393618 gene locus_tag LOCUS_06470 393322 393618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06470 395079 394009 gene locus_tag LOCUS_06480 395079 394009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 395421 395266 gene locus_tag LOCUS_06490 395421 395266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 395832 395476 gene locus_tag LOCUS_06500 395832 395476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 396390 396211 gene locus_tag LOCUS_06510 396390 396211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 396652 396497 gene locus_tag LOCUS_06520 396652 396497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 396892 396665 gene locus_tag LOCUS_06530 396892 396665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 397150 396968 gene locus_tag LOCUS_06540 397150 396968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 397328 397176 gene locus_tag LOCUS_06550 397328 397176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06550 398690 397338 gene locus_tag LOCUS_06560 398690 397338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06560 398954 398709 gene locus_tag LOCUS_06570 398954 398709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 399119 398985 gene locus_tag LOCUS_06580 399119 398985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06580 399533 399273 gene locus_tag LOCUS_06590 399533 399273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06590 399749 399540 gene locus_tag LOCUS_06600 399749 399540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 400207 400587 gene locus_tag LOCUS_06610 400207 400587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 401243 401593 gene locus_tag LOCUS_06620 401243 401593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 401621 401833 gene locus_tag LOCUS_06630 401621 401833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 401882 402352 gene locus_tag LOCUS_06640 401882 402352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 402581 402745 gene locus_tag LOCUS_06650 402581 402745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 402800 403075 gene locus_tag LOCUS_06660 402800 403075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 403255 404094 gene locus_tag LOCUS_06670 gene era 403255 404094 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016271.1 protein_id gnl|my_center|LOCUS_06670 404485 404895 gene locus_tag LOCUS_06680 404485 404895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 404974 405330 gene locus_tag LOCUS_06690 404974 405330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 405679 405858 gene locus_tag LOCUS_06700 405679 405858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 405869 406063 gene locus_tag LOCUS_06710 405869 406063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06710 406298 406444 gene locus_tag LOCUS_06720 406298 406444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 406490 406876 gene locus_tag LOCUS_06730 406490 406876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06730 407541 408110 gene locus_tag LOCUS_06740 407541 408110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06740 408988 409290 gene locus_tag LOCUS_06750 408988 409290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 409321 409632 gene locus_tag LOCUS_06760 409321 409632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 409657 409983 gene locus_tag LOCUS_06770 409657 409983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 410053 410382 gene locus_tag LOCUS_06780 410053 410382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 410725 410558 gene locus_tag LOCUS_06790 410725 410558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 411614 410787 gene locus_tag LOCUS_06800 gene mutM 411614 410787 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874736.1 protein_id gnl|my_center|LOCUS_06800 411675 411854 gene locus_tag LOCUS_06810 411675 411854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 411933 412148 gene locus_tag LOCUS_06820 411933 412148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 412153 412539 gene locus_tag LOCUS_06830 gene rpiB 412153 412539 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862995.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06830 413788 413663 gene locus_tag LOCUS_06840 413788 413663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 414896 414717 gene locus_tag LOCUS_06850 414896 414717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 415292 415026 gene locus_tag LOCUS_06860 415292 415026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 415832 415605 gene locus_tag LOCUS_06870 415832 415605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06870 416426 416145 gene locus_tag LOCUS_06880 416426 416145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 416878 416441 gene locus_tag LOCUS_06890 gene rplI 416878 416441 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015545494.1 protein_id gnl|my_center|LOCUS_06890 417224 416859 gene locus_tag LOCUS_06900 417224 416859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 418307 417261 gene locus_tag LOCUS_06910 418307 417261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06910 418336 418575 gene locus_tag LOCUS_06920 418336 418575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 418829 418530 gene locus_tag LOCUS_06930 418829 418530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 419387 418953 gene locus_tag LOCUS_06940 419387 418953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 419855 419694 gene locus_tag LOCUS_06950 419855 419694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 419797 420033 gene locus_tag LOCUS_06960 419797 420033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 420359 420048 gene locus_tag LOCUS_06970 420359 420048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 421228 420611 gene locus_tag LOCUS_06980 421228 420611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 421811 421422 gene locus_tag LOCUS_06990 421811 421422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06990 422003 421821 gene locus_tag LOCUS_07000 422003 421821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 422408 422058 gene locus_tag LOCUS_07010 422408 422058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 422546 423073 gene locus_tag LOCUS_07020 gene def 422546 423073 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957056.1 protein_id gnl|my_center|LOCUS_07020 423601 423371 gene locus_tag LOCUS_07030 423601 423371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 424045 423923 gene locus_tag LOCUS_07040 424045 423923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 424425 424111 gene locus_tag LOCUS_07050 424425 424111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 424800 424468 gene locus_tag LOCUS_07060 424800 424468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07060 426024 425263 gene locus_tag LOCUS_07070 426024 425263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 426717 426490 gene locus_tag LOCUS_07080 426717 426490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 427155 426793 gene locus_tag LOCUS_07090 427155 426793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 427282 427145 gene locus_tag LOCUS_07100 427282 427145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 427666 427947 gene locus_tag LOCUS_07110 427666 427947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07110 427987 428670 gene locus_tag LOCUS_07120 427987 428670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07120 428660 429088 gene locus_tag LOCUS_07130 428660 429088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 429284 429403 gene locus_tag LOCUS_07140 429284 429403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 429422 430096 gene locus_tag LOCUS_07150 429422 430096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07150 