COMMON	DATATYPE		type	WGS
	KEYWORD		keyword	WGS
	KEYWORD		keyword	STANDARD_DRAFT
	DBLINK		project	
			biosample	
	SUBMITTER		ab_name	
			ab_name	
			ab_name	
			contact	
			email	
			phone	
			fax	
			institute	
			country	
			city	
			street	
			zip	
	REFERENCE		title	
			ab_name	
			ab_name	
			ab_name	
			status	Unpublished
			year	
	COMMENT		line	Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp)
	ST_COMMENT		tagset_id	Genome-Assembly-Data
			Assembly Method	
			Genome Coverage	
			Sequencing Technology	
sequence01	source	1..316727	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(676..2391)	product	proline--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693134.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00010
			gene	proS
	CDS	2570..3007	product	rhodanese-like domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693147.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00020
	CDS	3017..3517	product	protein-export chaperone SecB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005630575.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00030
			gene	secB
	CDS	3569..4579	product	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694541.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00040
			gene	gpsA
	CDS	4602..5399	product	serine O-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694542.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00050
			gene	cysE
	CDS	5435..6259	product	shikimate 5-dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694543.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00060
	CDS	complement(6427..7053)	product	LysE/ArgO family amino acid transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010943404.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00070
	CDS	7177..7851	product	ribulose-phosphate 3-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008503032.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00080
			gene	rpe
	CDS	7860..8534	product	phosphoglycolate phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694158.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00090
	CDS	8581..9603	product	tryptophan--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694505.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00100
			gene	trpS
	CDS	complement(9669..10352)	product	2,3-diphosphoglycerate-dependent phosphoglycerate mutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693156.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00110
	CDS	10512..11726	product	murein hydrolase activator EnvC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693155.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00120
			gene	envC
	CDS	11732..12574	product	divergent polysaccharide deacetylase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869050.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00130
	CDS	12596..13102	product	DUF2301 domain-containing membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653606.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00140
	CDS	13148..14512	product	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694502.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00150
			gene	glmU
	CDS	14720..19543	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00160
	CDS	complement(19753..20142)	product	RidA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005630808.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00170
	CDS	complement(20298..20735)	product	FMN-binding protein MioC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694621.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00180
			gene	mioC
	CDS	complement(20752..21678)	product	ADP-glyceromanno-heptose 6-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632797.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00190
			gene	rfaD
	CDS	complement(21792..24383)	product	DNA mismatch repair protein MutS
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_040035576.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00200
			gene	mutS
	CDS	24802..25383	product	TetR/AcrR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693244.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00210
	CDS	25411..26607	product	efflux RND transporter periplasmic adaptor subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_168769341.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00220
	CDS	26623..29712	product	efflux RND transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_168769342.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00230
	CDS	complement(29799..31388)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00240
	CDS	31522..32790	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00250
	CDS	32904..33461	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00260
	tRNA	complement(33931..34006)	product	tRNA-Ala
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00010
	CDS	complement(34057..35496)	product	glutamate--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668173.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00270
			gene	gltX
	tRNA	35665..35740	product	tRNA-Val
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00020
	tRNA	35792..35867	product	tRNA-Val
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00030
	tRNA	35929..36004	product	tRNA-Val
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00040
	CDS	36088..38076	product	alkaline phosphatase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011260991.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00280
	CDS	38077..41526	product	transcription-repair coupling factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694314.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00290
			gene	mfd
	CDS	42134..42718	product	D-sedoheptulose 7-phosphate isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694260.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00300
			gene	lpcA
	CDS	complement(43014..44048)	product	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694133.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00310
			gene	tsaD
	CDS	44322..44537	product	30S ribosomal protein S21
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005627632.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00320
			gene	rpsU
	CDS	44704..46488	product	DNA primase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649498.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00330
			gene	dnaG
	CDS	46570..48438	product	RNA polymerase sigma factor RpoD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005174140.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00340
			gene	rpoD
	tRNA	48580..48655	product	tRNA-Met
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00050
	CDS	48885..49424	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00350
	CDS	49421..49804	product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002209925.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00360
	CDS	49958..50635	product	ComF family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995131.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00370
	CDS	complement(50638..51582)	product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694498.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00380
	CDS	complement(51784..52896)	product	aspartate-semialdehyde dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694497.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00390
			gene	asd
	CDS	complement(53045..53971)	product	permease-like cell division protein FtsX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005660149.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00400
			gene	ftsX
	CDS	complement(53998..54648)	product	cell division ATP-binding protein FtsE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632750.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00410
			gene	ftsE
	CDS	complement(54756..56036)	product	SLC13 family permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000433394.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00420
	CDS	complement(56379..57203)	product	outer membrane protein assembly factor BamD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694110.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00430
	CDS	57302..58276	product	23S rRNA pseudouridine(1911/1915/1917) synthase RluD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694111.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00440
			gene	rluD
	CDS	complement(58347..59021)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00450
	CDS	complement(59111..59647)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00460
	CDS	complement(59811..60068)	product	30S ribosomal protein S17
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625886.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00470
			gene	rpsQ
	CDS	complement(60068..60259)	product	50S ribosomal protein L29
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625888.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00480
			gene	rpmC
	CDS	complement(60259..60669)	product	50S ribosomal protein L16
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648425.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00490
			gene	rplP
	CDS	complement(60683..61390)	product	30S ribosomal protein S3
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693167.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00500
			gene	rpsC
	CDS	complement(61411..61743)	product	50S ribosomal protein L22
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625897.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00510
			gene	rplV
	CDS	complement(61755..62030)	product	30S ribosomal protein S19
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005539416.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00520
			gene	rpsS
	CDS	complement(62055..62876)	product	50S ribosomal protein L2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652371.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00530
			gene	rplB
	CDS	complement(62897..63202)	product	50S ribosomal protein L23
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632756.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00540
			gene	rplW
	CDS	complement(63199..63801)	product	50S ribosomal protein L4
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652369.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00550
			gene	rplD
	CDS	complement(63817..64443)	product	50S ribosomal protein L3
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632753.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00560
			gene	rplC
	CDS	complement(64460..64771)	product	30S ribosomal protein S10
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001181005.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00570
			gene	rpsJ
	CDS	complement(65179..65694)	product	MltR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000818298.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00580
	CDS	complement(65769..66914)	product	mannitol-1-phosphate 5-dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000739122.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00590
	CDS	complement(66967..68841)	product	PTS mannitol transporter subunit IICBA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005480508.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00600
	CDS	complement(69165..69461)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00610
			note	possible pseudo, frameshifted
	tRNA	complement(69708..69803)	product	tRNA-SeC
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00060
	CDS	69901..71283	product	L-seryl-tRNA(Sec) selenium transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694593.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00620
			gene	selA
	CDS	71280..73136	product	selenocysteine-specific translation elongation factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694594.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00630
			gene	selB
	CDS	73319..73918	product	YagU family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001019923.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00640
	CDS	complement(74043..75347)	product	oxaloacetate decarboxylase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015704360.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00650
	CDS	complement(75358..77169)	product	sodium-extruding oxaloacetate decarboxylase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000150450.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00660
			gene	oadA
	CDS	complement(77184..77450)	product	oxaloacetate decarboxylase subunit gamma
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015703617.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00670
	CDS	complement(77572..78414)	product	DUF5718 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_061002828.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00680
	CDS	78758..79012	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00690
	CDS	complement(79057..80070)	product	class II fructose-bisphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694623.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00700
			gene	glpX
	CDS	80230..80448	product	cell division protein ZapB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650820.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00710
			gene	zapB
	CDS	complement(80513..81013)	product	thiol peroxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693150.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00720
			gene	tpx
	CDS	complement(81100..82008)	product	CDF family cation-efflux transporter FieF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011815283.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00730
			gene	fieF
	CDS	complement(82050..83588)	product	threonine ammonia-lyase, biosynthetic
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_111696111.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00740
			gene	ilvA
	CDS	complement(83594..84427)	product	ZIP family manganese transporter TmpA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002904720.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00750
			gene	tmpA
	CDS	complement(84491..86335)	product	dihydroxy-acid dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693142.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00760
			gene	ilvD
	CDS	complement(86503..87957)	product	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649523.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00770
			gene	gnd
	CDS	complement(88014..88343)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00780
	CDS	complement(88352..88483)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00790
	CDS	complement(88492..89511)	product	PDDEXK nuclease domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004329798.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00800
	CDS	complement(89557..90165)	product	glutathione S-transferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010971586.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00810
	CDS	complement(90207..90905)	product	6-phosphogluconolactonase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_132500362.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00820
			gene	pgl
	CDS	complement(90923..92410)	product	glucose-6-phosphate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694154.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00830
			gene	zwf
	CDS	complement(92465..93280)	product	3'(2'),5'-bisphosphate nucleotidase CysQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694155.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00840
			gene	cysQ
	CDS	93436..94188	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011704473.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00850
	CDS	complement(94325..94879)	product	ADP compounds hydrolase NudE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000045740.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00860
			gene	nudE
	CDS	94950..95363	product	ribosome-associated heat shock protein Hsp15
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013099083.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00870
			gene	hslR
	CDS	95422..96294	product	Hsp33 family molecular chaperone HslO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693176.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00880
			gene	hslO
	CDS	96496..98109	product	phosphoenolpyruvate carboxykinase (ATP)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648384.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00890
			gene	pckA
	CDS	98305..98595	product	YfcZ/YiiS family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005636074.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00900
	CDS	98715..99623	product	glycine--tRNA ligase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005628151.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00910
			gene	glyQ
	CDS	99639..100970	product	bifunctional glucose-1-phosphatase/inositol phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015704989.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00920
			gene	agp
	CDS	100982..101248	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693272.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00930
	CDS	101387..102421	product	PDDEXK nuclease domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010946819.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00940
	CDS	102418..103485	product	PDDEXK nuclease domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011022383.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00950
	CDS	103586..103990	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00960
	CDS	104008..104487	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00970
	CDS	104501..106570	product	glycine--tRNA ligase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693270.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00980
			gene	glyS
	CDS	106739..110632	product	phosphoribosylformylglycinamidine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828325.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_00990
			gene	purL
	CDS	complement(110695..111861)	product	Na+/H+ antiporter NhaA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694067.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01000
			gene	nhaA
	CDS	complement(112090..112992)	product	N-acetylmuramic acid 6-phosphate etherase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693153.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01010
			gene	murQ
	CDS	complement(112996..114108)	product	anhydro-N-acetylmuramic acid kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693152.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01020
	CDS	complement(114112..115956)	product	ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686318.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01030
	CDS	complement(116195..116665)	product	recombination regulator RecX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694572.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01040
			gene	recX
	CDS	complement(116761..117834)	product	recombinase RecA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654959.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01050
			gene	recA
	CDS	complement(117936..118532)	product	anthranilate synthase component II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694270.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01060
	CDS	118629..119609	product	aminodeoxychorismate synthase component I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694271.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01070
	CDS	119606..120187	product	aminotransferase class IV family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694272.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01080
	CDS	complement(120162..121010)	product	Dam family site-specific DNA-(adenine-N6)-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996270.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01090
	CDS	complement(121016..122104)	product	3-dehydroquinate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694088.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01100
			gene	aroB
	CDS	complement(122125..122652)	product	shikimate kinase AroK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648746.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01110
			gene	aroK
	CDS	complement(122843..124195)	product	phosphoglycerate transporter PgtP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000955756.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01120
			gene	pgtP
	CDS	124479..125705	product	phosphoglycerate transport regulator PgtC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000467983.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01130
			gene	pgtC
	CDS	125708..127639	product	two-component system sensor histidine kinase PgtB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000678500.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01140
			gene	pgtB
	CDS	127629..128732	product	two-component system response regulator PgtA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000930841.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01150
			gene	pgtA
			note	possible pseudo, internal stop codon, frameshifted
	CDS	complement(129010..130395)	product	hexose-6-phosphate:phosphate antiporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005479317.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01160
			gene	uhpT
	CDS	130666..131211	product	ferredoxin-type protein NapF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005172332.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01170
			gene	napF
	CDS	131211..131474	product	chaperone NapD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694331.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01180
	CDS	131568..134075	product	nitrate reductase catalytic subunit NapA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011705481.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01190
			gene	napA
	CDS	134203..135108	product	ferredoxin-type protein NapG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694328.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01200
			gene	napG
	CDS	135109..136002	product	quinol dehydrogenase ferredoxin subunit NapH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694327.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01210
			gene	napH
	CDS	136160..136585	product	nitrate reductase cytochrome c-type subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649106.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01220
	CDS	136597..137208	product	cytochrome c3 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996144.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01230
	CDS	complement(137293..138213)	product	mechanosensitive ion channel
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011073210.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01240
	CDS	138301..138984	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01250
	CDS	139317..139595	product	cell division protein FtsB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661211.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01260
			gene	ftsB
	CDS	139595..140290	product	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655267.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01270
			gene	ispD
	CDS	140287..140763	product	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005687916.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01280
			gene	ispF
	CDS	complement(140831..142153)	product	HslU--HslV peptidase ATPase subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868991.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01290
			gene	hslU
	CDS	complement(142212..142733)	product	ATP-dependent protease subunit HslV
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008501802.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01300
			gene	hslV
	CDS	complement(142883..144310)	product	aspartate ammonia-lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995201.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01310
			gene	aspA
	CDS	144634..145956	product	anaerobic C4-dicarboxylate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655513.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01320
	CDS	146061..146207	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01330
	CDS	complement(146277..146618)	product	YggL family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694334.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01340
	CDS	complement(146642..147400)	product	tRNA (guanosine(46)-N7)-methyltransferase TrmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694335.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01350
			gene	trmB
	CDS	147491..148612	product	A/G-specific adenine glycosylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693157.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01360
			gene	mutY
	CDS	148605..148877	product	oxidative damage protection protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648477.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01370
	CDS	148890..149966	product	membrane-bound lytic murein transglycosylase MltC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693158.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01380
			gene	mltC
	tRNA	150181..150256	product	tRNA-Phe
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00070
	tRNA	150261..150336	product	tRNA-Asn
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00080
	CDS	complement(150444..150737)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01390
	CDS	complement(150746..151021)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01400
	CDS	151115..152182	product	AI-2E family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000462611.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01410
	CDS	152327..153079	product	DeoR/GlpR family DNA-binding transcription regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661551.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01420
	CDS	153301..155061	product	L-fucose isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869020.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01430
			gene	fucI
	CDS	155149..156606	product	L-fuculokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694547.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01440
			gene	fucK
	CDS	156620..157054	product	L-fucose mutarotase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648572.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01450
			gene	fucU
	CDS	157065..157715	product	L-fuculose-phosphate aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694545.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01460
			gene	fucA
	CDS	157761..159047	product	L-fucose permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694544.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01470
	CDS	159118..160269	product	lactaldehyde reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002288246.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01480
			gene	fucO
	CDS	complement(160347..160754)	product	DUF2251 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005636440.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01490
	CDS	complement(160828..162123)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01500
	CDS	complement(162190..162792)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01510
	CDS	162950..163291	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01520
	CDS	complement(163378..164688)	product	phosphopyruvate hydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648049.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01530
			gene	eno
	CDS	complement(164841..165212)	product	YbaN family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002682353.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01540
	CDS	complement(165234..166892)	product	thiol reductant ABC exporter subunit CydC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667625.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01550
			gene	cydC
	CDS	complement(166885..168654)	product	ABC transporter ATP-binding protein/permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995243.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01560
	CDS	complement(168734..171091)	product	TonB-dependent hemoglobin receptor HmbR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002222141.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01570
			gene	hmbR
	CDS	complement(171286..172917)	product	CTP synthase (glutamine hydrolyzing)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693400.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01580
			gene	pyrG
	CDS	173075..174082	product	tRNA pseudouridine(13) synthase TruD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694586.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01590
			gene	truD
	CDS	complement(174089..175255)	product	XylR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011272388.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01600
	CDS	complement(175355..176482)	product	sugar ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_111696047.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01610
			gene	gguB
	CDS	complement(176486..178000)	product	D-xylose ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693435.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01620
			gene	xylG
	CDS	complement(178082..179080)	product	D-xylose ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693436.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01630
			gene	xylF
	CDS	179329..180642	product	xylose isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651773.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01640
			gene	xylA
	CDS	180702..182150	product	xylulokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050158375.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01650
			gene	xylB
	CDS	complement(182300..184684)	product	maltodextrin phosphorylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000081915.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01660
			gene	malP
	CDS	184856..187519	product	HTH-type transcriptional regulator MalT
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817355.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01670
			gene	malT
	CDS	complement(187678..189732)	product	alpha-amylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817453.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01680
	CDS	complement(189933..190823)	product	maltose ABC transporter permease MalG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817307.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01690
			gene	malG
	CDS	complement(190862..192391)	product	maltose ABC transporter permease MalF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015368773.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01700
			gene	malF
	CDS	complement(192478..193665)	product	maltose/maltodextrin ABC transporter substrate-binding protein MalE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095045.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01710
			gene	malE
	CDS	194004..195146	product	maltose/maltodextrin ABC transporter ATP-binding protein MalK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005165719.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01720
			gene	malK
	CDS	195212..196507	product	maltoporin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002212092.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01730
	CDS	196601..197497	product	maltose operon protein MalM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050078161.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01740
			gene	malM
	CDS	197751..198491	product	5'/3'-nucleotidase SurE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694588.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01750
			gene	surE
	CDS	198699..199274	product	YqaA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694589.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01760
	CDS	199285..199470	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658446.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01770
	CDS	199486..200721	product	murein hydrolase activator NlpD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694590.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01780
			gene	nlpD
	CDS	complement(200996..203674)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01790
	CDS	complement(203746..205227)	product	ketol-acid reductoisomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654301.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01800
			gene	ilvC
	CDS	205366..206247	product	HTH-type transcriptional activator IlvY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694606.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01810
			gene	ilvY
	CDS	206323..207495	product	DNA-processing protein DprA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693325.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01820
			gene	dprA
	CDS	207586..208326	product	pyruvate formate lyase 1-activating protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694108.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01830
			gene	pflA
	CDS	208784..209428	product	3,4-dihydroxy-2-butanone-4-phosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652350.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01840
			gene	ribB
	CDS	complement(209583..210335)	product	M48 family metallopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_037586615.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01850
	CDS	210447..212009	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002858148.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01860
	CDS	212184..212429	product	30S ribosomal protein S16
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653865.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01870
			gene	rpsP
	CDS	212460..212987	product	ribosome maturation factor RimM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653863.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01880
			gene	rimM
	CDS	213028..213774	product	tRNA (guanosine(37)-N1)-methyltransferase TrmD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661387.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01890
			gene	trmD
	CDS	213811..214161	product	50S ribosomal protein L19
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648735.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01900
			gene	rplS
	CDS	214306..215682	product	GntP family permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002681107.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01910
	CDS	complement(215759..216259)	product	ribonuclease E activity regulator RraA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005669389.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01920
			gene	rraA
	CDS	complement(216392..217297)	product	1,4-dihydroxy-2-naphthoate octaprenyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649448.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01930
			gene	menA
	CDS	217378..218088	product	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693665.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01940
			gene	tsaA
	CDS	218150..218764	product	high frequency lysogenization protein HflD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694504.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01950
			gene	hflD
	CDS	218780..220147	product	adenylosuccinate lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869024.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01960
			gene	purB
	CDS	complement(220183..220431)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01970
	CDS	complement(220512..221837)	product	ATP-dependent RNA helicase SrmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693742.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01980
			gene	srmB
	CDS	complement(222121..223785)	product	putative transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693880.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_01990
	CDS	223951..225735	product	ABC transporter ATP-binding protein/permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668011.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02000
	CDS	225864..226142	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02010
	CDS	complement(226297..226554)	product	SemiSWEET family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002680497.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02020
	CDS	226931..229687	product	DNA polymerase I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693204.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02030
			gene	polA
	CDS	complement(229742..231289)	product	exopolyphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_111696218.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02040
			gene	ppx
	CDS	complement(231297..235250)	product	translocation/assembly module TamB domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694581.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02050
	CDS	complement(235260..237170)	product	autotransporter assembly complex family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429522.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02060
	CDS	complement(237275..237901)	product	response regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652269.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02070
	CDS	complement(237994..240510)	product	class I adenylate cyclase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694539.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02080
	CDS	240676..241602	product	hydroxymethylbilane synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001307481.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02090
			gene	hemC
	CDS	241606..242361	product	uroporphyrinogen-III synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011815338.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02100
			gene	hemD
	CDS	242375..243739	product	uroporphyrinogen-III C-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995370.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02110
	CDS	243750..244994	product	heme biosynthesis protein HemY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694537.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02120
	CDS	245261..246610	product	NADP-specific glutamate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005664327.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02130
			gene	gdhA
	CDS	246696..247415	product	tRNA1(Val) (adenine(37)-N6)-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828382.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02140
	CDS	247628..248632	product	ornithine carbamoyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651072.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02150
	CDS	248641..249573	product	carbamate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694569.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02160
			gene	arcC
	CDS	249638..251155	product	YfcC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694568.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02170
	CDS	251326..251793	product	Lrp/AsnC family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004522988.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02180
	CDS	complement(251889..252893)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02190
	CDS	complement(253014..253910)	product	4-hydroxy-tetrahydrodipicolinate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013525505.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02200
			gene	dapA
	CDS	254029..254499	product	thioredoxin-dependent thiol peroxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694049.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02210
			gene	bcp
	CDS	complement(254689..256953)	product	NADP-dependent malic enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694306.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02220
	CDS	257170..257865	product	16S rRNA pseudouridine(516) synthase RsuA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694303.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02230
			gene	rsuA
	CDS	257862..259073	product	Bcr/CflA family multidrug efflux MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694302.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02240
	CDS	complement(259277..260944)	product	PTS transporter subunit IIBC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011922665.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02250
	CDS	complement(260955..261746)	product	endonuclease/exonuclease/phosphatase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011921968.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02260
	CDS	complement(261756..264023)	product	glycogen/starch/alpha-glucan family phosphorylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012774979.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02270
			gene	glgP
	CDS	complement(264010..265533)	product	4-alpha-glucanotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011922661.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02280
			gene	malQ
	CDS	265729..266445	product	UTRA domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004194205.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02290
	CDS	266640..267830	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693372.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02300
	CDS	complement(267956..268450)	product	type 3 dihydrofolate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648125.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02310
			gene	folA
	CDS	complement(268471..268935)	product	threonine/serine exporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005459611.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02320
	CDS	complement(268937..269725)	product	threonine/serine exporter ThrE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005166994.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02330
	CDS	269863..270969	product	glutamate 5-kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693251.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02340
			gene	proB
	CDS	271067..272077	product	biotin synthase BioB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002217196.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02350
			gene	bioB
	CDS	complement(272274..272900)	product	FKBP-type peptidyl-prolyl cis-trans isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_044127011.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02360
	CDS	complement(272921..273805)	product	archaetidylserine decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826367.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02370
			gene	asd
	CDS	273877..275166	product	adenosylmethionine--8-amino-7-oxononanoate transaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693582.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02380
			gene	bioA
	CDS	275156..276322	product	8-amino-7-oxononanoate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693580.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02390
			gene	bioF
	CDS	276319..276987	product	DUF452 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693578.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02400
	CDS	276984..277733	product	malonyl-ACP O-methyltransferase BioC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693577.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02410
			gene	bioC
	CDS	277736..278377	product	dethiobiotin synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429216.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02420
			gene	bioD
	CDS	278462..278986	product	23S rRNA accumulation protein YceD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868949.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02430
			gene	yceD
	CDS	279003..279173	product	50S ribosomal protein L32
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005544470.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02440
			gene	rpmF
	CDS	279195..280226	product	phosphate acyltransferase PlsX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005170740.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02450
			gene	plsX
	CDS	280243..281193	product	ketoacyl-ACP synthase III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691510.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02460
	CDS	281275..282213	product	ACP S-malonyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694437.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02470
			gene	fabD
	CDS	282277..283002	product	3-oxoacyl-ACP reductase FabG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694436.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02480
			gene	fabG
	CDS	283217..283447	product	acyl carrier protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005544465.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02490
			gene	acpP
	CDS	283689..285038	product	anaerobic C4-dicarboxylate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005460955.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02500
