COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..352412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(559..1584) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1743..2231) product DUF5067 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2419..3534) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3639..4079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4136..5770) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 6120..6821 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6885..7796) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7959..9509) product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9510..10601) product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10620..11897) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12036..13622) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(13750..15234) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene xylB CDS complement(15249..16556) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene xylA CDS 16761..17900 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(18052..18444) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rpsI CDS complement(18467..18904) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene rplM CDS complement(19140..19826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(19854..20483) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20776..21537) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene truA CDS complement(21550..22347) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22344..23216) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23192..24031) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 24166..24828 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24975..26045) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(26269..26676) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene rplQ CDS complement(26700..27644) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(27754..28143) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101798.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene rpsK CDS complement(28171..28536) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene rpsM CDS complement(28556..28756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(28771..28989) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene infA CDS complement(29345..29992) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723678.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(30056..31351) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene secY CDS complement(31351..31791) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene rplO CDS complement(31844..32023) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene rpmD CDS complement(32040..32543) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723681.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene rpsE CDS complement(32564..32923) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rplR CDS complement(32958..33494) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rplF CDS complement(33525..33923) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rpsH CDS complement(33955..34140) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(34168..34707) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene rplE CDS complement(34734..35045) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rplX CDS complement(35079..35447) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene rplN CDS complement(35504..35767) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720941.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rpsQ CDS complement(35794..35985) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rpmC CDS complement(35975..36409) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rplP CDS complement(36412..37068) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rpsC CDS complement(37072..37428) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene rplV CDS complement(37451..37729) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene rpsS CDS complement(37822..38655) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rplB CDS complement(38696..38980) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene rplW CDS complement(38980..39603) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene rplD CDS complement(39629..40258) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rplC CDS complement(40315..40623) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rpsJ CDS 41011..42999 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene mcpA CDS complement(43052..44398) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(44574..45371) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(45396..46355) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene menA CDS complement(46372..47460) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(47631..48530) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 48980..50866 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 51018..51464 product flavin-based extracellular electron transfer system protein EetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene eetA CDS 51502..52044 product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene eetB CDS 52067..53050 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 53118..54449 product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(54532..55542) product DUF4003 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990030.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(55645..56247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(56448..57635) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene tuf CDS complement(57749..59833) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene fusA CDS complement(59934..60404) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rpsG CDS complement(60437..60850) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rpsL CDS complement(61112..61465) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(61552..62946) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(62960..63439) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 63685..64302 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(64360..65004) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene rpe CDS complement(65001..67016) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene tkt CDS complement(67036..67701) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(67712..68152) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene rpiB CDS complement(68365..69396) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(69400..70440) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(70485..71756) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(71832..72113) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(72136..72603) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(72644..74701) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(75047..75883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 note possible pseudo, internal stop codon CDS complement(76073..76321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(76500..77270) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(77267..78229) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(78248..78967) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(78989..80311) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(80345..80692) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(80705..81019) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(81034..83043) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989602.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 83331..83795 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(84846..85295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(85311..86066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(86084..91060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(91066..91362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(91377..91670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(91683..92075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(92095..96597) product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene essC CDS complement(96602..97816) product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene essB CDS complement(97835..98086) product EsaB/YukD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(98111..98638) product type VII secretion protein EssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene essA CDS complement(98628..102056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(102182..102478) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 102739..103194 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene rpiB CDS complement(103288..104103) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 104468..105346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 105409..106260 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(106309..107373) product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 107507..108391 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene murQ CDS 108409..109866 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(109946..110635) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(110604..113336) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(113357..113932) product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene kdpC CDS complement(113934..115991) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene kdpB CDS complement(116003..117691) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene kdpA CDS 118034..118339 product lactose/cellobiose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 118417..119721 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 119752..120054 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(120130..120450) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(120553..121119) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 121366..123405 product 1,4-beta-N-acetylmuramoylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(123515..124975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(125104..125433) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(125550..126182) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene tmk CDS complement(126222..127613) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 128127..129116 product dihydroxyacetone kinase subunit DhaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene dhaK1 CDS 129135..129731 product dihydroxyacetone kinase ADP-binding subunit DhaL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene dhaL1 CDS 129732..130106 product dihydroxyacetone kinase phosphoryl donor subunit DhaM1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene dhaM1 CDS complement(130167..130838) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(130840..131877) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(131893..133164) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(133182..133475) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(133498..133914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(133926..134399) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(134425..136485) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 136741..137601 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(137777..138427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(138591..140162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(140298..140585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(140684..140908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(140921..141589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(141922..142182) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(142195..142791) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene recR CDS complement(142881..143198) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(143230..144966) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene dnaX CDS complement(145172..145645) product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(145642..145842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(145845..146066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(146192..147556) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 147885..148019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 148231..151194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(151428..152078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(152791..154293) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 154856..155110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(155122..156861) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene cydC CDS complement(156861..158582) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene cydD CDS complement(158582..159595) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene cydB CDS complement(159582..160985) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(161360..161833) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene tadA CDS 162036..163619 product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(164004..164447) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(164547..165899) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(165883..166344) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 166509..167378 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(167445..168056) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(168077..168427) product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(168510..169466) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(169540..170877) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(171042..171749) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(171756..172037) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(172041..173243) product multidrug efflux MFS transporter Lde inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene lde CDS complement(173401..173754) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(173770..174414) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene fsa CDS complement(174542..175228) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 176195..176386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(176474..177760) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene serS CDS 178242..178838 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 178835..180565 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene pabB CDS 180666..180947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(181077..182309) product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene tagH CDS 182653..184044 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(184123..185460) product D-alanyl-D-alanine carboxypeptidase PBPD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene pbpD1 CDS complement(185590..187281) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(187637..188524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(189033..189902) product 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene iolJ CDS complement(189923..191839) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene iolD CDS complement(191859..192836) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene iolC CDS complement(192850..193671) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene iolB CDS complement(193689..195155) product methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene iolA CDS 195447..196217 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 196230..196619 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(196883..199039) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(199087..200868) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene recQ CDS 201117..201437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(201853..202377) product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(202429..204057) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(204674..205336) product DUF1129 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(205415..206554) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(206551..207666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(207676..208563) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(208560..208943) product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene ytrA CDS 209097..211430 product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene gshAB CDS 211654..214542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(214698..215798) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene ychF CDS 216089..216571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 216558..216869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(216936..217595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(217625..217933) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(217949..220219) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990068.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(220288..220590) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(220587..221897) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(222044..222217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(222214..222864) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(222870..224984) product bacteriocin-associated integral membrane family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(225042..225395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(225612..227534) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(227761..228417) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(228688..229191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(229212..231212) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(231230..231934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(231931..232620) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(232614..232982) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721861.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(233472..233723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(233751..234392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(234448..234969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(234983..237178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(238002..238205) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(238230..239081) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(239074..239835) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(240056..240796) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(240966..241286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(241300..242160) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene noc CDS complement(242280..242996) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene rsmG CDS complement(243069..244967) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene mnmG CDS complement(244989..246362) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene mnmE CDS complement(246670..247911) product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(247991..249181) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(249174..250268) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene serC CDS complement(250580..251734) product lmo2826 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(251748..252170) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(252291..252641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 252885..253484 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(253967..254743) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(254736..255461) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 255778..257028 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 257114..258007 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 258026..258850 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 258869..259486 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389905.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 259576..261747 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 261752..264979 product 1,2-beta-oligoglucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 265006..265965 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(266199..266540) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723835.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(266633..267976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 268098..268490 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(268663..269190) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 269280..269816 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(269872..270543) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene pgmB CDS complement(270545..272800) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(272797..273831) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990087.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(273898..274692) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(274708..275760) product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(275777..276628) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(276612..277496) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(277578..278885) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(278882..280573) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 280783..281811 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 tRNA 281854..281929 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(281965..282897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(282894..283382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(283554..284234) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(284399..285328) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(285340..285882) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(286486..287103) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(287100..287963) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene yidC CDS complement(288003..288365) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene rnpA CDS complement(288477..288611) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rpmH CDS complement(288778..289233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 289706..291058 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene dnaA CDS 291252..292397 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene dnaN CDS 292542..293882 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 294061..294279 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958651.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene yaaA CDS 294298..295413 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene recF CDS 295457..297406 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene gyrB CDS 297525..300065 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene gyrA CDS complement(300138..301148) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(301166..302335) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 302553..302738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 302763..303434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(303424..304275) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(304282..304701) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836913.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(304790..305095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 305406..306353 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene mvk CDS 306350..307318 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene mvaD CDS 307315..308382 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 308672..309778 product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene qoxA CDS 309796..311775 product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene qoxB CDS 311763..312371 product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene qoxC CDS 312373..312699 product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene qoxD CDS complement(312801..313484) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(313496..314890) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(314976..316373) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(316366..317028) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(317143..317517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 317702..318607 product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene lipA CDS complement(318665..319129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 319302..320741 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 321042..322034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(322069..325395) product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(325532..326203) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 326531..328435 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 328462..329274 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 329434..330297 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931862.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 330365..330760 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 330887..331219 product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721652.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 331506..332168 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(332250..332783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 332905..334131 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene arcA CDS 334098..334262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 334432..334725 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rpsF CDS 334783..335313 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene ssb CDS 335370..335609 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rpsR CDS 335925..336539 product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 336523..336675 product cyclic lactone autoinducer peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 336734..338041 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 338058..338801 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 338966..340939 product cyclic-di-AMP phosphodiesterase PdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene pdeA CDS 340941..341387 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rplI CDS 341418..342779 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene dnaB CDS complement(342931..343071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 343320..343769 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(343851..344372) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(344369..344986) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 345216..346508 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 346659..346958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 347060..348574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 349065..350447 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 tRNA 350562..350636 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(350864..351367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 note possible pseudo, internal stop codon, frameshifted CDS complement(351637..351900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 note possible pseudo, internal stop codon, frameshifted sequence02 source 1..265301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 575..979 product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(981..1106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(1212..1631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(1660..2241) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(2305..3552) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(3567..4844) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(4913..5851) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(6006..6911) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene murB CDS 7127..8110 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 8107..9624 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(9716..10546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(10762..11433) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(11436..12371) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(12387..13040) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(13041..14237) product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721933.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(14496..15062) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene thiT CDS complement(15317..15700) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 15805..17406 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(17445..18098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(18132..19478) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(19568..19960) product transcriptional regulator LrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene lrpB CDS 20077..20580 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(20620..22287) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(22302..23177) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene dapA CDS complement(23191..24402) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene dapG CDS complement(24423..25463) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(25647..27830) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(27986..28594) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 28894..29331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 note possible pseudo, frameshifted CDS 29408..29686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 note possible pseudo, frameshifted CDS 29808..30896 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene ispG CDS complement(31080..31967) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721949.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(32073..32693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(32748..33179) product transcriptional regulator ZurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene zurR CDS complement(33160..34038) product zinc ABC transporter permease ZurM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene zurM CDS complement(34013..34786) product zinc ABC transporter ATP-binding protein ZurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene zurA CDS 35002..35718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(35929..36852) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(36918..37811) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(37827..39134) product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene cshB CDS 39299..40294 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(40340..41464) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(41461..42165) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(42221..43342) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rpoD CDS complement(43429..45378) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene dnaG CDS complement(45350..45835) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(46007..46831) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(46925..48991) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene glyS CDS complement(48984..49874) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene glyQ CDS complement(50160..50834) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene recO CDS 51039..51668 product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(51709..52614) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene era CDS complement(52611..53009) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(53031..53420) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(53404..53886) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene ybeY CDS complement(53867..56065) product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene pgpH CDS complement(56087..57043) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(57184..57639) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(57653..57826) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene rpsU CDS complement(58016..58768) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(58768..59712) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene prmA CDS complement(59791..60921) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene dnaJ CDS complement(61059..62903) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721980.