430539 430748 gene locus_tag LOCUS_07160 430539 430748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 431215 430757 gene locus_tag LOCUS_07170 431215 430757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07170 431482 431225 gene locus_tag LOCUS_07180 431482 431225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07180 432383 431910 gene locus_tag LOCUS_07190 432383 431910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07190 433238 432387 gene locus_tag LOCUS_07200 433238 432387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07200 433216 433401 gene locus_tag LOCUS_07210 433216 433401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 433568 433413 gene locus_tag LOCUS_07220 433568 433413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 433540 433704 gene locus_tag LOCUS_07230 433540 433704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 433997 433716 gene locus_tag LOCUS_07240 433997 433716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 434537 434361 gene locus_tag LOCUS_07250 434537 434361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 435065 434574 gene locus_tag LOCUS_07260 435065 434574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07260 435597 435055 gene locus_tag LOCUS_07270 gene pth 435597 435055 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_07270 436073 435627 gene locus_tag LOCUS_07280 436073 435627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07280 436508 436089 gene locus_tag LOCUS_07290 436508 436089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07290 437465 436587 gene locus_tag LOCUS_07300 437465 436587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07300 437807 437523 gene locus_tag LOCUS_07310 437807 437523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 437891 438571 gene locus_tag LOCUS_07320 437891 438571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 438590 438784 gene locus_tag LOCUS_07330 438590 438784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07330 438791 439165 gene locus_tag LOCUS_07340 438791 439165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07340 439468 439953 gene locus_tag LOCUS_07350 439468 439953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07350 439954 440469 gene locus_tag LOCUS_07360 439954 440469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07360 440625 441251 gene locus_tag LOCUS_07370 440625 441251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 441372 441590 gene locus_tag LOCUS_07380 441372 441590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 441962 442159 gene locus_tag LOCUS_07390 441962 442159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 442406 443050 gene locus_tag LOCUS_07400 442406 443050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07400 443213 443416 gene locus_tag LOCUS_07410 443213 443416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07410 443636 443830 gene locus_tag LOCUS_07420 443636 443830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 444023 444610 gene locus_tag LOCUS_07430 444023 444610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07430 444600 444839 gene locus_tag LOCUS_07440 444600 444839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 445137 446183 gene locus_tag LOCUS_07450 445137 446183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 446708 447283 gene locus_tag LOCUS_07460 446708 447283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07460 447329 447499 gene locus_tag LOCUS_07470 447329 447499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 447503 447712 gene locus_tag LOCUS_07480 447503 447712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07480 447758 447928 gene locus_tag LOCUS_07490 447758 447928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07490 447959 448102 gene locus_tag LOCUS_07500 447959 448102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07500 449055 448129 gene locus_tag LOCUS_07510 449055 448129 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 protein_id gnl|my_center|LOCUS_07510 449535 449146 gene locus_tag LOCUS_07520 449535 449146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 450603 449899 gene locus_tag LOCUS_07530 450603 449899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 451449 450856 gene locus_tag LOCUS_07540 451449 450856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 451878 451558 gene locus_tag LOCUS_07550 451878 451558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 452149 452355 gene locus_tag LOCUS_07560 452149 452355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 452377 453204 gene locus_tag LOCUS_07570 452377 453204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07570 453226 453414 gene locus_tag LOCUS_07580 453226 453414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 453503 454072 gene locus_tag LOCUS_07590 453503 454072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07590 454211 454852 gene locus_tag LOCUS_07600 454211 454852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 455149 455496 gene locus_tag LOCUS_07610 455149 455496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07610 455650 455964 gene locus_tag LOCUS_07620 455650 455964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07620 455975 456193 gene locus_tag LOCUS_07630 455975 456193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 456265 456429 gene locus_tag LOCUS_07640 456265 456429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07640 456487 456984 gene locus_tag LOCUS_07650 456487 456984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07650 456998 457549 gene locus_tag LOCUS_07660 gene frr 456998 457549 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135448.1 protein_id gnl|my_center|LOCUS_07660 457673 457903 gene locus_tag LOCUS_07670 457673 457903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 458396 458641 gene locus_tag LOCUS_07680 458396 458641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07680 458661 460241 gene locus_tag LOCUS_07690 458661 460241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07690 460914 461249 gene locus_tag LOCUS_07700 460914 461249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07700 461478 461879 gene locus_tag LOCUS_07710 461478 461879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07710 461880 462215 gene locus_tag LOCUS_07720 461880 462215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07720 462288 462419 gene locus_tag LOCUS_07730 462288 462419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 462525 462770 gene locus_tag LOCUS_07740 462525 462770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07740 463697 464953 gene locus_tag LOCUS_07750 463697 464953 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356623.1 protein_id gnl|my_center|LOCUS_07750 464968 465240 gene locus_tag LOCUS_07760 464968 465240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 465240 466874 gene locus_tag LOCUS_07770 465240 466874 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_07770 466883 467902 gene locus_tag LOCUS_07780 gene plsX 466883 467902 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 protein_id gnl|my_center|LOCUS_07780 467895 468581 gene locus_tag LOCUS_07790 gene rnc 467895 468581 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440969.1 protein_id gnl|my_center|LOCUS_07790 468706 468885 gene locus_tag LOCUS_07800 468706 468885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 469693 469911 gene locus_tag LOCUS_07810 469693 469911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 470030 470173 gene locus_tag LOCUS_07820 470030 470173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 470184 470420 gene locus_tag LOCUS_07830 470184 470420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 471028 471327 gene locus_tag LOCUS_07840 471028 