	CDS	285160..285723	product	manganese efflux pump MntP family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005814509.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02510
	CDS	complement(285775..286455)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02520
	CDS	286646..289546	product	RNA polymerase-associated protein RapA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005167013.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02530
			gene	rapA
	CDS	289654..290619	product	TAXI family TRAP transporter solute-binding subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005464586.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02540
	CDS	290706..293339	product	TRAP transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_067553987.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02550
	CDS	293397..293822	product	universal stress protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011339636.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02560
	CDS	293896..294555	product	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654471.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02570
			gene	rluA
	CDS	complement(294621..294893)	product	cation transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005662887.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02580
	CDS	complement(295227..296330)	product	transglutaminase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647785.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02590
	CDS	complement(296428..297474)	product	glycosyltransferase family 9 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_115608061.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02600
	CDS	297549..298283	product	3-deoxy-D-manno-octulosonic acid kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694044.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02610
	CDS	complement(298675..310245)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02620
	CDS	complement(310925..311398)	product	pantetheine-phosphate adenylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694492.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02630
			gene	coaD
	CDS	complement(311395..312672)	product	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694491.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02640
			gene	waaA
	CDS	complement(313054..313824)	product	triose-phosphate isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661219.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02650
			gene	tpiA
	CDS	314003..314437	product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655034.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02660
	CDS	complement(314432..314719)	product	DUF167 family protein YggU
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005417561.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02670
			gene	yggU
	CDS	complement(314746..315321)	product	YggT family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651676.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02680
	CDS	complement(315442..316389)	product	magnesium/cobalt transporter CorA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651675.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02690
			gene	corA
sequence02	source	1..272636	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(62..1018)	product	petrobactin ABC transporter permease YclO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003246705.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02700
			gene	yclO
	CDS	complement(1011..1967)	product	petrobactin ABC transporter permease YclN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003234491.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02710
			gene	yclN
	CDS	2154..4115	product	TonB-dependent siderophore receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005482128.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02720
	CDS	4317..4772	product	TonB-system energizer ExbB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648856.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02730
			gene	exbB
	CDS	4782..5168	product	TonB system transport protein ExbD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694050.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02740
			gene	exbD
	CDS	5170..5940	product	energy transducer TonB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686676.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02750
	CDS	complement(6022..6513)	product	rod shape-determining protein MreD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657800.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02760
			gene	mreD
	CDS	complement(6513..7562)	product	rod shape-determining protein MreC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005687477.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02770
			gene	mreC
	CDS	complement(7639..8688)	product	rod shape-determining protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657804.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02780
	CDS	complement(8850..11315)	product	trimethylamine-N-oxide reductase TorA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_109063995.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02790
			gene	torA
	CDS	complement(11326..12426)	product	NapC/NirT family cytochrome c
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_025298411.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02800
	CDS	12663..12881	product	translation initiation factor IF-1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005627617.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02810
			gene	infA
	CDS	complement(12942..13877)	product	tRNA dihydrouridine(16) synthase DusC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694032.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02820
			gene	dusC
	CDS	complement(13877..14761)	product	co-chaperone DjlA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694031.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02830
			gene	djlA
	CDS	complement(14884..15600)	product	purine-nucleoside phosphorylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694122.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02840
			gene	deoD
	CDS	complement(15653..16840)	product	phosphopentomutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002209216.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02850
			gene	deoB
	CDS	complement(16941..18206)	product	NupC/NupG family nucleoside CNT transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649475.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02860
	CDS	18343..18978	product	YitT family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005692076.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02870
	CDS	19034..20287	product	tryptophan permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694021.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02880
			gene	mtr
	CDS	20289..21038	product	class I SAM-dependent methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666039.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02890
	CDS	21343..22242	product	ATP phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656529.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02900
			gene	hisG
	CDS	22502..23782	product	histidinol dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005669329.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02910
			gene	hisD
	CDS	23884..24945	product	histidinol-phosphate transaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005669332.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02920
			gene	hisC
	CDS	25017..25472	product	IS200/IS605 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011120397.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02930
			gene	tnpA
	CDS	25561..26649	product	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693690.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02940
			gene	hisB
	CDS	26752..27285	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02950
	CDS	27297..27890	product	imidazole glycerol phosphate synthase subunit HisH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693689.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02960
			gene	hisH
	CDS	27890..28546	product	MOSC domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003113716.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02970
	CDS	28607..29356	product	1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649383.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02980
			gene	hisA
	CDS	29338..30114	product	imidazole glycerol phosphate synthase subunit HisF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693688.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_02990
			gene	hisF
	CDS	30119..30733	product	DUF2726 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693640.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03000
	CDS	30801..31442	product	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649391.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03010
			gene	hisIE
	CDS	31577..32203	product	uracil phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652947.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03020
			gene	upp
	CDS	32251..33480	product	NCS2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694289.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03030
	CDS	complement(33575..34420)	product	class II glutamine amidotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647819.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03040
	CDS	complement(34544..35920)	product	cysteine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693844.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03050
			gene	cysS
	CDS	36029..36538	product	peptidylprolyl isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693842.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03060
	CDS	36581..37912	product	exodeoxyribonuclease VII large subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693773.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03070
			gene	xseA
	CDS	37914..38597	product	trimeric intracellular cation channel family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694300.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03080
	CDS	complement(38678..39538)	product	RNase adapter RapZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869138.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03090
			gene	rapZ
	CDS	complement(39542..40042)	product	PTS IIA-like nitrogen regulatory protein PtsN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693461.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03100
			gene	ptsN
	CDS	complement(40046..40771)	product	LPS export ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647567.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03110
			gene	lptB
	CDS	complement(40783..41298)	product	lipopolysaccharide transport periplasmic protein LptA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693464.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03120
			gene	lptA
	CDS	complement(41282..41893)	product	LPS export ABC transporter periplasmic protein LptC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647563.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03130
			gene	lptC
	CDS	42065..43204	product	glycerate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649699.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03140
	CDS	complement(43421..44098)	product	HEPN domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_065267398.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03150
	CDS	complement(44138..44410)	product	type II toxin-antitoxin system YafQ family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694595.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03160
	CDS	complement(44414..44683)	product	type II toxin-antitoxin system RelB/DinJ family antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661259.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03170
	CDS	complement(44766..44978)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03180
	CDS	complement(45031..45249)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03190
	CDS	complement(45401..46243)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03200
	CDS	complement(46209..46385)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03210
	CDS	46624..46962	product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011705012.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03220
	CDS	complement(47013..48296)	product	citrate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011072025.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03230
	CDS	48562..49809	product	NADP-dependent isocitrate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002210910.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03240
			gene	icd
	CDS	49819..52425	product	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095602.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03250
			gene	acnB
	CDS	52624..53028	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03260
			note	possible pseudo, frameshifted
	CDS	complement(53395..54246)	product	translation elongation factor Ts
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693261.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03270
			gene	tsf
	CDS	complement(54438..55163)	product	30S ribosomal protein S2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005645552.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03280
			gene	rpsB
	CDS	complement(55416..57293)	product	SurA N-terminal domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_059358191.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03290
	CDS	complement(57380..59803)	product	endopeptidase La
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693703.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03300
			gene	lon
	CDS	complement(60008..61246)	product	ATP-dependent protease ATP-binding subunit ClpX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661954.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03310
			gene	clpX
	CDS	complement(61256..61837)	product	ATP-dependent Clp endopeptidase proteolytic subunit ClpP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694635.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03320
			gene	clpP
	CDS	complement(62179..63474)	product	trigger factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869039.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03330
			gene	tig
	CDS	complement(63646..64503)	product	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654480.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03340
			gene	folD
	tRNA	64672..64748	product	tRNA-Pro
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00090
	tRNA	64800..64876	product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00100
	CDS	complement(65435..66805)	product	tRNA 5-hydroxyuridine modification protein YegQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693745.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03350
			gene	yegQ
	CDS	complement(66947..70033)	product	FAD-binding and (Fe-S)-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694279.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03360
	CDS	70465..71529	product	porin OmpA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996514.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03370
			gene	ompA
	CDS	71768..72349	product	LemA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202196.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03380
	CDS	72451..72891	product	TPM domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011964049.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03390
	CDS	72884..73681	product	TPM domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_123956445.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03400
	CDS	73766..74092	product	Grx4 family monothiol glutaredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653629.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03410
			gene	grxD
	CDS	complement(74199..74702)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03420
	CDS	complement(74702..75661)	product	23S rRNA pseudouridine(955/2504/2580) synthase RluC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693754.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03430
			gene	rluC
	CDS	76093..78891	product	ribonuclease E
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868984.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03440
			gene	rne
	CDS	complement(78990..80267)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03450
	CDS	complement(80375..81487)	product	iron-sulfur cluster carrier protein ApbC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869171.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03460
			gene	apbC
	CDS	81632..83689	product	methionine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694519.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03470
			gene	metG
	CDS	84410..84733	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03480
	CDS	84736..91530	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03490
			note	possible pseudo, frameshifted
	CDS	91693..92520	product	alpha/beta hydrolase-fold protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002263714.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03500
	CDS	92694..92978	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03510
	CDS	93228..93497	product	30S ribosomal protein S15
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652821.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03520
			gene	rpsO
	tRNA	93686..93775	product	tRNA-Ser
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00110
	CDS	complement(93874..94305)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03530
	CDS	94634..94897	product	DUF1778 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_045874275.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03540
	CDS	94897..95364	product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015705365.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03550
	CDS	complement(95548..96513)	product	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694009.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03560
			gene	cmoB
	CDS	complement(96510..98024)	product	sodium/proline symporter PutP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650684.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03570
			gene	putP
	CDS	98172..99650	product	ribonuclease G
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650682.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03580
			gene	rng
	CDS	complement(99700..101019)	product	HlyD family type I secretion periplasmic adaptor subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095714.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03590
	CDS	complement(101081..103255)	product	type I secretion system permease/ATPase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095715.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03600
	CDS	complement(103259..104533)	product	TolC family outer membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011105888.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03610
	CDS	complement(104629..104790)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03620
	CDS	105053..106501	product	metalloprotease TldD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995848.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03630
			gene	tldD
	CDS	106600..107805	product	aspartate aminotransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015369401.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03640
	CDS	complement(107970..108575)	product	chalcone isomerase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656697.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03650
	CDS	complement(108684..110078)	product	class II fumarate hydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650562.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03660
			gene	fumC
	CDS	110197..111264	product	YcjF family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995711.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03670
	CDS	111332..112297	product	sigma-54-dependent transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693758.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03680
	CDS	complement(112353..113726)	product	GTPase HflX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000460360.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03690
			gene	hflX
	CDS	complement(113726..114010)	product	RNA chaperone Hfq
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011262725.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03700
			gene	hfq
	CDS	complement(114093..115043)	product	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693854.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03710
			gene	miaA
	CDS	complement(115047..116924)	product	DNA mismatch repair endonuclease MutL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693855.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03720
			gene	mutL
	CDS	complement(116929..118785)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03730
	CDS	complement(118852..119331)	product	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693857.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03740
			gene	tsaE
	tRNA	complement(119482..119557)	product	tRNA-Gly
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00120
	CDS	complement(119661..120209)	product	oligoribonuclease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694199.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03750
			gene	orn
	CDS	120270..121316	product	small ribosomal subunit biogenesis GTPase RsgA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694198.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03760
			gene	rsgA
	CDS	121630..121887	product	HPr family phosphocarrier protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649965.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03770
	CDS	121996..123723	product	phosphoenolpyruvate-protein phosphotransferase PtsI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649967.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03780
			gene	ptsI
	CDS	123786..124286	product	PTS glucose transporter subunit IIA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654343.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03790
			gene	crr
	CDS	124394..124723	product	YbaB/EbfC family nucleoid-associated protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629464.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03800
	CDS	124782..125384	product	recombination mediator RecR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005626527.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03810
			gene	recR
	CDS	125388..125945	product	molecular chaperone
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693568.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03820
	CDS	complement(126118..128256)	product	YccS family putative transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005665016.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03830
			gene	yccS
	CDS	complement(128439..129104)	product	DUF2057 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654151.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03840
	CDS	129245..129517	product	acylphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000048236.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03850
			gene	yccX
	CDS	complement(129569..129898)	product	TusE/DsrC/DsvC family sulfur relay protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693989.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03860
	CDS	complement(129954..130625)	product	Bax inhibitor-1/YccA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649826.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03870
	tRNA	130818..130907	product	tRNA-Ser
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00130
	CDS	complement(131288..131470)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03880
	CDS	complement(131532..131711)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03890
	CDS	complement(131725..132615)	product	DMT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694611.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03900
	CDS	complement(132747..133286)	product	alpha/beta hydrolase YcfP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000587948.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03910
			gene	ycfP
	CDS	complement(133343..134248)	product	RimK family alpha-L-glutamate ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693559.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03920
	CDS	134375..134638	product	GrxA family glutaredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005628952.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03930
	CDS	134743..135165	product	phosphate-starvation-inducible protein PsiE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004705335.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03940
			gene	psiE
	CDS	complement(135179..136072)	product	site-specific tyrosine recombinase XerD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694355.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03950
			gene	xerD
	CDS	complement(136082..138562)	product	glycerol-3-phosphate 1-O-acyltransferase PlsB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693149.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03960
			gene	plsB
	CDS	complement(138692..140047)	product	lysine-sensitive aspartokinase 3
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095032.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03970
			gene	lysC
	CDS	complement(140179..141477)	product	3-phosphoshikimate 1-carboxyvinyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693605.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03980
			gene	aroA
	CDS	complement(141661..142761)	product	histidinol-phosphate transaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694274.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_03990
			gene	hisC
	CDS	complement(142834..143922)	product	3-phosphoserine/phosphohydroxythreonine transaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694273.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04000
			gene	serC
	CDS	144121..144462	product	DUF496 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653635.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04010
	CDS	complement(144591..145772)	product	Obg family GTPase CgtA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693230.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04020
			gene	cgtA
	CDS	complement(145769..146692)	product	DMT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693231.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04030
	CDS	complement(146816..147073)	product	50S ribosomal protein L27
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005539872.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04040
			gene	rpmA
	CDS	complement(147094..147405)	product	50S ribosomal protein L21
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005626416.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04050
			gene	rplU
	CDS	147621..148610	product	octaprenyl diphosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693233.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04060
			gene	ispB
	CDS	148671..149429	product	epoxyqueuosine reductase QueH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651413.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04070
	CDS	complement(149493..150905)	product	sucrose-specific PTS transporter subunit IIBC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000386199.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04080
	CDS	151348..151590	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04090
	CDS	complement(151634..152116)	product	single-stranded DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694052.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04100
	CDS	152279..155110	product	excinuclease ABC subunit UvrA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694053.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04110
			gene	uvrA
	CDS	155205..156140	product	bifunctional riboflavin kinase/FAD synthetase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828335.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04120
			gene	ribF
	CDS	156166..158967	product	isoleucine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002210509.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04130
			gene	ileS
	CDS	159306..159794	product	signal peptidase II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651632.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04140
			gene	lspA
	CDS	159791..160729	product	4-hydroxy-3-methylbut-2-enyl diphosphate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647895.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04150
			gene	ispH
	CDS	160914..161270	product	helix-hairpin-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015701999.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04160
	CDS	161362..161964	product	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694045.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04170
			gene	rdgB
	CDS	161965..163128	product	radical SAM family heme chaperone HemW
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693701.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04180
			gene	hemW
	CDS	163542..164819	product	HAAAP family serine/threonine permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666700.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04190
	CDS	164873..166249	product	L-serine ammonia-lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693026.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04200
	CDS	166468..167127	product	ribose-5-phosphate isomerase RpiA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693699.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04210
			gene	rpiA
	CDS	167193..168422	product	phosphoglycerate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693698.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04220
			gene	serA
	CDS	168524..169549	product	endolytic transglycosylase MltG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693707.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04230
			gene	mltG
	CDS	169570..170214	product	dTMP kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828392.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04240
			gene	tmk
	CDS	170211..171188	product	DNA polymerase III subunit delta'
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868989.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04250
	CDS	171261..171686	product	nucleoside-diphosphate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_172454026.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04260
			gene	ndk
	CDS	172071..173222	product	methionine adenosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005627231.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04270
			gene	metK
	CDS	173533..174030	product	SprT family zinc-dependent metalloprotease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996506.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04280
	CDS	174102..174701	product	opacity family porin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647500.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04290
	CDS	174837..176717	product	molecular chaperone HtpG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828396.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04300
			gene	htpG
	CDS	176915..177643	product	4'-phosphopantetheinyl transferase superfamily protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694435.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04310
	CDS	177772..178395	product	ADP-ribose diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013526508.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04320
			gene	nudF
	CDS	178543..179373	product	3',5'-cyclic-AMP phosphodiesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693770.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04330
			gene	cpdA
	CDS	179582..180217	product	cytochrome c biogenesis heme-transporting ATPase CcmA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693414.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04340
			gene	ccmA
	CDS	180217..180882	product	heme exporter protein CcmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005637214.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04350
			gene	ccmB
	CDS	180893..181624	product	heme ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693415.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04360
	CDS	181664..181867	product	heme exporter protein CcmD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693416.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04370
			gene	ccmD
	CDS	181864..182385	product	cytochrome c maturation protein CcmE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693417.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04380
			gene	ccmE
	CDS	182382..184328	product	heme lyase CcmF/NrfE family subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693418.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04390
	CDS	184329..184883	product	DsbE family thiol:disulfide interchange protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657352.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04400
	CDS	184880..185362	product	cytochrome c-type biogenesis protein CcmH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686388.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04410
	CDS	185366..186286	product	c-type cytochrome biogenesis protein CcmI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693419.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04420
			gene	ccmI
	CDS	186542..187123	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04430
	CDS	187152..187445	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04440
	CDS	187728..188324	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04450
	CDS	188553..189623	product	dTDP-glucose 4,6-dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011261022.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04460
			gene	rffG
	CDS	complement(189727..190092)	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001201297.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04470
	CDS	190237..190896	product	NAD(P)-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011705819.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04480
	CDS	complement(190973..191494)	product	cation diffusion facilitator family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005075543.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04490
	CDS	191837..192064	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04500
	CDS	complement(192161..192619)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04510
	CDS	192769..193560	product	4,5-DOPA dioxygenase extradiol
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007324092.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04520
			gene	ygiD
	CDS	complement(193455..194003)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04530
	CDS	complement(193927..194385)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04540
	CDS	194465..194704	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04550
	CDS	complement(194768..195376)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04560
	CDS	195423..195770	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04570
	CDS	195767..196018	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04580
	CDS	196119..196727	product	DUF1349 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012775494.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04590
	CDS	complement(196807..197124)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04600
	CDS	197456..197725	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04610
	CDS	197829..198002	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04620
	CDS	198241..198618	product	30S ribosomal protein S6
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005627620.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04630
			gene	rpsF
	CDS	198608..198934	product	primosomal replication protein N
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694144.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04640
			gene	priB
	CDS	198947..199174	product	30S ribosomal protein S18
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005598105.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04650
			gene	rpsR
	CDS	199191..199640	product	50S ribosomal protein L9
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649511.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04660
			gene	rplI
	CDS	complement(199738..200541)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04670
	CDS	complement(200855..201805)	product	cysteine synthase A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693427.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04680
			gene	cysK
	CDS	complement(202156..202722)	product	elongation factor P
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005544066.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04690
			gene	efp
	CDS	202758..203774	product	EF-P beta-lysylation protein EpmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691796.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04700
			gene	epmB
	CDS	203855..205297	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04710
	CDS	205308..205712	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04720
	CDS	complement(205784..206806)	product	porphobilinogen synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011704123.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04730
			gene	hemB
	CDS	complement(207000..207764)	product	twin-arginine translocase subunit TatC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694099.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04740
			gene	tatC
	CDS	complement(207761..208342)	product	Sec-independent protein translocase protein TatB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694100.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04750
			gene	tatB
	CDS	complement(208367..208552)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04760
	CDS	208743..209033	product	co-chaperone GroES
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005687043.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04770
	CDS	209109..210752	product	chaperonin GroEL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649509.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04780
			gene	groL
	CDS	complement(210857..212182)	product	Xaa-Pro aminopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693180.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04790
			gene	pepP
	CDS	complement(212192..212737)	product	UPF0149 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693181.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04800
	CDS	212848..213159	product	cell division protein ZapA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651366.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04810
	CDS	213425..213997	product	5-formyltetrahydrofolate cyclo-ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693206.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04820
	CDS	complement(214047..215234)	product	1-deoxy-D-xylulose-5-phosphate reductoisomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693175.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04830
			gene	ispC
	CDS	complement(215326..215883)	product	ribosome recycling factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632773.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04840
			gene	frr
	CDS	complement(215937..216650)	product	UMP kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693391.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04850
			gene	pyrH
	CDS	216787..218373	product	phosphoethanolamine transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04860
	CDS	218373..219098	product	2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694025.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04870
			gene	menH
	CDS	219188..220045	product	1,4-dihydroxy-2-naphthoyl-CoA synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693314.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04880
			gene	menB
	CDS	220088..220522	product	nucleotidyltransferase substrate binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010948605.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04890
	CDS	220504..220818	product	nucleotidyltransferase domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012258722.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04900
	CDS	220821..221807	product	o-succinylbenzoate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828336.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04910
			gene	menC
	CDS	complement(221869..222171)	product	DNA-binding transcriptional regulator Fis
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651583.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04920
			gene	fis
	CDS	complement(222164..223147)	product	tRNA dihydrouridine synthase DusB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869101.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04930
			gene	dusB
	CDS	complement(223318..224199)	product	50S ribosomal protein L11 methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647969.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04940
			gene	prmA
	CDS	complement(224268..225752)	product	sodium/pantothenate symporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647973.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04950
			gene	panF
	CDS	complement(225749..226042)	product	YhdT family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647974.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04960
	CDS	complement(226119..227462)	product	acetyl-CoA carboxylase biotin carboxylase subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655956.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04970
			gene	accC
	CDS	complement(227533..228006)	product	acetyl-CoA carboxylase biotin carboxyl carrier protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693317.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04980
			gene	accB
	CDS	complement(228173..228622)	product	type II 3-dehydroquinate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655954.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_04990
			gene	aroQ
	CDS	complement(228702..229298)	product	glycerol-3-phosphate 1-O-acyltransferase PlsY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653382.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05000
			gene	plsY
	CDS	229382..229738	product	dihydroneopterin aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656206.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05010
			gene	folB
	CDS	complement(229932..230669)	product	fatty acid metabolism transcriptional regulator FadR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015366064.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05020
			gene	fadR
	CDS	230805..232373	product	Na(+)/H(+) antiporter NhaB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868985.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05030
			gene	nhaB
	CDS	232391..232924	product	disulfide bond formation protein DsbB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693737.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05040
			gene	dsbB
	CDS	complement(233143..234201)	product	AI-2E family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694337.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05050
	CDS	complement(234395..234769)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05060
	CDS	complement(234794..235132)	product	nitrogen regulatory protein P-II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654045.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05070
			gene	glnB
	CDS	complement(235144..235605)	product	DMT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014206287.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05080
	CDS	complement(235618..236211)	product	molybdopterin adenylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647046.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05090
			gene	mog
	CDS	complement(236232..238088)	product	SLC13 family permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002227880.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05100
	CDS	complement(238100..238699)	product	ribonuclease HII
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693388.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05110
			gene	rnhB
	CDS	complement(238701..239876)	product	lipid-A-disaccharide synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869121.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05120
			gene	lpxB
	CDS	complement(239930..240718)	product	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651701.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05130
			gene	lpxA