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene dnaK CDS complement(62932..63486) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene grpE CDS complement(63538..64569) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene hrcA CDS complement(64717..65844) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene hemW CDS complement(65904..67730) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene lepA CDS 68004..68258 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rpsT CDS complement(68878..69861) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(69933..70754) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(71048..71236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(71562..72599) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene holA CDS complement(72661..74787) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(74939..75502) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(75559..76185) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(76344..77108) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(77136..77504) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene rsfS CDS complement(77488..78078) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene yqeK CDS complement(78065..78640) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(78656..78946) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene yhbY CDS complement(78956..79774) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990140.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene aroE CDS complement(79796..80893) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene yqeH CDS complement(80893..81414) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 81625..83430 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(83484..84185) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(84242..84889) product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(84950..85429) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene greA CDS complement(85604..86233) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene udk CDS complement(86226..86885) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(86944..88017) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene mltG CDS complement(88167..88367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 88563..89204 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(89265..90305) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(90363..90677) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(90692..91099) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene ruvX CDS complement(91105..91377) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(91525..94158) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene alaS CDS complement(94451..95137) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(95147..96682) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 96854..97543 product two component system response regulator PieR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene pieR CDS 97540..98988 product two component system sensor histidine kinase PieS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene pieS CDS complement(99081..101480) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(101510..102178) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(102191..102931) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(103055..104170) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene mnmA CDS complement(104184..105329) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(105698..106978) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 107123..107545 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 107777..108982 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723520.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 108995..109360 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 109498..109872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 110047..111285 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(111403..113178) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene aspS CDS complement(113178..114470) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene hisS CDS 114990..116216 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(116343..116795) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene dtd CDS complement(116808..119024) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(119248..119769) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723528.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(119795..122104) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene recJ CDS complement(122186..122560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(122828..125092) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723531.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene secDF CDS complement(125133..125438) product post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(125609..125953) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene yajC CDS complement(125991..127130) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene tgt CDS complement(127219..128247) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene queA CDS complement(128244..129257) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene ruvB CDS complement(129275..129874) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene ruvA CDS complement(130021..130956) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(131026..132366) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(132433..133158) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(133281..134843) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene rny CDS complement(135215..136258) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene recA CDS complement(136504..137784) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 137926..139035 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(139101..140621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(140639..141661) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(141662..142939) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(142962..143837) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(143850..144740) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(144762..146066) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(146264..146842) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene pgsA CDS complement(146915..147880) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732284.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(147937..148668) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(148813..150105) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(150098..151369) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(151499..152449) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(152446..153507) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(153500..155098) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(155406..156479) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(156745..159051) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(159207..160124) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 160331..161302 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(161360..162415) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene fni CDS complement(162412..162768) product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 162901..163182 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 163258..163545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 163581..164405 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(164485..165834) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727467.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(165957..166637) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(166870..168288) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene gndA CDS complement(168442..168828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 note possible pseudo, frameshifted CDS complement(168813..169532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(169921..171219) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(171245..172228) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(172230..173228) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722498.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(173258..174685) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene lpdA CDS complement(174703..175773) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene buk CDS complement(175932..176861) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(176994..178688) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene recN CDS complement(178708..179157) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene argR CDS complement(179339..180169) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(180166..182067) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene dxs CDS complement(182299..182499) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(182685..183566) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(183569..183796) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(183771..185135) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990104.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene xseA CDS complement(185161..186009) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene folD CDS complement(186082..186462) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene nusB CDS complement(186495..186899) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(186913..188268) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene accC CDS complement(188282..188743) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene accB CDS complement(188886..189443) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene efp CDS complement(189541..190605) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 190751..191716 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 191732..192007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 192076..192456 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 192583..193128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(193414..194883) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene gcvPB CDS complement(194880..196226) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene gcvPA CDS complement(196253..197344) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene gcvT CDS 197900..198916 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene comGA CDS 198879..199910 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene comGB CDS 199926..200249 product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene comGC CDS 200246..200671 product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene comGD CDS 200658..200951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 200909..201370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 201367..201525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(201556..202656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(202739..203713) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(203728..203955) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(203968..205512) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(205634..206176) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(206231..206380) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rpmG CDS 206578..206949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 note possible pseudo, internal stop codon, frameshifted CDS 206997..207479 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(207575..209761) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene pnp CDS complement(209986..210255) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rpsO CDS complement(210388..211323) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(211405..212319) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene truB CDS complement(212373..212717) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene rbfA CDS complement(212733..213011) product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(213008..215437) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene infB CDS complement(215460..215759) product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(215752..216036) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(216052..217218) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene nusA CDS complement(217245..217712) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene rimP CDS complement(217870..222204) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(222287..223993) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(224072..225334) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene rseP CDS complement(225347..226489) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(226504..227292) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(227310..228068) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(228299..228856) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene frr CDS complement(228856..229584) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene pyrH CDS 229777..231570 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 231596..232015 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(232147..233037) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene tsf CDS complement(233113..233865) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene rpsB CDS complement(234078..234416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(234711..237122) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene leuS CDS complement(237509..238927) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 239069..240040 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 240040..240600 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(240641..242506) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene asnB CDS complement(242709..243908) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene metK CDS complement(244215..244529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 245020..245322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(245375..246283) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(246302..246544) product DUF2584 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(246582..247064) product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene ytkD CDS 247622..248584 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(248660..249133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(249154..250590) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(250609..251427) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene menB CDS complement(251441..252229) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene menH CDS complement(252235..253974) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene menD CDS complement(253967..255358) product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 255514..256452 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(256492..258357) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(258354..259475) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(259496..261802) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene metE CDS complement(262039..263205) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 tRNA complement(263277..263348) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(263351..263441) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(263472..263546) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(263551..263625) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(263636..263706) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(263734..263807) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(263822..263895) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(263899..263974) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(263983..264058) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(264098..264189) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(264210..264284) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(264293..264369) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(264413..264486) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(264503..264579) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(264585..264659) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(264674..264759) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(264777..264851) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(264865..264947) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(264952..265025) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(265055..265130) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(265138..265213) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence03 source 1..261420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..928) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 1010..1795 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 1829..2188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(2236..3468) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene pepT CDS 4129..4884 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(4984..5343) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene rplT CDS complement(5384..5584) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720098.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene rpmI CDS complement(5606..6109) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene infC CDS complement(6424..6768) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rplS CDS 6967..7674 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(7705..8082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(8086..8910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(8891..9643) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene trmD CDS complement(9643..10161) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene rimM CDS complement(10175..10561) product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(10648..11208) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(11338..12066) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(12171..12401) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(12416..12688) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene rpsP CDS complement(12863..13429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(13700..15049) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ffh CDS complement(15061..15402) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(15485..16480) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene ftsY CDS complement(16494..20054) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989816.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene smc CDS complement(20079..20768) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene rnc CDS complement(20965..21198) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(21258..22007) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene fabG CDS complement(22008..22952) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene fabD CDS complement(22945..23958) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene plsX CDS complement(23965..24546) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene fapR CDS complement(24727..26778) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene recG CDS complement(26762..27661) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene sdaAA CDS complement(27698..28360) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene sdaAB CDS complement(28400..30058) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(30074..30439) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 30728..30916 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rpmB CDS complement(31038..31682) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(31738..32394) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rpe CDS complement(32397..33143) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rsgA CDS complement(33287..35254) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene pknB CDS complement(35251..36012) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(36033..37355) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene rsmB CDS complement(37356..38297) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene fmt CDS complement(38310..40712) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene priA CDS complement(40705..41916) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene coaBC CDS complement(42103..42300) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene rpoZ CDS complement(42297..42914) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene gmk CDS complement(42933..43808) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(43974..45110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(45112..46221) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(46235..47170) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(47241..48380) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397664.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(48373..49023) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 49148..50857 product Rqc2 family fibronectin-binding protein FbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene fbpA CDS complement(50937..52844) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(53587..54213) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene pyrE CDS complement(54210..54911) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene pyrF CDS complement(54908..55822) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(55819..56580) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(56605..59805) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene carB CDS complement(59798..60886) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(60886..62163) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(62151..63065) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(63143..64426) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009929301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(64588..65151) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene pyrR CDS 65638..65847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(65998..66879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(67388..68311) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(68308..68775) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene lspA CDS complement(68846..70135) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733836.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 70343..71692 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(72185..73666) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(73831..74037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(74060..76330) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(76346..76642) product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene csoR CDS complement(76803..77636) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(77685..78389) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene deoD CDS complement(78403..78636) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(78699..79601) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(79657..80100) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene msrB CDS complement(80100..80633) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene msrA CDS complement(80659..81291) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(81306..82103) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(82119..82958) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 83137..83772 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(83825..84325) product DUF4303 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(84341..84724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 84959..85588 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 85602..86420 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 86439..89078 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ppdK CDS 89266..90642 product L-cystine transporter TcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244685.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene tcyP CDS complement(90703..91251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(91294..92283) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(92376..92999) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(93176..94726) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(94808..95665) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(95704..96195) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(96212..97156) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(97172..99061) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(99323..101005) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(101156..101578) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene mntR CDS 101964..102164 product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene cspD CDS 102282..102683 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(102753..103625) product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(103798..104076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(104279..104659) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(104832..105485) product DUF5105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(105668..105937) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rpsN CDS complement(106090..107397) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(107401..107979) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(108210..109730) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(109746..110888) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(111412..111756) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene gpsB CDS complement(112177..112737) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(112734..113102) product YppE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 113307..113936 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene recU CDS 113967..116483 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(116632..117123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(117116..117775) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene nth CDS complement(117786..118490) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732058.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(118655..119947) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene asnS CDS complement(119960..121141) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(121161..121667) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(121755..124544) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene dinG CDS complement(124576..124956) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(124953..125801) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene panC CDS complement(125798..126637) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene panB CDS complement(126818..127282) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(127432..128406) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(128387..129571) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(129590..130003) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene mgsA CDS complement(130018..130791) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene dapB CDS complement(130788..131120) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 131224..132090 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(132084..133211) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(133213..133857) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 134031..135203 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 135218..136366 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 136363..137382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 137399..138079 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 138414..139472 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(139529..140785) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(140900..141583) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(141656..142204) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(142357..142890) product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(142919..144178) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(144313..145599) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene aroA CDS complement(145612..146712) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(146726..147817) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene hisC CDS complement(147814..148188) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene aroH CDS complement(148194..149285) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene aroB CDS complement(149288..150454) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene aroC CDS complement(150643..151086) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene ndk CDS complement(151100..152068) product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene hepT CDS complement(152065..152793) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene menG CDS complement(152811..153551) product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(153711..154280) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene folE tRNA complement(154519..154592) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(154600..154674) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(154846..155994) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene rpsA CDS complement(156288..156956) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723586.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene cmk CDS complement(156974..157936) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723587.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(158014..158742) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(158907..160313) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931427.