471327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 471508 471792 gene locus_tag LOCUS_07850 471508 471792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 472381 472524 gene locus_tag LOCUS_07860 472381 472524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 473070 472849 gene locus_tag LOCUS_07870 473070 472849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 472973 473167 gene locus_tag LOCUS_07880 472973 473167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 473243 474052 gene locus_tag LOCUS_07890 473243 474052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 474120 474533 gene locus_tag LOCUS_07900 474120 474533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 474546 474725 gene locus_tag LOCUS_07910 474546 474725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 474741 475745 gene locus_tag LOCUS_07920 474741 475745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 475959 478901 gene locus_tag LOCUS_07930 475959 478901 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_07930 478894 479229 gene locus_tag LOCUS_07940 478894 479229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 480025 480216 gene locus_tag LOCUS_07950 480025 480216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 480280 481845 gene locus_tag LOCUS_07960 480280 481845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07960 482641 485772 gene locus_tag LOCUS_07970 482641 485772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 485800 486579 gene locus_tag LOCUS_07980 485800 486579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 486661 487083 gene locus_tag LOCUS_07990 486661 487083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 487369 487500 gene locus_tag LOCUS_08000 487369 487500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 489126 488362 gene locus_tag LOCUS_08010 489126 488362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 489372 489494 gene locus_tag LOCUS_08020 489372 489494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 489744 489929 gene locus_tag LOCUS_08030 489744 489929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 490120 490308 gene locus_tag LOCUS_08040 490120 490308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 490432 491235 gene locus_tag LOCUS_08050 490432 491235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 491326 491532 gene locus_tag LOCUS_08060 491326 491532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 491587 492483 gene locus_tag LOCUS_08070 491587 492483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 492538 493650 gene locus_tag LOCUS_08080 492538 493650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 493762 493947 gene locus_tag LOCUS_08090 493762 493947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 493951 494244 gene locus_tag LOCUS_08100 493951 494244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 494518 494895 gene locus_tag LOCUS_08110 494518 494895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 494896 495492 gene locus_tag LOCUS_08120 494896 495492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 495661 495942 gene locus_tag LOCUS_08130 495661 495942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 496030 496215 gene locus_tag LOCUS_08140 496030 496215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 496300 498312 gene locus_tag LOCUS_08150 gene uvrB 496300 498312 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164919771.1 protein_id gnl|my_center|LOCUS_08150 498648 498803 gene locus_tag LOCUS_08160 498648 498803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 499041 499280 gene locus_tag LOCUS_08170 499041 499280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 499455 499727 gene locus_tag LOCUS_08180 499455 499727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 500740 500243 gene locus_tag LOCUS_08190 500740 500243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 501125 500751 gene locus_tag LOCUS_08200 501125 500751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 502049 501657 gene locus_tag LOCUS_08210 502049 501657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 502460 502230 gene locus_tag LOCUS_08220 502460 502230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 503297 503007 gene locus_tag LOCUS_08230 503297 503007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 503551 503294 gene locus_tag LOCUS_08240 503551 503294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 503827 503555 gene locus_tag LOCUS_08250 503827 503555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 503983 503840 gene locus_tag LOCUS_08260 503983 503840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 504316 504080 gene locus_tag LOCUS_08270 504316 504080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 504421 504735 gene locus_tag LOCUS_08280 504421 504735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 505510 505695 gene locus_tag LOCUS_08290 505510 505695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 506023 506226 gene locus_tag LOCUS_08300 506023 506226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 506306 506557 gene locus_tag LOCUS_08310 506306 506557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 506714 506887 gene locus_tag LOCUS_08320 506714 506887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 507038 507157 gene locus_tag LOCUS_08330 507038 507157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 508272 507352 gene locus_tag LOCUS_08340 508272 507352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 508712 508356 gene locus_tag LOCUS_08350 508712 508356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 509042 508785 gene locus_tag LOCUS_08360 509042 508785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 509570 509172 gene locus_tag LOCUS_08370 509570 509172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 509476 509721 gene locus_tag LOCUS_08380 509476 509721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 509770 509928 gene locus_tag LOCUS_08390 509770 509928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 510091 511884 gene locus_tag LOCUS_08400 510091 511884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 511927 512292 gene locus_tag LOCUS_08410 511927 512292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 512362 512736 gene locus_tag LOCUS_08420 512362 512736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 512986 513231 gene locus_tag LOCUS_08430 512986 513231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 513277 513495 gene locus_tag LOCUS_08440 513277 513495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 514181 513831 gene locus_tag LOCUS_08450 514181 513831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 514482 514273 gene locus_tag LOCUS_08460 514482 514273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 514751 514906 gene locus_tag LOCUS_08470 514751 514906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 516110 515427 gene locus_tag LOCUS_08480 516110 515427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 516401 516216 gene locus_tag LOCUS_08490 516401 516216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 517080 516631 gene locus_tag LOCUS_08500 517080 516631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 517332 517192 gene locus_tag LOCUS_08510 517332 517192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 517752 517447 gene locus_tag LOCUS_08520 517752 517447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 517974 517783 gene locus_tag LOCUS_08530 517974 517783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 518147 518338 gene locus_tag LOCUS_08540 518147 518338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 518851 518690 gene locus_tag LOCUS_08550 518851 518690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 519088 518861 gene locus_tag