	CDS	complement(240748..241200)	product	3-hydroxyacyl-ACP dehydratase FabZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_035660215.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05140
			gene	fabZ
	CDS	complement(241407..242504)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05150
	CDS	complement(243139..244284)	product	N-acetylneuraminate epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828455.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05160
	CDS	complement(244405..246252)	product	sialic acid TRAP transporter substrate-binding protein SiaT
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694432.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05170
			gene	siaT
	CDS	complement(246347..247330)	product	sialic acid TRAP transporter substrate-binding protein SiaP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694430.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05180
			gene	siaP
	CDS	247681..248370	product	N-acetylmannosamine-6-phosphate 2-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005687966.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05190
	CDS	248381..249271	product	N-acetylmannosamine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648623.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05200
	CDS	249284..249754	product	N-acetylneuraminate anomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005660595.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05210
			gene	nanQ
	CDS	249801..250664	product	MurR/RpiR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868944.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05220
	CDS	250674..251552	product	N-acetylneuraminate lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694428.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05230
			gene	nanA
	CDS	251632..252438	product	glucosamine-6-phosphate deaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668148.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05240
			gene	nagB
	CDS	252457..253602	product	N-acetylglucosamine-6-phosphate deacetylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694427.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05250
			gene	nagA
	CDS	253865..254446	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05260
	CDS	complement(254450..255295)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05270
	CDS	complement(255308..255787)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05280
	CDS	complement(256353..257360)	product	galactose/methyl galactoside ABC transporter permease MglC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652434.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05290
			gene	mglC
	CDS	complement(257373..258881)	product	galactose/methyl galactoside ABC transporter ATP-binding protein MglA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652432.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05300
			gene	mglA
	CDS	complement(258979..259971)	product	galactose/glucose ABC transporter substrate-binding protein MglB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869062.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05310
			gene	mglB
	CDS	260237..261280	product	galactose-1-phosphate uridylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693184.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05320
			gene	galT
	CDS	261325..262482	product	galactokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869061.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05330
			gene	galK
	CDS	262476..263498	product	galactose-1-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693182.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05340
			gene	galM
	CDS	263643..264554	product	CNNM family magnesium/cobalt transport protein CorC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694364.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05350
			gene	corC
	CDS	264547..266079	product	apolipoprotein N-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694362.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05360
			gene	lnt
	CDS	266259..268031	product	ShlB/FhaC/HecB family hemolysin secretion/activation protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014206788.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05370
sequence03	source	1..205082	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	176..2038	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_075985637.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05380
	CDS	complement(2085..2876)	product	inositol-1-monophosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693284.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05390
			gene	suhB
	CDS	3051..3779	product	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691741.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05400
			gene	trmJ
	CDS	3853..4314	product	Fe-S cluster assembly transcriptional regulator IscR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005659892.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05410
			gene	iscR
	CDS	4324..5538	product	IscS subfamily cysteine desulfurase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868979.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05420
	CDS	5604..5987	product	Fe-S cluster assembly scaffold IscU
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654861.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05430
			gene	iscU
	CDS	5990..6361	product	iron-sulfur cluster assembly protein IscA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000301571.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05440
			gene	iscA
	CDS	6368..6889	product	Fe-S protein assembly co-chaperone HscB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693789.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05450
			gene	hscB
	CDS	7246..7755	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05460
	CDS	7767..9611	product	Fe-S protein assembly chaperone HscA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693792.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05470
			gene	hscA
	CDS	9632..9973	product	ISC system 2Fe-2S type ferredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656373.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05480
			gene	fdx
	CDS	9973..10167	product	Fe-S cluster assembly protein IscX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656371.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05490
			gene	iscX
	CDS	10284..10922	product	uridine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654445.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05500
			gene	udk
	CDS	10932..11516	product	dCTP deaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649599.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05510
			gene	dcd
	CDS	11518..12831	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694421.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05520
	CDS	12831..14018	product	sugar transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694422.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05530
	CDS	complement(14082..14849)	product	DNA-binding transcriptional repressor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015703249.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05540
	CDS	complement(14857..15219)	product	transcriptional regulator GutM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005172508.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05550
			gene	gutM
	CDS	complement(15417..16205)	product	sorbitol-6-phosphate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005162204.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05560
			gene	srlD
	CDS	complement(16236..16604)	product	PTS glucitol/sorbitol transporter subunit IIA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098446.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05570
			gene	srlB
	CDS	complement(16660..17649)	product	PTS glucitol/sorbitol transporter subunit IIB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015703246.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05580
	CDS	complement(17719..18270)	product	PTS glucitol/sorbitol transporter subunit IIC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004391259.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05590
	CDS	complement(18626..19054)	product	ferric iron uptake transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996284.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05600
			gene	fur
	CDS	complement(19065..19589)	product	flavodoxin FldA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648709.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05610
			gene	fldA
	CDS	complement(19599..19880)	product	LexA regulated protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011705430.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05620
			gene	ybfE
	CDS	complement(19998..20783)	product	alpha/beta fold hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653834.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05630
	CDS	20874..21515	product	replication initiation negative regulator SeqA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648714.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05640
			gene	seqA
	CDS	21517..22938	product	o-succinylbenzoate--CoA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694098.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05650
			gene	menE
	CDS	22940..26260	product	mechanosensitive channel MscK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_044509288.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05660
			gene	mscK
	CDS	26270..27352	product	chorismate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694095.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05670
			gene	aroC
	CDS	27374..28219	product	penicillin-insensitive murein endopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694094.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05680
			gene	mepA
	CDS	28234..28998	product	TSUP family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005664344.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05690
	CDS	28998..29951	product	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694093.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05700
			gene	lpxM
	CDS	30025..30567	product	adenine phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650156.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05710
			gene	apt
	CDS	30701..32644	product	DNA polymerase III subunit gamma/tau
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694291.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05720
			gene	dnaX
	CDS	complement(32819..33175)	product	RidA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693637.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05730
	CDS	complement(34413..35612)	product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000526219.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05740
	CDS	complement(35632..36849)	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011017013.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05750
	CDS	complement(36946..37338)	product	type II toxin-antitoxin system VapC family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010970565.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05760
	CDS	complement(37335..37583)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05770
	CDS	complement(37747..46983)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05780
	CDS	complement(47640..49619)	product	exoribonuclease II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694220.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05790
			gene	rnb
	CDS	complement(49728..50390)	product	Fic family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011861855.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05800
	CDS	complement(50613..51401)	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649928.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05810
	CDS	complement(51476..52090)	product	histidine phosphatase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005769904.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05820
	CDS	complement(52094..52864)	product	Nif3-like dinuclear metal center hexameric protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649665.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05830
	CDS	complement(53120..54880)	product	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650259.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05840
	CDS	complement(54947..55639)	product	class I SAM-dependent methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015704466.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05850
	CDS	55661..56362	product	hydroxyacylglutathione hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694517.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05860
			gene	gloB
	CDS	complement(56364..57179)	product	DNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010951387.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05870
	CDS	complement(57478..58167)	product	formate dehydrogenase subunit gamma
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663315.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05880
	CDS	complement(58170..59111)	product	formate dehydrogenase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693893.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05890
			gene	fdxH
	CDS	complement(59111..62176)	product	formate dehydrogenase-N subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010904702.1
			transl_table	11
			codon_start	1
			transl_except	(pos:61589..61591,aa:Sec)
			note	codon on position 196 is selenocysteine opal codon.
			locus_tag	LOCUS_05900
			gene	fdnG
	CDS	62592..63392	product	formate dehydrogenase accessory sulfurtransferase FdhD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649892.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05910
			gene	fdhD
	CDS	complement(63471..64517)	product	ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000636730.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05920
	CDS	64702..66882	product	DNA helicase II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647471.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05930
			gene	uvrD
	CDS	66879..67751	product	EamA family transporter RarD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655039.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05940
			gene	rarD
	CDS	complement(67968..68291)	product	thioredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693835.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05950
			gene	trxA
	CDS	complement(68439..69548)	product	methionine biosynthesis PLP-dependent protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661154.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05960
	tRNA	69794..69869	product	tRNA-Gly
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00140
	tRNA	69892..69978	product	tRNA-Leu
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00150
	tRNA	70050..70123	product	tRNA-Cys
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00160
	CDS	complement(70376..71023)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05970
	CDS	71425..71802	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05980
	CDS	complement(71816..72262)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_05990
	CDS	complement(72264..73298)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06000
	CDS	73409..73762	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06010
	CDS	complement(73957..74874)	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000908873.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06020
	CDS	75138..79148	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06030
	CDS	79212..80096	product	outer membrane protein assembly factor BamE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004184872.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06040
			gene	bamE
	CDS	80494..81627	product	IS1595 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013529345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06050
	CDS	complement(82127..82444)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06060
	CDS	82687..82992	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06070
	CDS	complement(83634..84521)	product	protease modulator HflC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005660876.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06080
			gene	hflC
	CDS	complement(84521..85726)	product	FtsH protease activity modulator HflK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668135.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06090
			gene	hflK
	CDS	85855..86652	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694301.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06100
	CDS	86834..86965	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06110
	CDS	87187..88980	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06120
	CDS	88987..89229	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06130
	CDS	89226..89699	product	DUF3990 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005803082.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06140
	CDS	89696..89905	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06150
	CDS	89898..92150	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06160
	CDS	complement(92240..93199)	product	protein translocase subunit SecF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686665.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06170
			gene	secF
	CDS	complement(93215..95065)	product	protein translocase subunit SecD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694058.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06180
			gene	secD
	CDS	complement(95085..95384)	product	preprotein translocase subunit YajC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648822.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06190
			gene	yajC
	CDS	complement(95449..95679)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06200
	CDS	complement(95679..96143)	product	hemerythrin domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648824.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06210
	CDS	complement(96258..97418)	product	tRNA guanosine(34) transglycosylase Tgt
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005645731.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06220
			gene	tgt
	CDS	complement(97558..98637)	product	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694057.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06230
			gene	queA
	CDS	98753..99208	product	DNA polymerase III subunit chi
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693964.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06240
	CDS	99277..100035	product	Fic family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005814967.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06250
	CDS	100022..100195	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06260
	CDS	100182..100781	product	zeta toxin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_142413611.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06270
	CDS	100997..101467	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06280
	CDS	101521..104385	product	valine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693970.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06290
			gene	valS
	CDS	complement(104454..106508)	product	excinuclease ABC subunit UvrB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694308.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06300
			gene	uvrB
	tRNA	106904..106979	product	tRNA-Asn
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00170
	CDS	107145..108107	product	calcium/sodium antiporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011705183.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06310
	CDS	complement(108160..109179)	product	zinc transporter permease subunit ZevB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694309.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06320
			gene	zevB
	CDS	complement(109185..109808)	product	zinc transporter binding subunit ZevA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694310.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06330
			gene	zevA
	tRNA	complement(110155..110240)	product	tRNA-Leu
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00180
	CDS	complement(110266..110604)	product	preprotein translocase subunit SecG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693717.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06340
			gene	secG
	CDS	complement(110690..112651)	product	DNA topoisomerase III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693718.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06350
	CDS	complement(112732..114672)	product	LTA synthase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_065250839.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06360
	CDS	complement(114759..115289)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06370
	CDS	complement(115504..115809)	product	trp operon repressor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629736.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06380
			gene	trpR
	CDS	complement(115843..117873)	product	transglycosylase SLT domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648342.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06390
	CDS	117993..118865	product	VirK/YbjX family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693704.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06400
	CDS	118874..119536	product	(d)CMP kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_042611231.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06410
			gene	cmk
	CDS	119644..121296	product	30S ribosomal protein S1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650125.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06420
			gene	rpsA
	CDS	121481..121765	product	integration host factor subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694284.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06430
	CDS	121872..122165	product	LapA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650128.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06440
	CDS	122168..123361	product	lipopolysaccharide assembly protein LapB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694286.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06450
			gene	lapB
	CDS	123374..124072	product	orotidine-5'-phosphate decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667227.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06460
			gene	pyrF
	CDS	124144..124458	product	stress response translation initiation inhibitor YciH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663537.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06470
			gene	yciH
	CDS	complement(124538..125005)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06480
	CDS	complement(125185..125649)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06490
	CDS	complement(125693..125959)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06500
	CDS	complement(126018..127121)	product	Fic family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008759897.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06510
	CDS	127651..128775	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06520
	CDS	complement(128850..132539)	product	methionine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005453805.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06530
			gene	metH
	CDS	132807..133370	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06540
	CDS	133536..133910	product	type II toxin-antitoxin system RelE/ParE family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225795.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06550
	CDS	133927..134238	product	DNA-binding transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010969960.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06560
	CDS	complement(134303..135493)	product	cystathionine beta-lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694414.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06570
			gene	metC
	CDS	135649..136251	product	peroxiredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095829.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06580
	CDS	complement(136332..136964)	product	thiamine ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647864.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06590
			gene	thiQ
	CDS	complement(136957..138567)	product	thiamine/thiamine pyrophosphate ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693357.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06600
			gene	thiP
	CDS	complement(138568..139563)	product	thiamine ABC transporter substrate binding subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693356.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06610
			gene	thiB
	CDS	139490..139741	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06620
	CDS	139820..140437	product	DUF1919 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694305.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06630
	CDS	140551..141504	product	acetyl-CoA carboxylase carboxyl transferase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693763.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06640
			gene	accA
	CDS	141588..142448	product	pyridoxal kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005630043.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06650
			gene	pdxY
	CDS	142460..143749	product	tRNA lysidine(34) synthetase TilS
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693764.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06660
			gene	tilS
	CDS	complement(143867..146107)	product	DNA topoisomerase IV subunit A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693555.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06670
			gene	parC
	CDS	complement(146444..147550)	product	copper-containing nitrite reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225006.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06680
			gene	nirK
	CDS	complement(147552..149486)	product	DNA topoisomerase IV subunit B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693553.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06690
			gene	parE
	CDS	complement(149585..151255)	product	energy-dependent translational throttle protein EttA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650218.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06700
			gene	ettA
	CDS	complement(151673..153079)	product	DegQ family serine endoprotease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694316.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06710
	CDS	complement(153245..153655)	product	YhcB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653154.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06720
	CDS	complement(153834..155369)	product	L-2,4-diaminobutyrate decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693296.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06730
			gene	ddc
	CDS	complement(155512..156876)	product	diaminobutyrate--2-oxoglutarate transaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693298.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06740
	CDS	157377..157805	product	50S ribosomal protein L13
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650450.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06750
			gene	rplM
	CDS	157821..158216	product	30S ribosomal protein S9
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005631594.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06760
			gene	rpsI
	CDS	158432..159070	product	stringent starvation protein SspA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650452.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06770
			gene	sspA
	CDS	159070..159528	product	ClpXP protease specificity-enhancing factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650453.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06780
	CDS	159713..160186	product	6,7-dimethyl-8-ribityllumazine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694466.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06790
			gene	ribE
	CDS	160186..160614	product	transcription antitermination factor NusB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06800
			gene	nusB
	CDS	160678..161163	product	phosphatidylglycerophosphatase A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694464.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06810
	CDS	161160..161786	product	LysE family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650349.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06820
	CDS	161807..162619	product	4-hydroxy-tetrahydrodipicolinate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694461.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06830
			gene	dapB
	CDS	162807..164264	product	anion permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_157776019.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06840
	CDS	complement(164266..164523)	product	class I ribonucleotide reductase maintenance protein YfaE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650353.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06850
			gene	yfaE
	CDS	complement(164593..165723)	product	ribonucleotide-diphosphate reductase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650087.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06860
			gene	nrdB
	CDS	complement(165858..167138)	product	glutamate-1-semialdehyde 2,1-aminomutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095641.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06870
			gene	hemL
	CDS	167268..168344	product	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694200.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06880
			gene	wecA
	CDS	complement(168399..169337)	product	bile acid:sodium symporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014207989.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06890
	CDS	complement(169478..170032)	product	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694415.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06900
			gene	pgsA
	CDS	complement(170156..171187)	product	branched-chain-amino-acid transaminase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694252.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06910
			gene	ilvE
	CDS	171621..172508	product	transcriptional regulator GcvA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667412.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06920
	CDS	172505..173596	product	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869151.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06930
			gene	rlmM
	CDS	complement(173805..175019)	product	capsule biosynthesis protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002223278.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06940
	CDS	complement(175029..176996)	product	capsular polysaccharide biosynthesis protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002224756.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06950
	CDS	complement(177069..177707)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06960
	CDS	complement(177713..179047)	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013228075.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06970
	CDS	complement(179253..180038)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06980
			note	possible pseudo, frameshifted
	CDS	complement(180077..180400)	product	IS3 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003112569.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_06990
	CDS	complement(180671..181396)	product	CatB-related O-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014205889.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07000
	CDS	complement(181487..184105)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07010
	CDS	complement(184116..187808)	product	CDP-glycerol glycerophosphotransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000694256.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07020
	CDS	complement(187819..188937)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07030
	CDS	complement(189663..189959)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07040
	CDS	190302..191474	product	capsule polysaccharide export outer membrane protein CtrA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002215290.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07050
			gene	ctrA
	CDS	191484..192608	product	capsule polysaccharide export protein CtrB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002215287.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07060
			gene	ctrB
	CDS	192608..193405	product	ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002215286.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07070
	CDS	193402..194052	product	ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002224750.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07080
	CDS	complement(194230..195174)	product	50S ribosomal protein L3 N(5)-glutamine methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694243.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07090
			gene	prmB
	CDS	195240..195746	product	endonuclease SmrB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667389.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07100
			gene	smrB
	CDS	complement(195811..196746)	product	lipid A biosynthesis lauroyl acyltransferase HtrB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693550.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07110
			gene	htrB
	CDS	196862..198289	product	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693548.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07120
			gene	hldE
	CDS	complement(198345..199709)	product	sodium-dependent transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694179.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07130
	CDS	199857..202556	product	copper-exporting P-type ATPase CopA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011816861.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07140
			gene	copA
	CDS	202656..204599	product	ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694468.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07150
	tRNA	204752..204828	product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00190
	tRNA	204856..204931	product	tRNA-His
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00200
	tRNA	204937..205013	product	tRNA-Pro
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00210
sequence04	source	1..188456	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(204..4853)	product	YadA-like family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_133116924.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07160
	CDS	5258..5605	product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002669261.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07170
	CDS	complement(6244..6426)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07180
	CDS	complement(6686..6994)	product	type II toxin-antitoxin system antitoxin HigA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010920873.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07190
			gene	higA
	CDS	complement(7567..7989)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07200
	CDS	complement(7989..8267)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07210
	CDS	complement(8285..8737)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07220
	CDS	9010..9900	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07230
	CDS	10252..11055	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07240
	CDS	11065..12180	product	hydrogenase formation protein HypD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817174.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07250
			gene	hypD
	CDS	12182..13195	product	hydrogenase expression/formation protein HypE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_077175158.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07260
			gene	hypE
	CDS	complement(13280..15601)	product	carbamoyltransferase HypF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817173.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07270
			gene	hypF
	CDS	15870..17009	product	hydrogenase 2 small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011706350.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07280
			gene	hybO
	CDS	17014..18051	product	hydrogenase 2 operon protein HybA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001081870.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07290
			gene	hybA
	CDS	18044..19225	product	Ni/Fe-hydrogenase cytochrome b subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011706348.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07300
			gene	hybB
	CDS	19222..20931	product	hydrogenase 2 large subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011706347.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07310
			gene	hybC
	CDS	20931..21428	product	HyaD/HybD family hydrogenase maturation endopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005173947.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07320
	CDS	21421..21927	product	hydrogenase-2 assembly chaperone
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000004951.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07330
			gene	hybE
	CDS	21959..22246	product	hydrogenase maturation factor HybG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693971.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07340
			gene	hybG
	CDS	complement(22230..22643)	product	Cd(II)/Pb(II)-responsive transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005633867.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07350
	CDS	22751..23440	product	DUF4198 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005689200.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07360
	CDS	23461..23913	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07370
	CDS	23926..24552	product	cobalt transporter CbiM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693633.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07380
			gene	cbiM
	CDS	24549..25172	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07390
	CDS	25169..25807	product	energy-coupling factor ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_139989290.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07400
	CDS	complement(25785..26126)	product	hydrogenase maturation nickel metallochaperone HypA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000544952.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07410
			gene	hypA
	CDS	complement(26235..28166)	product	threonine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693993.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07420
			gene	thrS
	CDS	complement(28719..31181)	product	glycogen/starch/alpha-glucan phosphorylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693999.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07430
	CDS	complement(31435..32877)	product	glycogen synthase GlgA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429230.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07440
			gene	glgA
	CDS	complement(33020..34330)	product	glucose-1-phosphate adenylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005706553.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07450
			gene	glgC
	CDS	complement(34348..36351)	product	glycogen debranching protein GlgX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694002.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07460
			gene	glgX
	CDS	complement(36535..38946)	product	1,4-alpha-glucan branching protein GlgB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694003.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07470
			gene	glgB
	CDS	complement(38959..41061)	product	4-alpha-glucanotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_180978722.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07480
			gene	malQ
	CDS	41352..42221	product	fructosamine kinase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000267456.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07490
	CDS	complement(42516..43364)	product	outer membrane protein assembly factor BamE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004184872.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07500
			gene	bamE
	CDS	complement(43550..44611)	product	protease SohB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694402.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07510
			gene	sohB
	CDS	44782..46326	product	anthranilate synthase component I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693976.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07520
			gene	trpE
	CDS	46336..46914	product	aminodeoxychorismate/anthranilate synthase component II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693974.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07530
	CDS	47037..48038	product	anthranilate phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693973.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07540
			gene	trpD
	CDS	48058..49491	product	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650575.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07550
			gene	trpCF
	CDS	49727..50923	product	tryptophan synthase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693932.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07560
			gene	trpB
	CDS	50923..51729	product	tryptophan synthase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693930.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07570
			gene	trpA
	CDS	complement(51961..52254)	product	BrnA antitoxin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225230.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07580
	CDS	complement(52238..52507)	product	BrnT family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002213585.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07590
	CDS	52681..55596	product	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693853.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07600
			gene	glnE
	CDS	56015..57283	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07610
	CDS	57285..58478	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07620
	CDS	58690..59730	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07630
	CDS	59732..60235	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07640
	CDS	complement(60263..60760)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07650
	CDS	61032..61259	product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011074342.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07660
	CDS	complement(61402..62250)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07670
	CDS	complement(62447..63736)	product	serine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693809.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07680
			gene	serS
	CDS	complement(63827..65170)	product	replication-associated recombination protein A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_111696686.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07690
	CDS	complement(65239..65868)	product	outer membrane lipoprotein chaperone LolA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693608.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07700
			gene	lolA
	CDS	complement(65880..68600)	product	DNA translocase FtsK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011072306.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07710
	CDS	complement(68613..69104)	product	leucine-responsive transcriptional regulator Lrp
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005664572.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07720
			gene	lrp
	CDS	complement(69221..70600)	product	DNA repair protein RadA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693612.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07730
			gene	radA
	CDS	complement(70602..71645)	product	inorganic triphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_044509535.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07740
	CDS	71858..72538	product	TIGR00153 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647270.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07750
	CDS	72564..73826	product	inorganic phosphate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996436.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07760
	CDS	73891..74499	product	TIGR04211 family SH3 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668333.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07770
	CDS	74516..75751	product	multifunctional CCA addition/repair protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693619.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07780
	CDS	75900..77678	product	ShlB/FhaC/HecB family hemolysin secretion/activation protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014206788.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07790
	CDS	77733..86447	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07800
	CDS	86447..86833	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07810