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(160318..161301) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 161432..161680 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(161685..162293) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(162661..163188) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(163204..164994) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989845.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(165084..165800) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(165982..166713) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(166713..167318) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene scpB CDS complement(167305..168054) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(168069..169382) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene lysA CDS complement(169529..170347) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(170366..171547) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene deoB CDS complement(171579..172472) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene xerD CDS complement(172636..173091) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene fur CDS 173439..174281 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 174262..175257 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989848.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(175302..175865) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 176105..176749 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 176746..177948 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 178212..178832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(178877..179947) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene dinB CDS complement(180050..180844) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(180841..181770) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene rnz CDS 182048..183526 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene zwf CDS complement(183646..184065) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931532.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 184170..185090 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 185200..185634 product DUF1694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 185695..185835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(185815..186285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(186263..186817) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 187463..189154 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene ilvD CDS 189171..190877 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene ilvB CDS 190879..191367 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene ilvN CDS 191450..192445 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene ilvC CDS 192591..194117 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 194119..195198 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene leuB CDS 195179..196567 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene leuC CDS 196554..197135 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene leuD CDS 197155..198423 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene ilvA CDS 198601..199320 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene budA CDS complement(199386..200687) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(200767..201792) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(201854..202516) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene deoC CDS 203293..203742 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 203735..204511 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(205097..206770) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene alsS CDS 207036..207389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(207508..207708) product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene cspB CDS complement(208048..208743) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(208758..209750) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene dapF CDS complement(209874..212633) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene ileS CDS 212721..212873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(212966..213499) product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene divIVA CDS complement(213637..214161) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(214158..215273) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 215404..216861 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene nadB CDS 216869..217711 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene nadC CDS 217708..218811 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene nadA CDS complement(218857..219633) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(219760..220050) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(220074..220526) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(220530..221228) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(221320..222480) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731982.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene ftsZ CDS complement(222546..223832) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene ftsA CDS complement(224155..224940) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(224976..226067) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene murG CDS complement(226064..227431) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene murD CDS complement(227538..228512) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene mraY CDS complement(228583..230055) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(230208..232478) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(232475..232837) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene ftsL CDS complement(232887..233816) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene rsmH CDS complement(233829..234260) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene mraZ CDS complement(234451..235716) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 235850..237619 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(237572..237961) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(237954..238838) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(238885..239022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(239234..239407) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726143.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene rpmF CDS complement(239484..240023) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 240166..241329 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(241643..241876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(241897..242202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(242304..242483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(242691..243737) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(243758..244243) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene coaD CDS complement(244240..244803) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene rsmD CDS complement(244922..245203) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(245237..245686) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(245735..246790) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 247145..248401 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(248454..249512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(249666..250583) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733858.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene cyoE CDS 250938..251855 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 251939..252781 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(252862..253533) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 253873..254592 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(254639..255289) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723943.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(255312..255638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(255635..255967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 note possible pseudo, internal stop codon CDS complement(255986..256246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 note possible pseudo, internal stop codon CDS complement(256261..257760) product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 257820..257984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(258103..260523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 sequence04 source 1..260077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..1929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(2646..3269) product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 3430..4020 product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 4036..4395 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 4503..4940 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142237840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 5330..6331 product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 6404..7360 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 7793..9232 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene proS CDS complement(9226..10197) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 tRNA complement(10367..10463) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 10687..11856 product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene prdC CDS 12013..13917 product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene prdA CDS 13940..14242 product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 14243..14968 product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_table 11 codon_start 1 transl_except (pos:14693..14695,aa:Sec) note codon on position 151 is selenocysteine opal codon. locus_tag LOCUS_08720 gene prdB CDS 14989..15729 product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene prdD CDS 15828..16304 product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 16337..17353 product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 17392..18282 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 18285..18452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 18456..19472 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene selD CDS 19486..20079 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene yedF CDS 20092..20328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 20342..22222 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene selB CDS 22235..23401 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 23398..24789 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene selA CDS 24791..25393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 25524..26084 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 26195..26992 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 27005..27475 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 27564..27782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 27880..28503 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 28744..29922 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 30038..31021 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 31034..32035 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 32122..32547 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 32615..33253 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 33454..34248 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 34507..35517 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 35667..36749 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 36873..37841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 37921..38691 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(38739..39092) product DUF6054 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 39245..39577 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 40040..41092 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene pheS CDS 41094..43502 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene pheT CDS 43630..44331 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 44345..47779 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 47897..48289 product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 48279..48830 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 48943..49395 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721623.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 49397..52621 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989710.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 52758..53432 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 53447..54157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(54238..55158) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene rnhC CDS 55358..55627 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003740576.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene zapA CDS 55624..56166 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 56224..57936 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989712.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene polX CDS 57948..60302 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 60384..60698 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene trxA CDS 60837..62651 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene uvrC CDS 62654..63868 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(63929..64405) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 64589..65404 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene racE CDS 65394..66143 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene rph CDS 66146..66757 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 66799..67320 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 tRNA 67412..67488 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 68141..69424 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 69574..69807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 69820..70287 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(70340..70537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(70614..71462) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(71646..71789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(71774..71914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 72030..72506 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723557.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(72565..73029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 73218..74135 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(74196..75443) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932313.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(75436..76269) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene proB CDS complement(76394..77578) product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(77703..78125) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(78136..78540) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 78783..79016 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(79556..80089) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(80099..81415) product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(81397..82719) product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(82753..82971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 83342..84277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 84390..85676 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene tig CDS 85841..87103 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene clpX CDS 87208..87573 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 87677..88234 product type I signal peptidase SipX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene sipX CDS 88344..88904 product type I signal peptidase SipY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene sipY CDS 88998..89537 product type I signal peptidase SipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene sipZ CDS 89549..90436 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ylqF CDS 90411..91181 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 91315..92130 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene dprA CDS 92380..94458 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene topA CDS 94524..95828 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene trmFO CDS 96104..97009 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene xerC CDS 97029..97568 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene hslV CDS 97583..98992 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989722.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene hslU CDS 99012..99791 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene codY CDS 99921..100352 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 100352..100684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 100665..101537 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(101581..102177) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene plsY CDS 102327..103622 product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 103627..104040 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 104314..106278 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723731.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene parE CDS 106275..108737 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989723.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene parC CDS 108819..109283 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(109346..111238) product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene oatA CDS 111621..113300 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 113457..114389 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene miaA CDS 114493..114720 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene hfq CDS 114786..116069 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 116233..116601 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 116655..117989 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene glnA CDS complement(118577..119191) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene lexA CDS 119353..119682 product cell division suppressor protein YneA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene yneA CDS 119743..120195 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene mscL CDS 120275..120502 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 120653..122647 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene tkt CDS 122837..123076 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 123577..125337 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 125330..127126 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 127203..127682 product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 127915..128433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(128492..129103) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 129198..130325 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 130322..133390 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 133462..136686 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 136686..137099 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 137111..137725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 137860..140565 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene acnA CDS 140912..141475 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(141576..142634) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(142631..143548) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(143780..146380) product adhesion-mediating acetaldehyde/alcohol dehydrogenase LAP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene lap CDS 147422..148786 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene trpE CDS 148783..149364 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 149366..150385 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene trpD CDS 150382..151143 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene trpC CDS 151140..151754 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 151751..152950 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene trpB CDS 152947..153711 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene trpA CDS 153774..154202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 154328..155941 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(156024..156854) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 156961..157377 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724165.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 157475..158887 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene pepV CDS 158989..159864 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene dat CDS 160087..160530 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 160527..161996 product multidrug efflux MFS transporter MdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene mdrM CDS 162230..163012 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 163020..163664 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene trmB CDS 163734..164579 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(164779..165090) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 165261..166334 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 166360..166548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 166661..166972 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 166995..167792 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 167801..168418 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 168710..171223 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 171510..172850 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene murC CDS 172984..173529 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(173603..174715) product M29 family aminopeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 174933..175385 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 175406..175912 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 176292..177374 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 177636..178637 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene ccpA CDS 179071..180333 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene tyrS CDS complement(180384..180749) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833129.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(180906..181508) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989757.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene rpsD CDS complement(181728..182219) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 182470..184176 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989755.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ezrA CDS 184267..185406 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 185407..186618 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene thiI CDS 186794..187822 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene argC CDS 187837..189036 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene argJ CDS 189049..189801 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene argB CDS 189798..190955 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 190960..191904 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene argF CDS complement(191951..192751) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 192922..193941 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene sppA CDS 193953..194474 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 194559..195056 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene tpx CDS 195239..196252 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732561.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 196262..197458 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(197623..198084) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 198182..198358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 198324..199436 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene ald CDS complement(199534..200628) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 200819..201502 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 201523..202839 product CBS-HotDog domain-containing transcription factor YtoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene ytoI CDS 202863..203801 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 203893..207213 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene dnaE CDS 207439..208326 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene accD CDS 208316..209272 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 209549..210508 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pfkA CDS 210819..212576 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene pyk CDS 212697..213077 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene fxsA CDS 213231..213710 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 213740..214864 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene citZ CDS 214877..216145 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene icd CDS 216327..218954 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene polA CDS 218974..219795 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene mutM CDS 219806..220408 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene coaE CDS 220470..220934 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene nrdR CDS 220950..222347 product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 222353..223279 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene dnaI CDS 223636..225558 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene thrS CDS 225672..226259 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene yihA CDS 226386..227717 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723241.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene hemA CDS 227680..228609 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene hemC CDS 228606..229319 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931590.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 229321..230301 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene hemB CDS 230305..231594 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene hemL CDS 231901..234546 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 234610..235890 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 236797..237462 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723232.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene radC CDS 237662..238675 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 238757..239662 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene mreC CDS 239662..240189 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene mreD CDS 240361..241038 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene minC CDS 241041..241841 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene minD CDS 241912..243249 product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 243401..243709 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene rplU CDS 243727..244050 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 244063..244353 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene rpmA CDS 244581..244760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 244723..245541 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727395.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 245594..247087 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene glpK CDS 247306..248598 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene obgE CDS 248665..249513 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene pheA CDS 249527..250018 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 250049..250849 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 250867..251229 product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003744056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 251319..253943 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene mutS CDS 253960..255837 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene mutL CDS 255857..256417 product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 256750..257511 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene pflA CDS complement(257592..258122) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 258283..259488 product multidrug efflux MFS transporter MdrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene mdrL CDS 259683..260072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 sequence05 source 1..259410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..5472 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989592.1:bacterial Ig-like domain-containing protein locus_tag LOCUS_11040 CDS complement(5621..7390) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 7688..8122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 note possible pseudo, frameshifted CDS 8186..9076 product bile-regulated transcriptional regulator BrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene brtA CDS 9173..10663 product cholic acid efflux MFS transporter MdrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene mdrT CDS 10785..11234 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 11225..12034 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene proC CDS 12142..13677 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 13674..15800 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 15806..16762 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene ppx CDS 17041..20031 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene fdhF CDS 20024..20500 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 20559..21350 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene fdhD CDS complement(21543..22418) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 22521..23345 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 23412..23687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 23891..26155 product class 1 internalin InlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990081.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene inlJ CDS complement(26378..26917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 27225..28247 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 28240..28761 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 28764..29399 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 29418..30032 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 30167..31840 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 31999..32325 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 32376..32582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 32954..33784 product lipoyl-[GcvH]:protein N-lipoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 33803..35119 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(35172..35357) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 35435..36085 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 36165..36617 product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 36614..38281 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene argS CDS 38659..39204 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene rpoE CDS 39538..41136 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(41225..43996) product autolysin Ami inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ami CDS 44329..45243 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 45410..46264 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724024.