LOCUS_08560 519088 518861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 519582 519764 gene locus_tag LOCUS_08570 519582 519764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 519957 520505 gene locus_tag LOCUS_08580 519957 520505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 520524 521168 gene locus_tag LOCUS_08590 gene gmk 520524 521168 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640361.1 protein_id gnl|my_center|LOCUS_08590 521473 521658 gene locus_tag LOCUS_08600 521473 521658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 521915 522814 gene locus_tag LOCUS_08610 521915 522814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 522920 523762 gene locus_tag LOCUS_08620 gene rsgA 522920 523762 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972439.1 protein_id gnl|my_center|LOCUS_08620 523771 524424 gene locus_tag LOCUS_08630 gene rpe 523771 524424 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_08630 524433 524726 gene locus_tag LOCUS_08640 524433 524726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 524824 525384 gene locus_tag LOCUS_08650 524824 525384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 525461 526324 gene locus_tag LOCUS_08660 gene tsaD 525461 526324 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166293.1 protein_id gnl|my_center|LOCUS_08660 527645 527475 gene locus_tag LOCUS_08670 527645 527475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 527969 527781 gene locus_tag LOCUS_08680 527969 527781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 528448 528143 gene locus_tag LOCUS_08690 528448 528143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 529087 528623 gene locus_tag LOCUS_08700 529087 528623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 529191 529517 gene locus_tag LOCUS_08710 529191 529517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 529638 530105 gene locus_tag LOCUS_08720 529638 530105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 530151 530447 gene locus_tag LOCUS_08730 530151 530447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 531104 531367 gene locus_tag LOCUS_08740 531104 531367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 531357 532667 gene locus_tag LOCUS_08750 531357 532667 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_08750 532670 533293 gene locus_tag LOCUS_08760 532670 533293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08760 533682 534017 gene locus_tag LOCUS_08770 533682 534017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08770 534162 534419 gene locus_tag LOCUS_08780 534162 534419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 534429 535091 gene locus_tag LOCUS_08790 534429 535091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 535305 535499 gene locus_tag LOCUS_08800 535305 535499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08800 536049 536276 gene locus_tag LOCUS_08810 536049 536276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 536472 536690 gene locus_tag LOCUS_08820 536472 536690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08820 537385 537167 gene locus_tag LOCUS_08830 537385 537167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 537273 537818 gene locus_tag LOCUS_08840 537273 537818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 538692 538489 gene locus_tag LOCUS_08850 538692 538489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 539016 538792 gene locus_tag LOCUS_08860 539016 538792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08860 540162 539086 gene locus_tag LOCUS_08870 540162 539086 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182968.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08870 540588 540172 gene locus_tag LOCUS_08880 540588 540172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08880 541725 540592 gene locus_tag LOCUS_08890 541725 540592 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182967.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08890 542188 542514 gene locus_tag LOCUS_08900 542188 542514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 542683 543102 gene locus_tag LOCUS_08910 542683 543102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 543922 544173 gene locus_tag LOCUS_08920 543922 544173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 544315 544494 gene locus_tag LOCUS_08930 544315 544494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 544561 544713 gene locus_tag LOCUS_08940 544561 544713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 545111 544962 gene locus_tag LOCUS_08950 545111 544962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 545591 545280 gene locus_tag LOCUS_08960 545591 545280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08960 546444 545893 gene locus_tag LOCUS_08970 546444 545893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08970 546782 546459 gene locus_tag LOCUS_08980 546782 546459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 547280 546783 gene locus_tag LOCUS_08990 547280 546783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 548011 547691 gene locus_tag LOCUS_09000 548011 547691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 548176 548045 gene locus_tag LOCUS_09010 548176 548045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 548551 548177 gene locus_tag LOCUS_09020 548551 548177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 548782 548564 gene locus_tag LOCUS_09030 548782 548564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 548935 548798 gene locus_tag LOCUS_09040 548935 548798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 549494 549778 gene locus_tag LOCUS_09050 549494 549778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 549979 550149 gene locus_tag LOCUS_09060 549979 550149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 550247 550402 gene locus_tag LOCUS_09070 550247 550402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 550636 550469 gene locus_tag LOCUS_09080 550636 550469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 551157 551501 gene locus_tag LOCUS_09090 551157 551501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 551628 551924 gene locus_tag LOCUS_09100 551628 551924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 552313 552585 gene locus_tag LOCUS_09110 552313 552585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 552881 553177 gene locus_tag LOCUS_09120 552881 553177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09120 553355 553621 gene locus_tag LOCUS_09130 553355 553621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 554214 554447 gene locus_tag LOCUS_09140 554214 554447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 555317 556072 gene locus_tag LOCUS_09150 555317 556072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 556370 556561 gene locus_tag LOCUS_09160 556370 556561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 556589 557806 gene locus_tag LOCUS_09170 556589 557806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 557900 558154 gene locus_tag LOCUS_09180 557900 558154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 558311 558850 gene locus_tag LOCUS_09190 558311 558850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 558843 559736 gene locus_tag LOCUS_09200 558843 559736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 560103 560285 gene locus_tag LOCUS_09210 560103 560285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 560943 561098 gene locus_tag LOCUS_09220 560943 561098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 561212 561448 gene locus_tag LOCUS_09230 561212 561448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 561563 561787 gene locus_tag LOCUS_09240 561563 561787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 561791 562081 gene locus_tag