	CDS	86854..87621	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07820
	CDS	87621..87905	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07830
	CDS	87923..88162	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07840
	CDS	88236..88862	product	lipoprotein insertase outer membrane protein LolB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693620.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07850
			gene	lolB
	CDS	88862..89767	product	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869257.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07860
			gene	ispE
	CDS	89793..90740	product	ribose-phosphate pyrophosphokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647284.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07870
	CDS	90901..93546	product	DNA topoisomerase (ATP-hydrolyzing) subunit A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694321.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07880
			gene	gyrA
	CDS	complement(93605..95014)	product	YcjX family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693645.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07890
	CDS	95081..96763	product	ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693646.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07900
	CDS	96763..97728	product	ABC transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693647.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07910
	CDS	97718..98605	product	ABC transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693648.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07920
	CDS	98614..99657	product	ATP-binding cassette domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693649.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07930
	CDS	99660..100466	product	ATP-binding cassette domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005670537.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07940
	CDS	complement(100598..101722)	product	bifunctional chorismate mutase/prephenate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650298.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07950
			gene	tyrA
	CDS	complement(101933..102985)	product	3-deoxy-7-phosphoheptulonate synthase AroF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098343.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07960
			gene	aroF
	CDS	complement(103126..104988)	product	signal peptide peptidase SppA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693566.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07970
			gene	sppA
	CDS	105398..105898	product	5-(carboxyamino)imidazole ribonucleotide mutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693627.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07980
			gene	purE
	CDS	105945..107024	product	5-(carboxyamino)imidazole ribonucleotide synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693629.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_07990
			gene	purK
	CDS	107158..108348	product	aspartate/tyrosine/aromatic aminotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693630.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08000
	CDS	complement(108392..109765)	product	quorum sensing histidine kinase QseC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694197.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08010
			gene	qseC
	CDS	complement(109749..110432)	product	two-component system response regulator QseB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649974.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08020
	CDS	complement(110727..111284)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08030
	CDS	complement(111445..111900)	product	molybdopterin synthase catalytic subunit MoaE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694395.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08040
			gene	moaE
	CDS	complement(111902..112147)	product	molybdopterin synthase sulfur carrier subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654167.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08050
			gene	moaD
	CDS	complement(112151..112630)	product	cyclic pyranopterin monophosphate synthase MoaC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000080921.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08060
			gene	moaC
	CDS	complement(112657..113667)	product	GTP 3',8-cyclase MoaA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694398.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08070
			gene	moaA
	CDS	113951..114874	product	uridine diphosphate-N-acetylglucosamine-binding protein YvcK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015704803.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08080
			gene	yvcK
	CDS	complement(114986..115204)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08090
	CDS	115583..116518	product	KpsF/GutQ family sugar isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012054716.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08100
	CDS	116527..117069	product	HAD family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005665007.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08110
	CDS	complement(117139..118131)	product	catabolite repressor/activator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000762401.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08120
			gene	cra
	CDS	118446..120716	product	ribonucleoside-diphosphate reductase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694386.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08130
			gene	nrdA
	CDS	complement(120795..122138)	product	PTS sugar transporter subunit IIC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_060779496.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08140
	CDS	complement(122141..123469)	product	alpha-L-fucosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004083032.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08150
	CDS	complement(123729..125636)	product	ATP-dependent zinc metalloprotease FtsH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869183.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08160
			gene	ftsH
	CDS	complement(125759..126385)	product	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694443.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08170
			gene	rlmE
	CDS	complement(126463..127047)	product	SIS domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694384.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08180
	CDS	complement(127050..127427)	product	YraN family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694382.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08190
	CDS	complement(127427..129151)	product	penicillin-binding protein activator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694381.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08200
	CDS	129235..130080	product	16S rRNA (cytidine(1402)-2'-O)-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694380.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08210
			gene	rsmI
	CDS	complement(130138..130917)	product	transporter substrate-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004195836.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08220
	CDS	complement(130992..132083)	product	lytic murein transglycosylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050298239.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08230
	CDS	complement(132100..132909)	product	lipooligosaccharide biosynthesis galactosyltransferase LsgF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995797.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08240
			gene	lsgF
	CDS	complement(132910..133791)	product	lipooligosaccharide biosynthesis N-acetyl-glucosamine transferase LsgE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694185.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08250
			gene	lsgE
	CDS	complement(133791..134969)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08260
	CDS	complement(134969..135730)	product	lipooligosaccharide biosynthesis galactosyltransferase LsgD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694186.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08270
			gene	lsgD
	CDS	complement(135727..136926)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08280
	CDS	complement(136916..137890)	product	polysaccharide pyruvyl transferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015706046.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08290
	CDS	138045..138791	product	YdcF family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694191.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08300
	CDS	complement(138861..140297)	product	serine-type D-Ala-D-Ala carboxypeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694445.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08310
			gene	dacB
	CDS	140467..140943	product	transcription elongation factor GreA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694444.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08320
			gene	greA
	tmRNA	141035..141401	product	transfer-messenger RNA
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_tm00010
	CDS	141897..142142	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08330
	CDS	complement(142206..144860)	product	phosphoenolpyruvate carboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693644.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08340
			gene	ppc
	CDS	145264..146091	product	dihydropteroate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694653.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08350
			gene	folP
	CDS	146156..147490	product	phosphoglucosamine mutase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694655.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08360
			gene	glmM
	tRNA	147604..147680	product	tRNA-Val
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00220
	CDS	147976..148119	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08370
	CDS	complement(148329..149594)	product	serine hydroxymethyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693240.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08380
	CDS	complement(149724..151013)	product	phosphoribosylamine--glycine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693239.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08390
			gene	purD
	CDS	complement(151530..153128)	product	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693238.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08400
			gene	purH
	CDS	complement(153265..154155)	product	Dyp-type peroxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011815851.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08410
	CDS	complement(154165..155910)	product	protein-disulfide reductase DsbD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693234.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08420
	CDS	complement(155934..156095)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08430
	CDS	156172..157176	product	ornithine carbamoyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651072.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08440
	CDS	complement(157306..157956)	product	GTP cyclohydrolase II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629111.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08450
			gene	ribA
	CDS	158048..158773	product	phosphatase PAP2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694086.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08460
	CDS	158827..159744	product	N-acetylglucosamine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694104.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08470
			gene	nagK
	CDS	complement(159812..160552)	product	MIP/aquaporin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004081684.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08480
	CDS	160918..162429	product	glycerol kinase GlpK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655029.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08490
			gene	glpK
	CDS	complement(162984..163205)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08500
	CDS	complement(163561..166113)	product	translation initiation factor IF-2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650282.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08510
			gene	infB
	CDS	complement(166126..167661)	product	transcription termination factor NusA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691699.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08520
			gene	nusA
	CDS	complement(167689..168144)	product	ribosome maturation factor RimP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657488.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08530
			gene	rimP
	tRNA	complement(168287..168363)	product	tRNA-Met
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00230
	CDS	complement(168457..168585)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08540
	CDS	complement(168582..169319)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005662421.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08550
	CDS	complement(169385..170821)	product	sodium:alanine symporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648689.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08560
	CDS	complement(171000..171710)	product	dethiobiotin synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693920.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08570
			gene	bioD
	CDS	complement(171810..173126)	product	glutamyl-tRNA reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005169107.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08580
			gene	hemA
	CDS	complement(173215..174771)	product	peptide ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694085.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08590
	CDS	complement(174857..175318)	product	glycine zipper 2TM domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996417.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08600
	CDS	complement(175355..175969)	product	VOC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013096073.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08610
	CDS	176184..177911	product	arginine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693602.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08620
			gene	argS
	CDS	complement(178232..179455)	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011458936.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08630
	CDS	179781..181088	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08640
	CDS	complement(181116..181448)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08650
	CDS	complement(181570..182001)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08660
	CDS	complement(182012..182245)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08670
	CDS	182399..183583	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08680
	CDS	183796..185700	product	molecular chaperone DnaK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000516135.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08690
			gene	dnaK
	CDS	185772..186899	product	molecular chaperone DnaJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828442.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08700
			gene	dnaJ
	CDS	complement(187262..187678)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08710
	misc_feature	complement(187915..>188456)	inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_000018529.1:SPI-7-type island replicative DNA helicase
			locus_tag	LOCUS_08720
sequence05	source	1..182117	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(68..2725)	product	pyruvate dehydrogenase (acetyl-transferring), homodimeric type
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694293.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08730
			gene	aceE
	CDS	3152..3688	product	hypoxanthine phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693468.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08740
			gene	hpt
	CDS	3947..4936	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08750
	CDS	4938..5537	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08760
	CDS	5628..6755	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08770
	CDS	6742..7848	product	glycosyltransferase family 4 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000692504.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08780
	CDS	7850..8698	product	glycosyltransferase family 2 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011476095.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08790
	CDS	8711..9691	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002383750.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08800
	CDS	10047..10745	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08810
	CDS	10764..11465	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000612460.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08820
	CDS	11496..12956	product	flippase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_128519551.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08830
	CDS	13026..13667	product	CatB-related O-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000146565.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08840
	CDS	13687..14997	product	undecaprenyl-phosphate galactose phosphotransferase WbaP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995534.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08850
			gene	wbaP
	CDS	15013..16746	product	DUF262 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012257894.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08860
	CDS	16814..17881	product	dTDP-glucose 4,6-dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011261022.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08870
			gene	rffG
	CDS	17888..18901	product	PDDEXK nuclease domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011022383.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08880
	CDS	18912..19790	product	glucose-1-phosphate thymidylyltransferase RfbA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002224747.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08890
			gene	rfbA
	CDS	19790..20668	product	dTDP-4-dehydrorhamnose reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010980837.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08900
			gene	rfbD
	CDS	20665..21207	product	dTDP-4-dehydrorhamnose 3,5-epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_036472525.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08910
			gene	rfbC
	CDS	21547..21825	product	type II toxin-antitoxin system RelE/ParE family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005737444.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08920
	CDS	21834..22106	product	HigA family addiction module antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011103139.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08930
	CDS	22277..23590	product	aminopeptidase PepB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002209829.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08940
			gene	pepB
	CDS	23762..24970	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011108877.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08950
	CDS	complement(25121..26635)	product	ribosome biogenesis GTPase Der
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694423.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08960
			gene	der
	CDS	complement(26800..27861)	product	YedE family putative selenium transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545330.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08970
			gene	yedE
	tRNA	complement(28069..28145)	product	tRNA-Asp
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00240
	tRNA	complement(28184..28260)	product	tRNA-Asp
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00250
	CDS	complement(28337..29131)	product	DNA polymerase III subunit epsilon
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996329.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08980
			gene	dnaQ
	CDS	29190..29654	product	ribonuclease HI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005687959.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_08990
			gene	rnhA
	CDS	complement(29716..30291)	product	nucleotide exchange factor GrpE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_146104764.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09000
			gene	grpE
	CDS	30417..31328	product	NAD(+) kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995695.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09010
	CDS	31407..33083	product	DNA repair protein RecN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693852.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09020
			gene	recN
	CDS	complement(33231..33860)	product	outer membrane protein OmpW
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005460838.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09030
			gene	ompW
	CDS	34135..34857	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648352.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09040
	CDS	34854..35390	product	septation protein A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655641.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09050
	CDS	35394..35834	product	acyl-CoA thioester hydrolase YciA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655643.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09060
			gene	yciA
	CDS	35872..36156	product	YciI family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648344.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09070
	CDS	36342..37055	product	two-component system response regulator ArcA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001194358.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09080
			gene	arcA
	CDS	37092..37574	product	SsrA-binding protein SmpB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647965.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09090
			gene	smpB
	CDS	37715..38347	product	transcriptional repressor LexA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648504.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09100
			gene	lexA
	CDS	complement(38405..40417)	product	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000683534.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09110
			gene	mnmC
	CDS	40588..41808	product	beta-ketoacyl-ACP synthase I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693560.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09120
			gene	fabB
	CDS	41922..43172	product	glutamate-5-semialdehyde dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694299.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09130
			gene	proA
	tRNA	complement(43269..43345)	product	tRNA-Met
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00260
	CDS	complement(43413..43838)	product	DNA polymerase III subunit psi
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663309.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09140
			gene	holD
	CDS	43900..44892	product	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693888.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09150
			gene	rsmC
	CDS	complement(44971..46371)	product	surface lipoprotein assembly modifier
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010980777.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09160
	CDS	complement(46461..46781)	product	type II toxin-antitoxin system YafQ family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010971265.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09170
	CDS	complement(46753..47022)	product	type II toxin-antitoxin system RelB/DinJ family antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011816235.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09180
	CDS	complement(47148..48776)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09190
	CDS	48923..49315	product	helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003688532.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09200
	CDS	complement(49442..50635)	product	mannose-6-phosphate isomerase, class I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005111913.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09210
			gene	manA
	CDS	complement(50794..51138)	product	fumarate reductase subunit FrdD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648338.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09220
			gene	frdD
	CDS	complement(51151..51540)	product	fumarate reductase subunit FrdC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648336.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09230
			gene	frdC
	CDS	complement(51553..52320)	product	succinate dehydrogenase/fumarate reductase iron-sulfur subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005639269.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09240
	CDS	complement(52333..54129)	product	fumarate reductase (quinol) flavoprotein subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663061.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09250
			gene	frdA
	CDS	54414..55382	product	elongation factor P--(R)-beta-lysine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648321.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09260
			gene	epmA
	CDS	complement(55495..56601)	product	metallophosphoesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000793731.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09270
	CDS	complement(57159..58025)	product	AraC family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010943748.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09280
	CDS	58143..58574	product	organic hydroperoxide resistance protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013383115.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09290
	CDS	complement(58640..58996)	product	MmcQ/YjbR family DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011104332.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09300
	CDS	complement(59099..61516)	product	penicillin-binding protein 1B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694212.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09310
			gene	mrcB
	CDS	complement(61550..61882)	product	YacL family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869281.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09320
	CDS	complement(61929..62270)	product	iron-sulfur cluster insertion protein ErpA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649956.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09330
			gene	erpA
	CDS	62399..63202	product	type I methionyl aminopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694208.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09340
			gene	map
	CDS	63291..66245	product	bifunctional uridylyltransferase/uridylyl-removing protein GlnD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694204.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09350
			gene	glnD
	CDS	66704..67258	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09360
	CDS	complement(67329..67739)	product	Cu(I)-responsive transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001026762.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09370
			gene	cueR
	CDS	complement(67739..68374)	product	endonuclease III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654382.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09380
			gene	nth
	CDS	complement(68371..69021)	product	electron transport complex subunit E
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658208.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09390
	CDS	complement(69023..69607)	product	electron transport complex subunit RsxG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694178.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09400
			gene	rsxG
	CDS	complement(69609..70697)	product	electron transport complex subunit RsxD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694177.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09410
			gene	rsxD
	CDS	complement(70875..73145)	product	electron transport complex subunit RsxC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869271.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09420
			gene	rsxC
	CDS	complement(73142..73720)	product	electron transport complex subunit RsxB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650033.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09430
			gene	rsxB
	CDS	complement(73722..74300)	product	electron transport complex subunit RsxA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694403.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09440
			gene	rsxA
	CDS	complement(74435..75034)	product	vancomycin high temperature exclusion protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995886.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09450
	CDS	75310..76392	product	homoserine O-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694320.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09460
	CDS	complement(76572..77060)	product	2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693858.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09470
			gene	folK
	CDS	complement(77064..78503)	product	polynucleotide adenylyltransferase PcnB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868929.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09480
			gene	pcnB
	CDS	complement(78754..79200)	product	RNA polymerase-binding protein DksA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001155232.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09490
			gene	dksA
	CDS	79490..81859	product	DNA internalization-related competence protein ComEC/Rec2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693861.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09500
	CDS	81902..83653	product	lipid A ABC transporter ATP-binding protein/permease MsbA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649789.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09510
			gene	msbA
	CDS	83703..84677	product	tetraacyldisaccharide 4'-kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693863.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09520
			gene	lpxK
	CDS	84679..85464	product	3-deoxy-manno-octulosonate cytidylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693864.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09530
			gene	kdsB
	CDS	85558..86361	product	DUF4198 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225093.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09540
	CDS	86456..88300	product	excinuclease ABC subunit UvrC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693865.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09550
			gene	uvrC
	CDS	88347..88937	product	DNA glycosylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225483.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09560
	CDS	88982..90067	product	selenide, water dikinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:UniprotKB:A5UG02
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09570
			gene	selD
	CDS	90162..91607	product	tRNA 4-thiouridine(8) synthase ThiI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013095844.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09580
			gene	thiI
	CDS	91807..93036	product	porin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694426.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09590
	CDS	93141..93620	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09600
	CDS	93622..94056	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09610
	CDS	94342..94662	product	BrnA antitoxin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003816743.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09620
	CDS	94811..96145	product	argininosuccinate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694213.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09630
			gene	argG
	CDS	complement(96240..96884)	product	adenylate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649108.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09640
			gene	adk
	CDS	complement(97511..98788)	product	AmpG family muropeptide MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002243984.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09650
	CDS	complement(98958..99974)	product	UDP-glucose 4-epimerase GalE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694325.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09660
			gene	galE
	CDS	100154..101467	product	NCS2 family permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694416.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09670
	CDS	101498..101983	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09680
	CDS	complement(102067..102528)	product	LexA family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032823702.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09690
	CDS	102802..104046	product	serine/threonine transporter SstT
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050845826.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09700
			gene	sstT
	CDS	104129..105574	product	molybdate ABC transporter ATP-binding protein ModF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013097518.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09710
			gene	modF
	CDS	105623..106534	product	SPFH domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000904497.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09720
	CDS	106544..107005	product	NfeD family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011263065.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09730
	CDS	107086..107667	product	NAD(P)H-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693569.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09740
	CDS	complement(107711..109165)	product	leucyl aminopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694194.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09750
	CDS	109298..110395	product	LPS export ABC transporter permease LptF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658246.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09760
			gene	lptF
	CDS	110405..111472	product	LPS export ABC transporter permease LptG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694193.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09770
			gene	lptG
	CDS	complement(111610..113085)	product	amidophosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694238.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09780
			gene	purF
	CDS	complement(113098..113589)	product	CvpA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694239.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09790
	CDS	complement(113681..114121)	product	terminus macrodomain insulation protein YfbV
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694240.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09800
			gene	yfbV
	CDS	complement(114177..114866)	product	5'-methylthioadenosine/adenosylhomocysteine nucleosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694230.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09810
	CDS	complement(114873..115529)	product	thiol:disulfide interchange protein DsbA/DsbL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694231.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09820
	CDS	complement(115529..117250)	product	single-stranded-DNA-specific exonuclease RecJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694232.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09830
			gene	recJ
	CDS	complement(117642..118322)	product	bifunctional protein-disulfide isomerase/oxidoreductase DsbC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647404.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09840
			gene	dsbC
	CDS	118574..119572	product	peptide chain release factor 2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_111697003.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09850
			gene	prfB
	CDS	119591..121096	product	lysine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050838325.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09860
			gene	lysS
	tRNA	121261..121347	product	tRNA-Leu
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00270
	CDS	121565..121861	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09870
	CDS	121862..122275	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09880
	CDS	122359..122844	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09890
	CDS	123112..123426	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09900
	CDS	complement(123437..123850)	product	type II toxin-antitoxin system HicB family antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005767619.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09910
	CDS	complement(123950..124165)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09920
	CDS	125178..125456	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09930
	CDS	125449..125712	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09940
			note	possible pseudo, frameshifted
	CDS	125693..125983	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09950
			note	possible pseudo, frameshifted
	CDS	complement(125973..126215)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09960
	CDS	complement(126295..127329)	product	DNA polymerase IV
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011261445.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09970
			gene	dinB
	CDS	complement(127444..128988)	product	ATP-dependent endonuclease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011816028.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09980
	CDS	129062..129970	product	lysine exporter LysO family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013097331.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_09990
	CDS	complement(129985..130800)	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002211898.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10000
	CDS	complement(130891..131751)	product	phosphoribosylaminoimidazolesuccinocarboxamide synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649949.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10010
	CDS	131899..133479	product	peptide chain release factor 3
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694221.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10020
			gene	prfC
	CDS	complement(133533..134201)	product	iron-sulfur cluster repair protein YtfE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694400.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10030
			gene	ytfE
	CDS	complement(134328..134825)	product	YbhB/YbcL family Raf kinase inhibitor-like protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_115308544.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10040
	CDS	134930..135379	product	transcriptional regulator NrdR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648026.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10050
			gene	nrdR
	CDS	135382..136512	product	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693291.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10060
			gene	ribD
	CDS	136505..137566	product	outer membrane-stress sensor serine endopeptidase DegS
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648024.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10070
			gene	degS
	CDS	137641..138594	product	oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693928.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10080
	CDS	complement(138822..139535)	product	tRNA pseudouridine(65) synthase TruC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002212125.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10090
			gene	truC
	CDS	complement(139532..139852)	product	YqcC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650459.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10100
	CDS	139915..140697	product	Zn-ribbon-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995944.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10110
	CDS	140694..141530	product	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694533.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10120
			gene	queF
	CDS	141558..142919	product	nucleotide 5'-monophosphate nucleosidase PpnN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015369952.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10130
			gene	ppnN
	CDS	142953..143642	product	carbonate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005631770.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10140
			gene	can
	CDS	complement(143861..144865)	product	HTH-type transcriptional repressor PurR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005660510.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10150
			gene	purR
	CDS	145470..145643	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10160
	CDS	complement(146077..147648)	product	glutamine-hydrolyzing GMP synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694070.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10170
			gene	guaA
	CDS	complement(147658..148650)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10180
	CDS	complement(148744..149568)	product	BRO family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962647.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10190
	CDS	complement(149668..151134)	product	IMP dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694071.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10200
			gene	guaB
	CDS	151275..152219	product	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_168769356.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10210
			gene	birA
	CDS	complement(152401..153723)	product	amino-acid N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098542.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10220
			gene	argA
	CDS	153879..156029	product	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001086472.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10230
			gene	rlmKL
	CDS	complement(156110..157207)	product	extracellular solute-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650701.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10240
	CDS	complement(157351..158121)	product	spermidine/putrescine ABC transporter permease PotC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650699.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10250
			gene	potC
	CDS	complement(158121..158975)	product	spermidine/putrescine ABC transporter permease PotB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694014.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10260
			gene	potB
	CDS	complement(158962..160074)	product	spermidine/putrescine ABC transporter ATP-binding protein PotA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011962024.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10270
			gene	potA
	CDS	160383..161615	product	peptidase T
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694011.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10280
			gene	pepT
	CDS	complement(161659..164301)	product	PqiB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694394.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10290
	CDS	complement(164282..165550)	product	paraquat-inducible protein A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667179.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10300
	CDS	165748..166410	product	RNA chaperone ProQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650069.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10310
			gene	proQ
	CDS	166524..168557	product	carboxy terminal-processing peptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_044509453.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10320
			gene	prc
	CDS	168722..170050	product	murein L,D-transpeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694392.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10330
	CDS	170116..170679	product	YcbK family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015367456.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10340
	CDS	170746..171378	product	MBL fold metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694389.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10350
	tRNA	171551..171627	product	tRNA-Met
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00280
	tRNA	171646..171728	product	tRNA-Leu
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00290
	tRNA	171768..171842	product	tRNA-Gln
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00300
	tRNA	171885..171959	product	tRNA-Gln
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00310
	CDS	172151..173353	product	divalent metal cation transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002262233.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10360
	CDS	complement(173426..174355)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10370
	CDS	174485..174937	product	DUF441 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693397.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10380
	CDS	174939..178859	product	ATP-dependent RNA helicase HrpA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996585.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10390
			gene	hrpA
	CDS	complement(178923..180356)	product	YdgA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001309873.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10400