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene fba CDS 46626..47903 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 47896..48918 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 48924..49982 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724021.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 50075..51355 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 51457..52728 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene rho CDS 52833..53075 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 53661..54947 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 54951..56006 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene thrC CDS 56006..56872 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990012.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene thrB CDS 56998..57576 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 57594..58670 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene prfA CDS 58657..59517 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene prmC CDS 59795..60850 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 60902..61264 product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 61400..62641 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 62803..63432 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene upp CDS 63512..64651 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene wecB CDS 65669..66055 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 66073..66789 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene atpB CDS 66840..67058 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732517.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene atpE CDS 67155..67667 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene atpF CDS 67664..68203 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 68230..69744 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene atpA CDS 69779..70648 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 70715..72136 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene atpD CDS 72158..72559 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 72699..72935 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 73135..74433 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene murA CDS 74598..75593 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene mreB CDS 75615..76058 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 76071..76505 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene fabZ CDS 76738..77160 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene ssb CDS 77297..78043 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 78040..79152 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene menC CDS 79171..80220 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(80279..81352) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(81564..82100) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(82097..82738) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 83161..83847 product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene degU CDS 83866..84720 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 84927..86264 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 86518..86931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 87138..87692 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene raiA CDS complement(87749..88813) product chitinase ChiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene chiA CDS 89224..91737 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene secA CDS 91745..91954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 91965..92981 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene prfB CDS 92999..93856 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 94337..95023 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene ftsE CDS 95013..95897 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene ftsX CDS 95990..97204 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 97333..98694 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 98799..100247 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene cls CDS 100278..101459 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 101683..102402 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 102399..104168 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 104405..105307 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 105398..106321 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene pstC CDS 106318..107202 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene pstA CDS 107226..108059 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene pstB CDS 108078..108851 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene pstB CDS 108864..109523 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene phoU CDS 109610..110191 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174573.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 110269..110574 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 110760..112898 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 113030..113416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 113431..114072 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 114105..114344 product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 114535..116511 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene uvrB CDS 116519..119386 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene uvrA CDS 119825..121102 product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 121177..122445 product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 122462..122665 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 122668..123018 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 123170..124105 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene hprK CDS 124232..125068 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene lgt CDS 125095..125751 product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene ppaX CDS 125756..126244 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 126402..127856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 127931..128893 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene trxB CDS complement(129217..130215) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(130217..131236) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930537.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 131397..132260 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 132381..133553 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 133556..134551 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene galE CDS 134558..136030 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene galT CDS 136047..137096 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 137233..138222 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 138249..139979 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 140044..140967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 141049..141924 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rapZ CDS 141926..142876 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 142899..143870 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene whiA CDS 143891..144907 product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene namA CDS complement(144990..145223) product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(145236..146171) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(146168..147010) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(146991..147734) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 147908..148186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 148565..150190 product class 1 internalin InlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989387.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene inlE CDS complement(150246..150839) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722600.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene clpP CDS 151170..152615 product polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 152794..153648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 tRNA 153753..153825 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 153901..154344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(154533..154754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 154891..155136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 155129..155563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 155635..156015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 156079..157005 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 157202..158557 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene rpoN CDS 158998..160044 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 160080..161090 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene gap CDS 161205..162395 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 162442..163197 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene tpiA CDS 163198..164730 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene gpmI CDS 165130..166422 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene eno CDS 166540..166896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 166913..167638 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 167626..168606 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(168654..169787) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(169906..172197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(172328..173899) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(173971..174408) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 174542..175285 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 175418..175765 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 176099..176716 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 176819..176983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 176996..177559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 177666..178496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 178472..178675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 178835..180460 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 180687..180884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(180881..182269) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(182329..182757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(182796..183290) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(183371..183724) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 184003..184227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 184217..184396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 184393..184683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 184828..185067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 185067..185234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 185231..185494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 185502..185672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 185659..185880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 185861..186223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 186227..186799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 186803..187963 product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714175.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 187986..188555 product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 188758..190764 product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 190772..191398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 191391..192341 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 192344..193054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 193066..195480 product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 195771..196133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 196130..197503 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 197490..198044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 198034..198561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 198913..199215 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 199333..199665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 199662..201344 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 201361..202497 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 202484..203308 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 203333..204475 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 204495..204758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 204768..205079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 205076..205471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 205443..205850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 205847..206242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 206242..206820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 206878..207195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 207383..212224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 212227..213051 product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 213056..214201 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 214198..214455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 214460..215083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 215080..215442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 215444..216196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 216193..216537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 216551..216676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 216875..217213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 217214..217498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 217495..218469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(218570..218758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(218815..218979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(218969..219265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(219742..220239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(220323..220472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(220486..221760) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168747012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 222003..222272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 222857..223489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 223513..225186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 225176..226075 product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544921.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene cas7i CDS 226062..226814 product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene cas5 CDS 226877..229069 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 229081..229569 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene cas4 CDS 229581..230570 product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene cas1b CDS 230574..230852 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene cas2 CDS complement(231217..232416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(232485..232874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(232879..233193) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 233384..233611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387116.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 233660..233968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 233970..234092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 234097..234258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 234483..234785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 234782..235540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 235540..235773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 235787..236728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 236718..237194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 237236..237523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 237708..237860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 237857..238153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 238196..238471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 238453..238623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 238640..239143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 239355..240047 product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989957.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 240040..241299 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 241310..242839 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 242733..243740 product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 243762..244037 product DUF6275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 244037..244219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 244363..244986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 245019..245939 product DUF5309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 245945..246154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 246168..246503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 246500..246877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 246837..247256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 247253..247687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 247692..248444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 248501..248962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 248983..249255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 249245..252793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 252809..253540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 253537..255681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 255665..257407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 257581..257985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 258044..258292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 258292..259077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 sequence06 source 1..154178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 873..1931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 2256..4367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 4357..5169 product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 5188..6201 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(6253..8058) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(8072..8833) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 9167..10888 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 10888..12660 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(12742..13089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 13329..13556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 13633..13956 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 13971..14690 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(14674..15255) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 15420..16181 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(16299..17192) product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733788.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(17206..18057) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(18050..19243) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 19522..20964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 21137..22258 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 22255..23166 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 23272..23721 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(23827..24591) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719096.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 24823..26295 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924505.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene rhaB CDS 26285..27547 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene rhaA CDS 27565..28383 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene rhaD CDS 28489..29640 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(29741..31021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(31221..31943) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(32066..32623) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 32813..33313 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 33340..34110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(34281..34673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(34725..36065) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003738285.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 36380..36847 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 36855..38579 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 38576..40387 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 40775..41080 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294651.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 41077..42729 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 42729..43025 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 43004..43288 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(43377..44111) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990050.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 44192..44911 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(44978..45604) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722807.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 45758..46921 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 46937..47347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(47562..48206) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 48263..48595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(48657..48923) product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(49183..49992) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(49938..50645) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(50659..51609) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 51857..53377 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene cls CDS 53758..54321 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989584.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 54512..56173 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(56227..56865) product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 56960..57646 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 57674..58354 product transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 58461..59285 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 59398..60648 product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 60766..61662 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(61772..62857) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(62884..63588) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 63881..65407 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(65503..66504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 66691..69084 product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 69251..70459 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(70502..71497) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 71674..73380 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 73399..76206 product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(76781..77377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 tRNA complement(77537..77622) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 77762..78511 product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 tRNA complement(78971..79054) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 79319..79702 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene crcB CDS 79699..80058 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989889.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene crcB CDS 80147..80512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 80707..81825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 81944..82417 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene tsaE CDS 82401..83093 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene tsaB CDS 83090..83536 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rimI CDS 83533..84558 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene tsaD CDS complement(84627..86582) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene abc-f CDS 86926..87570 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 87757..88017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 note possible pseudo, frameshifted CDS 88014..88475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 note possible pseudo, frameshifted CDS complement(88538..90361) product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene ltaP CDS 90553..91953 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 92036..92866 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(93053..93334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 93442..94395 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721765.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 94417..95061 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721766.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 95456..96112 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(96196..96723) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721769.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(96772..97812) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 98218..98421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 98485..99192 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 99293..100186 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(100275..100838) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 100972..101811 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(101862..102683) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene pdxK CDS complement(102704..103570) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 103745..104296 product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 104307..104591 product DUF5327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 104604..104987 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(105598..105942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 106138..107499 product multidrug efflux MATE transporter FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene fepA CDS 107899..110172 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 110257..111306 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 111303..111740 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 111737..112063 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 112126..112410 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(112471..112650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 112842..113156 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(113192..114127) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 114209..114664 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 114661..115176 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 115336..116352 product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 117161..118075 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 118093..119067 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 119068..120051 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(120838..121737) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(122056..122232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(122386..122859) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(122878..124110) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(124103..125008) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 125356..126003 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(125977..126651) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 tRNA complement(126823..126895) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(126902..126976) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(126982..127065) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(127077..127151) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(127266..127339) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 127637..129460 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731925.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 129741..130643 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene rocF CDS 130881..131129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731926.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(131126..131317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 131253..132227 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 132361..134136 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989902.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 134311..135567 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 135670..136974 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722384.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 136975..137826 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 137931..138707 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 138704..140974 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 141554..142375 product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene dacA CDS 142372..143724 product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 143899..145245 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722378.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene glmM CDS 145327..145788 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 145813..146643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(146683..146886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 147337..149145 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene glmS CDS complement(149338..149544) product DUF4305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(149548..150231) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 150558..150842 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene groES CDS 150888..152516 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene groL CDS 153500..153880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 sequence07 source 1..144203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1967..2191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(2377..3942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(4555..6357) product lmo0331 family class 1 internalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 6533..6757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(6912..7097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(7112..7753) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728647.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(7760..9922) product DUF1430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(9985..10365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(10688..11665) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722362.