LOCUS_09250 561791 562081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 562230 563126 gene locus_tag LOCUS_09260 562230 563126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 563490 563678 gene locus_tag LOCUS_09270 563490 563678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 563865 564485 gene locus_tag LOCUS_09280 563865 564485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 564599 564835 gene locus_tag LOCUS_09290 564599 564835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 564950 565174 gene locus_tag LOCUS_09300 564950 565174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 565190 565468 gene locus_tag LOCUS_09310 565190 565468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 565630 566076 gene locus_tag LOCUS_09320 565630 566076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 566190 566426 gene locus_tag LOCUS_09330 566190 566426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 566541 566765 gene locus_tag LOCUS_09340 566541 566765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 567248 567595 gene locus_tag LOCUS_09350 567248 567595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 567644 568072 gene locus_tag LOCUS_09360 567644 568072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 568435 568238 gene locus_tag LOCUS_09370 568435 568238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 568772 569182 gene locus_tag LOCUS_09380 568772 569182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 569220 569543 gene locus_tag LOCUS_09390 569220 569543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 569695 569429 gene locus_tag LOCUS_09400 569695 569429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 569733 570008 gene locus_tag LOCUS_09410 569733 570008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 570025 570303 gene locus_tag LOCUS_09420 570025 570303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 570398 570844 gene locus_tag LOCUS_09430 570398 570844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 570960 571385 gene locus_tag LOCUS_09440 570960 571385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 571395 572141 gene locus_tag LOCUS_09450 571395 572141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09450 572142 572843 gene locus_tag LOCUS_09460 572142 572843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09460 572966 573829 gene locus_tag LOCUS_09470 gene atpG 572966 573829 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966150.1 protein_id gnl|my_center|LOCUS_09470 573839 575359 gene locus_tag LOCUS_09480 gene atpD 573839 575359 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_09480 575363 575740 gene locus_tag LOCUS_09490 575363 575740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 576259 576456 gene locus_tag LOCUS_09500 576259 576456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 576457 576771 gene locus_tag LOCUS_09510 576457 576771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 576802 577128 gene locus_tag LOCUS_09520 576802 577128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 577159 577347 gene locus_tag LOCUS_09530 577159 577347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 577589 577975 gene locus_tag LOCUS_09540 577589 577975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 578219 579496 gene locus_tag LOCUS_09550 578219 579496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 579536 581419 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatagcttactcaaatattgtacagcgctaaaac 581547 581831 gene locus_tag LOCUS_09560 581547 581831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 581892 582419 gene locus_tag LOCUS_09570 581892 582419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09570 582436 582744 gene locus_tag LOCUS_09580 gene cas2 582436 582744 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_09580 582746 583006 gene locus_tag LOCUS_09590 582746 583006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 583581 584687 gene locus_tag LOCUS_09600 583581 584687 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102729.1 protein_id gnl|my_center|LOCUS_09600 584809 585126 gene locus_tag LOCUS_09610 584809 585126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 585229 585567 gene locus_tag LOCUS_09620 585229 585567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09620 585634 585753 gene locus_tag LOCUS_09630 585634 585753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09630 585765 586481 gene locus_tag LOCUS_09640 585765 586481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 586806 587909 gene locus_tag LOCUS_09650 586806 587909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 587978 588187 gene locus_tag LOCUS_09660 587978 588187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 588239 588538 gene locus_tag LOCUS_09670 588239 588538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 588585 589025 gene locus_tag LOCUS_09680 588585 589025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 589200 589406 gene locus_tag LOCUS_09690 589200 589406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 589407 590303 gene locus_tag LOCUS_09700 589407 590303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 590312 591403 gene locus_tag LOCUS_09710 590312 591403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 591405 591722 gene locus_tag LOCUS_09720 591405 591722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09720 591804 592001 gene locus_tag LOCUS_09730 591804 592001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09730 592146 592355 gene locus_tag LOCUS_09740 592146 592355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09740 593272 592424 gene locus_tag LOCUS_09750 593272 592424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 594600 593881 gene locus_tag LOCUS_09760 594600 593881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 595287 594916 gene locus_tag LOCUS_09770 595287 594916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 595533 595294 gene locus_tag LOCUS_09780 595533 595294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09780 595750 595848 gene locus_tag LOCUS_r00010 595750 595848 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 595867 596739 gene locus_tag LOCUS_09790 595867 596739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 597464 597634 gene locus_tag LOCUS_09800 597464 597634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 597662 598708 gene locus_tag LOCUS_09810 597662 598708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 599579 598713 gene locus_tag LOCUS_09820 599579 598713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 599870 599652 gene locus_tag LOCUS_09830 599870 599652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 600582 600415 gene locus_tag LOCUS_09840 600582 600415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 601113 600805 gene locus_tag LOCUS_09850 601113 600805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09850 601294 602379 gene locus_tag LOCUS_09860 601294 602379 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166467.1 protein_id gnl|my_center|LOCUS_09860 602401 602619 gene locus_tag LOCUS_09870 602401 602619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 602794 603156 gene locus_tag LOCUS_09880 602794 603156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 603193 604206 gene locus_tag LOCUS_09890 603193 604206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09890 604199 604486 gene locus_tag LOCUS_09900 604199 604486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 604598 605056 gene locus_tag LOCUS_09910 604598 605056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09910 605114 605572 gene locus_tag LOCUS_09920 605114 605572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09920 605627 606079 gene locus_tag LOCUS_09930 605627 606079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09930 606785 606558 gene locus_tag LOCUS_09940 606785 606558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 607112 606882 gene locus_tag LOCUS_09950 607112 606882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 607392 607273 gene locus_tag LOCUS_09960 607392 607273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 607600 609330 gene locus_tag LOCUS_09970 607600 609330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 609479 610498 gene locus_tag LOCUS_09980 gene thiI 609479 610498 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166477.