	CDS	complement(180370..180942)	product	elongation factor P hydroxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005688501.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10410
	CDS	complement(181000..181296)	product	ribosome assembly RNA-binding protein YhbY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650404.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10420
			gene	yhbY
	tRNA	181559..181634	product	tRNA-Gly
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00320
	tRNA	181658..181744	product	tRNA-Leu
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00330
sequence06	source	1..158626	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(100..1278)	product	ATP-grasp domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002263541.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10430
	CDS	complement(1478..2776)	product	adenylosuccinate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_139989280.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10440
			gene	purA
	CDS	complement(2856..4304)	product	sucrose-6-phosphate hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_009896953.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10450
	CDS	complement(4533..5459)	product	aminoimidazole riboside kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_057563589.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10460
	CDS	complement(5473..6660)	product	tyrosine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_111696676.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10470
			gene	tyrS
	CDS	complement(6904..7617)	product	DNA/RNA nuclease SfsA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996442.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10480
			gene	sfsA
	CDS	complement(7628..8575)	product	transcriptional regulator MelR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000106992.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10490
			gene	melR
	CDS	8797..10167	product	melibiose:sodium transporter MelB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000028114.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10500
			gene	melB
	CDS	10179..12314	product	alpha-galactosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002213113.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10510
	CDS	12578..14116	product	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693998.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10520
			gene	pntA
	CDS	14128..15576	product	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693997.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10530
			gene	pntB
	CDS	complement(15639..21632)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10540
	CDS	complement(21796..22581)	product	zinc ABC transporter permease subunit ZnuB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693761.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10550
			gene	znuB
	CDS	complement(22594..23406)	product	zinc ABC transporter ATP-binding protein ZnuC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666536.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10560
			gene	znuC
	CDS	23572..25038	product	murein DD-endopeptidase MepM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693760.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10570
			gene	mepM
	CDS	25266..26480	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005771113.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10580
	CDS	complement(26540..27430)	product	ABC transporter six-transmembrane domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225028.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10590
	CDS	complement(27430..27873)	product	MarR family winged helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002222199.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10600
	CDS	28145..29437	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011460406.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10610
	CDS	29714..30625	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10620
	CDS	30927..32030	product	efflux RND transporter periplasmic adaptor subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010969954.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10630
	CDS	32154..33158	product	virulence RhuM family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011202293.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10640
	CDS	complement(33226..34173)	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011037507.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10650
	CDS	34318..35163	product	MBL fold metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011103734.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10660
	CDS	complement(35444..35875)	product	cyclophilin-like fold protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_018307336.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10670
	CDS	complement(35895..36446)	product	DapH/DapD/GlmU-related protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002287468.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10680
	CDS	complement(36482..36820)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10690
	CDS	complement(36918..37667)	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_009931125.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10700
	CDS	complement(37669..37968)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10710
	CDS	complement(37968..38531)	product	NAD(P)H-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000789913.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10720
	CDS	38649..39116	product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000621142.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10730
	CDS	39202..40098	product	LysR substrate-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005307641.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10740
	CDS	40091..41380	product	chloride channel protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002229369.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10750
	CDS	complement(41475..42893)	product	glutamate--ammonia ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693212.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10760
			gene	glnA
	CDS	43378..45228	product	translational GTPase TypA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693211.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10770
			gene	typA
	CDS	complement(45297..45614)	product	ribosome-associated translation inhibitor RaiA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653397.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10780
			gene	raiA
	CDS	complement(45881..47248)	product	sodium:alanine symporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666065.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10790
	CDS	complement(47711..54241)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10800
	CDS	complement(54707..55744)	product	DNA polymerase III subunit delta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693269.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10810
			gene	holA
	CDS	complement(55747..56253)	product	LPS assembly lipoprotein LptE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005659127.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10820
			gene	lptE
	CDS	complement(56265..57023)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10830
	CDS	complement(57029..59611)	product	leucine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693268.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10840
			gene	leuS
	CDS	complement(59727..60344)	product	glucose-6-phosphate 1-dehydrogenase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694148.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10850
	CDS	complement(60341..61168)	product	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005664434.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10860
			gene	apaH
	CDS	complement(61171..62037)	product	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649513.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10870
			gene	rsmA
	CDS	complement(62086..63033)	product	peptidylprolyl isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_162877157.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10880
	CDS	complement(63108..63647)	product	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649361.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10890
			gene	pyrR
	CDS	complement(63732..64370)	product	phosphoribosylglycinamide formyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693938.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10900
			gene	purN
	CDS	complement(64426..65463)	product	phosphoribosylformylglycinamidine cyclo-ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693936.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10910
			gene	purM
	CDS	66124..66726	product	RNA pyrophosphohydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693252.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10920
			gene	rppH
	CDS	66723..67514	product	sulfite exporter TauE/SafE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693253.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10930
	CDS	67522..68349	product	prolipoprotein diacylglyceryl transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693254.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10940
			gene	lgt
	CDS	68360..69211	product	thymidylate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648113.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10950
	CDS	69382..69900	product	tRNA adenosine(34) deaminase TadA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693256.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10960
			gene	tadA
	CDS	complement(70110..70703)	product	YajG family lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694116.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10970
	CDS	70805..71116	product	BolA family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668108.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10980
	CDS	71413..72762	product	Na(+)-translocating NADH-quinone reductase subunit A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694115.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_10990
	CDS	72765..73994	product	NADH:ubiquinone reductase (Na(+)-transporting) subunit B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653793.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11000
	CDS	73994..74767	product	Na(+)-translocating NADH-quinone reductase subunit C
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003689271.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11010
	CDS	74767..75390	product	NADH:ubiquinone reductase (Na(+)-transporting) subunit D
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648665.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11020
			gene	nqrD
	CDS	75394..75990	product	NADH:ubiquinone reductase (Na(+)-transporting) subunit E
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005631374.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11030
			gene	nqrE
	CDS	76001..77230	product	NADH:ubiquinone reductase (Na(+)-transporting) subunit F
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648666.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11040
			gene	nqrF
	CDS	77385..77822	product	nucleotidyltransferase substrate binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693848.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11050
	CDS	77815..78111	product	nucleotidyltransferase domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693849.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11060
	CDS	78116..79153	product	FAD:protein FMN transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668096.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11070
	CDS	79178..79432	product	(Na+)-NQR maturation NqrM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629187.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11080
			gene	nqrM
	CDS	79535..80689	product	tRNA 2-thiouridine(34) synthase MnmA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_100066294.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11090
			gene	mnmA
	CDS	80800..81471	product	superoxide dismutase [Mn]
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693413.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11100
			gene	sodA
	CDS	complement(81596..81808)	product	SlyX family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694169.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11110
	CDS	81909..82691	product	FKBP-type peptidyl-prolyl cis-trans isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694170.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11120
			gene	fkpA
	CDS	82893..83555	product	transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694171.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11130
	CDS	83555..83935	product	sulfurtransferase complex subunit TusD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694173.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11140
			gene	tusD
	CDS	83932..84294	product	sulfurtransferase complex subunit TusC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654660.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11150
			gene	tusC
	CDS	84304..84582	product	DsrH/TusB family sulfur relay protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649577.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11160
	CDS	complement(84579..85790)	product	NAD(P)/FAD-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693280.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11170
	CDS	complement(85774..86880)	product	heme lyase NrfEFG subunit NrfF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693281.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11180
			gene	nrfF
	CDS	complement(86877..87407)	product	DsbE family thiol:disulfide interchange protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693282.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11190
	tRNA	87476..87551	product	tRNA-Thr
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00340
	CDS	complement(87586..89526)	product	heme lyase NrfEFG subunit NrfE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693283.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11200
			gene	nrfE
	CDS	complement(89610..90566)	product	cytochrome c nitrite reductase subunit NrfD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693393.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11210
			gene	nrfD
	CDS	complement(90566..91246)	product	cytochrome c nitrite reductase Fe-S protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647733.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11220
			gene	nrfC
	CDS	complement(91243..91893)	product	cytochrome c nitrite reductase pentaheme subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647730.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11230
			gene	nrfB
	CDS	complement(91974..93494)	product	ammonia-forming nitrite reductase cytochrome c552 subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005690769.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11240
			gene	nrfA
	CDS	complement(94086..95051)	product	lipoyl synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652627.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11250
			gene	lipA
	CDS	complement(95103..95774)	product	lipoyl(octanoyl) transferase LipB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691065.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11260
			gene	lipB
	CDS	complement(95774..96076)	product	DUF493 family protein YbeD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649857.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11270
			gene	ybeD
	CDS	complement(96311..97519)	product	D-alanyl-D-alanine carboxypeptidase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693881.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11280
	CDS	complement(97529..98038)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11290
	CDS	complement(98104..99222)	product	rod shape-determining protein RodA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649852.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11300
			gene	rodA
	CDS	complement(99222..101171)	product	penicillin-binding protein 2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649850.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11310
			gene	mrdA
	CDS	complement(101292..101726)	product	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649848.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11320
			gene	rlmH
	CDS	complement(101803..102111)	product	ribosome silencing factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005635481.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11330
			gene	rsfS
	CDS	complement(102177..103022)	product	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693720.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11340
	CDS	complement(103099..105690)	product	penicillin-binding protein 1A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_118806713.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11350
	CDS	105808..106626	product	competence protein A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693722.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11360
	CDS	106637..107134	product	competence protein ComB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693724.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11370
			gene	comB
	CDS	107131..107664	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11380
	CDS	107667..108044	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11390
	CDS	108054..109469	product	type IV pilus secretin PilQ family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693728.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11400
	CDS	109586..110551	product	6-phosphofructokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005664214.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11410
			gene	pfkA
	CDS	110654..112681	product	DNA helicase Rep
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869028.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11420
			gene	rep
	tRNA	112767..112861	product	tRNA-Ser
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00350
	tRNA	112901..112977	product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00360
	tRNA	113042..113118	product	tRNA-Arg
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00370
	CDS	113261..113866	product	beta-phosphoglucomutase family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652027.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11430
	CDS	113866..114468	product	sugar O-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010965980.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11440
	CDS	115137..115640	product	S-ribosylhomocysteine lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693682.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11450
			gene	luxS
	CDS	115652..116833	product	formate-dependent phosphoribosylglycinamide formyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004406408.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11460
			gene	purT
	CDS	complement(116902..118269)	product	oxygen-independent coproporphyrinogen III oxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000116090.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11470
			gene	hemN
	CDS	complement(118353..118784)	product	DUF2489 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693128.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11480
	CDS	complement(118791..119354)	product	Der GTPase-activating protein YihI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693127.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11490
			gene	yihI
	CDS	119722..120213	product	50S ribosomal protein L10
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005626605.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11500
			gene	rplJ
	CDS	120271..120639	product	50S ribosomal protein L7/L12
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650892.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11510
			gene	rplL
	CDS	121033..125061	product	DNA-directed RNA polymerase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666423.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11520
			gene	rpoB
	CDS	125162..129430	product	DNA-directed RNA polymerase subunit beta'
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693659.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11530
			gene	rpoC
	CDS	complement(129720..130532)	product	DNA-formamidopyrimidine glycosylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693293.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11540
			gene	mutM
	CDS	complement(130623..130793)	product	50S ribosomal protein L33
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005613503.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11550
			gene	rpmG
	CDS	complement(130805..131041)	product	50S ribosomal protein L28
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005542826.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11560
			gene	rpmB
	CDS	complement(131263..131925)	product	DNA repair protein RadC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013527272.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11570
			gene	radC
	CDS	132134..133342	product	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693302.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11580
			gene	coaBC
	CDS	133358..133813	product	dUTP diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005631431.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11590
			gene	dut
	CDS	133820..134476	product	nucleoid occlusion factor SlmA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648000.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11600
			gene	slmA
	CDS	134473..134697	product	YheU family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000586568.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11610
	CDS	134730..135395	product	cAMP-activated global transcriptional regulator CRP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000242755.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11620
			gene	crp
	CDS	complement(135480..136562)	product	DNA replication/repair protein RecF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693333.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11630
			gene	recF
	CDS	complement(136588..137688)	product	DNA polymerase III subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693335.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11640
			gene	dnaN
	CDS	complement(137698..139074)	product	chromosomal replication initiator protein DnaA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693336.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11650
			gene	dnaA
	CDS	139336..139539	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11660
	CDS	139554..139919	product	ribonuclease P protein component
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647913.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11670
			gene	rnpA
	CDS	140143..141759	product	membrane protein insertase YidC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693342.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11680
			gene	yidC
	CDS	141875..143245	product	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693343.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11690
			gene	mnmE
	CDS	complement(143295..144824)	product	murein biosynthesis integral membrane protein MurJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826265.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11700
			gene	murJ
	CDS	145086..145349	product	30S ribosomal protein S20
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651580.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11710
			gene	rpsT
	CDS	complement(145419..146084)	product	YtjB family periplasmic protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015368377.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11720
	CDS	146150..147094	product	phosphoserine phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995656.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11730
			gene	serB
	CDS	147106..147597	product	YajQ family cyclic di-GMP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651674.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11740
	CDS	147823..148050	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11750
	CDS	148071..148547	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11760
	CDS	148581..149060	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11770
	CDS	complement(149129..150481)	product	CDP-diacylglycerol--serine O-phosphatidyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693739.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11780
			gene	pssA
	CDS	150592..151632	product	tRNA/rRNA methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693740.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11790
	CDS	151617..151862	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11800
	CDS	complement(151879..152139)	product	YfhL family 4Fe-4S dicluster ferredoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649491.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11810
	CDS	152211..152990	product	ribonuclease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694129.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11820
	CDS	153095..154264	product	phosphoglycerate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694128.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11830
			gene	pgk
	CDS	154362..155441	product	class II fructose-bisphosphate aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694127.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11840
			gene	fbaA
	CDS	155514..156776	product	O-antigen ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995535.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11850
	CDS	complement(156851..157762)	product	petrobactin ABC transporter substrate-binding protein YclQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003246619.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11860
			gene	yclQ
	CDS	complement(157794..158555)	product	ATP-binding cassette domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011948720.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11870
sequence07	source	1..154258	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(10..933)	product	IS30 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011674809.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11880
	CDS	1140..2036	product	homocysteine S-methyltransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011706612.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11890
	CDS	2054..3463	product	basic amino acid/polyamine antiporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011706611.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11900
	CDS	complement(3778..4629)	product	DMT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015064131.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11910
	CDS	complement(4963..6612)	product	glucose-6-phosphate isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869249.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11920
			gene	pgi
	CDS	complement(6648..7724)	product	alanine racemase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693598.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11930
			gene	alr
	CDS	complement(7761..9173)	product	replicative DNA helicase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828363.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11940
	CDS	9308..10306	product	gluconate operon transcriptional repressor GntR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005174797.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11950
			gene	gntR
	CDS	complement(10513..11031)	product	gluconokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005307862.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11960
	CDS	11249..12292	product	L-idonate 5-dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001197408.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11970
			gene	idnD
	CDS	12302..13066	product	gluconate 5-dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002210264.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11980
			gene	idnO
	CDS	13079..14428	product	GntP family permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005478622.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_11990
	CDS	14588..16945	product	DEAD/DEAH box helicase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000229101.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12000
	CDS	16949..18421	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010891943.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12010
	CDS	18651..20120	product	class I SAM-dependent DNA methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012775649.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12020
	CDS	20179..21687	product	restriction endonuclease subunit S
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000187233.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12030
	CDS	21744..22547	product	tyrosine-type recombinase/integrase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008764673.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12040
	CDS	complement(22603..23592)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12050
	CDS	complement(24024..26930)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12060
	CDS	26866..27084	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12070
	CDS	complement(27175..31842)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12080
	CDS	complement(32126..33208)	product	3-deoxy-7-phosphoheptulonate synthase AroG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_165590136.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12090
			gene	aroG
	CDS	complement(33337..34575)	product	lipoprotein-releasing ABC transporter permease subunit LolE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_038439909.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12100
			gene	lolE
	CDS	complement(34577..35260)	product	lipoprotein-releasing ABC transporter ATP-binding protein LolD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693575.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12110
			gene	lolD
	CDS	complement(35903..37108)	product	lipoprotein-releasing ABC transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654778.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12120
	CDS	complement(37108..38049)	product	2-hydroxyacid dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693583.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12130
	CDS	complement(38131..38985)	product	3-deoxy-8-phosphooctulonate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693586.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12140
			gene	kdsA
	CDS	complement(39023..39835)	product	SirB1 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654786.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12150
	CDS	complement(39832..40692)	product	peptide chain release factor N(5)-glutamine methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693587.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12160
			gene	prmC
	CDS	complement(40789..41871)	product	peptide chain release factor 1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032803489.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12170
			gene	prfA
	CDS	42009..42506	product	phosphohistidine phosphatase SixA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652786.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12180
			gene	sixA
	CDS	complement(42552..43205)	product	GTP cyclohydrolase I FolE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666869.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12190
			gene	folE
	CDS	43382..44785	product	asparagine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869177.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12200
			gene	asnS
	CDS	44900..45379	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12210
	CDS	45619..45864	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12220
	CDS	complement(45938..46711)	product	TIGR01619 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657798.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12230
	CDS	complement(46721..47521)	product	exodeoxyribonuclease III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663264.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12240
			gene	xthA
	CDS	47704..48915	product	molybdopterin molybdotransferase MoeA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693918.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12250
			gene	moeA
	CDS	48919..49644	product	molybdopterin-synthase adenylyltransferase MoeB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693917.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12260
			gene	moeB
	CDS	49687..49923	product	exodeoxyribonuclease VII small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693923.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12270
			gene	xseB
	CDS	49925..50821	product	(2E,6E)-farnesyl diphosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_061724061.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12280
			gene	ispA
	CDS	50906..52762	product	1-deoxy-D-xylulose-5-phosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650455.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12290
			gene	dxs
	CDS	complement(52976..53329)	product	50S ribosomal protein L20
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005596075.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12300
			gene	rplT
	CDS	complement(53392..53589)	product	50S ribosomal protein L35
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005596065.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12310
			gene	rpmI
	CDS	complement(53831..54256)	product	translation initiation factor IF-3
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869182.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12320
			gene	infC
	CDS	complement(54554..55921)	product	sodium-dependent transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694179.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12330
	CDS	complement(56007..57119)	product	alanine dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012869878.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12340
			gene	ald
	CDS	57415..58002	product	division/outer membrane stress-associated lipid-binding lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657657.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12350
			gene	dolP
	CDS	complement(58055..61219)	product	type I restriction endonuclease subunit R
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694526.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12360
	CDS	61414..61719	product	type II toxin-antitoxin system RelE/ParE family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694311.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12370
	CDS	61730..62056	product	HigA family addiction module antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650217.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12380
	CDS	complement(62233..63138)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12390
	CDS	complement(63142..64494)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12400
	CDS	complement(64485..65858)	product	type I restriction-modification system subunit M
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429263.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12410
	CDS	complement(66264..66875)	product	riboflavin synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693624.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12420
			gene	ribE
	CDS	66914..68311	product	sodium-coupled multidrug efflux MATE transporter HmrM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693623.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12430
			gene	hmrM
	CDS	68445..70610	product	TonB-dependent siderophore receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011816920.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12440
	CDS	70949..72712	product	ABC transporter ATP-binding protein/permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693484.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12450
	CDS	72917..74131	product	acetate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694241.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12460
	CDS	74246..76387	product	phosphate acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694242.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12470
			gene	pta
	CDS	76627..77058	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12480
	CDS	77060..77764	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12490
	CDS	complement(77923..78861)	product	malate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694235.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12500
			gene	mdh
	CDS	79072..79536	product	transcriptional regulator ArgR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691176.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12510
			gene	argR
	CDS	79537..80424	product	TIGR01777 family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002209739.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12520
	CDS	complement(80421..81791)	product	anti-phage deoxyguanosine triphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001198176.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12530
	CDS	complement(81788..82471)	product	CidB/LrgB family autolysis modulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694470.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12540
	CDS	complement(82468..82899)	product	CidA/LrgA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694471.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12550
	CDS	82999..83496	product	thermonuclease family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995946.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12560
	CDS	83496..84692	product	cysteine desulfurase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995945.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12570
	CDS	84694..85080	product	SufE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694476.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12580
	CDS	complement(85072..86058)	product	capsular polysaccharide synthesis protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_008765271.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12590
	CDS	complement(86210..86539)	product	branched-chain amino acid transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658306.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12600
	CDS	complement(86529..87287)	product	azaleucine resistance protein AzlC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429553.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12610
			gene	azlC
	CDS	complement(87290..88219)	product	LysR substrate-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694223.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12620
	CDS	88386..89426	product	ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694419.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12630
	CDS	89545..90582	product	ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000784324.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12640
	CDS	90664..92721	product	iron ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_168769364.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12650
	CDS	92821..93879	product	ferric ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429501.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12660
			gene	fbpC
	CDS	93917..94846	product	nucleoside hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004113476.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12670
	CDS	95115..96218	product	winged helix-turn-helix transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001283968.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12680
	CDS	96211..97122	product	pseudouridine-5'-phosphate glycosidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003722579.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12690
	CDS	97175..98440	product	NupC/NupG family nucleoside CNT transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005456066.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12700
	CDS	98558..99418	product	SAM-dependent methyltransferase TehB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694518.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12710
			gene	tehB
	CDS	complement(99753..100517)	product	molybdate ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015704779.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12720
			gene	modA
	CDS	100632..101405	product	TOBE domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694183.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12730
	CDS	101402..101818	product	hotdog fold thioesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693476.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12740
	CDS	101838..102797	product	ferrochelatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693475.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12750
			gene	hemH
	CDS	102927..105197	product	5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694192.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12760
			gene	metE
	CDS	complement(105341..106303)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12770
	CDS	106469..106705	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12780
	CDS	complement(107103..107660)	product	DUF5358 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693313.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12790
	CDS	complement(107803..108672)	product	succinate--CoA ligase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694247.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12800
			gene	sucD
	CDS	complement(108675..109841)	product	ADP-forming succinate--CoA ligase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694249.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12810
			gene	sucC
	CDS	complement(109952..111157)	product	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694387.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12820
			gene	odhB
	CDS	complement(111224..114031)	product	2-oxoglutarate dehydrogenase E1 component
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869267.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12830
			gene	sucA
	CDS	114206..115600	product	DASS family sodium-coupled anion symporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_038439489.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12840
	CDS	complement(115658..117124)	product	surface lipoprotein assembly modifier
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010980777.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12850
	CDS	complement(117178..118152)	product	transferrin-binding protein-like solute binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693319.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12860
	CDS	complement(118356..120122)	product	assimilatory sulfite reductase (NADPH) hemoprotein subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225214.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12870
			gene	cysI
	CDS	complement(120439..122256)	product	assimilatory sulfite reductase (NADPH) flavoprotein subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010980903.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12880
	CDS	complement(122576..123865)	product	sulfate adenylyltransferase subunit 1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225213.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12890
	CDS	complement(123954..124880)	product	sulfate adenylyltransferase subunit CysD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002213549.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12900
			gene	cysD
	CDS	complement(124983..125714)	product	phosphoadenylyl-sulfate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002232454.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12910
	CDS	complement(125742..127163)	product	siroheme synthase CysG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225211.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12920
			gene	cysG
	CDS	complement(127160..128164)	product	sulfate ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_107879069.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12930
	CDS	128601..129422	product	sulfate ABC transporter permease subunit CysT
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225366.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12940
			gene	cysT
	CDS	129422..130246	product	sulfate ABC transporter permease subunit CysW
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225368.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12950
			gene	cysW
	CDS	130259..131335	product	sulfate/molybdate ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000027092.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12960