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene pta CDS 11968..12198 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 12191..14182 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene feoB CDS 14198..14365 product FeoB-associated Cys-rich membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(14410..15390) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 15636..16694 product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(16799..17038) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 17182..17913 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 17987..18946 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene manA CDS complement(19292..19645) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 19818..20582 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(20781..21410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(21480..22211) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(22213..24000) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(24142..24780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(24794..25465) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(25462..26775) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene fliI CDS complement(26768..27460) product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733172.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(27447..28553) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721835.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(28562..30199) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene fliF CDS complement(30274..30576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(30590..31003) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene flgC CDS complement(31013..31378) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene flgB CDS complement(31397..31681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(31653..32039) product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(32055..33344) product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727196.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(33357..34232) product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(34248..35771) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene flgK CDS complement(35785..36216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(36225..36698) product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(36763..37920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(37944..39344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(39345..40988) product flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(41011..41985) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene fliM CDS complement(42017..42238) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(42252..43487) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene flgE CDS complement(43524..43946) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(43928..44986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(45002..45412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(45425..45721) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(45734..47596) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(47617..47973) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(48211..49140) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(49312..50220) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(50234..52135) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(52153..52653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(52660..53475) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(53447..54286) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene motA CDS complement(54312..54647) product DUF3964 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721804.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(54663..55454) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(55479..56258) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(56255..57484) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene flhF CDS complement(57497..59563) product FHIPEP family type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(59581..60627) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(60643..61401) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(61404..61676) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(61692..62462) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(62449..62751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 63091..64035 product motility genes transcriptional repressor MogR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene mogR CDS 64055..64264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 64415..64711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 64782..65165 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 65351..66640 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene celB CDS 66724..67437 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(67970..69784) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene pepF CDS complement(69863..70969) product competence protein CoiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(71095..71748) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene mecA CDS complement(71973..72368) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene spxA CDS complement(72689..73651) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(73644..74723) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(74741..75763) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(75763..76692) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(76938..78620) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 79283..79630 product DUF3899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 79950..80942 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene trpS CDS complement(81004..81423) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(81803..83044) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene fabF CDS complement(83274..84215) product 3-oxoacyl-ACP synthase III FabH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene fabH CDS complement(84371..85483) product GW domain-containing glycosaminoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 85733..85921 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003763532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(85968..86657) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene gpmA CDS complement(86830..89424) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene clpB CDS complement(90010..90504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(90485..91294) product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(91305..92564) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(92774..93544) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(93579..94370) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(94531..95607) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(95703..96065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723828.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(96248..97174) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene hemH CDS complement(97171..98235) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene hemE CDS 98437..98940 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(98995..100221) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(100205..100954) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 101131..101553 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 101612..101974 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 102135..102701 product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731889.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 102817..103761 product posttranslocation chaperone PrsA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene prsA2 CDS complement(103910..104857) product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene yhaM CDS complement(104897..107671) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(107668..108903) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 109042..109464 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(109534..109887) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723354.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(109969..111102) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(111184..112551) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene fumC CDS complement(112617..113414) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(113411..114319) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(114322..114519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(114630..116759) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 117013..117462 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 117540..118427 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 118787..120004 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723363.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 120315..121187 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(121232..121891) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(121888..122787) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 123151..123771 product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 123783..124781 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 124890..125411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 125614..127071 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 127064..127786 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 127858..129009 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731868.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(129111..129752) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 129918..131210 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 131333..131599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(132050..132322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 132383..132742 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009913680.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(132818..133126) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(133203..133955) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene yjfP CDS 134110..134919 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(134965..135324) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925066.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(135325..136197) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930518.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(136194..139925) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene addA CDS complement(139909..143400) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene addB CDS complement(143542..143778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 143994..144149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 sequence08 source 1..141012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..6697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(7141..8151) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(8174..9484) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene der tRNA complement(9729..9819) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(9826..9899) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(9968..10432) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(10571..12730) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(12868..13479) product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(13479..14261) product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene sigB CDS complement(14239..14703) product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene rsbW CDS complement(14678..15031) product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene rsbV CDS complement(15101..16102) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(16118..16528) product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003738506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(16531..16887) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(16892..17728) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(18000..18344) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(18349..18627) product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(18855..19967) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene alr CDS complement(19983..20345) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene acpS CDS complement(20342..21730) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989606.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene hemG CDS complement(21898..23403) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(23396..23878) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721449.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 24010..24486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 24536..25009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(25057..25548) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(25708..26280) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 26617..27099 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 27124..29865 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(29978..31381) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(31482..32975) product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732374.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene cshA CDS complement(33393..34313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(34363..35097) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(35125..36498) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(36555..37667) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(37831..38154) product quaternary ammonium compound efflux SMR transporter SugE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene sugE2 CDS complement(38151..38486) product quaternary ammonium compound efflux SMR transporter SugE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene sugE1 CDS complement(38490..39062) product efflux SMR transporter transcriptional repressor SugR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene sugR CDS complement(39209..39796) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703661.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(40170..40937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(41111..41257) product Lmo0850 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(41589..42317) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(42314..43741) product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(44064..44441) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 44537..44806 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721408.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(44859..47507) product calcium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(47650..48633) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 48752..49645 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 49716..50126 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene psiE CDS 50355..52940 product autolysin Ami inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene ami CDS 53147..55108 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(55380..57743) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 57845..58414 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(58505..62200) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene nifJ CDS complement(62330..64066) product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(64292..65332) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 65533..66747 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 66751..68127 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene argH CDS complement(68171..68668) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(68688..69617) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(69685..70563) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(70702..71244) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(71273..72226) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(72241..72942) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(73380..74324) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054398098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(74484..74819) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(75053..76132) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(76129..76935) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(76932..77741) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(77738..78835) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(78851..79393) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(79594..81636) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(81718..82353) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(82524..84422) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(84653..85153) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 85625..87091 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(87166..88515) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene brnQ CDS complement(88711..89151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 89364..89894 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(89946..91109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 91247..92410 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 92619..93554 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734267.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene rarD CDS 93604..93852 product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 93888..94358 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723804.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ybaK CDS complement(94485..98918) product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989571.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(98988..99146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(99261..99893) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 100079..102898 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 103216..103647 product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 103647..104132 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721900.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 104299..105120 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 105138..106016 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 106147..106611 product Lmo0779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(106709..107089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721894.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(107152..108369) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(108479..108826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724493.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(108841..109764) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(109867..110274) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 110404..111402 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(111468..112352) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(112366..113016) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(113045..113800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(113936..114556) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896772.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(114663..115553) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(115608..116873) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene hflX CDS complement(117212..117862) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene pgmB CDS complement(117874..120600) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 120759..121475 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294254.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene treR CDS 121620..123584 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene treP CDS complement(123627..124244) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(124241..124867) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925076.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(124873..125832) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(125783..126724) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(126975..127457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(127444..127791) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(127806..128282) product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 128459..130642 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(130695..131423) product bifunctional riboflavin kinase/FMN adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(131687..132514) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906355.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 132642..133208 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(133280..135244) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722840.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(135502..136416) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(136490..137005) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 tRNA 137106..137198 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(137665..139053) product DUF4026 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(139072..139674) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(139838..140911) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 sequence09 source 1..99830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1451..2359) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(2556..2774) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(2786..3334) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(3480..4400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(4409..4789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(5260..7029) product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene urdA CDS 7184..8797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 8775..9515 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922507.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 10092..10505 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 10498..12228 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 12228..13877 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932493.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(13923..14321) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(14318..14650) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(14789..15676) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733114.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(15861..16670) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(16701..16994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(17076..18035) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(18097..18576) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene rlmH CDS complement(19342..19854) product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene yraA CDS complement(19970..21502) product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene htrA CDS complement(21636..22466) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(22624..23436) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(23439..24752) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene yycH CDS complement(24749..26584) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene walK CDS complement(26594..27307) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene yycF CDS complement(27623..29566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 tRNA complement(29822..29895) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(30009..31193) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 31650..32468 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 32481..33497 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 33494..34156 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 34178..34957 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(35216..35767) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene nrdG CDS complement(35760..37910) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989397.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene nrdD CDS 38302..39402 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ugpC CDS 39780..39929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 39895..40473 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 40489..41307 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 41333..43138 product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 43135..44109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 44123..45085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989621.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(45539..46042) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989394.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 46175..46987 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene yidA CDS 47027..47224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 47358..48794 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(49037..49717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(49695..50732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(50838..51059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 51569..51997 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 52022..52954 product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(53112..53552) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(53549..55423) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(55433..55909) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(56068..56391) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(56425..58476) product beta-galactosidase GanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene ganA CDS complement(58498..60732) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(60797..61240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(61280..62572) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene celB CDS complement(62705..63733) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(63854..64855) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476545.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(64872..65312) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(65450..66091) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(66166..67125) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(67140..67553) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(67628..68158) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 68331..69791 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(69856..70347) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 repeat_region 70353..70641 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacatttcacaatgcttatttaaaac CDS complement(70873..74478) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732839.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene rpoC CDS complement(74630..78175) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene rpoB CDS complement(78709..79308) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(79379..81004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(81196..81564) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene rplL CDS complement(81617..82117) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rplJ CDS complement(82344..83033) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene rplA CDS complement(83074..83499) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene rplK CDS complement(83663..84196) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene nusG CDS complement(84354..84533) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728078.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene secE CDS complement(84817..85440) product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(85526..86038) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(86043..86786) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene rlmB CDS complement(86786..87196) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930887.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(87200..88615) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene cysS CDS complement(88596..89231) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726845.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene cysE CDS complement(89624..91096) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene gltX CDS complement(91120..91593) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ispF CDS complement(91590..92291) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene ispD CDS complement(92327..93412) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(93538..94911) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene radA CDS complement(95094..97544) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(97572..98606) product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989379.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(98603..99118) product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(99138..99596) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 sequence10 source 1..99447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(524..1447) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene cysK CDS complement(1572..2456) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene hslO CDS complement(2479..3249) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(3377..5485) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene ftsH CDS complement(5779..7728) product bifunctional tRNA lysidine(34) synthetase TilS/hypoxanthine phosphoribosyltransferase HprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723741.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(7832..8251) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(8356..8751) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(8980..9255) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(9265..10863) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733153.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(10907..14455) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989376.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene mfd CDS complement(14570..15124) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722742.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene pth CDS complement(15273..15593) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(15664..16287) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 16636..17577 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722739.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 17692..18024 product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(18152..19108) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(19162..20535) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene glmU CDS complement(20943..21242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(21368..21673) product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene spoVG CDS complement(22395..23600) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(23597..24286) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(24317..24997) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722722.