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09980 610546 610908 gene locus_tag LOCUS_09990 610546 610908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 611063 611248 gene locus_tag LOCUS_10000 611063 611248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 611501 612037 gene locus_tag LOCUS_10010 611501 612037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 612080 612391 gene locus_tag LOCUS_10020 612080 612391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10020 612467 614482 gene locus_tag LOCUS_10030 612467 614482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10030 614482 615003 gene locus_tag LOCUS_10040 614482 615003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10040 615109 615378 gene locus_tag LOCUS_10050 615109 615378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 615674 616567 gene locus_tag LOCUS_10060 615674 616567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 616597 616818 gene locus_tag LOCUS_10070 616597 616818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 617005 617307 gene locus_tag LOCUS_10080 617005 617307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 617368 617520 gene locus_tag LOCUS_10090 617368 617520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 617562 617750 gene locus_tag LOCUS_10100 617562 617750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 618403 618477 gene locus_tag LOCUS_t00270 618403 618477 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 618481 618557 gene locus_tag LOCUS_t00280 618481 618557 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 618664 618996 gene locus_tag LOCUS_10110 618664 618996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 619121 619933 gene locus_tag LOCUS_10120 gene hrcA 619121 619933 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183316.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10120 619982 620149 gene locus_tag LOCUS_10130 619982 620149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 620139 620954 gene locus_tag LOCUS_10140 620139 620954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 621111 621725 gene locus_tag LOCUS_10150 621111 621725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10150 621747 622901 gene locus_tag LOCUS_10160 621747 622901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10160 623371 622970 gene locus_tag LOCUS_10170 623371 622970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 623859 624011 gene locus_tag LOCUS_10180 623859 624011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 624205 624074 gene locus_tag LOCUS_10190 624205 624074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 625227 625036 gene locus_tag LOCUS_10200 625227 625036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 625516 625238 gene locus_tag LOCUS_10210 625516 625238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 626140 625757 gene locus_tag LOCUS_10220 626140 625757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 626947 626258 gene locus_tag LOCUS_10230 626947 626258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 627371 627057 gene locus_tag LOCUS_10240 627371 627057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 627750 627917 gene locus_tag LOCUS_10250 627750 627917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 628255 628034 gene locus_tag LOCUS_10260 628255 628034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 628245 629045 gene locus_tag LOCUS_10270 628245 629045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 629124 629462 gene locus_tag LOCUS_10280 629124 629462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10280 629746 629501 gene locus_tag LOCUS_10290 629746 629501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 629637 629849 gene locus_tag LOCUS_10300 629637 629849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 629924 630154 gene locus_tag LOCUS_10310 629924 630154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 630224 630559 gene locus_tag LOCUS_10320 630224 630559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 630731 631093 gene locus_tag LOCUS_10330 630731 631093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 631351 631809 gene locus_tag LOCUS_10340 631351 631809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 631909 632808 gene locus_tag LOCUS_10350 631909 632808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10350 632830 633357 gene locus_tag LOCUS_10360 632830 633357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10360 633558 633325 gene locus_tag LOCUS_10370 633558 633325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 633992 634450 gene locus_tag LOCUS_10380 633992 634450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10380 634887 635123 gene locus_tag LOCUS_10390 634887 635123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10390 635432 635623 gene locus_tag LOCUS_10400 635432 635623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 635656 636717 gene locus_tag LOCUS_10410 635656 636717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 637090 637347 gene locus_tag LOCUS_10420 637090 637347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10420 637573 638025 gene locus_tag LOCUS_10430 637573 638025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10430 638340 638525 gene locus_tag LOCUS_10440 638340 638525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 638823 639368 gene locus_tag LOCUS_10450 638823 639368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 639807 640061 gene locus_tag LOCUS_10460 639807 640061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 640353 641141 gene locus_tag LOCUS_10470 640353 641141 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_10470 641986 641219 gene locus_tag LOCUS_10480 gene rsmA 641986 641219 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166215.1 protein_id gnl|my_center|LOCUS_10480 642666 641986 gene locus_tag LOCUS_10490 642666 641986 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10490 643445 642798 gene locus_tag LOCUS_10500 643445 642798 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556970.1 protein_id gnl|my_center|LOCUS_10500 643741 643544 gene locus_tag LOCUS_10510 gene rpmB 643741 643544 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183124.1 protein_id gnl|my_center|LOCUS_10510 644606 644016 gene locus_tag LOCUS_10520 644606 644016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 645113 644715 gene locus_tag LOCUS_10530 645113 644715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 646495 645299 gene locus_tag LOCUS_10540 gene dnaA 646495 645299 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182898.