	CDS	131546..132460	product	formate dehydrogenase accessory protein FdhE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693890.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12970
			gene	fdhE
	CDS	132470..133288	product	pyridoxal phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002210759.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12980
	CDS	133310..133630	product	HI1450 family dsDNA-mimic protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005628170.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_12990
	CDS	133634..133981	product	SirB2 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652996.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13000
	CDS	complement(134087..134824)	product	ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011388250.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13010
	CDS	complement(134817..135797)	product	iron ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014537491.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13020
	CDS	complement(135810..136658)	product	BRO family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_016475763.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13030
	CDS	complement(136756..137544)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13040
	CDS	complement(137581..139515)	product	TonB-dependent receptor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011337464.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13050
	CDS	139665..140546	product	methylenetetrahydrofolate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002223857.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13060
			gene	metF
	CDS	complement(140599..141603)	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011963749.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13070
	CDS	complement(141596..142429)	product	glycosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000282880.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13080
	CDS	complement(142426..143343)	product	tRNA pseudouridine(55) synthase TruB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429261.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13090
			gene	truB
	CDS	complement(143343..143753)	product	30S ribosome-binding factor RbfA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694530.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13100
			gene	rbfA
	CDS	complement(143781..144422)	product	hexitol phosphatase HxpB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015366193.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13110
			gene	hxpB
	CDS	complement(144469..144825)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13120
	CDS	complement(145182..145325)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13130
	CDS	145549..145716	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13140
	CDS	complement(145766..146635)	product	plasmid partitioning protein RepB C-terminal domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011338948.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13150
	CDS	complement(146628..147518)	product	plasmid partitioning protein RepB C-terminal domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010974304.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13160
	CDS	complement(147433..149064)	product	recombinase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011338946.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13170
	CDS	149203..149451	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13180
	CDS	149474..149983	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13190
	CDS	149967..150278	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13200
	CDS	150344..150553	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13210
	CDS	complement(150702..152138)	product	pyruvate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429176.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13220
			gene	pyk
	CDS	152334..152606	product	ACT domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003691603.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13230
	CDS	152617..153972	product	PFL family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002218495.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13240
sequence08	source	1..116986	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(221..1627)	product	MDR family MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995514.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13250
	CDS	complement(1633..2142)	product	molybdopterin-guanine dinucleotide biosynthesis protein MobB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648290.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13260
			gene	mobB
	CDS	complement(2139..2519)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13270
	CDS	complement(2629..3456)	product	PTS mannose transporter subunit IID
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002211067.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13280
	CDS	complement(3471..4268)	product	PTS mannose/fructose/sorbose transporter subunit IIC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004701713.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13290
	CDS	complement(4281..5246)	product	PTS mannose transporter subunit IIAB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000150527.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13300
			gene	manX
	CDS	complement(5452..6000)	product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003234219.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13310
	CDS	6133..7638	product	sodium-dependent transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693140.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13320
	CDS	complement(7940..9796)	product	ferrous iron transporter B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011037005.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13330
	CDS	complement(9798..10064)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13340
	CDS	10253..11206	product	thiosulfate utilization transporter TsuA/YeeE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000492339.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13350
			gene	tsuA
	CDS	11219..12598	product	sulfurtransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011948793.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13360
	CDS	12854..15217	product	LPS assembly protein LptD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_075985423.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13370
			gene	lptD
	CDS	complement(15300..15833)	product	inorganic diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005630160.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13380
	CDS	complement(15909..16139)	product	acetolactate synthase 2 small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002212016.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13390
			gene	ilvM
	CDS	complement(16168..17823)	product	acetolactate synthase 2 catalytic subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001012623.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13400
			gene	ilvG
	CDS	17971..18789	product	Cof-type HAD-IIB family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694570.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13410
	CDS	18805..19185	product	fluoride efflux transporter CrcB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651074.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13420
			gene	crcB
	CDS	19182..20555	product	chloride channel protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003697502.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13430
	CDS	complement(20713..21756)	product	lipopolysaccharide heptosyltransferase II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693429.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13440
			gene	waaF
	CDS	complement(21990..23267)	product	anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694608.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13450
			gene	glpC
	CDS	complement(23278..24570)	product	glycerol-3-phosphate dehydrogenase subunit GlpB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694609.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13460
			gene	glpB
	CDS	complement(24560..26239)	product	anaerobic glycerol-3-phosphate dehydrogenase subunit A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694610.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13470
			gene	glpA
	CDS	complement(26477..27556)	product	glycerophosphodiester phosphodiesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694613.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13480
			gene	glpQ
	CDS	complement(27638..29083)	product	glycerol-3-phosphate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650782.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13490
			gene	glpT
	CDS	complement(29295..29909)	product	MarC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011262766.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13500
	CDS	complement(29928..30779)	product	protease HtpX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005633091.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13510
			gene	htpX
	CDS	complement(30861..31265)	product	type II toxin-antitoxin system VapC family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_064252024.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13520
	CDS	complement(31262..31525)	product	type II toxin-antitoxin system prevent-host-death family antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_064242138.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13530
	CDS	31685..33616	product	ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694483.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13540
	CDS	33613..33936	product	multidrug efflux SMR transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011261337.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13550
	CDS	34536..36425	product	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694554.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13560
			gene	mnmG
	CDS	36415..37050	product	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652031.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13570
			gene	rsmG
	CDS	37291..37674	product	ATP synthase subunit I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005659757.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13580
	CDS	37687..38475	product	F0F1 ATP synthase subunit A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629251.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13590
			gene	atpB
	CDS	38594..38848	product	F0F1 ATP synthase subunit C
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652035.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13600
			gene	atpE
	CDS	38907..39377	product	F0F1 ATP synthase subunit B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629246.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13610
			gene	atpF
	CDS	39391..39921	product	F0F1 ATP synthase subunit delta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005642563.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13620
			gene	atpH
	CDS	39937..41478	product	F0F1 ATP synthase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005688698.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13630
			gene	atpA
	CDS	41497..42366	product	F0F1 ATP synthase subunit gamma
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693686.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13640
			gene	atpG
	CDS	42382..43758	product	F0F1 ATP synthase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649402.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13650
			gene	atpD
	CDS	43793..44221	product	F0F1 ATP synthase subunit epsilon
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649396.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13660
	CDS	44319..45095	product	Cof-type HAD-IIB family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649894.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13670
	CDS	complement(45143..45889)	product	class I SAM-dependent methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693198.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13680
	CDS	complement(45898..46992)	product	tRNA (uridine(54)-C5)-methyltransferase TrmA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693197.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13690
			gene	trmA
	CDS	complement(47076..47405)	product	DUF413 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648303.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13700
	CDS	complement(47435..48052)	product	DsbA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693196.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13710
	CDS	complement(48062..48331)	product	YihD family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693195.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13720
	CDS	48416..48988	product	molybdenum cofactor guanylyltransferase MobA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693194.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13730
			gene	mobA
	CDS	48985..49539	product	DNA-3-methyladenine glycosylase I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694489.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13740
	CDS	49658..50443	product	amino acid ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010980844.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13750
	CDS	50481..51149	product	amino acid ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003687787.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13760
	CDS	51158..51907	product	amino acid ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010980846.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13770
	CDS	51981..52394	product	nucleotidyltransferase substrate binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693848.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13780
	CDS	52387..52686	product	nucleotidyltransferase domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693849.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13790
	CDS	complement(52796..54703)	product	glycosyl transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002208722.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13800
	CDS	complement(54720..56051)	product	30S ribosomal protein S12 methylthiotransferase RimO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015704839.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13810
			gene	rimO
	CDS	56178..57980	product	monovalent cation:proton antiporter-2 (CPA2) family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014207190.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13820
	CDS	complement(58041..59756)	product	FTR1 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000252107.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13830
	CDS	complement(59713..60906)	product	iron uptake transporter deferrochelatase/peroxidase subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000136411.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13840
			gene	efeB
	CDS	complement(60940..61728)	product	EfeM/EfeO family lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011836939.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13850
	CDS	complement(61937..62536)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13860
	CDS	complement(62605..63306)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13870
	CDS	complement(63316..63675)	product	diacylglycerol kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694338.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13880
	CDS	complement(63752..65974)	product	GTP pyrophosphokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694339.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13890
	CDS	complement(65984..67312)	product	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694340.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13900
			gene	rlmD
	CDS	complement(67312..67956)	product	DNA repair protein RecO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654053.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13910
			gene	recO
	CDS	68274..68693	product	D-ribose pyranase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693672.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13920
			gene	rbsD
	CDS	68703..70199	product	ribose ABC transporter ATP-binding protein RbsA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693671.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13930
			gene	rbsA
	CDS	70215..71180	product	ribose ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005664522.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13940
			gene	rbsC
	CDS	71199..72077	product	ribose ABC transporter substrate-binding protein RbsB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693669.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13950
			gene	rbsB
	CDS	72131..73063	product	ribokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693668.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13960
			gene	rbsK
	CDS	73076..74077	product	substrate-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693667.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13970
	CDS	74078..74767	product	rRNA large subunit pseudouridine synthase E
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_116956690.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13980
	CDS	complement(74873..76231)	product	PTS ascorbate transporter subunit IIC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098119.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_13990
	CDS	complement(76241..76510)	product	PTS sugar transporter subunit IIB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098120.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14000
	CDS	complement(76525..76980)	product	PTS sugar transporter subunit IIA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098121.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14010
	CDS	77158..78177	product	LacI family DNA-binding transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013098122.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14020
	CDS	78355..79377	product	thiosulfate utilization transporter TsuA/YeeE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000492339.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14030
			gene	tsuA
	CDS	79396..79617	product	sulfurtransferase TusA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001830019.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14040
	CDS	79724..80146	product	NUDIX hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015367142.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14050
	CDS	complement(80207..81253)	product	extracellular solute-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666442.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14060
	CDS	81371..82666	product	FAD-binding oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693676.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14070
	CDS	complement(82805..83647)	product	patatin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000953624.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14080
	CDS	83922..85982	product	BCCT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667119.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14090
	CDS	86012..87337	product	MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002878829.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14100
	CDS	87400..89166	product	sodium:proton antiporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011072494.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14110
	CDS	complement(89267..90022)	product	alpha/beta hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011181710.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14120
	CDS	complement(90341..91213)	product	LysR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003814625.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14130
	CDS	91347..92219	product	pirin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003809214.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14140
	CDS	92367..92753	product	DoxX family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002216361.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14150
	CDS	92911..93354	product	NADPH-dependent FMN reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011100931.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14160
			note	possible pseudo, internal stop codon
	CDS	complement(93449..93766)	product	met regulon transcriptional regulator MetJ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005631186.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14170
			gene	metJ
	CDS	complement(93915..94868)	product	transaldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693444.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14180
			gene	tal
	CDS	95017..97326	product	Tex family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_139989449.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14190
	CDS	97452..98744	product	sodium:proton antiporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011704405.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14200
	CDS	complement(98797..99846)	product	glycosyltransferase family 4 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010951397.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14210
	CDS	complement(99909..100121)	product	50S ribosomal protein L31
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625828.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14220
			gene	rpmE
	CDS	complement(100273..101064)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14230
	CDS	101160..103328	product	primosomal protein N'
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694336.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14240
			gene	priA
	CDS	103434..104309	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14250
	CDS	104554..105768	product	aromatic amino acid transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693687.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14260
	CDS	105918..107132	product	aromatic amino acid transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666410.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14270
	CDS	complement(107179..108618)	product	aminoacyl-histidine dipeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694602.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14280
	CDS	108740..109198	product	xanthine phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650775.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14290
			gene	gpt
	CDS	109225..109959	product	molybdate ABC transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005628423.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14300
			gene	modB
	CDS	109963..110649	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14310
	CDS	110692..111252	product	YqgE/AlgH family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694360.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14320
	CDS	111252..111668	product	Holliday junction resolvase RuvX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648994.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14330
			gene	ruvX
	CDS	complement(111746..112420)	product	DNA transformation protein TfoX
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995324.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14340
			gene	tfoX
	CDS	112845..113219	product	30S ribosomal protein S12
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005543325.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14350
			gene	rpsL
	CDS	113365..113835	product	30S ribosomal protein S7
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005626581.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14360
			gene	rpsG
	CDS	113935..116037	product	elongation factor G
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869011.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14370
			gene	fusA
sequence09	source	1..97725	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(32..454)	product	isoprenylcysteine carboxylmethyltransferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011261733.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14380
	CDS	complement(547..1638)	product	redox-regulated ATPase YchF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693776.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14390
			gene	ychF
	CDS	complement(1897..2481)	product	aminoacyl-tRNA hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693775.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14400
			gene	pth
	CDS	2864..4174	product	NCS2 family permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005161126.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14410
	CDS	4229..4585	product	DsrE/DsrF/TusD sulfur relay family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015705087.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14420
	CDS	4620..8330	product	exodeoxyribonuclease V subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694451.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14430
			gene	recB
	CDS	8323..10245	product	exodeoxyribonuclease V subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694450.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14440
			gene	recD
	CDS	complement(10310..11149)	product	formyltetrahydrofolate deformylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693604.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14450
			gene	purU
	CDS	complement(11219..11611)	product	H-NS family nucleoid-associated regulatory protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647241.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14460
	CDS	11822..13351	product	Na+/H+ antiporter NhaC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996423.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14470
	CDS	13639..15351	product	acetolactate synthase 3 large subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005671546.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14480
	CDS	15363..15854	product	acetolactate synthase small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647229.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14490
			gene	ilvN
	CDS	16101..17507	product	phosphoethanolamine transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14500
	CDS	complement(17567..18496)	product	universal stress protein UspE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656626.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14510
			gene	uspE
	CDS	complement(18705..19472)	product	fumarate/nitrate reduction transcriptional regulator Fnr
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005662331.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14520
			gene	fnr
	CDS	complement(19822..20319)	product	non-heme ferritin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693978.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14530
			gene	ftnA
	CDS	complement(20337..20822)	product	non-heme ferritin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650594.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14540
			gene	ftnA
	CDS	complement(21002..21418)	product	EamA family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003114104.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14550
	CDS	complement(21440..22618)	product	sugar efflux transporter SetB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015706120.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14560
			gene	setB
	CDS	22772..23599	product	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632504.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14570
			gene	dapD
	CDS	23686..23970	product	YcgL domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000882652.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14580
	CDS	24085..26685	product	type I DNA topoisomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429232.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14590
			gene	topA
	CDS	26914..27123	product	cold shock domain-containing protein CspD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652728.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14600
			gene	cspD
	CDS	complement(27197..27643)	product	macrodomain Ter protein MatP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005628871.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14610
			gene	matP
	CDS	27798..29546	product	Lon protease family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826279.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14620
	CDS	29674..30207	product	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650386.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14630
			gene	fabA
	CDS	complement(30269..30715)	product	ribosomal protein S18-alanine N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010868917.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14640
			gene	rimI
	CDS	30858..31928	product	dihydroxyacetone kinase subunit DhaK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000733715.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14650
			gene	dhaK
	CDS	31976..32602	product	dihydroxyacetone kinase subunit DhaL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005379705.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14660
			gene	dhaL
	CDS	32612..33022	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14670
	CDS	complement(33168..35294)	product	heme/hemopexin-binding protein HxuC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694042.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14680
			gene	hxuC
	CDS	35443..37137	product	heme/hemopexin-binding protein HxuB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694040.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14690
			gene	hxuB
	CDS	37153..40074	product	heme/hemopexin-binding protein HxuA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694039.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14700
			gene	hxuA
	CDS	complement(40506..40811)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14710
	CDS	complement(40934..42307)	product	TolC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_042593394.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14720
	CDS	complement(42446..44377)	product	MacB family efflux pump subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002247530.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14730
	CDS	complement(44405..45583)	product	MacA family efflux pump subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010951265.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14740
	CDS	45746..47542	product	glutamine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650680.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14750
			gene	glnS
	CDS	47546..47692	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005634891.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14760
	CDS	47767..48198	product	YcgN family cysteine cluster protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650678.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14770
	CDS	48562..49092	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14780
	CDS	49093..49347	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14790
	CDS	49344..50024	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14800
	CDS	50118..50318	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14810
	CDS	complement(50510..50827)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14820
	CDS	complement(50824..50961)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14830
	CDS	51245..51955	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14840
	CDS	51894..52313	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14850
	CDS	complement(52348..52767)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002211610.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14860
	CDS	complement(52810..52992)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14870
	CDS	complement(53402..53689)	product	50S ribosomal protein L25
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005691222.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14880
			gene	rplY
	CDS	53880..54500	product	DedA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996462.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14890
	CDS	54631..55419	product	TatD family hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693839.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14900
	CDS	complement(55416..55916)	product	anaerobic ribonucleoside-triphosphate reductase-activating protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693470.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14910
			gene	nrdG
	CDS	complement(56255..58381)	product	anaerobic ribonucleoside-triphosphate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693847.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14920
			gene	nrdD
	CDS	58662..59522	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14930
	CDS	complement(59658..60596)	product	tRNA 2-thiocytidine(32) synthetase TtcA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693987.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14940
			gene	ttcA
	CDS	60775..62109	product	chromosome partition protein MukF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869195.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14950
			gene	mukF
	CDS	62144..62881	product	chromosome partition protein MukE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693983.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14960
			gene	mukE
	CDS	62881..67410	product	chromosome partition protein MukB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693982.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14970
			gene	mukB
	CDS	67560..67775	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14980
	CDS	67762..68055	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_14990
	CDS	68238..68486	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15000
	CDS	68495..68881	product	type II toxin-antitoxin system toxin VapC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010970128.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15010
			gene	vapC
	CDS	complement(68931..71954)	product	glycoside hydrolase family 2 TIM barrel-domain containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002288607.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15020
	CDS	complement(71968..73251)	product	MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013099342.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15030
	CDS	73480..74484	product	LacI family DNA-binding transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_038420170.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15040
	CDS	complement(75059..76474)	product	exodeoxyribonuclease I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656746.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15050
			gene	sbcB
	CDS	complement(76474..76977)	product	NlpC/P60 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650361.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15060
	CDS	complement(77047..77340)	product	integration host factor subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652847.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15070
	CDS	complement(77343..79730)	product	phenylalanine--tRNA ligase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694456.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15080
			gene	pheT
	CDS	complement(79747..80229)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15090
	CDS	complement(80239..81228)	product	phenylalanine--tRNA ligase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694457.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15100
			gene	pheS
	CDS	complement(81298..81972)	product	RNA pseudouridine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693879.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15110
	CDS	82072..82623	product	NAD(P)H nitroreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693567.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15120
	CDS	complement(82688..83518)	product	PHP domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693963.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15130
	CDS	complement(83515..84537)	product	quinone-dependent dihydroorotate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693962.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15140
			gene	pyrD
	CDS	complement(84715..87336)	product	aminopeptidase N
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693625.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15150
			gene	pepN
	CDS	87460..88098	product	histidine phosphatase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003732846.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15160
	CDS	complement(88223..89539)	product	bifunctional tetrahydrofolate synthase/dihydrofolate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826312.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15170
			gene	folC
	CDS	complement(89558..90448)	product	acetyl-CoA carboxylase, carboxyltransferase subunit beta
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694317.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15180
			gene	accD
	CDS	complement(90520..91713)	product	cupin domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693774.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15190
	CDS	complement(91733..92032)	product	RnfH family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649214.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15200
	CDS	complement(92072..92938)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693980.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15210
	CDS	complement(92982..93953)	product	HTH-type transcriptional regulator CysB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667393.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15220
			gene	cysB
	CDS	complement(93962..95029)	product	23S rRNA pseudouridine(2605) synthase RluB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694244.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15230
			gene	rluB
	CDS	complement(95079..95702)	product	L-threonylcarbamoyladenylate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667400.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15240
	CDS	complement(96069..96356)	product	HigA family addiction module antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011103139.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15250
	CDS	complement(96675..97460)	product	tRNA pseudouridine(38-40) synthase TruA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693653.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15260
			gene	truA
sequence10	source	1..81342	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	352..582	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15270
	CDS	557..685	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15280
	CDS	676..1011	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15290
	CDS	complement(1155..1412)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15300
	CDS	complement(1470..2735)	product	M20 family metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694556.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15310
	CDS	complement(2781..4073)	product	C4-dicarboxylate transporter DcuC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007052501.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15320
			gene	dcuC
	CDS	complement(4083..4787)	product	dipeptidase PepE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995241.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15330
			gene	pepE
	CDS	complement(4997..5986)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15340
	CDS	6013..6219	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15350
	CDS	complement(6178..7983)	product	DUF3413 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693193.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15360
	CDS	complement(7999..8211)	product	YejL family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693192.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15370
	CDS	8316..9332	product	nucleoid-associated protein YejK
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869067.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15380
			gene	yejK
	CDS	9394..9807	product	outer membrane protein assembly factor BamE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693190.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15390
			gene	bamE
	CDS	9830..10531	product	envelope stress response regulator transcription factor CpxR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001033727.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15400
			gene	cpxR
	CDS	10582..12000	product	envelope stress sensor histidine kinase CpxA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005175902.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15410
			gene	cpxA
	tRNA	complement(12441..12530)	product	tRNA-Ser
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00380
	CDS	12715..14460	product	C4-dicarboxylic acid transporter DauA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011816539.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15420
			gene	dauA
	CDS	complement(14519..16375)	product	DEAD/DEAH box helicase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694061.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15430
	CDS	complement(16460..17305)	product	lipoprotein NlpI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694062.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15440
			gene	nlpI
	CDS	complement(17478..19601)	product	polyribonucleotide nucleotidyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_139988996.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15450
			gene	pnp
	CDS	19859..22351	product	ribonuclease R
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429007.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15460
			gene	rnr
	CDS	22367..23104	product	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655733.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15470
			gene	rlmB
	repeat_region	23252..24717	inference	COORDINATES:alignment:CRT:1.2
			rpt_family	CRISPR
			rpt_type	direct
			rpt_unit_seq	gtttcaatccctttgatacagggcaaggtctttcgac
	CDS	complement(24891..25181)	product	CRISPR-associated endonuclease Cas2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012546007.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15480
			gene	cas2
	CDS	complement(25190..26263)	product	CRISPR-associated endonuclease Cas1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012546247.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15490
			gene	cas1
	CDS	complement(26273..26557)	product	CRISPR-associated endonuclease Cas2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545199.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15500
			gene	cas2
	CDS	complement(26515..26652)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15510
	CDS	complement(27004..28137)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15520
	CDS	complement(28137..29309)	product	DUF1887 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005461150.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15530
	CDS	complement(29318..29608)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15540
	CDS	complement(29673..30593)	product	CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545643.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15550
			gene	cas6
	CDS	complement(30593..32122)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15560
	CDS	complement(32122..33066)	product	CRISPR-associated protein, Csm4 family
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012546365.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15570
	CDS	complement(33075..33776)	product	type III-A CRISPR-associated RAMP protein Csm3
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545508.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15580
			gene	csm3
	CDS	complement(33773..34183)	product	type III-A CRISPR-associated protein Csm2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012546668.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15590
			gene	csm2
	CDS	complement(34203..36812)	product	type III-A CRISPR-associated protein Cas10/Csm1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012545463.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15600
			gene	cas10
	CDS	complement(36896..37093)	product	YnbE family lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000698145.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15610
	CDS	complement(37090..39831)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15620
	CDS	complement(39888..40862)	product	zinc ABC transporter substrate-binding protein ZnuA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694411.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15630
			gene	znuA
	CDS	complement(40931..41695)	product	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_162627419.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15640