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(25201..26019) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722721.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene purR CDS complement(26142..27008) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene ispE CDS complement(27148..27405) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(27524..28411) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene rsmA CDS complement(28365..28976) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene rnmV CDS complement(29116..30345) product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(30642..31409) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(31603..33603) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene metG CDS complement(33866..34723) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(34917..35699) product blue-light photoreceptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(35800..36657) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 36812..37087 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(37176..38420) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(38829..39185) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357112.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(39198..40079) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rsmI CDS complement(40057..40347) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(40331..41077) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(41139..41513) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene yabA CDS complement(41524..42357) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723490.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(42363..43355) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene holB CDS 43529..43975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 44155..44886 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(45426..46733) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(46756..48777) product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 48913..49881 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(50234..50836) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(50892..51263) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722027.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(51267..51629) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722028.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(51693..52487) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(52587..55211) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 55336..56841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(57010..57819) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene yidA CDS complement(57847..60189) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(60425..62071) product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(62716..65421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(65622..66284) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(66369..67358) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(67393..67905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(67902..68804) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525052.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene rbsK CDS complement(68833..70116) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene dcuC CDS complement(70207..71124) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene rihC CDS 71338..72996 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989361.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(73456..74916) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(74935..75915) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(75935..76864) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(76963..78462) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(78455..80200) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(80253..80873) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(80951..82243) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(82227..84983) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 85156..88248 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 88886..89059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 note possible pseudo, frameshifted CDS 89333..90463 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461088.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 90469..92775 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 92775..93047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(93255..93596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(93574..93786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 94123..94296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 94715..95275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 note possible pseudo, internal stop codon, frameshifted CDS 95372..95554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 note possible pseudo, internal stop codon, frameshifted CDS complement(96102..96449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(96714..97058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(97048..97374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(97494..97853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(98313..98585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 misc_feature complement(98602..>99447) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989340.1:LXG domain-containing protein locus_tag LOCUS_19710 sequence11 source 1..98322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..317) product DUF1871 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(320..721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(733..2241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2238..2606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2606..2890) product DUF3130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(3479..3694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(3932..5476) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989661.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene guaA CDS complement(5632..5943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(5954..6778) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene nadE CDS complement(6858..8348) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721509.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(8489..8872) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene tagD CDS complement(8885..10036) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(10114..11139) product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(11132..11845) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(11943..14885) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288728.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(14890..15879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(15876..18161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 18336..19226 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene galU CDS 19351..21366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(21412..23526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(23650..24594) product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene tagH CDS complement(24606..25415) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(25720..29160) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(29452..30681) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(30830..31111) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 31353..31592 product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(31637..32509) product DUF5068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(32657..34498) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene typA CDS complement(34717..35490) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 35636..36253 product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 36451..37395 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(37435..37968) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(37986..38258) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(38401..38685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(38738..39013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(39217..40620) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene lpdA CDS complement(40624..42252) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(42334..43311) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(43314..44429) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene pdhA CDS 45223..45774 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene def CDS 45831..46841 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 46855..47349 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(47404..48177) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene modA CDS 48293..48964 product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722665.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 48966..49616 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 49633..50166 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(50296..51768) product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(51772..52089) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(52102..53460) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(53460..53768) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(53910..54614) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(54686..55555) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360061.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(55889..56659) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 57118..57327 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 57334..59001 product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene rnjA CDS 59130..60161 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(60215..61063) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(61050..61982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(62046..62705) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(62721..63359) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722886.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(63352..64416) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722885.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(64413..65126) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene liaF CDS complement(65240..66115) product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(66234..66923) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925345.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(66980..67474) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989640.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 67707..68552 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(68803..69915) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722876.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(69979..70689) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene dapD CDS complement(70740..71618) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(71621..72067) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(72238..72468) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(72673..72897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 73081..74223 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(74285..75145) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732449.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(75159..76187) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(76283..78001) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene ptsP CDS complement(78001..78267) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 78673..78867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 78957..80414 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(80411..81190) product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 81457..81969 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 82153..84309 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(84397..84876) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 85024..85896 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 note possible pseudo, frameshifted CDS 85904..86092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 note possible pseudo, frameshifted CDS 86120..86494 product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(86573..87982) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733786.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(87921..88718) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(88840..89604) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(89884..91452) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722853.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(91587..92054) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732436.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(92067..93119) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722847.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 93250..94725 product LM6179_1298 family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(94776..95924) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 96044..96793 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 96811..97254 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(97328..98005) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722798.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene rpiA sequence12 source 1..97202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 198..722 product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 890..1378 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene purE CDS 1371..2495 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene purK CDS 2514..3806 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene purB CDS 3867..4583 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989809.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 4587..4832 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene purS CDS 4835..5518 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene purQ CDS 5508..7727 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene purL CDS 7712..9133 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene purF CDS 9164..10213 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene purM CDS 10210..10782 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene purN CDS 10782..12311 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene purH CDS 12324..13586 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene purD CDS 13721..14017 product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 14026..14292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 14446..15126 product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 15173..17371 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene pcrA CDS 17389..19398 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989804.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene ligA CDS 19402..20520 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 20714..21007 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene gatC CDS 21041..22495 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene gatA CDS 22511..23941 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene gatB CDS 24195..25145 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(25192..27732) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 27980..28939 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(28982..29560) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 29740..30495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722229.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 30582..31949 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene rlmD CDS 31916..32176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 32202..32528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 32613..33392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 33410..33775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 34046..35074 product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721659.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene ptcA CDS 35144..36529 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 36555..37607 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene aguA CDS 37623..38567 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene arcC CDS 38702..39769 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene aguA CDS 39784..40563 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(40579..41076) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 41312..41812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 41952..42719 product ABC transporter ATP-binding protein VirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene virB CDS 42706..44682 product ABC transporter permease VirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene virA CDS 44742..45419 product two-component system response regulator VirR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene virR CDS 45504..46397 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 46406..46861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 46877..48616 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene ade CDS 48632..49678 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989801.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 49675..50799 product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 50796..51308 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(51362..52249) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 52456..57048 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene gltB CDS 57069..58541 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(58656..60005) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(60030..60434) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007781386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(60493..60801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 60974..61957 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 61973..62965 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 63093..64271 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 64401..64595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 note possible pseudo, internal stop codon CDS 64638..67085 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 67232..67540 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 67577..67879 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 67907..68989 product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 tRNA 69112..69185 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(69542..70549) product rod-share determining protein MreBH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene mreBH CDS complement(70748..72019) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930645.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(72132..73364) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(73522..73752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(73838..74287) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003767289.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 74521..75279 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene map CDS 75353..76156 product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930648.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(76153..76377) product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 76504..77367 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(77409..78047) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 78207..79589 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene rlmD CDS complement(79815..81284) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(81281..81475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(81773..82537) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 82784..83404 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 83459..86053 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724075.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene mprF CDS complement(86386..87291) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 87383..88192 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene recX CDS 88189..88431 product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 88428..88889 product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733108.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(88947..89927) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 90049..91233 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene mutY CDS 91235..91981 product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene fabL CDS 92086..92613 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(92656..93750) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(93823..95133) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 95273..96217 product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 96305..96742 product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene perR sequence13 source 1..96520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 949..4104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 4176..4613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 4616..5896 product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene cap8O CDS 5918..6643 product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 6643..7284 product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene ptkA CDS 7298..7945 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 7948..8694 product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene vpsK CDS 8691..9950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 9947..11371 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 11415..12455 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 12461..14785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 14807..15529 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(15590..16915) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 17127..17876 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(17929..18543) product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene dhaS CDS 18896..21280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 21277..21636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 21636..22430 product WxL domain-containing protein ElrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene elrC CDS 22470..23228 product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 23238..23405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 23380..24390 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 24417..24848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 24845..25243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(25493..25888) product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 26209..27711 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 27698..29221 product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989502.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 29232..30482 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 30500..32554 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989503.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 32565..33419 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 33487..33996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 34179..34448 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 34460..35815 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(35853..36821) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989506.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 36982..38307 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(38420..39283) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(39276..39704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(39943..40956) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 41206..42402 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 42619..43371 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 43368..44279 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731860.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene pfkB CDS 44298..46172 product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704632.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 46282..46632 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(46705..47124) product competence protein ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020975176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(47253..48389) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287688.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(48489..49502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(49589..50017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(50033..50467) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 50625..50810 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774191.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(50961..51197) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101085.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 51352..51561 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 51619..51891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 51914..52426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 52442..52708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 52723..52905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 53028..53306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 53439..53666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 53663..54001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 53988..55931 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 55935..57035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 57032..57739 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 57745..58602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 58544..59380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 59374..59547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 59537..59749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 59746..59937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 59915..60355 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 60372..60986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 61025..61396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 61383..61559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 61571..62224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 note possible pseudo, frameshifted CDS 62298..62516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 62513..63097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 63094..63399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 63401..63664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 63713..63997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 64018..64578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 note possible pseudo, frameshifted CDS 64575..65228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 65304..65822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 66084..66242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 66239..67507 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 67638..67865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 67903..68778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 68750..70207 product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene terL CDS 70221..71612 product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 71605..72978 product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 72978..73154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 73197..74297 product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774204.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 74298..74750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 74778..75683 product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010733792.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 75698..76072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 76084..76425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 76425..77021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088270662.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 77021..77404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 77388..77858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010717320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 77861..78856 product DUF3383 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010717321.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 78871..79281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 79326..79691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386763.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 79672..79866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034564802.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 79868..84517 product peptidoglycan endopeptidase EnpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774207.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene enpA CDS 84517..85056 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 85056..85424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377517.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 85421..86239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 86240..86578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 86575..86940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 86933..88087 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 88077..88721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 88739..90757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 90761..91099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 91134..91259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 91306..91497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 91690..91995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 91996..92259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 92252..92488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 92491..93336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(93378..93650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(93670..93969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(94102..94326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(94363..94977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(95253..95702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(95835..96029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 sequence14 source 1..87461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(669..1229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721720.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(1226..1543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(1555..2925) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930830.