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10540 647236 647415 gene locus_tag LOCUS_10550 647236 647415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 647366 647749 gene locus_tag LOCUS_10560 647366 647749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 647797 647946 gene locus_tag LOCUS_10570 647797 647946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 648340 648486 gene locus_tag LOCUS_10580 gene rpmH 648340 648486 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_10580 648646 648861 gene locus_tag LOCUS_10590 648646 648861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 648992 649435 gene locus_tag LOCUS_10600 648992 649435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 649644 649480 gene locus_tag LOCUS_10610 649644 649480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 649739 649885 gene locus_tag LOCUS_10620 649739 649885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 650075 650263 gene locus_tag LOCUS_10630 650075 650263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 650510 650665 gene locus_tag LOCUS_10640 650510 650665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 651224 651490 gene locus_tag LOCUS_10650 651224 651490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10650 651497 652231 gene locus_tag LOCUS_10660 651497 652231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 652224 652382 gene locus_tag LOCUS_10670 652224 652382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 652410 652661 gene locus_tag LOCUS_10680 652410 652661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 652668 653528 gene locus_tag LOCUS_10690 652668 653528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 653547 654182 gene locus_tag LOCUS_10700 653547 654182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 654285 654761 gene locus_tag LOCUS_10710 gene mscL 654285 654761 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910203.1 protein_id gnl|my_center|LOCUS_10710 654789 655454 gene locus_tag LOCUS_10720 654789 655454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 655622 655464 gene locus_tag LOCUS_10730 655622 655464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 655740 655582 gene locus_tag LOCUS_10740 655740 655582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 656225 655935 gene locus_tag LOCUS_10750 656225 655935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 656493 656846 gene locus_tag LOCUS_10760 656493 656846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 657321 657497 gene locus_tag LOCUS_10770 657321 657497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 657762 657953 gene locus_tag LOCUS_10780 657762 657953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 658234 658413 gene locus_tag LOCUS_10790 658234 658413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 658426 658560 gene locus_tag LOCUS_10800 658426 658560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 658960 659652 gene locus_tag LOCUS_10810 658960 659652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 659977 660402 gene locus_tag LOCUS_10820 659977 660402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 660590 661060 gene locus_tag LOCUS_10830 660590 661060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 661130 661498 gene locus_tag LOCUS_10840 661130 661498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 661662 662039 gene locus_tag LOCUS_10850 661662 662039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10850 662091 662429 gene locus_tag LOCUS_10860 662091 662429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 662496 663242 gene locus_tag LOCUS_10870 662496 663242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10870 663509 663336 gene locus_tag LOCUS_10880 663509 663336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 663511 663720 gene locus_tag LOCUS_10890 663511 663720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 663892 664086 gene locus_tag LOCUS_10900 663892 664086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 664093 664446 gene locus_tag LOCUS_10910 664093 664446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 664687 664614 gene locus_tag LOCUS_t00290 664687 664614 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 664763 664690 gene locus_tag LOCUS_t00300 664763 664690 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 664895 664820 gene locus_tag LOCUS_t00310 664895 664820 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 664986 665408 gene locus_tag LOCUS_10920 664986 665408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10920 665604 665774 gene locus_tag LOCUS_10930 665604 665774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 666177 666560 gene locus_tag LOCUS_10940 666177 666560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10940 666876 667355 gene locus_tag LOCUS_10950 666876 667355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 667418 667621 gene locus_tag LOCUS_10960 667418 667621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 668597 667920 gene locus_tag LOCUS_10970 668597 667920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10970 669056 668868 gene locus_tag LOCUS_10980 669056 668868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 670067 669114 gene locus_tag LOCUS_10990 670067 669114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10990 671223 670510 gene locus_tag LOCUS_11000 671223 670510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 671707 671489 gene locus_tag LOCUS_11010 671707 671489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11010 671926 671777 gene locus_tag LOCUS_11020 671926 671777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11020 672692 672372 gene locus_tag LOCUS_11030 672692 672372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 673493 672912 gene locus_tag LOCUS_11040 673493 672912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 673719 673964 gene locus_tag LOCUS_11050 673719 673964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 674076 674312 gene locus_tag LOCUS_11060 674076 674312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 674586 674765 gene locus_tag LOCUS_11070 674586 674765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 674765 675331 gene locus_tag LOCUS_11080 674765 675331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11080 675596 675796 gene locus_tag LOCUS_11090 675596 675796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 675789 676550 gene locus_tag LOCUS_11100 675789 676550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901785.1 protein_id gnl|my_center|LOCUS_11100 676694 676984 gene locus_tag LOCUS_11110 676694 676984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 677057 677626 gene locus_tag LOCUS_11120 677057 677626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 678181 677777 gene locus_tag LOCUS_11130 678181 677777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 678352 679371 gene locus_tag LOCUS_11140 678352 679371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 679955 680197 gene locus_tag LOCUS_11150 679955 680197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 680653 680525 gene locus_tag LOCUS_11160 680653 680525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 681316 680858 gene locus_tag LOCUS_11170 681316 680858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11170 682468 682638 gene locus_tag LOCUS_11180 682468 682638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 682693 682893 gene locus_tag LOCUS_11190 682693 682893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 683809 684063 gene locus_tag LOCUS_11200 683809 684063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 684073 684354 gene locus_tag LOCUS_11210 684073 684354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 684436 684666 gene locus_tag LOCUS_11220 684436 684666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 684860 684675 gene locus_tag LOCUS_11230 684860 684675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11230 685193 685035 gene locus_tag LOCUS_11240 685193 685035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 686083 685283 gene locus_tag LOCUS_11250 686083 685283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11250 686371 686165 gene locus_tag LOCUS_11260 686371 686165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11260 686647 