			gene	tcdA
	CDS	complement(41695..42804)	product	murein transglycosylase A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_112089645.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15650
			gene	mltA
	CDS	complement(42870..46214)	product	exodeoxyribonuclease V subunit gamma
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693290.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15660
			gene	recC
	CDS	complement(46295..46588)	product	DUF5374 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995601.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15670
	CDS	complement(46572..47249)	product	DUF2572 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869091.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15680
	CDS	complement(47246..47929)	product	type II secretion system protein J
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693287.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15690
	CDS	complement(47980..48510)	product	type II secretion system protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693285.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15700
	tRNA	complement(48863..48938)	product	tRNA-Lys
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00390
	CDS	complement(49150..49605)	product	peptidoglycan-associated lipoprotein Pal
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652235.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15710
			gene	pal
	CDS	complement(49628..50917)	product	Tol-Pal system beta propeller repeat protein TolB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693786.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15720
			gene	tolB
	CDS	complement(50950..52134)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15730
	CDS	complement(52172..52597)	product	colicin uptake protein TolR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649190.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15740
			gene	tolR
	CDS	complement(52670..53356)	product	protein TolQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649191.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15750
			gene	tolQ
	CDS	complement(53424..53801)	product	tol-pal system-associated acyl-CoA thioesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693784.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15760
			gene	ybgC
	CDS	complement(54086..55222)	product	cytochrome d ubiquinol oxidase subunit II
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656051.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15770
			gene	cydB
	CDS	complement(55235..56797)	product	cytochrome ubiquinol oxidase subunit I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869127.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15780
	CDS	57261..57578	product	DUF5339 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694353.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15790
	CDS	complement(57618..58625)	product	Holliday junction branch migration DNA helicase RuvB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694352.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15800
			gene	ruvB
	CDS	complement(58651..59265)	product	Holliday junction branch migration protein RuvA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694351.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15810
			gene	ruvA
	CDS	complement(59327..59899)	product	crossover junction endodeoxyribonuclease RuvC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694350.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15820
			gene	ruvC
	CDS	complement(59979..60425)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15830
	CDS	complement(60534..61274)	product	YebC/PmpR family DNA-binding transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649034.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15840
	CDS	complement(61608..62048)	product	dihydroneopterin triphosphate diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002211203.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15850
			gene	nudB
	CDS	complement(62096..63865)	product	aspartate--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694347.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15860
			gene	aspS
	CDS	63980..64705	product	carboxy-S-adenosyl-L-methionine synthase CmoA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694346.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15870
			gene	cmoA
	CDS	complement(64764..66092)	product	glycerol-3-phosphate transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003246460.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15880
			gene	glpT
	CDS	66286..66693	product	lactoylglutathione lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005688980.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15890
			gene	gloA
	CDS	66697..67374	product	ribonuclease T
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15900
			gene	rnt
	CDS	67421..68776	product	Na+/H+ antiporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694344.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15910
	CDS	68834..69412	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15920
	CDS	69479..70357	product	D-alanyl-D-alanine carboxypeptidase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693802.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15930
	CDS	complement(70403..72427)	product	NAD-dependent DNA ligase LigA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005665886.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15940
			gene	ligA
	CDS	complement(72502..73563)	product	cell division protein ZipA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693425.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15950
			gene	zipA
	CDS	73691..74533	product	sulfate transporter CysZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693426.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15960
			gene	cysZ
	CDS	74551..74889	product	carboxymuconolactone decarboxylase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651693.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15970
	CDS	complement(74927..75637)	product	UDP-2,3-diacylglucosamine diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693139.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15980
			gene	lpxH
	CDS	75715..76443	product	1-acylglycerol-3-phosphate O-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005689023.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_15990
	CDS	76444..77847	product	cell division protein FtsP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817210.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16000
			gene	ftsP
	CDS	complement(78076..78678)	product	3-isopropylmalate dehydratase small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693330.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16010
			gene	leuD
	CDS	complement(78715..80124)	product	3-isopropylmalate dehydratase large subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693329.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16020
			gene	leuC
	CDS	complement(80208..81173)	product	IS110 family transposase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002235716.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16030
sequence11	source	1..79272	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	rRNA	31..141	product	5S ribosomal RNA
			inference	COORDINATES:profile:Barrnap:0.8
			locus_tag	LOCUS_r00010
	CDS	388..1488	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16040
	CDS	complement(1659..1886)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16050
	CDS	complement(2372..2863)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16060
	CDS	complement(2864..3226)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16070
	CDS	complement(3354..3686)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16080
	CDS	complement(3814..4122)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16090
	CDS	4250..4609	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16100
	CDS	4609..5790	product	DUF2220 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002209174.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16110
	CDS	complement(5849..6307)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16120
	CDS	complement(6450..7133)	product	arginine ABC transporter permease ArtM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694264.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16130
			gene	artM
	CDS	complement(7133..7804)	product	arginine ABC transporter permease ArtQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694263.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16140
			gene	artQ
	CDS	complement(7808..8530)	product	lysine/arginine/ornithine ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694262.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16150
	CDS	complement(8539..9273)	product	arginine ABC transporter ATP-binding protein ArtP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694261.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16160
			gene	artP
	CDS	9591..10709	product	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_172454032.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16170
	CDS	10750..11301	product	type IV pilus biogenesis/stability protein PilW
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693799.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16180
			gene	pilW
	CDS	11399..12346	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693797.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16190
	CDS	12355..13470	product	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693796.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16200
			gene	ispG
	CDS	13494..14765	product	histidine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693795.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16210
			gene	hisS
	CDS	14776..15390	product	YfgM family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693794.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16220
	CDS	15549..16919	product	glutathione-disulfide reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694117.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16230
			gene	gorA
	CDS	complement(16957..17280)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16240
	CDS	17443..17694	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16250
	CDS	17803..20508	product	preprotein translocase subunit SecA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693259.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16260
			gene	secA
	CDS	20574..20978	product	8-oxo-dGTP diphosphatase MutT
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869085.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16270
			gene	mutT
	CDS	complement(21066..21329)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16280
	CDS	complement(21340..21543)	product	DNA gyrase inhibitor YacG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429021.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16290
			gene	yacG
	CDS	complement(21540..22157)	product	dephospho-CoA kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869082.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16300
			gene	coaE
	CDS	complement(22186..22860)	product	A24 family peptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694370.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16310
	CDS	complement(22857..24077)	product	type II secretion system F family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694369.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16320
	CDS	complement(24074..25456)	product	GspE/PulE family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694368.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16330
	CDS	complement(25533..25976)	product	prepilin-type N-terminal cleavage/methylation domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694367.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16340
	CDS	26084..26641	product	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694366.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16350
			gene	ampD
	CDS	complement(26708..27496)	product	nucleoside triphosphate pyrophosphohydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693705.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16360
			gene	mazG
	CDS	27659..28084	product	universal stress protein UspA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648375.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16370
			gene	uspA
	CDS	28268..30895	product	alanine--tRNA ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995486.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16380
			gene	alaS
	CDS	30981..31163	product	carbon storage regulator CsrA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632782.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16390
			gene	csrA
	CDS	31191..32555	product	phosphomannomutase CpsG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002208588.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16400
			gene	cpsG
	CDS	32635..33522	product	UTP--glucose-1-phosphate uridylyltransferase GalU
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693178.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16410
			gene	galU
	CDS	33669..34076	product	preprotein translocase subunit SecE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658616.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16420
			gene	secE
	CDS	34078..34635	product	transcription termination/antitermination protein NusG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648601.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16430
			gene	nusG
	CDS	34785..35957	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16440
	CDS	36099..36527	product	50S ribosomal protein L11
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005630840.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16450
			gene	rplK
	CDS	36532..37221	product	50S ribosomal protein L1
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649467.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16460
			gene	rplA
	CDS	37312..37476	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16470
	CDS	complement(38063..38557)	product	YfbU family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005760813.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16480
	CDS	complement(38567..39319)	product	VacJ family lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694634.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16490
	CDS	39666..40793	product	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002244304.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16500
			gene	carA
	CDS	40839..44045	product	carbamoyl-phosphate synthase large subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225779.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16510
			gene	carB
	CDS	44286..44822	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16520
	CDS	45086..45763	product	response regulator transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010931888.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16530
	CDS	45756..47102	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225641.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16540
	CDS	47338..47559	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16550
	CDS	47597..49222	product	phosphoethanolamine--lipid A transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002216735.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16560
	CDS	49324..49800	product	tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652354.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16570
			gene	trmL
	CDS	49917..52376	product	DNA topoisomerase (ATP-hydrolyzing) subunit B
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995225.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16580
			gene	gyrB
	CDS	complement(52447..53064)	product	glutathione S-transferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693808.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16590
	CDS	complement(53074..54321)	product	diaminopimelate decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693130.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16600
			gene	lysA
	CDS	complement(54331..54498)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16610
	CDS	complement(54619..56130)	product	CoA-acylating methylmalonate-semialdehyde dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011704254.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16620
	CDS	56348..57181	product	5-deoxy-glucuronate isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005174807.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16630
			gene	iolB
	CDS	57237..58382	product	Gfo/Idh/MocA family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005168149.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16640
	CDS	58958..59893	product	sugar ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007246965.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16650
	CDS	59962..60897	product	sugar ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005764495.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16660
	CDS	60937..62451	product	sugar ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010972980.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16670
	CDS	62489..63445	product	ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013530262.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16680
	CDS	complement(63589..64518)	product	GTPase Era
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005657841.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16690
			gene	era
	CDS	complement(64515..65189)	product	ribonuclease III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693887.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16700
			gene	rnc
	CDS	complement(65191..66213)	product	signal peptidase I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693886.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16710
			gene	lepB
	CDS	complement(66227..68023)	product	translation elongation factor 4
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649880.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16720
			gene	lepA
	CDS	complement(68204..68500)	product	HigA family addiction module antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_103019402.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16730
	CDS	complement(68833..69216)	product	autonomous glycyl radical cofactor GrcA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005628746.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16740
			gene	grcA
	CDS	69375..69557	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16750
	CDS	69484..70152	product	uracil-DNA glycosylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693885.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16760
			gene	ung
	CDS	70158..70925	product	peroxide stress protein YaaA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869102.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16770
			gene	yaaA
	CDS	70982..71599	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693323.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16780
	CDS	71789..76255	product	glutamate synthase large subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050077010.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16790
			gene	gltB
	CDS	76419..77822	product	glutamate synthase subunit GltD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000081695.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16800
			gene	gltD
	CDS	78065..78421	product	MmcQ/YjbR family DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011104332.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16810
	CDS	78709..79050	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16820
sequence12	source	1..71902	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(70..1401)	product	NAD(P)/FAD-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693148.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16830
	CDS	1564..2352	product	NAD(+) diphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693731.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16840
			gene	nudC
	CDS	2417..3481	product	uroporphyrinogen decarboxylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000137652.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16850
			gene	hemE
	CDS	3536..4123	product	YjaG family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693732.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16860
	CDS	4289..4564	product	HU family DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005630954.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16870
	CDS	4703..5476	product	DeoR/GlpR family DNA-binding transcription regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001906605.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16880
	CDS	5509..7341	product	glutamine--fructose-6-phosphate transaminase (isomerizing)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_112119346.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16890
			gene	glmS
	CDS	7545..8750	product	MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693428.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16900
	CDS	complement(8790..10049)	product	HlyC/CorC family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828395.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16910
	CDS	complement(10118..10891)	product	inner membrane protein YpjD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005167431.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16920
	CDS	11002..12402	product	signal recognition particle protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693814.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16930
			gene	ffh
	CDS	complement(12455..13444)	product	bile acid:sodium symporter family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_121651842.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16940
	CDS	complement(13490..14197)	product	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002211474.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16950
			gene	yigB
	CDS	complement(14215..15102)	product	tyrosine recombinase XerC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005692390.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16960
			gene	xerC
	CDS	complement(15137..15961)	product	diaminopimelate epimerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655521.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16970
			gene	dapF
	CDS	16134..16853	product	polyprenyl diphosphate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655860.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16980
			gene	uppS
	CDS	16864..17730	product	phosphatidate cytidylyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693266.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_16990
	CDS	17740..19068	product	RIP metalloprotease RseP
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693265.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17000
			gene	rseP
	CDS	19111..21483	product	outer membrane protein assembly factor BamA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693264.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17010
			gene	bamA
	CDS	21582..22127	product	OmpH family outer membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693263.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17020
	CDS	22147..23169	product	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693262.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17030
			gene	lpxD
	CDS	23358..24782	product	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649877.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17040
			gene	miaB
	CDS	24958..25134	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17050
	CDS	25134..25544	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17060
	CDS	25700..26359	product	amino acid ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014206470.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17070
	CDS	26361..27029	product	amino acid ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000418066.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17080
	CDS	27033..27797	product	amino acid ABC transporter ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001130360.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17090
	CDS	28076..28933	product	cysteine ABC transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_014206472.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17100
	CDS	29186..31462	product	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002287901.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17110
			gene	gshAB
	CDS	31476..31880	product	nucleotidyltransferase substrate binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693848.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17120
	CDS	31883..32188	product	nucleotidyltransferase domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693849.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17130
	CDS	32194..33282	product	PhoH family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002210345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17140
	CDS	33388..34512	product	Fic family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_212639319.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17150
	CDS	complement(34595..34894)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17160
	CDS	complement(34907..35140)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17170
	CDS	complement(35199..35624)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17180
	CDS	complement(35673..36254)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17190
	CDS	36393..36728	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17200
	CDS	36787..37410	product	thiamine diphosphokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010921882.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17210
	CDS	37414..37881	product	rRNA maturation RNase YbeY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663323.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17220
			gene	ybeY
	CDS	38228..40012	product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050298646.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17230
	CDS	40019..40189	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17240
	CDS	40306..41826	product	carbon starvation protein A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011706437.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17250
	CDS	42088..42546	product	division/cell wall cluster transcriptional repressor MraZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686427.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17260
			gene	mraZ
	CDS	42685..43659	product	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651812.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17270
			gene	rsmH
	CDS	43659..43988	product	cell division protein FtsL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647600.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17280
			gene	ftsL
	CDS	43995..45830	product	peptidoglycan synthase FtsI
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693446.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17290
	CDS	45859..47328	product	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693448.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17300
			gene	murE
	CDS	47325..48695	product	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006996536.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17310
			gene	murF
	CDS	48702..49784	product	phospho-N-acetylmuramoyl-pentapeptide-transferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651824.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17320
			gene	mraY
	CDS	49835..51154	product	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693450.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17330
			gene	murD
	CDS	51158..52348	product	putative lipid II flippase FtsW
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005661306.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17340
			gene	ftsW
	CDS	52374..53438	product	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693451.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17350
			gene	murG
	CDS	53487..54917	product	UDP-N-acetylmuramate--L-alanine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693453.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17360
			gene	murC
	CDS	54945..55868	product	D-alanine--D-alanine ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693454.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17370
	CDS	55868..56635	product	cell division protein FtsQ/DivIB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693455.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17380
	CDS	56667..57959	product	cell division protein FtsA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693456.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17390
			gene	ftsA
	CDS	58041..59258	product	cell division protein FtsZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_139990268.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17400
			gene	ftsZ
	CDS	59301..60218	product	UDP-3-O-acyl-N-acetylglucosamine deacetylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693459.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17410
			gene	lpxC
	CDS	60312..61466	product	alcohol dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817209.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17420
			gene	yqhD
	CDS	61523..63172	product	bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011816863.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17430
			gene	ushA
	CDS	63436..64596	product	prephenate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647570.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17440
			gene	pheA
	CDS	complement(64647..64982)	product	zinc ribbon domain-containing protein YjdM
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652591.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17450
	CDS	complement(65075..65839)	product	TerC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693866.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17460
	CDS	complement(65899..66567)	product	DNA mismatch repair endonuclease MutH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693765.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17470
			gene	mutH
	CDS	complement(66595..67134)	product	methylated-DNA--[protein]-cysteine S-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828387.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17480
	CDS	complement(67184..68482)	product	OmpP1/FadL family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693768.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17490
	CDS	68789..68965	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17500
	CDS	68998..70548	product	2-isopropylmalate synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693326.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17510
			gene	leuA
	CDS	70669..71745	product	3-isopropylmalate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693328.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17520
			gene	leuB
sequence13	source	1..68712	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	assembly_gap	2955..2966	estimated_length	known
			gap_type	within scaffold
			linkage_evidence	paired-ends
	rRNA	3084..3194	product	5S ribosomal RNA
			inference	COORDINATES:profile:Barrnap:0.8
			locus_tag	LOCUS_r00020
	rRNA	3249..3359	product	5S ribosomal RNA
			inference	COORDINATES:profile:Barrnap:0.8
			locus_tag	LOCUS_r00030
	tRNA	3375..3451	product	tRNA-Asp
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00400
	tRNA	3464..3539	product	tRNA-Trp
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00410
	CDS	complement(3629..4498)	product	DMT family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001260364.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17530
	CDS	complement(4585..5769)	product	mannonate dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667994.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17540
			gene	uxuA
	CDS	complement(5799..6554)	product	GntR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649802.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17550
	CDS	complement(6569..8950)	product	glycoside hydrolase family 31 protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002209892.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17560
	CDS	complement(8968..10269)	product	TRAP transporter large permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005461370.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17570
	CDS	complement(10281..10772)	product	TRAP transporter small permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005461368.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17580
	CDS	11022..12008	product	TRAP transporter substrate-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005449968.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17590
	CDS	12037..12918	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005668002.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17600
	CDS	12929..14332	product	glucuronate isomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005477444.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17610
			gene	uxaC
	CDS	14339..15286	product	sugar kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693872.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17620
	CDS	15304..15942	product	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693874.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17630
	CDS	complement(16205..18214)	product	oligopeptide transporter, OPT family
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005669465.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17640
	CDS	complement(18299..18925)	product	7-carboxy-7-deazaguanine synthase QueE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686506.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17650
	CDS	complement(18922..19341)	product	6-carboxytetrahydropterin synthase QueD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663812.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17660
			gene	queD
	CDS	complement(19334..20017)	product	7-cyano-7-deazaguanine synthase QueC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002225597.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17670
			gene	queC
	CDS	complement(20129..22699)	product	ATP-dependent chaperone ClpB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_112130572.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17680
			gene	clpB
	CDS	complement(23005..24411)	product	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694643.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17690
			gene	rsmB
	CDS	complement(24408..25361)	product	methionyl-tRNA formyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694641.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17700
			gene	fmt
	CDS	complement(25407..26456)	product	beta-N-acetylhexosaminidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693307.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17710
			gene	nagZ
	CDS	complement(26463..26813)	product	DUF1425 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647993.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17720
	CDS	complement(26843..27193)	product	purine nucleoside phosphoramidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005627389.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17730
			gene	hinT
	CDS	27598..28458	product	formate transporter FocA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694105.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17740
			gene	focA
	CDS	28563..30887	product	formate C-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005653814.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17750
			gene	pflB
	CDS	30977..31261	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17760
			note	possible pseudo, frameshifted
	CDS	31272..31640	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17770
			note	possible pseudo, frameshifted
	CDS	complement(31854..32585)	product	16S rRNA (uracil(1498)-N(3))-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694361.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17780
			gene	rsmE
	CDS	complement(32588..34009)	product	signal recognition particle-docking protein FtsY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826258.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17790
			gene	ftsY
	CDS	34050..34670	product	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693161.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17800
			gene	rsmD
	CDS	34754..35269	product	peptide deformylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694639.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17810
			gene	def
	CDS	35331..36488	product	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693305.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17820
			gene	rlmC
	CDS	complement(36547..37389)	product	RNA polymerase sigma factor RpoH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694033.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17830
			gene	rpoH
	CDS	complement(37522..37836)	product	DUF2322 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002222730.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17840
	CDS	complement(37848..38873)	product	UDP-N-acetylmuramate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694036.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17850
			gene	murB
	CDS	complement(38988..40196)	product	sodium/glutamate symporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693557.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17860
			gene	gltS
	CDS	complement(40368..40868)	product	GNAT family N-acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004527197.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17870
	CDS	complement(40878..42566)	product	nitrate/nitrite two-component system sensor histidine kinase NarQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694037.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17880
			gene	narQ
	CDS	complement(42614..43225)	product	HTH-type transcriptional repressor FabR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005629669.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17890
			gene	fabR
	CDS	complement(43227..44129)	product	DNA-binding transcriptional regulator OxyR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649559.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17900
			gene	oxyR
	CDS	44273..44998	product	redoxin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694168.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17910
	CDS	complement(45076..46578)	product	DUF853 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_023853666.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17920
	CDS	46705..47169	product	YchJ family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694029.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17930
	CDS	47251..48420	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011167098.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17940
	CDS	48422..49492	product	DNA cytosine methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001106909.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17950
	CDS	49495..50217	product	site-specific DNA-methyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000614886.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17960
	CDS	50227..51099	product	virulence factor BrkB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005656225.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17970
	CDS	51096..51533	product	D-aminoacyl-tRNA deacylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694618.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17980
			gene	dtd
	CDS	complement(51615..52181)	product	acetate uptake transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000528527.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_17990
			gene	satP
	CDS	52461..55076	product	bifunctional acetaldehyde-CoA/alcohol dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011836312.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18000
			gene	adhE
	CDS	55261..56250	product	2-hydroxyacid dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002222131.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18010
	CDS	complement(56291..56932)	product	orotate phosphoribosyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686697.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18020
			gene	pyrE
	CDS	complement(56999..57715)	product	ribonuclease PH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005632808.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18030
			gene	rph
	CDS	57831..58694	product	YicC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693694.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18040
	CDS	58698..59522	product	folate-binding protein YgfZ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693695.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18050
	CDS	complement(59674..60150)	product	transcription elongation factor GreB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694166.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18060
			gene	greB
	CDS	60283..60867	product	Fe-S biogenesis protein NfuA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693730.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18070
			gene	nfuA
	CDS	complement(60864..61298)	product	SoxR reducing system RseC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005670174.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18080
	CDS	complement(61399..61947)	product	RseA family anti-sigma factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651258.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18090
	CDS	complement(61972..62547)	product	RNA polymerase sigma factor RpoE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658683.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18100
			gene	rpoE
	CDS	complement(62647..62898)	product	succinate dehydrogenase assembly factor 2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694645.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18110
	CDS	complement(62915..63547)	product	pyridoxamine 5'-phosphate oxidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002222336.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18120
			gene	pdxH
	CDS	63676..65052	product	Trk system potassium transporter TrkA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694644.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18130
			gene	trkA
	CDS	65182..65565	product	large-conductance mechanosensitive channel protein MscL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005658680.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18140
			gene	mscL
	CDS	65620..66042	product	ribonuclease E inhibitor RraB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995269.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18150
			gene	rraB
	CDS	complement(66179..67129)	product	type I pantothenate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005667563.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18160
			gene	coaA
	tRNA	67343..67418	product	tRNA-Thr
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00420
	tRNA	67446..67530	product	tRNA-Tyr
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00430
	tRNA	67567..67641	product	tRNA-Gly
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00440
	tRNA	67649..67724	product	tRNA-Thr
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00450
sequence14	source	1..54273	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	177..2060	product	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000963533.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18170
			gene	aceF
	CDS	2114..3538	product	dihydrolipoyl dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005663527.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18180
			gene	lpdA
	CDS	3785..4327	product	NlpC/P60 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005659678.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18190
	CDS	complement(4479..5837)	product	metalloprotease PmbA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693467.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18200
			gene	pmbA
	CDS	5956..6501	product	ribosome biogenesis factor YjgA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651852.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18210
			gene	yjgA
	CDS	complement(6720..7400)	product	M15 family metallopeptidase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005172351.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18220
	CDS	complement(7402..8532)	product	succinyl-diaminopimelate desuccinylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693818.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18230
			gene	dapE
	CDS	complement(8529..8858)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18240