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene atpD CDS complement(2926..3792) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(3789..5285) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(5282..6313) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(6327..6569) product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721714.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(6626..8944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989343.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(8941..14799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(14884..15546) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721711.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(15793..16608) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene hisJ CDS 16722..17912 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 17909..18550 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene hisG CDS 18547..19836 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene hisD CDS 19833..20417 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721360.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene hisB CDS 20418..21047 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930737.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene hisH CDS 21020..21742 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989518.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene hisA CDS 21729..22490 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989517.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene hisF CDS 22487..22807 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene hisI CDS 22800..23111 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721355.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene hisE CDS complement(23199..23408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(23432..24664) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(24657..25343) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(25327..26556) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 27006..28385 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721354.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene gdhA CDS 29230..30267 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(30499..30819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 note possible pseudo, frameshifted CDS complement(30816..31193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 note possible pseudo, frameshifted CDS complement(31311..32786) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(32863..34053) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(34152..36470) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene helD CDS 36658..37491 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 37574..38209 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721347.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene cbpA CDS complement(38321..38851) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 39246..40523 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 40545..41687 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723400.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene metX CDS complement(41720..42397) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(42770..43858) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(43962..44684) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(44750..45097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(45479..46873) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722438.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene sufB CDS complement(46894..47340) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722439.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(47337..48563) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(48565..49866) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene sufD CDS complement(49886..50671) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene sufC CDS complement(50898..52964) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437601.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 53162..54223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(54423..55256) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(55278..55943) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722446.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(55940..57046) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722447.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(57242..57436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(57510..58652) product histidine kinase CesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene cesK CDS complement(58642..59334) product response regulator CesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene cesR CDS complement(59424..60302) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(60471..60776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(60903..61280) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene gcvH CDS complement(61328..61681) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(61861..63036) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene rodA CDS complement(63345..64142) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989991.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(64139..65140) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(65140..66120) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 66273..66593 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 66762..67487 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989647.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(67503..67934) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(67953..68777) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358531.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(68899..70185) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721657.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(70203..71714) product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(71714..72508) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene yidA CDS complement(72505..73188) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 73833..74162 product PadR family transcriptional regulator LftR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene lftR CDS 74159..74494 product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 74496..75401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 75398..76177 product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene lieB CDS complement(76231..77283) product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(77449..77940) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(77959..78408) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(78600..79445) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 79696..81315 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732534.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 81380..81544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 81612..82016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 82119..82988 product D-alanyl-D-alanine carboxypeptidase PBPD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990077.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 83223..84413 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095906.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 84514..85476 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 86070..87140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 sequence15 source 1..82387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..719) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(836..1000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(1155..2291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2485..3687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(4225..4440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(4456..5733) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(5741..6247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(6800..10813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(11247..11654) product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 note possible pseudo, frameshifted CDS complement(11728..12117) product DUF4259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 12249..12611 product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(12782..13039) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 13184..14692 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(14894..15958) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene buk CDS complement(16043..16960) product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(16982..18241) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(18260..19237) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(19240..20343) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene pdhA CDS complement(20363..21406) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(21436..22842) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289686.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene lpdA CDS 22990..23892 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 23983..24981 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702981.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(25052..26719) product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(26723..29317) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(29393..31399) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990051.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 31593..32351 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(32402..33724) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(33712..34380) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699925.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(34771..35520) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 35726..38041 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 38283..39107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(39324..40505) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(40505..41239) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287709.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 41474..41749 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 41847..43862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 44314..44607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 44657..45010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 45511..47106 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 47096..48298 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287733.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 48311..51460 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 52322..52987 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(53045..54499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 54831..56033 product multidrug efflux MFS transporter Lde inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene lde CDS complement(56183..56809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(56935..63045) product bacterial Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 63611..64627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 64788..66266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(66428..66979) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(67008..67607) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(67659..68804) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066853.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(68983..69888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(70754..71842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(71845..72102) product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611512.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(72099..72419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(72479..73279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(73283..73657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931691.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(73669..74253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(74269..74568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721751.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(74565..75707) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989348.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(75720..76538) product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(76538..78394) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(78384..78806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(78827..79129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721745.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(79192..79710) product protein LmaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721744.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene lmaA CDS complement(79723..80124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(80340..80702) product protein LmaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene lmaC CDS complement(80846..81277) product protein LmaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene lmaD CDS 81511..81846 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721740.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 81852..82304 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721739.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 sequence16 source 1..81523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..1685 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene dltA CDS 1682..2866 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732428.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene dltB CDS 2890..3126 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722794.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene dltC CDS 3126..4394 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722792.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene dltD CDS complement(4545..5333) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene fabI CDS complement(5388..6305) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(6316..7110) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729850.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(7125..7799) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 7969..8553 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 8725..9603 product protease adaptor protein YjbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722785.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene yjbH CDS complement(9671..10591) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene htpX CDS complement(10613..11170) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(11246..12472) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722782.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(12485..13393) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931632.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(13522..14580) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 14780..15712 product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(15860..16582) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722779.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(16598..17302) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932532.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene nagB CDS complement(17318..18451) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene nagA CDS complement(18753..19601) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(19617..19934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722775.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(20072..20302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(20400..20858) product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 20994..21815 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722772.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 21826..22716 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722771.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(22805..23251) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(23232..24302) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722770.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 24438..25121 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989625.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 25114..26301 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(26383..27570) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(27855..28157) product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(28372..28842) product non-heme iron-binding ferritin Fri inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene fri CDS 29057..29779 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 29781..30251 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 30317..30478 product lmo0937 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(30521..31258) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene nfsA CDS complement(31273..31782) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722757.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene trmL CDS complement(31788..32924) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989619.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene queG tRNA complement(33006..33077) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 33257..33595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(33666..34661) product lipoate protein ligase LplA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene lplA1 CDS complement(34676..35407) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989617.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(35469..36146) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989499.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(36245..36910) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722751.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(36912..37586) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722750.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 37839..39890 product lipoteichoic acid synthase LtaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene ltaS CDS 39999..41246 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 41356..42108 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 42225..43373 product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene kdpDN CDS complement(43466..44122) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734004.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(44138..45268) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733783.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(45265..45987) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771267.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(46121..47041) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene coaA CDS complement(47140..47979) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(47992..49041) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732405.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(49193..50926) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989891.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(51039..52256) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674457.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(52318..53883) product ABC-F type ribosomal protection protein Vga(G) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene abc-f CDS complement(54155..54961) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722154.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(54970..55857) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924096.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(55854..56303) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722156.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(56296..56964) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990073.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(57026..58423) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(58449..59450) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(59474..60175) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930423.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(60329..61792) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989613.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(61908..62723) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(62849..63361) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721479.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(63442..64548) product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(64550..64942) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 65079..66218 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989612.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(66276..66950) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(67018..68367) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene gorA CDS complement(68489..69988) product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704158.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene yjeM CDS complement(70194..70691) product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(70878..71552) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110844.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(71570..71806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963777.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(71899..72996) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(73182..73454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(73757..74134) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932564.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(74261..75061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(75285..75782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(75802..76743) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene floA CDS complement(76744..77040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(77364..77639) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(78055..79023) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(79298..79609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(80003..80473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(80470..81177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 note possible pseudo, frameshifted CDS complement(81307..81471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 sequence17 source 1..61466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..949) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722392.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(1047..2399) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(2477..2842) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 note possible pseudo, frameshifted CDS complement(3090..3440) product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene yugI CDS 3614..4780 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 4953..6056 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 6053..6736 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(6790..7095) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 7316..8680 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(8728..9429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(9490..10077) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722402.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 10647..13058 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989977.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 13045..13467 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 13468..13815 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722406.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 13769..15295 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 15302..15781 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 15778..16065 product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 16049..16627 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene mnhG CDS complement(17053..17793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(17950..19068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 19200..22007 product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 22014..23234 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 23224..24090 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 24120..25031 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 repeat_region 25160..25640 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacattgcaaaatgcttacttaaaac CDS complement(25876..26247) product 1,4-dihydroxy-2-naphthoyl-CoA thioesterase MenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722411.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene menI CDS 26353..26835 product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925810.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(26868..27323) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964318.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(27452..29551) product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene vanT CDS complement(29548..30105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(30105..31139) product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene vanG CDS complement(31305..32513) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 33019..34014 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722416.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 34076..34708 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733273.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(34749..35183) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(35324..35557) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722418.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(35595..35924) product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 36326..36562 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722421.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 36616..37122 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722422.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(37204..38508) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(38580..39344) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989984.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(39341..39637) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(39634..41016) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989985.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 41156..41995 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 41997..42371 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(42456..44831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(44989..45465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(45632..46474) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732461.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(46666..47604) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(47678..48562) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989930.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 48918..49778 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 49813..51738 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 51786..52655 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989932.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene aroE CDS 52702..53940 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 54117..55316 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(55580..56398) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371452.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(56504..56728) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 56896..57861 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733112.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 58061..59227 product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298930.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 59235..59993 product putative 2-hydroxyacyl-CoA dehydratase activator YjiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene yjiL CDS 59990..60481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 60522..61076 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 repeat_region 61193..>61466 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacatttcataatgtttatttaaac sequence18 source 1..58032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 77..150 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 169..243 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 263..334 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 342..413 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 436..509 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 552..638 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(1095..2054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(2172..2480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 2946..3638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 3656..5422 product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 5805..6641 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 6744..8603 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 8596..10035 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(10145..11173) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 11438..12841 product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 12858..13682 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 13675..14628 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 14625..16085 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 16082..17941 product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 17961..19229 product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(19325..21106) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(21093..22841) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 23004..23837 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 24832..26277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 26421..27071 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721889.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 27086..27721 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722722.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 27730..28404 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 28401..29579 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 29604..29804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 29884..30459 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 30622..31455 product RsbT co-antagonist RsbRC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene rsbRC CDS 32480..35050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(35155..36012) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 36305..36853 product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732639.