686432 gene locus_tag LOCUS_11270 686647 686432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11270 686842 686696 gene locus_tag LOCUS_11280 686842 686696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11280 687361 687131 gene locus_tag LOCUS_11290 687361 687131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11290 687850 687981 gene locus_tag LOCUS_11300 687850 687981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 688015 688311 gene locus_tag LOCUS_11310 688015 688311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 688713 689891 gene locus_tag LOCUS_11320 688713 689891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11320 690123 690860 gene locus_tag LOCUS_11330 690123 690860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11330 690844 692514 gene locus_tag LOCUS_11340 gene nusA 690844 692514 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183189.1 protein_id gnl|my_center|LOCUS_11340 692504 692803 gene locus_tag LOCUS_11350 692504 692803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 692767 693510 gene locus_tag LOCUS_11360 692767 693510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11360 693586 694581 gene locus_tag LOCUS_11370 693586 694581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 694574 694807 gene locus_tag LOCUS_11380 694574 694807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 694908 695180 gene locus_tag LOCUS_11390 694908 695180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 695184 696710 gene locus_tag LOCUS_11400 gene mnmG 695184 696710 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183567.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11400 696732 697163 gene locus_tag LOCUS_11410 696732 697163 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016410.1 protein_id gnl|my_center|LOCUS_11410 697406 697182 gene locus_tag LOCUS_11420 697406 697182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 697960 698145 gene locus_tag LOCUS_11430 697960 698145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11430 698206 698976 gene locus_tag LOCUS_11440 698206 698976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11440 699059 699283 gene locus_tag LOCUS_11450 699059 699283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11450 699471 699274 gene locus_tag LOCUS_11460 699471 699274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 699680 699862 gene locus_tag LOCUS_11470 699680 699862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 699878 700105 gene locus_tag LOCUS_11480 699878 700105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 700142 700297 gene locus_tag LOCUS_11490 700142 700297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 700297 701028 gene locus_tag LOCUS_11500 700297 701028 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880470.1 protein_id gnl|my_center|LOCUS_11500 701031 701729 gene locus_tag LOCUS_11510 701031 701729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 701910 702209 gene locus_tag LOCUS_11520 701910 702209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11520 702181 702339 gene locus_tag LOCUS_11530 702181 702339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 702352 702621 gene locus_tag LOCUS_11540 702352 702621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 702621 703106 gene locus_tag LOCUS_11550 702621 703106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11550 703299 703514 gene locus_tag LOCUS_11560 703299 703514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 703868 704209 gene locus_tag LOCUS_11570 703868 704209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11570 704705 704947 gene locus_tag LOCUS_11580 704705 704947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 705065 705739 gene locus_tag LOCUS_11590 gene infC 705065 705739 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183085.1 protein_id gnl|my_center|LOCUS_11590 705720 705908 gene locus_tag LOCUS_11600 gene rpmI 705720 705908 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874473.1 protein_id gnl|my_center|LOCUS_11600 706471 706611 gene locus_tag LOCUS_11610 706471 706611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11610 706750 707469 gene locus_tag LOCUS_11620 706750 707469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11620 707738 707884 gene locus_tag LOCUS_11630 707738 707884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11630 708176 708721 gene locus_tag LOCUS_11640 708176 708721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11640 708791 709066 gene locus_tag LOCUS_11650 708791 709066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11650 709073 709399 gene locus_tag LOCUS_11660 709073 709399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11660 709400 710149 gene locus_tag LOCUS_11670 709400 710149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11670 710142 710282 gene locus_tag LOCUS_11680 710142 710282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 710346 710579 gene locus_tag LOCUS_11690 710346 710579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11690 710582 710932 gene locus_tag LOCUS_11700 710582 710932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 711271 711648 gene locus_tag LOCUS_11710 711271 711648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 711648 712115 gene locus_tag LOCUS_11720 gene greA 711648 712115 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_11720 712423 713940 gene locus_tag LOCUS_r00020 712423 713940 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 714162 717054 gene locus_tag LOCUS_r00030 714162 717054 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 717208 717281 gene locus_tag LOCUS_t00320 717208 717281 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 717450 717803 gene locus_tag LOCUS_11730 717450 717803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 718095 718364 gene locus_tag LOCUS_11740 718095 718364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11740 718357 719487 gene locus_tag LOCUS_11750 718357 719487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 719489 719764 gene locus_tag LOCUS_11760 719489 719764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 719768 720499 gene locus_tag LOCUS_11770 719768 720499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 720728 721324 gene locus_tag LOCUS_11780 720728 721324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11780 721337 721684 gene locus_tag LOCUS_11790 721337 721684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11790 721703 722515 gene locus_tag LOCUS_11800 721703 722515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11800 722525 723547 gene locus_tag LOCUS_11810 722525 723547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11810 723853 723647 gene locus_tag LOCUS_11820 723853 723647 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183245.1 protein_id gnl|my_center|LOCUS_11820 724406 724257 gene locus_tag LOCUS_11830 724406 724257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 724760 724452 gene locus_tag LOCUS_11840 724760 724452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 725531 724761 gene locus_tag LOCUS_11850 725531 724761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 726566 725802 gene locus_tag LOCUS_11860 726566 725802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11860 726658 727548 gene locus_tag LOCUS_11870 726658 727548 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101673.1 protein_id gnl|my_center|LOCUS_11870 727560 727650 gene locus_tag LOCUS_t00330 727560 727650 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 727877 727656 gene locus_tag LOCUS_11880 727877 727656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11880 728270 727965 gene locus_tag LOCUS_11890 728270 727965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11890