	CDS	complement(8836..9183)	product	ArsC family reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693817.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18250
	CDS	complement(9233..10507)	product	threonine synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693831.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18260
			gene	thrC
	CDS	complement(10578..11525)	product	homoserine kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654296.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18270
			gene	thrB
	CDS	complement(11525..13981)	product	bifunctional aspartate kinase/homoserine dehydrogenase I
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693830.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18280
			gene	thrA
	CDS	complement(14273..14821)	product	superoxide dismutase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002216968.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18290
	CDS	14916..15614	product	YggS family pyridoxal phosphate-dependent enzyme
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693829.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18300
	CDS	complement(15765..17042)	product	UDP-N-acetylglucosamine 1-carboxyvinyltransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693405.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18310
			gene	murA
	CDS	complement(17066..17323)	product	BolA family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686372.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18320
	CDS	complement(17335..17703)	product	lipid asymmetry maintenance protein MlaB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693407.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18330
	CDS	complement(17710..18345)	product	phospholipid-binding protein MlaC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693408.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18340
			gene	mlaC
	CDS	complement(18373..18864)	product	outer membrane lipid asymmetry maintenance protein MlaD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693409.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18350
			gene	mlaD
	CDS	complement(18900..19679)	product	lipid asymmetry maintenance ABC transporter permease subunit MlaE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693411.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18360
			gene	mlaE
	CDS	complement(19676..20485)	product	phospholipid ABC transporter ATP-binding protein MlaF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693412.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18370
			gene	mlaF
	CDS	complement(20555..22261)	product	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826344.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18380
			gene	menD
	CDS	complement(22320..23591)	product	isochorismate synthase MenF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_061720832.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18390
	CDS	23757..24974	product	pyridoxal phosphate-dependent aminotransferase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694022.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18400
	CDS	25027..25701	product	CsgG/HfaB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005172134.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18410
	CDS	25711..26055	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18420
	CDS	26066..26728	product	DUF799 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002217218.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18430
	CDS	complement(26809..27624)	product	pyrroline-5-carboxylate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694358.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18440
			gene	proC
	CDS	27687..28589	product	recombination-associated protein RdgC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694359.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18450
			gene	rdgC
	CDS	28768..29088	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18460
	CDS	complement(29136..29825)	product	DnaA regulatory inactivator Hda
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694288.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18470
			gene	hda
	CDS	complement(29826..33302)	product	DNA polymerase III subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693144.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18480
			gene	dnaE
	CDS	complement(33468..34757)	product	hemolysin family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_136429435.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18490
	CDS	complement(34760..35284)	product	DUF1523 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652096.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18500
	CDS	complement(35325..36107)	product	YchF/TatD family DNA exonuclease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_116972861.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18510
	CDS	36353..37771	product	DASS family sodium-coupled anion symporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000827961.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18520
	CDS	complement(37811..39850)	product	oligopeptidase A
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032826366.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18530
			gene	prlC
	CDS	39962..40810	product	co-chaperone YbbN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_075985340.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18540
	CDS	40871..41824	product	thioredoxin-disulfide reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693473.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18550
			gene	trxB
	CDS	42056..43819	product	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693472.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18560
			gene	cydD
	CDS	44110..45840	product	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693471.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18570
			gene	cydC
	CDS	complement(46063..47202)	product	ribonuclease D
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013526513.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18580
			gene	rnd
	CDS	complement(47255..48937)	product	long-chain-fatty-acid--CoA ligase FadD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693780.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18590
			gene	fadD
	CDS	complement(48995..49564)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18600
	CDS	complement(49601..50314)	product	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693782.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18610
			gene	tsaB
	CDS	complement(50318..52243)	product	ATP-dependent DNA helicase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693783.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18620
	CDS	52304..53110	product	D-hexose-6-phosphate mutarotase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005650376.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18630
	CDS	complement(53161..54114)	product	AEC family transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005172553.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18640
sequence15	source	1..51932	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(274..1083)	product	ParA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005895559.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18650
	CDS	complement(1391..2089)	product	site-specific integrase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000142493.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18660
			note	possible pseudo, frameshifted
	CDS	complement(2282..4315)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18670
	CDS	4576..5676	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18680
	CDS	5685..6143	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18690
	CDS	6433..6726	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18700
	CDS	6798..7421	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18710
	CDS	7425..7592	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18720
	CDS	7631..7873	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18730
	CDS	complement(7908..8180)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18740
	CDS	8434..8697	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18750
	CDS	8720..9271	product	DUF5420 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693506.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18760
	CDS	complement(9434..9568)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18770
	CDS	complement(9655..9783)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18780
	CDS	complement(9785..10018)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18790
	CDS	complement(10134..10436)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18800
	CDS	complement(10405..10659)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18810
	CDS	complement(10742..11206)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18820
	CDS	complement(11335..11616)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18830
	CDS	complement(11678..12667)	product	zincin-like metallopeptidase domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_150388385.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18840
	CDS	complement(12645..13190)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18850
	CDS	13949..15733	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18860
	CDS	15723..16253	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18870
	CDS	16385..16765	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18880
	CDS	17037..17351	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18890
	CDS	17360..17776	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18900
	CDS	17903..19162	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013228075.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18910
	CDS	19162..19830	product	RloB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013228074.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18920
	CDS	complement(19916..20305)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18930
	CDS	20443..20730	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18940
	CDS	complement(20804..21361)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18950
	CDS	complement(21358..21699)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18960
	CDS	complement(21897..22301)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18970
	CDS	complement(22345..24357)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18980
	CDS	complement(24377..25327)	product	TIGR03756 family integrating conjugative element protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_024483820.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_18990
	CDS	complement(25320..25796)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19000
	CDS	25949..26128	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19010
	CDS	complement(26199..26894)	product	TIGR03747 family integrating conjugative element membrane protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000081046.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19020
	CDS	complement(26917..29049)	product	type IV conjugative transfer system coupling protein TraD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015038880.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19030
			gene	traD
	CDS	complement(29046..29570)	product	integrating conjugative element protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_162526859.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19040
	CDS	complement(29621..30415)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19050
	CDS	complement(30394..31164)	product	TIGR03759 family integrating conjugative element protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000734461.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19060
	CDS	31294..31563	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19070
	CDS	complement(31470..32180)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19080
	CDS	complement(32389..33288)	product	outer membrane protein assembly factor BamE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004184872.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19090
			gene	bamE
	CDS	complement(33351..35873)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19100
	CDS	complement(36238..36711)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19110
	CDS	complement(36812..37462)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19120
	CDS	complement(37548..37877)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19130
	CDS	complement(37960..38406)	product	virulence-associated protein VapD
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002219746.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19140
	CDS	complement(38440..38697)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19150
	CDS	complement(38773..38943)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19160
	CDS	complement(38945..39265)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19170
	CDS	complement(39456..39737)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19180
	CDS	complement(39856..40266)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19190
	CDS	complement(41139..43169)	product	DNA topoisomerase III
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015038895.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19200
	CDS	43364..44005	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19210
	CDS	complement(43962..44261)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19220
	CDS	complement(44281..44493)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19230
	CDS	complement(44617..45051)	product	single-stranded DNA-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003114685.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19240
			gene	ssb
	CDS	complement(45208..45396)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19250
	CDS	complement(45756..46235)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19260
	CDS	complement(46254..46970)	product	TIGR03761 family integrating conjugative element protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817112.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19270
	CDS	complement(47213..48400)	product	STY4528 family pathogenicity island replication protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_016190692.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19280
	CDS	complement(48471..49031)	product	DUF2857 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_007372575.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19290
	CDS	complement(49024..50745)	product	ParB family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_150625513.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19300
	misc_feature	complement(50748..>51932)	inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_001059486.1:SPI-7-type island replicative DNA helicase
			locus_tag	LOCUS_19310
sequence16	source	1..41444	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(179..1876)	product	fructose-specific PTS transporter subunit EIIC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693715.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19320
	CDS	complement(1880..2824)	product	1-phosphofructokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693714.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19330
			gene	fruK
	CDS	complement(2830..4323)	product	fused PTS fructose transporter subunit IIA/HPr protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693713.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19340
			gene	fruB
	CDS	complement(4384..4896)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005686915.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19350
	CDS	4919..5113	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19360
	CDS	5136..5324	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19370
	CDS	5348..6205	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19380
	CDS	complement(6258..6806)	product	TIGR00645 family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649445.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19390
	CDS	complement(6862..7176)	product	thiosulfate sulfurtransferase GlpE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694604.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19400
			gene	glpE
	CDS	complement(7124..8629)	product	DNA recombination protein RmuC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649434.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19410
	CDS	8761..9321	product	type I DNA topoisomerase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694485.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19420
	CDS	complement(9318..10316)	product	2-keto-3-deoxygluconate permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015063967.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19430
	CDS	complement(10352..11107)	product	DeoR/GlpR family DNA-binding transcription regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015366720.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19440
	CDS	complement(11118..12188)	product	ATP-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011107381.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19450
	CDS	complement(12470..13696)	product	four-carbon acid sugar kinase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015063966.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19460
	CDS	complement(13698..14690)	product	2-keto-3-deoxygluconate permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015063967.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19470
	CDS	complement(14701..15702)	product	D-threonate 4-phosphate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001059575.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19480
	CDS	complement(15712..15957)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19490
	CDS	16127..16744	product	glutathione S-transferase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011837317.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19500
	CDS	16746..17297	product	Sua5/YciO/YrdC/YwlC family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694486.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19510
	CDS	17300..18097	product	shikimate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694487.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19520
			gene	aroE
	CDS	complement(18197..18955)	product	DeoR/GlpR family DNA-binding transcription regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_168769345.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19530
	CDS	19131..20036	product	NAD(P)-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005665973.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19540
	CDS	20036..21280	product	four-carbon acid sugar kinase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693348.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19550
	CDS	21277..21909	product	aldolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005647883.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19560
	CDS	21912..22688	product	hydroxypyruvate isomerase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693349.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19570
	CDS	22838..23524	product	cyclase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_115248746.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19580
	CDS	23587..24300	product	glycerol uptake facilitator protein GlpF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001272193.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19590
			gene	glpF
	CDS	24636..26642	product	transketolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995655.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19600
			gene	tkt
	CDS	26712..27182	product	low molecular weight protein-tyrosine-phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003702839.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19610
	CDS	complement(27216..28199)	product	tRNA dihydrouridine(20/20a) synthase DusA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694659.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19620
			gene	dusA
	CDS	28321..29364	product	L-asparaginase 2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652322.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19630
			gene	ansB
	CDS	complement(29557..29727)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19640
	CDS	complement(29718..29975)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19650
	CDS	complement(30585..31832)	product	ATP-dependent RNA helicase RhlB
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828332.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19660
			gene	rhlB
	CDS	32035..33297	product	transcription termination factor Rho
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648966.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19670
			gene	rho
	CDS	complement(33369..34511)	product	acetylornithine deacetylase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013099301.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19680
			gene	argE
	CDS	34616..35626	product	N-acetyl-gamma-glutamyl-phosphate reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_015703956.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19690
			gene	argC
	CDS	35628..36401	product	acetylglutamate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_020686923.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19700
			gene	argB
	CDS	36498..37874	product	argininosuccinate lyase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693177.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19710
			gene	argH
	CDS	complement(37944..38771)	product	MetQ/NlpA family lipoprotein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694548.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19720
	CDS	complement(38800..39489)	product	ABC transporter permease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005459160.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19730
	CDS	complement(39479..40516)	product	methionine ABC transporter ATP-binding protein MetN
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648552.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19740
			gene	metN
	CDS	40693..41247	product	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694551.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19750
			gene	gmhB
sequence17	source	1..36553	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	rRNA	31..141	product	5S ribosomal RNA
			inference	COORDINATES:profile:Barrnap:0.8
			locus_tag	LOCUS_r00040
	CDS	336..1172	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19760
	CDS	complement(1185..3038)	product	DNA helicase RecQ
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693132.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19770
			gene	recQ
	CDS	complement(3039..3350)	product	iron donor protein CyaY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655473.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19780
			gene	cyaY
	CDS	complement(3439..6765)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19790
	CDS	complement(6862..7872)	product	inositol 2-dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004083264.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19800
			gene	iolG
	CDS	complement(7890..8786)	product	myo-inosose-2 dehydratase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011817366.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19810
			gene	iolE
	CDS	complement(8858..10801)	product	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011268320.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19820
			gene	iolD
	CDS	11142..12578	product	D-xylose transporter XylE
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001097267.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19830
			gene	xylE
	CDS	12591..14510	product	5-dehydro-2-deoxygluconokinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_050164505.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19840
			gene	iolC
	CDS	14636..15478	product	MurR/RpiR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005157438.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19850
	CDS	15491..16225	product	peptidoglycan editing factor PgeF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694112.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19860
			gene	pgeF
	CDS	16474..16845	product	50S ribosomal protein L14
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005548786.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19870
			gene	rplN
	CDS	16856..17167	product	50S ribosomal protein L24
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005635734.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19880
			gene	rplX
	CDS	17185..17724	product	50S ribosomal protein L5
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625881.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19890
			gene	rplE
	CDS	17736..18041	product	30S ribosomal protein S14
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625879.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19900
			gene	rpsN
	CDS	18079..18471	product	30S ribosomal protein S8
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625877.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19910
			gene	rpsH
	CDS	18487..19020	product	50S ribosomal protein L6
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005655593.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19920
			gene	rplF
	CDS	19034..19387	product	50S ribosomal protein L18
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625873.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19930
			gene	rplR
	CDS	19402..19902	product	30S ribosomal protein S5
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005625871.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19940
			gene	rpsE
	CDS	19909..20088	product	50S ribosomal protein L30
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693169.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19950
			gene	rpmD
	CDS	20093..20527	product	50S ribosomal protein L15
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648410.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19960
			gene	rplO
	CDS	20535..21860	product	preprotein translocase subunit SecY
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005652382.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19970
			gene	secY
	CDS	22142..22498	product	30S ribosomal protein S13
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648406.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19980
			gene	rpsM
	CDS	22514..22903	product	30S ribosomal protein S11
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005543603.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_19990
			gene	rpsK
	CDS	22933..23553	product	30S ribosomal protein S4
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693170.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20000
			gene	rpsD
	CDS	23586..24575	product	DNA-directed RNA polymerase subunit alpha
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648402.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20010
			gene	rpoA
	CDS	24615..24998	product	50S ribosomal protein L17
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005648400.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20020
			gene	rplQ
	CDS	complement(25229..26527)	product	ammonium transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004526016.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20030
	CDS	complement(26556..26894)	product	P-II family nitrogen regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003812004.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20040
	CDS	complement(27118..28110)	product	aspartate--ammonia ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005654693.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20050
			gene	asnA
	CDS	28279..28731	product	transcriptional regulator AsnC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005649540.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20060
			gene	asnC
	CDS	complement(28745..30277)	product	YifB family Mg chelatase-like AAA ATPase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013527838.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20070
	CDS	complement(30380..30997)	product	ribosome biogenesis GTP-binding protein YihA/YsxC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005651790.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20080
			gene	yihA
	CDS	31248..32525	product	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005666220.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20090
			gene	nadR
	CDS	32535..33221	product	metallophosphoesterase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693159.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20100
	CDS	complement(33301..33555)	product	sulfurtransferase TusA
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010869042.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20110
			gene	tusA
	CDS	33622..34227	product	YigZ family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_032828482.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20120
	CDS	34242..35705	product	Trk system potassium transporter TrkH
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005176271.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20130
			gene	trkH
	CDS	35705..36217	product	menaquinone-dependent protoporphyrinogen IX dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005465051.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20140
			gene	hemG
sequence18	source	1..34789	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	293..700	product	DUF2000 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003974764.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20150
	CDS	complement(781..1305)	product	TetR/AcrR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010963525.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20160
	CDS	1475..2224	product	glucose 1-dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000653653.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20170
	CDS	2451..2771	product	metalloregulator ArsR/SmtB family transcription factor
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003689616.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20180
	CDS	2885..4096	product	NADH:flavin oxidoreductase/NADH oxidase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011262931.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20190
	CDS	4173..5045	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011921895.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20200
	CDS	5245..6090	product	KilA-N domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004804477.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20210
	CDS	6291..7283	product	RhuM family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011070741.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20220
			gene	rhuM
	CDS	complement(7340..8230)	product	LysR substrate-binding domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005464957.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20230
	CDS	8353..8967	product	DsbA family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013529481.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20240
	CDS	complement(9050..9949)	product	LysR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013529480.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20250
	CDS	10055..11194	product	NADH-dependent flavin oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011101366.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20260
	CDS	complement(11297..12409)	product	alpha/beta fold hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000859695.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20270
	CDS	complement(12420..14075)	product	carboxylesterase/lipase family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_084146450.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20280
	CDS	complement(14145..14987)	product	aldo/keto reductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004080532.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20290
	CDS	15103..15990	product	LysR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013530541.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20300
	CDS	16122..16427	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20310
	CDS	16428..17657	product	HipA domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001173917.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20320
	CDS	17731..17988	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20330
	CDS	complement(18077..19168)	product	extracellular solute-binding protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013227324.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20340
	CDS	complement(19195..20028)	product	MBL fold metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011073321.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20350
	CDS	20138..21028	product	LysR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005173375.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20360
	CDS	21264..21818	product	Raf kinase inhibitor-like protein YbcL
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001306955.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20370
			gene	ybcL
	CDS	complement(21828..22697)	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003691028.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20380
	CDS	22920..23363	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20390
	CDS	23584..24012	product	Dps family protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001041894.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20400
	CDS	complement(24185..25912)	product	group II intron reverse transcriptase/maturase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_235893157.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20410
			gene	ltrA
	CDS	complement(27496..28515)	product	type I glyceraldehyde-3-phosphate dehydrogenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005646416.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20420
			gene	gap
	CDS	28796..29422	product	guanylate kinase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693898.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20430
			gene	gmk
	CDS	29485..29790	product	DNA-directed RNA polymerase subunit omega
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693900.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20440
			gene	rpoZ
	CDS	29860..31719	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20450
	CDS	31723..33807	product	ATP-dependent DNA helicase RecG
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693902.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20460
			gene	recG
	CDS	33867..34673	product	glutamate racemase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_006995756.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20470
			gene	murI
sequence19	source	1..22399	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(101..709)	product	DUF1349 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012775494.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20480
	CDS	complement(810..1715)	product	LysR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011088296.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20490
	CDS	1817..2398	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003642965.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20500
	CDS	2412..3245	product	SDR family oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011101946.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20510
	CDS	3261..3722	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20520
	CDS	3953..4561	product	TIR domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011030355.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20530
	CDS	4626..6656	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20540
	CDS	6673..7284	product	TIR domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011183217.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20550
	CDS	7307..8170	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20560
	CDS	complement(8242..8823)	product	NAD(P)H-dependent oxidoreductase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_003693637.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20570
	CDS	complement(8980..9504)	product	SRPBCC domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013094816.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20580
	CDS	9673..10569	product	LysR family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_013094814.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20590
	CDS	complement(10628..11050)	product	type II toxin-antitoxin system VapC family toxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005766948.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20600
	CDS	complement(11060..11326)	product	type II toxin-antitoxin system prevent-host-death family antitoxin
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005766946.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20610
	CDS	11536..12951	product	MDR family MFS transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000993830.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20620
	CDS	12953..13156	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20630
	CDS	13156..13383	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20640
	CDS	13716..14087	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20650
	CDS	14189..14722	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20660
	CDS	14741..16246	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20670
	CDS	16271..17338	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20680
	CDS	17310..18044	product	SprT family zinc-dependent metalloprotease
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_167939808.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20690
	CDS	complement(18122..21190)	product	efflux RND transporter permease subunit
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011140808.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20700
	CDS	complement(21340..22185)	product	MBL fold metallo-hydrolase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011103734.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20710
sequence20	source	1..8368	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(58..4332)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20720
	CDS	complement(4472..4786)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20730
	CDS	complement(5083..5511)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20740
	misc_feature	complement(5513..>8368)	inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_013098820.1:contact-dependent inhibition effector 16S rRNA endonuclease
			locus_tag	LOCUS_20750
sequence21	source	1..7855	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(496..1701)	product	sodium/glutamate symporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693557.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20760
			gene	gltS
	CDS	2145..2465	product	antibiotic biosynthesis monooxygenase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000562370.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20770
	CDS	2458..2844	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000460651.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20780
	CDS	2915..3538	product	winged helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001284954.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20790
	CDS	complement(3516..4139)	product	tetracycline resistance transcriptional repressor TetR(B)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001322387.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20800
			gene	tetR(B)
	CDS	4221..5426	product	tetracycline efflux MFS transporter Tet(B)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001089068.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20810
			gene	tet(B)
	CDS	complement(5539..6132)	product	tetracyline resistance-associated transcriptional repressor TetC
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001366182.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20820
			gene	tetC
	CDS	6220..6636	product	AraC family transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000275180.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20830
sequence22	source	1..7248	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	158..910	product	alpha/beta hydrolase-fold protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002289836.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20840
	CDS	1236..2654	product	membrane-bound lytic murein transglycosylase MltF
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694060.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20850
			gene	mltF
	CDS	2669..2821	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20860
	CDS	2893..3057	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20870
	CDS	3172..3684	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20880
	CDS	complement(3807..4382)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20890
	CDS	complement(4491..5498)	product	class 1 fructose-bisphosphatase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005693654.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20900
			gene	fbp
	CDS	5676..7055	product	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_005694412.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20910
			gene	mpl
sequence23	source	1..6847	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	2..769	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011037507.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20920
	CDS	complement(846..1454)	product	DUF1349 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_012775494.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20930
	CDS	1629..2084	product	DUF411 domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004552138.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20940
	CDS	2098..3645	product	multicopper oxidase CueO
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_002858205.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20950
			gene	cueO
	CDS	complement(3715..4719)	product	ACR3 family arsenite efflux transporter
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_011070874.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20960
			gene	arsB
	CDS	complement(4719..5132)	product	arsenate reductase (glutaredoxin)
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_010922177.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20970
			gene	arsC
	CDS	complement(5184..5498)	product	helix-turn-helix domain-containing protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_049049137.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20980
	CDS	5784..6413	product	FMN-binding negative transcriptional regulator
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_004521852.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_20990
	CDS	complement(6485..6673)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21000
sequence24	source	1..5667	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	misc_feature	<1..592	inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			note	partial CDS similar to WP_001082319.1:aminoglycoside O-phosphotransferase APH(3'')-Ib
			locus_tag	LOCUS_21010
	CDS	598..1302	product	aminoglycoside O-phosphotransferase APH(6)-Id
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_000480968.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21020
	CDS	2844..3149	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21030
	CDS	3146..4117	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21040
	CDS	complement(4065..4322)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21050
	CDS	4395..5210	product	sulfonamide-resistant dihydropteroate synthase Sul2
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			inference	similar to AA sequence:RefSeq:WP_001043260.1
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21060
			gene	sul2
sequence25	source	1..1632	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	tRNA	complement(25..100)	product	tRNA-Ala
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00460
	tRNA	complement(161..237)	product	tRNA-Ile
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00470
sequence26	source	1..1537	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	CDS	complement(410..937)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21070
	CDS	complement(1172..1294)	product	hypothetical protein
			inference	COORDINATES:ab initio prediction:MetaGeneAnnotator
			transl_table	11
			codon_start	1
			locus_tag	LOCUS_21080
sequence27	source	1..1068	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
	tRNA	complement(718..793)	product	tRNA-Ala
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00480
	tRNA	complement(854..930)	product	tRNA-Ile
			inference	COORDINATES:profile:Aragorn:1.2.38
			locus_tag	LOCUS_t00490
sequence28	source	1..461	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
sequence29	source	1..327	mol_type	genomic DNA
			organism	
			submitter_seqid	@@[entry]@@
			ff_definition	@@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@