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 37104..37904 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 38089..38835 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 38848..39819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 39950..40825 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 40903..42393 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686168.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(42490..44199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(44406..45158) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(45155..45901) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391646.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 46081..46563 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 tRNA complement(46648..46720) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(47079..48086) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 48339..49658 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 49655..50536 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724790.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 50520..51353 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 51369..52889 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989597.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 52873..53778 product DUF1861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933050.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 53795..54862 product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 54859..56529 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989599.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(56584..56943) product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721298.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 57221..57652 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 sequence19 source 1..54301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 504..752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 763..978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 1132..2280 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 tmRNA complement(2400..2766) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(3006..3470) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723350.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene smpB CDS complement(3487..5862) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene rnr CDS complement(5901..6647) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723352.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(6784..7014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(7126..7887) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene aroD CDS complement(7930..8802) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983735.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(8938..10935) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989492.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 11141..12040 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(12093..12824) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989490.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(12821..13618) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(13719..13883) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene rpmF CDS complement(13949..14524) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(14508..14894) product heme oxygenase IsdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721271.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene isdG CDS complement(14959..15318) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(15796..16209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 16454..17287 product RsbT co-antagonist RsbRC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene rsbRC CDS complement(17346..18026) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(18191..19294) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene rlmN CDS complement(19414..20505) product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(20498..21091) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989526.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(21066..21416) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 21643..22590 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 22597..23760 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989473.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 23744..25930 product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989472.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(25986..26978) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(27129..27845) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 27978..28520 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 28544..28957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 28954..29442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(29611..30540) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(30706..31044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 31232..33259 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989467.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(33283..33777) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(33817..34605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(34607..35020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(35025..35360) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289468.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 35642..36760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989466.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(36804..38201) product peptidoglycan N-acetylglucosamine deacetylase PgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene pgdA CDS complement(38299..39042) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(39506..40315) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(40330..40551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 40682..40909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(40974..41357) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723120.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(41464..42471) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732986.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(42565..42960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(42951..43391) product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(43948..46455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 46671..48077 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 48074..49753 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 49772..50902 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(50972..52078) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721411.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene uvrC CDS 52261..52947 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723483.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(53229..53696) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(53768..54112) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 sequence20 source 1..44468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 782..1417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930831.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(1678..2973) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 3298..4686 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721368.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 4742..5470 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 5657..7459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(7534..7983) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(7996..8745) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931017.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 8911..9117 product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925352.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 9133..9783 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732650.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(9822..11009) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732649.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(11082..12602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 13066..15396 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989521.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene secA2 CDS 15507..16400 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 16615..17781 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723390.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 18046..18642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 18680..19390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 19457..22180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 22299..22943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 22974..24257 product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene cap8O CDS 24392..25510 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 25522..26841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 26854..27990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 27977..30130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 30142..32274 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930053.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 32299..33387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 33395..34204 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 34219..35166 product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722702.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene tagH CDS 35181..36128 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 36663..38888 product lmo2396 family class 1 internalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989982.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 39139..39519 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074555200.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 39567..40748 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 40903..42138 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 42138..43715 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 44026..44262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 sequence21 source 1..36714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..3033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 3069..4169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 4170..4355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 4352..5098 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287741.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 5115..6728 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296509.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 6977..8347 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989915.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 8553..10136 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 10133..11359 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 11372..12301 product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 12381..12761 product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990406.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 12994..13206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 13435..14928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(14968..16512) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930535.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(16680..18101) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723717.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(18091..18396) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 18514..19143 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 19217..19741 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(19836..20432) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003291871.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 20579..21502 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905660.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 21495..23099 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 23364..25454 product class 1 internalin InlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989462.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene inlA CDS 25935..26396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(26450..26638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 26935..28650 product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387419.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 29046..29609 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene ahpC CDS 29622..31151 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene ahpF CDS complement(31326..33608) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723027.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene pflB CDS 34062..34799 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476575.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(35051..35770) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733006.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(35916..36629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 sequence22 source 1..32859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 234..461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 note possible pseudo, frameshifted CDS 503..826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 note possible pseudo, frameshifted CDS 907..1437 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 1556..2563 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene gap CDS complement(2849..4330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(4363..4899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(5365..6240) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364431.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(6510..7559) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(7575..8543) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(8540..9268) product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(9265..10011) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(10017..11102) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(11168..12058) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(12145..12876) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(12962..13636) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078306.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(13633..14013) product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(14250..15389) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(15389..15670) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946538.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(15667..15915) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(15981..16607) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356716.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 16759..17142 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989912.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(17202..17372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(17410..18441) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721366.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 18539..18847 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924768.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(18891..19586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(19733..20293) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357432.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(20391..20756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(20797..22233) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 22358..23245 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene pdxS CDS 23247..23810 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932189.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene pdxT CDS 23879..24088 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 24578..24967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(25078..25551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(25710..25907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 note possible pseudo, frameshifted CDS complement(25891..26040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(26972..27988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(28128..28484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(28490..29965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(29962..30330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989430.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(30330..30617) product DUF3130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989429.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(31334..31738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(31843..32466) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635275.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 sequence23 source 1..30251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(391..1728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(1725..2093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(2094..2378) product DUF3130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989429.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(2861..5143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 5126..5290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 5407..6621 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722667.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 6600..7088 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989648.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene mobB CDS 7085..7507 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 7494..7736 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene moaD CDS 7753..8226 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene moaC CDS 8239..9240 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene moaA CDS 9298..10059 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015825263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 10347..11240 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 11224..12051 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 12075..14051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 14150..14875 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 14960..16132 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209877.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 16145..17320 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170470.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene nagA CDS 17307..18269 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene lacD CDS 18295..18777 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 18790..20580 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109466.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 20573..20986 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 21014..24892 product endo-alpha-N-acetylgalactosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386883.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(25201..25506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(25428..26792) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284877.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(26900..28015) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene ald CDS complement(28398..30209) product lmo0514 family class 1 internalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 sequence24 source 1..21856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..434 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227921.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene tagD CDS 437..2785 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 2794..3816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 4143..6686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 7186..7836 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 8168..11239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 12711..13712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 13733..14530 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081584.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(14585..14800) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(14811..15293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 15582..17444 product lmo0331 family class 1 internalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(17535..19919) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294145.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(20292..21389) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 21620..21760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 sequence25 source 1..20623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1191..1625) product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(1634..2236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(2243..3139) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(3232..4233) product invasion-associated protein P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(4230..6473) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989670.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(6502..8964) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861918.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(8948..9379) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004843362.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(9420..9638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(9677..9970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(10030..10218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(10208..10570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(10573..10845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(10881..11972) product DNA relaxase NicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene nicK CDS complement(11969..13405) product coupling conjugation protein ConQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene conQ CDS complement(13487..13876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(14003..14230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(14241..14483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(14499..14693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(14744..17623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(17759..18901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(18991..19167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(19289..19750) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(19740..20258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 sequence26 source 1..15001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 763..1431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 1510..3780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 4032..5795 product lmo0331 family class 1 internalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 6223..8754 product class 1 internalin InlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989462.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene inlA CDS 8958..9221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(9297..10547) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989456.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(10544..10975) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989457.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(10978..11526) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 12455..12637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 13368..14270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 14305..14592 product DUF3130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 14592..14960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989430.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 sequence27 source 1..13837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(598..1356) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(1417..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(1762..3852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(3983..5056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(5085..6512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(6533..6760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(6782..6931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(7071..8486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(8897..9076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(9063..10097) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(10205..10363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(10458..10961) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674689.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(11041..12555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(12579..12962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(13056..13220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 sequence28 source 1..11856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..1208 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene galE CDS complement(1399..2565) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211973.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 3032..3433 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912224.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 3490..3858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 4037..4804 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 4819..5226 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925165.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 5223..5705 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 5723..6526 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 6507..7331 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 7347..8051 product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(8150..10057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(10224..10865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(10887..11534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 sequence29 source 1..9549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1400 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000105162.1:site-specific DNA-methyltransferase locus_tag LOCUS_29000 CDS 1393..4041 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(4161..5018) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461681.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 5205..5534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 5576..6037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 6224..7057 product Rep protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 7153..7326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 7319..8521 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(8697..8906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(9095..9508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 sequence30 source 1..6179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..864 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989340.1:LXG domain-containing protein locus_tag LOCUS_29100 CDS 879..1307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933590.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 1953..2480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 sequence31 source 1..5472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(588..971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(982..1533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(1586..1717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(1817..1951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(1960..2250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 2621..2962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3096..4028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 4227..5045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 sequence32 source 1..5001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(353..1849) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989378.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene lysS CDS complement(1971..2960) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931913.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene dusB CDS complement(3044..3526) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733323.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene folK CDS complement(3516..3890) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733322.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene folB CDS complement(3883..4716) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989377.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene folP sequence33 source 1..3147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 16..2944 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence34 source 1..2928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence35 source 1..1940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence36 source 1..1861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 357..1154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 sequence37 source 1..1708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(410..550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(670..1401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 sequence38 source 1..1286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..1098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence40 source 1..1002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..637 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009911635.1:tyrosine recombinase XerC locus_tag LOCUS_29310 CDS 705..962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 sequence41 source 1..1000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 3..78 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 103..175 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 sequence42 source 1..773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence43 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence45 source 1..542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence46 source 1..477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence47 source 1..458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence48 source 1..442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence49 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence50 source 1..403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence51 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence52 source 1..394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence53 source 1..393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 3..77 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 83..173 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 188..260 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 318..393 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 sequence54 source 1..377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence55 source 1..331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence56 source 1..329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence57 source 1..301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@